Alfalfa Gene Editing Database
Nr:
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MS.gene41113.t1 | XP_028762943.1 | 63.8 | 94 | 28 | 1 | 12 | 99 | 255 | 348 | 2.00E-26 | 128.3 |
Swissprot:
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Trembl:
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MS.gene41113.t1 | A0A392P9H0 | 64.4 | 90 | 31 | 1 | 2 | 91 | 107 | 195 | 4.7e-25 | 123.2 |
TFs/TRs:
| Gene ID | Type | Classification |
|---|
Protein Kinases:
| Gene ID | Type | Classification |
|---|
Network:
Co-expression Network:
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| MS.gene049254 | MS.gene41113 | 0.802243 | 6.15E-49 | -1.69E-46 |
| MS.gene049531 | MS.gene41113 | 0.817524 | 3.15E-52 | -1.69E-46 |
| MS.gene050026 | MS.gene41113 | 0.801276 | 9.72E-49 | -1.69E-46 |
| MS.gene050221 | MS.gene41113 | 0.811071 | 8.41E-51 | -1.69E-46 |
| MS.gene051744 | MS.gene41113 | 0.801433 | 9.03E-49 | -1.69E-46 |
| MS.gene052037 | MS.gene41113 | 0.803822 | 2.90E-49 | -1.69E-46 |
| MS.gene054236 | MS.gene41113 | 0.820834 | 5.56E-53 | -1.69E-46 |
| MS.gene056174 | MS.gene41113 | 0.833793 | 4.35E-56 | -1.69E-46 |
| MS.gene056595 | MS.gene41113 | 0.806387 | 8.43E-50 | -1.69E-46 |
| MS.gene056854 | MS.gene41113 | 0.822964 | 1.79E-53 | -1.69E-46 |
| MS.gene058037 | MS.gene41113 | 0.82306 | 1.70E-53 | -1.69E-46 |
| MS.gene059272 | MS.gene41113 | 0.863024 | 3.34E-64 | -1.69E-46 |
PPI:
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MS.gene41113.t1 | MTR_1g036690 | 58.537 | 82 | 27 | 3 | 19 | 99 | 5 | 80 | 2.63e-25 | 90.5 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 0 sgRNAs with CRISPR-Local
Find 18 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !! | AATGTTGTAAAGAATGATAT+TGG | + | 15211:3873-3892 | MS.gene41113:CDS | 20.0% |
| !! | ACTTCAAAATAAGGATAAAA+GGG | + | 15211:4004-4023 | MS.gene41113:CDS | 20.0% |
| ! | CACTTCAAAATAAGGATAAA+AGG | + | 15211:4003-4022 | MS.gene41113:CDS | 25.0% |
| ! | GAAAATGATGAAGATGATTA+TGG | + | 15211:4047-4066 | MS.gene41113:CDS | 25.0% |
| ! | TGAAGATGATTATGGTAATA+TGG | + | 15211:4055-4074 | MS.gene41113:CDS | 25.0% |
| !! | TAAAGATCAACAAGATGTTT+TGG | - | 15211:3975-3994 | MS.gene41113:intergenic | 25.0% |
| !! | TATTTTCATCTCTAATGAGA+TGG | - | 15211:4136-4155 | MS.gene41113:intergenic | 25.0% |
| CATTAGAGATGAAAATATCC+AGG | + | 15211:4139-4158 | MS.gene41113:CDS | 30.0% | |
| CCAACAATCACTTCAAAATA+AGG | + | 15211:3995-4014 | MS.gene41113:CDS | 30.0% | |
| !!! | CCTTATTTTGAAGTGATTGT+TGG | - | 15211:3998-4017 | MS.gene41113:intergenic | 30.0% |
| ! | AGATGGTCAATCTTTTCATC+AGG | - | 15211:4119-4138 | MS.gene41113:intergenic | 35.0% |
| AGAAATCAGCAGCATCTAAG+TGG | - | 15211:4088-4107 | MS.gene41112:intergenic | 40.0% | |
| GAAATCAGCAGCATCTAAGT+GGG | - | 15211:4087-4106 | MS.gene41113:intergenic | 40.0% | |
| !! | AGTATTTGCTATCGTTGTGG+AGG | + | 15211:3918-3937 | MS.gene41113:CDS | 40.0% |
| !! | GAGAGTATTTGCTATCGTTG+TGG | + | 15211:3915-3934 | MS.gene41113:CDS | 40.0% |
| GTTGTGGAGGAAAAGGTCAT+TGG | + | 15211:3931-3950 | MS.gene41113:CDS | 45.0% | |
| TGCTATCGTTGTGGAGGAAA+AGG | + | 15211:3924-3943 | MS.gene41113:CDS | 45.0% | |
| !!! | AAGATGTTTTGGCGTACGAC+AGG | - | 15211:3964-3983 | MS.gene41113:intergenic | 45.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| 15211 | gene | 3867 | 4166 | 3867 | ID=MS.gene41113 |
| 15211 | mRNA | 3867 | 4166 | 3867 | ID=MS.gene41113.t1;Parent=MS.gene41113 |
| 15211 | exon | 3867 | 4166 | 3867 | ID=MS.gene41113.t1.exon1;Parent=MS.gene41113.t1 |
| 15211 | CDS | 3867 | 4166 | 3867 | ID=cds.MS.gene41113.t1;Parent=MS.gene41113.t1 |
| Gene Sequence |
| Protein sequence |