Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa1112630 | AES80148.2 | 88.991 | 109 | 10 | 2 | 1 | 109 | 1 | 107 | 2.87e-50 | 164 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa1112630 | sp|Q8W4Y8|IBB_LENCU | 50.476 | 105 | 46 | 2 | 5 | 107 | 10 | 110 | 1.83e-30 | 107 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa1112630 | G7L3M8 | 88.991 | 109 | 10 | 2 | 1 | 109 | 1 | 107 | 1.37e-50 | 164 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
Msa0064990 | Msa1112630 | 0.818593 | 1.807668e-52 | -8.615850e-47 |
Msa0689840 | Msa1112630 | 0.806341 | 8.621686e-50 | -8.615850e-47 |
Msa0728210 | Msa1112630 | 0.810472 | 1.133449e-50 | -8.615850e-47 |
Msa0744550 | Msa1112630 | 0.804276 | 2.335195e-49 | -8.615850e-47 |
Msa0789410 | Msa1112630 | 0.817495 | 3.201904e-52 | -8.615850e-47 |
Msa0814350 | Msa1112630 | 0.807926 | 3.981213e-50 | -8.615850e-47 |
Msa0841670 | Msa1112630 | 0.800615 | 1.326618e-48 | -8.615850e-47 |
Msa0183960 | Msa1112630 | -0.801313 | 9.552641e-49 | -8.615850e-47 |
Msa0370620 | Msa1112630 | 0.803101 | 4.094285e-49 | -8.615850e-47 |
Msa0374040 | Msa1112630 | 0.803008 | 4.278085e-49 | -8.615850e-47 |
Msa0409490 | Msa1112630 | 0.806339 | 8.629396e-50 | -8.615850e-47 |
Msa0414480 | Msa1112630 | 0.804436 | 2.161801e-49 | -8.615850e-47 |
Msa0480540 | Msa1112630 | 0.801769 | 7.702381e-49 | -8.615850e-47 |
Msa0996980 | Msa1112630 | 0.813056 | 3.104251e-51 | -8.615850e-47 |
Msa1037530 | Msa1112630 | 0.809813 | 1.571952e-50 | -8.615850e-47 |
Msa0248320 | Msa1112630 | 0.818906 | 1.534620e-52 | -8.615850e-47 |
Msa0303900 | Msa1112630 | 0.813896 | 2.029712e-51 | -8.615850e-47 |
Msa0333770 | Msa1112630 | 0.809045 | 2.296739e-50 | -8.615850e-47 |
Msa0354550 | Msa1112630 | 0.825971 | 3.502926e-54 | -8.615850e-47 |
Msa0361700 | Msa1112630 | 0.800362 | 1.493453e-48 | -8.615850e-47 |
Msa1112630 | Msa1130410 | 0.805870 | 1.083274e-49 | -8.615850e-47 |
Msa1112630 | Msa1138110 | 0.803917 | 2.773067e-49 | -8.615850e-47 |
Msa1112630 | Msa1173290 | 0.800293 | 1.542420e-48 | -8.615850e-47 |
Msa1112630 | Msa1214960 | 0.809491 | 1.843109e-50 | -8.615850e-47 |
Msa1112630 | Msa1375640 | 0.805058 | 1.602968e-49 | -8.615850e-47 |
Msa1112630 | Msa1376520 | 0.808117 | 3.625900e-50 | -8.615850e-47 |
Msa1112630 | Msa1419390 | 0.814812 | 1.273478e-51 | -8.615850e-47 |
Msa1112630 | Msa1419700 | 0.804267 | 2.345092e-49 | -8.615850e-47 |
Msa1112630 | Msa1429190 | 0.803155 | 3.989657e-49 | -8.615850e-47 |
Msa1112630 | Msa1446090 | 0.803962 | 2.713873e-49 | -8.615850e-47 |
Msa0496070 | Msa1112630 | 0.817273 | 3.591153e-52 | -8.615850e-47 |
Msa0538650 | Msa1112630 | 0.808671 | 2.762315e-50 | -8.615850e-47 |
Msa0574220 | Msa1112630 | -0.803974 | 2.698638e-49 | -8.615850e-47 |
Msa0594470 | Msa1112630 | 0.806754 | 7.053286e-50 | -8.615850e-47 |
Msa0896920 | Msa1112630 | 0.814289 | 1.662400e-51 | -8.615850e-47 |
Msa0902340 | Msa1112630 | 0.807653 | 4.550153e-50 | -8.615850e-47 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa1112630 | MtrunA17_Chr7g0247451 | 87.156 | 109 | 12 | 2 | 1 | 109 | 1 | 107 | 5.57e-54 | 164 |
Msa1112630 | MtrunA17_Chr7g0247571 | 54.464 | 112 | 45 | 2 | 3 | 109 | 48 | 158 | 1.38e-37 | 124 |
Msa1112630 | MtrunA17_Chr7g0247471 | 58.163 | 98 | 37 | 2 | 7 | 101 | 14 | 110 | 4.31e-33 | 111 |
Msa1112630 | MtrunA17_Chr7g0247531 | 55.769 | 104 | 38 | 2 | 5 | 101 | 1 | 103 | 9.61e-33 | 110 |
Msa1112630 | MtrunA17_Chr7g0247461 | 54.128 | 109 | 37 | 4 | 3 | 101 | 27 | 132 | 1.99e-31 | 107 |
Msa1112630 | MtrunA17_Chr7g0247521 | 56.190 | 105 | 39 | 4 | 1 | 101 | 1 | 102 | 9.06e-29 | 100 |
Msa1112630 | MtrunA17_Chr7g0247481 | 53.000 | 100 | 40 | 3 | 5 | 98 | 2 | 100 | 1.25e-28 | 99.8 |
Msa1112630 | MtrunA17_Chr7g0247511 | 43.269 | 104 | 51 | 3 | 5 | 101 | 11 | 113 | 3.52e-21 | 81.3 |
Msa1112630 | MtrunA17_Chr7g0247541 | 40.625 | 96 | 52 | 3 | 5 | 98 | 10 | 102 | 3.10e-14 | 63.2 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Find 19 sgRNAs with CRISPR-Local
Find 19 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TTCAAAACGAGCATCAATAA+TGG | 0.364997 | 7_3:+58594033 | None:intergenic |
ACTCAGCTTGCAAGACTTGT+AGG | 0.371610 | 7_3:-58593877 | Msa1112630:CDS |
ACTTGAGTGATGAGGGAGTT+TGG | 0.371670 | 7_3:+58594010 | None:intergenic |
TGTTGTCGATTTGACACCAT+TGG | 0.451422 | 7_3:+58593982 | None:intergenic |
TCATTAATCTTAATGAGCCT+TGG | 0.460999 | 7_3:+58593772 | None:intergenic |
AGCAAAAGTCAGTGATATCA+AGG | 0.473824 | 7_3:+58593822 | None:intergenic |
GTTATAGTAGTTGAGTTACA+TGG | 0.521465 | 7_3:+58593794 | None:intergenic |
ACGAGCATCAATAATGGTTG+TGG | 0.542447 | 7_3:+58594039 | None:intergenic |
TCAAGGCAATCGCACTTCAA+AGG | 0.562557 | 7_3:+58593839 | None:intergenic |
GGATATCACTTGAGTGATGA+GGG | 0.569030 | 7_3:+58594003 | None:intergenic |
TAACTCAACTACTATAACCA+AGG | 0.583203 | 7_3:-58593789 | Msa1112630:CDS |
ATCACTCAAGTGATATCCAA+TGG | 0.590793 | 7_3:-58593998 | Msa1112630:CDS |
GCACCTTGTTGTGATAATTG+TGG | 0.595238 | 7_3:-58593956 | Msa1112630:CDS |
TTGCAAGCTGAGTGACATGT+TGG | 0.596983 | 7_3:+58593887 | None:intergenic |
TGGATATCACTTGAGTGATG+AGG | 0.599239 | 7_3:+58594002 | None:intergenic |
TCAGTACAACGACACTGAGG+AGG | 0.627030 | 7_3:+58593917 | None:intergenic |
CAGTACAACGACACTGAGGA+GGG | 0.637399 | 7_3:+58593918 | None:intergenic |
CAACCACAATTATCACAACA+AGG | 0.653733 | 7_3:+58593953 | None:intergenic |
ACATCAGTACAACGACACTG+AGG | 0.777519 | 7_3:+58593914 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!!! | GCTTTGTTACTTTTTTTCAT+AGG | - | chr7_3:58593802-58593821 | Msa1112630:CDS | 25.0% |
TTCAAAACGAGCATCAATAA+TGG | + | chr7_3:58593839-58593858 | None:intergenic | 30.0% | |
GTTATAGTAGTTGAGTTACA+TGG | + | chr7_3:58594078-58594097 | None:intergenic | 30.0% | |
TAACTCAACTACTATAACCA+AGG | - | chr7_3:58594080-58594099 | Msa1112630:CDS | 30.0% | |
ATCACTCAAGTGATATCCAA+TGG | - | chr7_3:58593871-58593890 | Msa1112630:CDS | 35.0% | |
CAACCACAATTATCACAACA+AGG | + | chr7_3:58593919-58593938 | None:intergenic | 35.0% | |
AGCAAAAGTCAGTGATATCA+AGG | + | chr7_3:58594050-58594069 | None:intergenic | 35.0% | |
ACGAGCATCAATAATGGTTG+TGG | + | chr7_3:58593833-58593852 | None:intergenic | 40.0% | |
GGATATCACTTGAGTGATGA+GGG | + | chr7_3:58593869-58593888 | None:intergenic | 40.0% | |
TGGATATCACTTGAGTGATG+AGG | + | chr7_3:58593870-58593889 | None:intergenic | 40.0% | |
!! | TGTTGTCGATTTGACACCAT+TGG | + | chr7_3:58593890-58593909 | None:intergenic | 40.0% |
! | GCACCTTGTTGTGATAATTG+TGG | - | chr7_3:58593913-58593932 | Msa1112630:CDS | 40.0% |
ACTTGAGTGATGAGGGAGTT+TGG | + | chr7_3:58593862-58593881 | None:intergenic | 45.0% | |
ACATCAGTACAACGACACTG+AGG | + | chr7_3:58593958-58593977 | None:intergenic | 45.0% | |
TTGCAAGCTGAGTGACATGT+TGG | + | chr7_3:58593985-58594004 | None:intergenic | 45.0% | |
ACTCAGCTTGCAAGACTTGT+AGG | - | chr7_3:58593992-58594011 | Msa1112630:CDS | 45.0% | |
TCAAGGCAATCGCACTTCAA+AGG | + | chr7_3:58594033-58594052 | None:intergenic | 45.0% | |
CAGTACAACGACACTGAGGA+GGG | + | chr7_3:58593954-58593973 | None:intergenic | 50.0% | |
TCAGTACAACGACACTGAGG+AGG | + | chr7_3:58593955-58593974 | None:intergenic | 50.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
chr7_3 | gene | 58593781 | 58594110 | 58593781 | ID=Msa1112630;Name=Msa1112630 |
chr7_3 | mRNA | 58593781 | 58594110 | 58593781 | ID=Msa1112630-mRNA-1;Parent=Msa1112630;Name=Msa1112630-mRNA-1;_AED=0.48;_eAED=0.48;_QI=0|-1|0|1|-1|1|1|0|109 |
chr7_3 | exon | 58593781 | 58594110 | 58593781 | ID=Msa1112630-mRNA-1:exon:12919;Parent=Msa1112630-mRNA-1 |
chr7_3 | CDS | 58593781 | 58594110 | 58593781 | ID=Msa1112630-mRNA-1:cds;Parent=Msa1112630-mRNA-1 |
Gene Sequence |
Protein sequence |