Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsG0580026188.01.T01 | RHN76464.1 | 80.702 | 57 | 4 | 1 | 1 | 57 | 1 | 50 | 6.72E-22 | 89.4 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsG0580026188.01.T01 | A0A396JH39 | 80.702 | 57 | 4 | 1 | 1 | 57 | 1 | 50 | 3.21e-22 | 89.4 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| MsG0180004426.01 | MsG0580026188.01 | 0.816170 | 6.348787e-52 | 4.465861e-49 |
| MsG0280006325.01 | MsG0580026188.01 | 0.812956 | 3.265869e-51 | 2.104902e-48 |
| MsG0380014251.01 | MsG0580026188.01 | 0.819436 | 1.162730e-52 | 8.946982e-50 |
| MsG0380017822.01 | MsG0580026188.01 | 0.805247 | 1.463819e-49 | 7.706214e-47 |
| MsG0580026188.01 | MsG0580027018.01 | 0.800424 | 1.450556e-48 | 6.752089e-46 |
| MsG0580026188.01 | MsG0780040596.01 | 0.839687 | 1.364839e-57 | 1.899147e-54 |
| MsG0580026188.01 | MsG0880041836.01 | 0.813475 | 2.512558e-51 | 1.642495e-48 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsG0580026188.01.T01 | MTR_4g056250 | 91.304 | 46 | 4 | 0 | 1 | 46 | 28 | 73 | 1.94e-25 | 89.0 |
| MsG0580026188.01.T01 | MTR_0623s0010 | 80.702 | 57 | 4 | 1 | 1 | 57 | 96 | 145 | 2.03e-25 | 90.9 |
| MsG0580026188.01.T01 | MTR_0623s0020 | 80.000 | 55 | 4 | 1 | 1 | 55 | 41 | 88 | 4.56e-24 | 85.9 |
| MsG0580026188.01.T01 | MTR_7g073070 | 43.860 | 57 | 25 | 1 | 1 | 57 | 28 | 77 | 8.47e-11 | 52.4 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 4 sgRNAs with CRISPR-Local
Find 6 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| TGAACCGACACCATTCTTCT+TGG | 0.284066 | 5:-32021791 | None:intergenic |
| ACTAAATGAGATTCCAAAGC+TGG | 0.496020 | 5:+32021629 | MsG0580026188.01.T01:CDS |
| TAAGAGATATCCAAGAAGAA+TGG | 0.529910 | 5:+32021781 | MsG0580026188.01.T01:CDS |
| ATATCCAAGAAGAATGGTGT+CGG | 0.652191 | 5:+32021787 | MsG0580026188.01.T01:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !! | ATTAAGTTTATTAATTAACA+TGG | + | Chr5:32021690-32021709 | MsG0580026188.01.T01:intron | 10.0% |
| ! | TAAAAATAACATACCAGCTT+TGG | - | Chr5:32021645-32021664 | None:intergenic | 25.0% |
| TAAGAGATATCCAAGAAGAA+TGG | + | Chr5:32021781-32021800 | MsG0580026188.01.T01:CDS | 30.0% | |
| ACTAAATGAGATTCCAAAGC+TGG | + | Chr5:32021629-32021648 | MsG0580026188.01.T01:CDS | 35.0% | |
| ATATCCAAGAAGAATGGTGT+CGG | + | Chr5:32021787-32021806 | MsG0580026188.01.T01:CDS | 35.0% | |
| TGAACCGACACCATTCTTCT+TGG | - | Chr5:32021794-32021813 | None:intergenic | 45.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr5 | gene | 32021597 | 32021836 | 32021597 | ID=MsG0580026188.01;Name=MsG0580026188.01 |
| Chr5 | mRNA | 32021597 | 32021836 | 32021597 | ID=MsG0580026188.01.T01;Parent=MsG0580026188.01;Name=MsG0580026188.01.T01;_AED=0.39;_eAED=0.39;_QI=0|0.5|0.66|1|0|0|3|0|57 |
| Chr5 | exon | 32021597 | 32021671 | 32021597 | ID=MsG0580026188.01.T01:exon:13222;Parent=MsG0580026188.01.T01 |
| Chr5 | exon | 32021738 | 32021836 | 32021738 | ID=MsG0580026188.01.T01:exon:13223;Parent=MsG0580026188.01.T01 |
| Chr5 | CDS | 32021597 | 32021671 | 32021597 | ID=MsG0580026188.01.T01:cds;Parent=MsG0580026188.01.T01 |
| Chr5 | CDS | 32021738 | 32021836 | 32021738 | ID=MsG0580026188.01.T01:cds;Parent=MsG0580026188.01.T01 |
| Gene Sequence |
| Protein sequence |
