Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0017510 | Msa1321030 | 0.818590 | 1.810592e-52 | -8.615850e-47 |
| Msa0110970 | Msa1321030 | 0.807869 | 4.093306e-50 | -8.615850e-47 |
| Msa0657970 | Msa1321030 | 0.806574 | 7.700492e-50 | -8.615850e-47 |
| Msa0157290 | Msa1321030 | 0.817173 | 3.783836e-52 | -8.615850e-47 |
| Msa1321030 | Msa1438250 | 0.828714 | 7.711373e-55 | -8.615850e-47 |
| Msa0243100 | Msa1321030 | 0.804637 | 1.963255e-49 | -8.615850e-47 |
| Msa0858840 | Msa1321030 | 0.810094 | 1.367355e-50 | -8.615850e-47 |
| Msa0880140 | Msa1321030 | 0.816329 | 5.848487e-52 | -8.615850e-47 |
| Msa0909120 | Msa1321030 | 0.813619 | 2.335841e-51 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1321030 | MtrunA17_Chr8g0357931 | 54.688 | 64 | 24 | 3 | 1 | 64 | 1 | 59 | 3.10e-12 | 60.5 |
| Msa1321030 | MtrunA17_Chr8g0357971 | 50.000 | 76 | 32 | 4 | 1 | 76 | 1 | 70 | 9.56e-12 | 56.2 |
| Msa1321030 | MtrunA17_Chr8g0357801 | 48.684 | 76 | 34 | 3 | 1 | 76 | 1 | 71 | 1.40e-11 | 58.5 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 7 sgRNAs with CRISPR-Local
Find 8 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| TCATATACTTATCAATATCA+TGG | 0.424224 | 8_4:-26203967 | Msa1321030:CDS |
| AGTATAATTAGTAGTGCTCT+TGG | 0.491988 | 8_4:-26203782 | Msa1321030:CDS |
| TTTAGAGTATACAGCAAATG+AGG | 0.510029 | 8_4:+26203865 | None:intergenic |
| ACTTATCAATATCATGGTTG+TGG | 0.521159 | 8_4:-26203961 | Msa1321030:CDS |
| CAACTTGATAGTTTGAAGCC+TGG | 0.541235 | 8_4:-26203902 | Msa1321030:CDS |
| GAGGTATTCATTGTATCACC+AGG | 0.609096 | 8_4:+26203884 | None:intergenic |
| TTTGCTGTATACTCTAAACA+AGG | 0.685455 | 8_4:-26203860 | Msa1321030:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !! | TCATATACTTATCAATATCA+TGG | - | chr8_4:26203800-26203819 | Msa1321030:CDS | 20.0% |
| !!! | CTTACTTTTGCTGATTTTAT+TGG | - | chr8_4:26203940-26203959 | Msa1321030:CDS | 25.0% |
| ACTTATCAATATCATGGTTG+TGG | - | chr8_4:26203806-26203825 | Msa1321030:CDS | 30.0% | |
| ! | TTTAGAGTATACAGCAAATG+AGG | + | chr8_4:26203905-26203924 | None:intergenic | 30.0% |
| ! | TTTGCTGTATACTCTAAACA+AGG | - | chr8_4:26203907-26203926 | Msa1321030:CDS | 30.0% |
| AGTATAATTAGTAGTGCTCT+TGG | - | chr8_4:26203985-26204004 | Msa1321030:CDS | 30.0% | |
| ! | CAACTTGATAGTTTGAAGCC+TGG | - | chr8_4:26203865-26203884 | Msa1321030:CDS | 40.0% |
| ! | GAGGTATTCATTGTATCACC+AGG | + | chr8_4:26203886-26203905 | None:intergenic | 40.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| chr8_4 | gene | 26203763 | 26204026 | 26203763 | ID=Msa1321030;Name=Msa1321030 |
| chr8_4 | mRNA | 26203763 | 26204026 | 26203763 | ID=Msa1321030-mRNA-1;Parent=Msa1321030;Name=Msa1321030-mRNA-1;_AED=0.45;_eAED=0.45;_QI=0|-1|0|1|-1|1|1|0|87 |
| chr8_4 | exon | 26203763 | 26204026 | 26203763 | ID=Msa1321030-mRNA-1:exon:8989;Parent=Msa1321030-mRNA-1 |
| chr8_4 | CDS | 26203763 | 26204026 | 26203763 | ID=Msa1321030-mRNA-1:cds;Parent=Msa1321030-mRNA-1 |
| Gene Sequence |
| Protein sequence |
