Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
Msa0027390 | Msa0966080 | 0.819660 | 1.033413e-52 | -8.615850e-47 |
Msa0092440 | Msa0966080 | 0.821159 | 4.681491e-53 | -8.615850e-47 |
Msa0651270 | Msa0966080 | 0.806486 | 8.036258e-50 | -8.615850e-47 |
Msa0663250 | Msa0966080 | 0.842689 | 2.218106e-58 | -8.615850e-47 |
Msa0687450 | Msa0966080 | 0.807628 | 4.606988e-50 | -8.615850e-47 |
Msa0757800 | Msa0966080 | 0.802491 | 5.470558e-49 | -8.615850e-47 |
Msa0800700 | Msa0966080 | 0.821131 | 4.751320e-53 | -8.615850e-47 |
Msa0828660 | Msa0966080 | 0.808732 | 2.679617e-50 | -8.615850e-47 |
Msa0165300 | Msa0966080 | 0.819650 | 1.038940e-52 | -8.615850e-47 |
Msa0174360 | Msa0966080 | 0.803116 | 4.063692e-49 | -8.615850e-47 |
Msa0218350 | Msa0966080 | 0.804416 | 2.182696e-49 | -8.615850e-47 |
Msa0417650 | Msa0966080 | 0.816636 | 4.992658e-52 | -8.615850e-47 |
Msa0417730 | Msa0966080 | 0.812626 | 3.856375e-51 | -8.615850e-47 |
Msa0428050 | Msa0966080 | 0.811155 | 8.066140e-51 | -8.615850e-47 |
Msa0269520 | Msa0966080 | 0.826496 | 2.627145e-54 | -8.615850e-47 |
Msa0510290 | Msa0966080 | 0.827770 | 1.302250e-54 | -8.615850e-47 |
Msa0512870 | Msa0966080 | 0.828260 | 9.921825e-55 | -8.615850e-47 |
Msa0861830 | Msa0966080 | 0.804288 | 2.321031e-49 | -8.615850e-47 |
Msa0925250 | Msa0966080 | 0.823332 | 1.466400e-53 | -8.615850e-47 |
Msa0925280 | Msa0966080 | 0.951224 | 3.205632e-109 | -8.615850e-47 |
Msa0925290 | Msa0966080 | 0.801092 | 1.059801e-48 | -8.615850e-47 |
Msa0961300 | Msa0966080 | 0.817630 | 2.984885e-52 | -8.615850e-47 |
Msa0966080 | Msa0966090 | 0.819389 | 1.191772e-52 | -8.615850e-47 |
Msa0966080 | Msa1010070 | 0.814174 | 1.762447e-51 | -8.615850e-47 |
Msa0966080 | Msa1176270 | 0.806239 | 9.059541e-50 | -8.615850e-47 |
Msa0966080 | Msa1388450 | 0.802754 | 4.829264e-49 | -8.615850e-47 |
Msa0966080 | Msa1403480 | 0.802541 | 5.343611e-49 | -8.615850e-47 |
Msa0966080 | Msa1432770 | 0.853805 | 1.874906e-61 | -8.615850e-47 |
Msa0966080 | Msa1443060 | 0.833607 | 4.840521e-56 | -8.615850e-47 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Find 11 sgRNAs with CRISPR-Local
Find 19 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
ATCAAATCTAATGTCCTTAT+TGG | 0.159858 | 6_3:-94025525 | None:intergenic |
AATGTCCTTATTGGTTGTTT+TGG | 0.290172 | 6_3:-94025516 | Msa0966080:CDS |
TTCATCCAAAACAACCAATA+AGG | 0.361690 | 6_3:+94025511 | None:intergenic |
CTCTGAATCTGAACAGTCTT+AGG | 0.361731 | 6_3:+94025440 | None:intergenic |
CTTAGGCCACTTGTCGAATC+TGG | 0.370934 | 6_3:+94025457 | None:intergenic |
TTCAGATTCAGAGGAAGAAG+AGG | 0.501652 | 6_3:-94025430 | Msa0966080:CDS |
TTAACATGGTTTAATCATTG+AGG | 0.522179 | 6_3:+94025110 | None:intergenic |
GGAAGCTATTCGAGAAGAAG+AGG | 0.554823 | 6_3:-94025487 | Msa0966080:CDS |
CTAAGACTGTTCAGATTCAG+AGG | 0.581573 | 6_3:-94025439 | Msa0966080:CDS |
ATTTGACCAGATTCGACAAG+TGG | 0.608851 | 6_3:-94025463 | Msa0966080:CDS |
GAAGCTATTCGAGAAGAAGA+GGG | 0.626506 | 6_3:-94025486 | Msa0966080:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
TTCATCCAAAACAACCAATA+AGG | + | chr6_3:94025131-94025150 | None:intergenic | 30.0% | |
!!! | TATTGGTTGTTTTGGATGAA+TGG | - | chr6_3:94025131-94025150 | Msa0966080:CDS | 30.0% |
AAACCATATAGACTGATACA+CGG | + | chr6_3:94025349-94025368 | None:intergenic | 30.0% | |
! | TATCAGTCTATATGGTTTGT+AGG | - | chr6_3:94025351-94025370 | Msa0966080:intron | 30.0% |
TTTCAACATTTAGCATGTAC+TGG | - | chr6_3:94025455-94025474 | Msa0966080:CDS | 30.0% | |
ATATAGACTGATACACGGAT+AGG | + | chr6_3:94025344-94025363 | None:intergenic | 35.0% | |
TATCCGTGTATCAGTCTATA+TGG | - | chr6_3:94025343-94025362 | Msa0966080:intron | 35.0% | |
GAAGCTATTCGAGAAGAAGA+GGG | - | chr6_3:94025153-94025172 | Msa0966080:intron | 40.0% | |
ATTTGACCAGATTCGACAAG+TGG | - | chr6_3:94025176-94025195 | Msa0966080:intron | 40.0% | |
CTCTGAATCTGAACAGTCTT+AGG | + | chr6_3:94025202-94025221 | None:intergenic | 40.0% | |
CTAAGACTGTTCAGATTCAG+AGG | - | chr6_3:94025200-94025219 | Msa0966080:intron | 40.0% | |
TTCAGATTCAGAGGAAGAAG+AGG | - | chr6_3:94025209-94025228 | Msa0966080:intron | 40.0% | |
!!! | AGAAGAGGATTTTGAAGCAG+AGG | - | chr6_3:94025224-94025243 | Msa0966080:intron | 40.0% |
!!! | GATTTTGAAGCAGAGGTTGA+AGG | - | chr6_3:94025231-94025250 | Msa0966080:intron | 40.0% |
! | CCAAATTTCTAGACAGCTCA+AGG | + | chr6_3:94025282-94025301 | None:intergenic | 40.0% |
CCTTGAGCTGTCTAGAAATT+TGG | - | chr6_3:94025279-94025298 | Msa0966080:intron | 40.0% | |
GCTGTCTAGAAATTTGGATG+TGG | - | chr6_3:94025285-94025304 | Msa0966080:intron | 40.0% | |
GGAAGCTATTCGAGAAGAAG+AGG | - | chr6_3:94025152-94025171 | Msa0966080:CDS | 45.0% | |
CTTAGGCCACTTGTCGAATC+TGG | + | chr6_3:94025185-94025204 | None:intergenic | 50.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
chr6_3 | gene | 94025124 | 94025537 | 94025124 | ID=Msa0966080;Name=Msa0966080 |
chr6_3 | mRNA | 94025124 | 94025537 | 94025124 | ID=Msa0966080-mRNA-1;Parent=Msa0966080;Name=Msa0966080-mRNA-1;_AED=0.72;_eAED=0.72;_QI=0|0|0|0.5|1|1|2|0|58 |
chr6_3 | exon | 94025409 | 94025537 | 94025409 | ID=Msa0966080-mRNA-1:exon:17338;Parent=Msa0966080-mRNA-1 |
chr6_3 | exon | 94025124 | 94025171 | 94025124 | ID=Msa0966080-mRNA-1:exon:17337;Parent=Msa0966080-mRNA-1 |
chr6_3 | CDS | 94025409 | 94025537 | 94025409 | ID=Msa0966080-mRNA-1:cds;Parent=Msa0966080-mRNA-1 |
chr6_3 | CDS | 94025124 | 94025171 | 94025124 | ID=Msa0966080-mRNA-1:cds;Parent=Msa0966080-mRNA-1 |
Gene Sequence |
Protein sequence |