Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1467020 | PNX55331.1 | 68.235 | 85 | 26 | 1 | 1 | 84 | 19 | 103 | 8.95e-31 | 114 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1467020 | A0A2K3JMS3 | 68.235 | 85 | 26 | 1 | 1 | 84 | 19 | 103 | 4.28e-31 | 114 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa1438250 | Msa1467020 | 0.809270 | 2.056325e-50 | -8.615850e-47 |
| Msa0688270 | Msa1467020 | 0.804988 | 1.658217e-49 | -8.615850e-47 |
| Msa0697030 | Msa1467020 | 0.801743 | 7.796121e-49 | -8.615850e-47 |
| Msa0697060 | Msa1467020 | 0.802533 | 5.361891e-49 | -8.615850e-47 |
| Msa0735170 | Msa1467020 | 0.808179 | 3.516169e-50 | -8.615850e-47 |
| Msa0766630 | Msa1467020 | 0.815798 | 7.687154e-52 | -8.615850e-47 |
| Msa0777930 | Msa1467020 | 0.806145 | 9.483236e-50 | -8.615850e-47 |
| Msa0833290 | Msa1467020 | 0.802686 | 4.986913e-49 | -8.615850e-47 |
| Msa0153910 | Msa1467020 | 0.816541 | 5.242952e-52 | -8.615850e-47 |
| Msa0214300 | Msa1467020 | 0.813253 | 2.811091e-51 | -8.615850e-47 |
| Msa0406120 | Msa1467020 | 0.801297 | 9.624071e-49 | -8.615850e-47 |
| Msa0437990 | Msa1467020 | 0.816603 | 5.077999e-52 | -8.615850e-47 |
| Msa1014540 | Msa1467020 | 0.806877 | 6.643553e-50 | -8.615850e-47 |
| Msa1082500 | Msa1467020 | 0.805275 | 1.444399e-49 | -8.615850e-47 |
| Msa0294030 | Msa1467020 | 0.812073 | 5.093582e-51 | -8.615850e-47 |
| Msa1136090 | Msa1467020 | 0.808817 | 2.570174e-50 | -8.615850e-47 |
| Msa0885280 | Msa1467020 | 0.842333 | 2.756824e-58 | -8.615850e-47 |
| Msa0885290 | Msa1467020 | 0.817299 | 3.544718e-52 | -8.615850e-47 |
| Msa0935910 | Msa1467020 | 0.832300 | 1.022459e-55 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1467020 | MtrunA17_Chr3g0135571 | 69.620 | 79 | 24 | 0 | 1 | 79 | 94 | 172 | 3.56e-32 | 110 |
| Msa1467020 | MtrunA17_Chr3g0135541 | 69.620 | 79 | 24 | 0 | 1 | 79 | 246 | 324 | 1.92e-31 | 112 |
| Msa1467020 | MtrunA17_Chr3g0135511 | 68.354 | 79 | 25 | 0 | 1 | 79 | 94 | 172 | 3.89e-31 | 107 |
| Msa1467020 | MtrunA17_Chr6g0454951 | 69.333 | 75 | 23 | 0 | 1 | 75 | 1066 | 1140 | 5.15e-29 | 108 |
| Msa1467020 | MtrunA17_Chr6g0455211 | 90.741 | 54 | 5 | 0 | 1 | 54 | 1014 | 1067 | 1.75e-28 | 107 |
| Msa1467020 | MtrunA17_Chr6g0455141 | 63.158 | 76 | 28 | 0 | 4 | 79 | 1 | 76 | 5.69e-28 | 96.7 |
| Msa1467020 | MtrunA17_Chr6g0455251 | 69.333 | 75 | 12 | 1 | 1 | 75 | 1094 | 1157 | 2.64e-27 | 103 |
| Msa1467020 | MtrunA17_Chr6g0454971 | 67.089 | 79 | 15 | 1 | 1 | 79 | 1012 | 1079 | 4.63e-26 | 100 |
| Msa1467020 | MtrunA17_Chr4g0014821 | 58.667 | 75 | 31 | 0 | 1 | 75 | 89 | 163 | 7.06e-24 | 89.4 |
| Msa1467020 | MtrunA17_Chr6g0455191 | 67.089 | 79 | 11 | 2 | 1 | 79 | 1297 | 1360 | 3.24e-23 | 92.0 |
| Msa1467020 | MtrunA17_Chr4g0005851 | 53.165 | 79 | 37 | 0 | 1 | 79 | 1015 | 1093 | 8.88e-22 | 87.8 |
| Msa1467020 | MtrunA17_Chr6g0455221 | 62.162 | 74 | 17 | 1 | 2 | 75 | 1086 | 1148 | 1.64e-21 | 87.0 |
| Msa1467020 | MtrunA17_Chr6g0454861 | 59.494 | 79 | 7 | 1 | 1 | 79 | 51 | 104 | 6.52e-21 | 79.7 |
| Msa1467020 | MtrunA17_Chr4g0005591 | 55.696 | 79 | 33 | 1 | 1 | 79 | 1057 | 1133 | 6.53e-21 | 85.5 |
| Msa1467020 | MtrunA17_Chr6g0454961 | 61.333 | 75 | 24 | 2 | 1 | 75 | 1017 | 1086 | 1.46e-20 | 84.3 |
| Msa1467020 | MtrunA17_Chr6g0454821 | 47.826 | 92 | 48 | 0 | 1 | 92 | 1022 | 1113 | 4.23e-20 | 83.2 |
| Msa1467020 | MtrunA17_Chr6g0454911 | 61.333 | 75 | 4 | 1 | 1 | 75 | 207 | 256 | 1.53e-19 | 79.7 |
| Msa1467020 | MtrunA17_Chr4g0005871 | 49.367 | 79 | 37 | 1 | 1 | 79 | 1105 | 1180 | 2.78e-18 | 77.8 |
| Msa1467020 | MtrunA17_Chr6g0454851 | 60.938 | 64 | 25 | 0 | 1 | 64 | 1072 | 1135 | 2.89e-18 | 77.8 |
| Msa1467020 | MtrunA17_Chr6g0455551 | 68.333 | 60 | 18 | 1 | 1 | 59 | 1065 | 1124 | 1.40e-17 | 75.9 |
| Msa1467020 | MtrunA17_Chr6g0454881 | 54.839 | 62 | 27 | 1 | 1 | 61 | 30 | 91 | 9.50e-17 | 68.6 |
| Msa1467020 | MtrunA17_Chr7g0257531 | 59.677 | 62 | 24 | 1 | 1 | 61 | 629 | 690 | 1.31e-16 | 73.2 |
| Msa1467020 | MtrunA17_Chr4g0010711 | 61.404 | 57 | 22 | 0 | 1 | 57 | 1490 | 1546 | 1.87e-16 | 72.8 |
| Msa1467020 | MtrunA17_Chr6g0455031 | 60.759 | 79 | 20 | 1 | 1 | 79 | 1001 | 1068 | 1.34e-15 | 70.1 |
| Msa1467020 | MtrunA17_Chr4g0005891 | 49.367 | 79 | 39 | 1 | 1 | 79 | 1029 | 1106 | 5.11e-12 | 60.1 |
| Msa1467020 | MtrunA17_Chr4g0009101 | 53.448 | 58 | 27 | 0 | 1 | 58 | 1508 | 1565 | 1.12e-11 | 59.3 |
| Msa1467020 | MtrunA17_Chr6g0455131 | 45.333 | 75 | 18 | 1 | 1 | 75 | 1074 | 1125 | 1.23e-11 | 58.9 |
| Msa1467020 | MtrunA17_Chr7g0234901 | 56.140 | 57 | 25 | 0 | 1 | 57 | 505 | 561 | 1.35e-11 | 58.9 |
| Msa1467020 | MtrunA17_Chr6g0454831 | 71.739 | 46 | 13 | 0 | 1 | 46 | 987 | 1032 | 1.52e-11 | 58.9 |
| Msa1467020 | MtrunA17_Chr4g0009171 | 49.180 | 61 | 30 | 1 | 2 | 61 | 1698 | 1758 | 7.01e-11 | 57.0 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 0 sgRNAs with CRISPR-Local
Find 9 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !! | TCAATAGTTTGAGTAAAATT+TGG | + | tig0049611:223-242 | Msa1467020:CDS | 20.0% |
| !!! | AACTCTATTTTTTTGCCAAT+TGG | - | tig0049611:105-124 | Msa1467020:intergenic | 25.0% |
| CAAGTAATGTCATTCAAATC+TGG | - | tig0049611:138-157 | Msa1467020:intergenic | 30.0% | |
| TTGAATGACATTACTTGTAG+AGG | + | tig0049611:141-160 | Msa1467020:CDS | 30.0% | |
| CTCGTATATGATGAACCAAT+TGG | + | tig0049611:87-106 | Msa1467020:CDS | 35.0% | |
| AAACTATTGAAGTCATCAGC+AGG | - | tig0049611:213-232 | Msa1467020:intergenic | 35.0% | |
| CAAGAGATTCTCTACTGAAG+AGG | + | tig0049611:185-204 | Msa1467020:CDS | 40.0% | |
| AGAACCTGGCAACAAAGTTG+AGG | + | tig0049611:14-33 | Msa1467020:CDS | 45.0% | |
| ACGACCTCAACTTTGTTGCC+AGG | - | tig0049611:21-40 | Msa1467020:intergenic | 50.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| tig0049611 | gene | 3 | 281 | 3 | ID=Msa1467020;Name=Msa1467020 |
| tig0049611 | mRNA | 3 | 281 | 3 | ID=Msa1467020-mRNA-1;Parent=Msa1467020;Name=Msa1467020-mRNA-1;_AED=0.30;_eAED=0.41;_QI=0|-1|0|1|-1|1|1|0|92 |
| tig0049611 | exon | 3 | 281 | 3 | ID=Msa1467020-mRNA-1:exon:25184;Parent=Msa1467020-mRNA-1 |
| tig0049611 | CDS | 3 | 281 | 3 | ID=Msa1467020-mRNA-1:cds;Parent=Msa1467020-mRNA-1 |
| Gene Sequence |
| Protein sequence |
