Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
Msa0027390 | Msa0925280 | 0.817639 | 2.971683e-52 | -8.615850e-47 |
Msa0031180 | Msa0925280 | 0.818046 | 2.404820e-52 | -8.615850e-47 |
Msa0078480 | Msa0925280 | 0.820842 | 5.538431e-53 | -8.615850e-47 |
Msa0082440 | Msa0925280 | 0.804144 | 2.487601e-49 | -8.615850e-47 |
Msa0092440 | Msa0925280 | 0.823452 | 1.374333e-53 | -8.615850e-47 |
Msa0651270 | Msa0925280 | 0.814130 | 1.801815e-51 | -8.615850e-47 |
Msa0663250 | Msa0925280 | 0.841791 | 3.835057e-58 | -8.615850e-47 |
Msa0682550 | Msa0925280 | 0.801033 | 1.089497e-48 | -8.615850e-47 |
Msa0687450 | Msa0925280 | 0.804586 | 2.011663e-49 | -8.615850e-47 |
Msa0749400 | Msa0925280 | 0.809892 | 1.511658e-50 | -8.615850e-47 |
Msa0756530 | Msa0925280 | 0.803149 | 4.000058e-49 | -8.615850e-47 |
Msa0757800 | Msa0925280 | 0.809372 | 1.955198e-50 | -8.615850e-47 |
Msa0780280 | Msa0925280 | 0.814052 | 1.875035e-51 | -8.615850e-47 |
Msa0800700 | Msa0925280 | 0.826992 | 2.000242e-54 | -8.615850e-47 |
Msa0805430 | Msa0925280 | 0.800286 | 1.547817e-48 | -8.615850e-47 |
Msa0821800 | Msa0925280 | 0.820307 | 7.350016e-53 | -8.615850e-47 |
Msa0828660 | Msa0925280 | 0.810317 | 1.224349e-50 | -8.615850e-47 |
Msa0832090 | Msa0925280 | 0.803730 | 3.031896e-49 | -8.615850e-47 |
Msa0126230 | Msa0925280 | 0.805422 | 1.345297e-49 | -8.615850e-47 |
Msa0128180 | Msa0925280 | 0.804948 | 1.690702e-49 | -8.615850e-47 |
Msa0139700 | Msa0925280 | 0.802500 | 5.448221e-49 | -8.615850e-47 |
Msa0143850 | Msa0925280 | 0.813679 | 2.265603e-51 | -8.615850e-47 |
Msa0165300 | Msa0925280 | 0.813648 | 2.300826e-51 | -8.615850e-47 |
Msa0174360 | Msa0925280 | 0.823942 | 1.055483e-53 | -8.615850e-47 |
Msa0218350 | Msa0925280 | 0.809055 | 2.286405e-50 | -8.615850e-47 |
Msa0417650 | Msa0925280 | 0.816329 | 5.848641e-52 | -8.615850e-47 |
Msa0417730 | Msa0925280 | 0.811377 | 7.218167e-51 | -8.615850e-47 |
Msa0428050 | Msa0925280 | 0.816707 | 4.812941e-52 | -8.615850e-47 |
Msa0468250 | Msa0925280 | 0.801763 | 7.722769e-49 | -8.615850e-47 |
Msa0269520 | Msa0925280 | 0.829433 | 5.163174e-55 | -8.615850e-47 |
Msa0284350 | Msa0925280 | 0.804128 | 2.506261e-49 | -8.615850e-47 |
Msa0308550 | Msa0925280 | 0.802336 | 5.887252e-49 | -8.615850e-47 |
Msa0317740 | Msa0925280 | 0.801000 | 1.107008e-48 | -8.615850e-47 |
Msa0318880 | Msa0925280 | 0.800961 | 1.127005e-48 | -8.615850e-47 |
Msa0320800 | Msa0925280 | 0.800766 | 1.235411e-48 | -8.615850e-47 |
Msa0358400 | Msa0925280 | 0.806590 | 7.639349e-50 | -8.615850e-47 |
Msa0484780 | Msa0925280 | 0.803419 | 3.518384e-49 | -8.615850e-47 |
Msa0510290 | Msa0925280 | 0.819781 | 9.699579e-53 | -8.615850e-47 |
Msa0512870 | Msa0925280 | 0.824766 | 6.755761e-54 | -8.615850e-47 |
Msa0576680 | Msa0925280 | 0.813446 | 2.549874e-51 | -8.615850e-47 |
Msa0579200 | Msa0925280 | 0.808182 | 3.511808e-50 | -8.615850e-47 |
Msa0861830 | Msa0925280 | 0.820932 | 5.280423e-53 | -8.615850e-47 |
Msa0868440 | Msa0925280 | 0.802431 | 5.627508e-49 | -8.615850e-47 |
Msa0925250 | Msa0925280 | 0.822414 | 2.399734e-53 | -8.615850e-47 |
Msa0925270 | Msa0925280 | 0.805449 | 1.327948e-49 | -8.615850e-47 |
Msa0925280 | Msa0925290 | 0.808979 | 2.373806e-50 | -8.615850e-47 |
Msa0925280 | Msa0939000 | 0.801185 | 1.014584e-48 | -8.615850e-47 |
Msa0925280 | Msa0961300 | 0.814942 | 1.191432e-51 | -8.615850e-47 |
Msa0925280 | Msa0966080 | 0.951224 | 3.205632e-109 | -8.615850e-47 |
Msa0925280 | Msa0966090 | 0.819579 | 1.078456e-52 | -8.615850e-47 |
Msa0925280 | Msa0975940 | 0.811213 | 7.833060e-51 | -8.615850e-47 |
Msa0925280 | Msa1010070 | 0.825098 | 5.641860e-54 | -8.615850e-47 |
Msa0925280 | Msa1176270 | 0.812776 | 3.576241e-51 | -8.615850e-47 |
Msa0925280 | Msa1224830 | 0.802245 | 6.147676e-49 | -8.615850e-47 |
Msa0925280 | Msa1288450 | 0.804843 | 1.778556e-49 | -8.615850e-47 |
Msa0925280 | Msa1333730 | 0.805985 | 1.024522e-49 | -8.615850e-47 |
Msa0925280 | Msa1338250 | 0.802503 | 5.439282e-49 | -8.615850e-47 |
Msa0925280 | Msa1388450 | 0.806693 | 7.267168e-50 | -8.615850e-47 |
Msa0925280 | Msa1392700 | 0.809796 | 1.585105e-50 | -8.615850e-47 |
Msa0925280 | Msa1403480 | 0.815217 | 1.035017e-51 | -8.615850e-47 |
Msa0925280 | Msa1424680 | 0.801204 | 1.005579e-48 | -8.615850e-47 |
Msa0925280 | Msa1432770 | 0.848111 | 7.546793e-60 | -8.615850e-47 |
Msa0925280 | Msa1435400 | 0.801566 | 8.474257e-49 | -8.615850e-47 |
Msa0925280 | Msa1443060 | 0.841006 | 6.172444e-58 | -8.615850e-47 |
Msa0925280 | Msa1446780 | 0.804826 | 1.792719e-49 | -8.615850e-47 |
Msa0925280 | Msa1462930 | 0.809095 | 2.241107e-50 | -8.615850e-47 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Find 11 sgRNAs with CRISPR-Local
Find 19 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
ATCAAATCTAATGTCCTTAT+TGG | 0.159858 | 6_2:-68224595 | None:intergenic |
AATGTCCTTATTGGTTGTTT+TGG | 0.290172 | 6_2:-68224586 | Msa0925280:CDS |
TTCATCCAAAACAACCAATA+AGG | 0.361690 | 6_2:+68224581 | None:intergenic |
CTCTGAATCTGAACAGTCTT+AGG | 0.361731 | 6_2:+68224510 | None:intergenic |
CTTAGGCCACTTGTCGAATC+TGG | 0.370934 | 6_2:+68224527 | None:intergenic |
TTCAGATTCAGAGGAAGAAG+AGG | 0.501652 | 6_2:-68224500 | Msa0925280:CDS |
TTAACATGGTTTAATCATTG+AGG | 0.522179 | 6_2:+68224180 | None:intergenic |
GGAAGCTATTCGAGAAGAAG+AGG | 0.554823 | 6_2:-68224557 | Msa0925280:CDS |
CTAAGACTGTTCAGATTCAG+AGG | 0.581573 | 6_2:-68224509 | Msa0925280:CDS |
ATTTGACCAGATTCGACAAG+TGG | 0.608851 | 6_2:-68224533 | Msa0925280:CDS |
GAAGCTATTCGAGAAGAAGA+GGG | 0.626506 | 6_2:-68224556 | Msa0925280:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
TTCATCCAAAACAACCAATA+AGG | + | chr6_2:68224201-68224220 | None:intergenic | 30.0% | |
!!! | TATTGGTTGTTTTGGATGAA+TGG | - | chr6_2:68224201-68224220 | Msa0925280:CDS | 30.0% |
AAACCATATAGACTGATACA+CGG | + | chr6_2:68224419-68224438 | None:intergenic | 30.0% | |
! | TATCAGTCTATATGGTTTGT+AGG | - | chr6_2:68224421-68224440 | Msa0925280:intron | 30.0% |
TTTCAACATTTAGCATGTAC+TGG | - | chr6_2:68224525-68224544 | Msa0925280:CDS | 30.0% | |
ATATAGACTGATACACGGAT+AGG | + | chr6_2:68224414-68224433 | None:intergenic | 35.0% | |
TATCCGTGTATCAGTCTATA+TGG | - | chr6_2:68224413-68224432 | Msa0925280:intron | 35.0% | |
GAAGCTATTCGAGAAGAAGA+GGG | - | chr6_2:68224223-68224242 | Msa0925280:intron | 40.0% | |
ATTTGACCAGATTCGACAAG+TGG | - | chr6_2:68224246-68224265 | Msa0925280:intron | 40.0% | |
CTCTGAATCTGAACAGTCTT+AGG | + | chr6_2:68224272-68224291 | None:intergenic | 40.0% | |
CTAAGACTGTTCAGATTCAG+AGG | - | chr6_2:68224270-68224289 | Msa0925280:intron | 40.0% | |
TTCAGATTCAGAGGAAGAAG+AGG | - | chr6_2:68224279-68224298 | Msa0925280:intron | 40.0% | |
!!! | AGAAGAGGATTTTGAAGCAG+AGG | - | chr6_2:68224294-68224313 | Msa0925280:intron | 40.0% |
!!! | GATTTTGAAGCAGAGGTTGA+AGG | - | chr6_2:68224301-68224320 | Msa0925280:intron | 40.0% |
! | CCAAATTTCTAGACAGCTCA+AGG | + | chr6_2:68224352-68224371 | None:intergenic | 40.0% |
CCTTGAGCTGTCTAGAAATT+TGG | - | chr6_2:68224349-68224368 | Msa0925280:intron | 40.0% | |
GCTGTCTAGAAATTTGGATG+TGG | - | chr6_2:68224355-68224374 | Msa0925280:intron | 40.0% | |
GGAAGCTATTCGAGAAGAAG+AGG | - | chr6_2:68224222-68224241 | Msa0925280:CDS | 45.0% | |
CTTAGGCCACTTGTCGAATC+TGG | + | chr6_2:68224255-68224274 | None:intergenic | 50.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
chr6_2 | gene | 68224194 | 68224607 | 68224194 | ID=Msa0925280;Name=Msa0925280 |
chr6_2 | mRNA | 68224194 | 68224607 | 68224194 | ID=Msa0925280-mRNA-1;Parent=Msa0925280;Name=Msa0925280-mRNA-1;_AED=0.72;_eAED=0.72;_QI=0|0|0|0.5|1|1|2|0|58 |
chr6_2 | exon | 68224479 | 68224607 | 68224479 | ID=Msa0925280-mRNA-1:exon:10879;Parent=Msa0925280-mRNA-1 |
chr6_2 | exon | 68224194 | 68224241 | 68224194 | ID=Msa0925280-mRNA-1:exon:10878;Parent=Msa0925280-mRNA-1 |
chr6_2 | CDS | 68224479 | 68224607 | 68224479 | ID=Msa0925280-mRNA-1:cds;Parent=Msa0925280-mRNA-1 |
chr6_2 | CDS | 68224194 | 68224241 | 68224194 | ID=Msa0925280-mRNA-1:cds;Parent=Msa0925280-mRNA-1 |
Gene Sequence |
Protein sequence |