Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0017510 | Msa0372520 | 0.822223 | 2.657972e-53 | -8.615850e-47 |
| Msa0140780 | Msa0372520 | 0.803476 | 3.423383e-49 | -8.615850e-47 |
| Msa0157290 | Msa0372520 | 0.822172 | 2.730265e-53 | -8.615850e-47 |
| Msa0200260 | Msa0372520 | 0.813906 | 2.018642e-51 | -8.615850e-47 |
| Msa0220740 | Msa0372520 | 0.811793 | 5.860472e-51 | -8.615850e-47 |
| Msa0372520 | Msa0431690 | 0.804961 | 1.679599e-49 | -8.615850e-47 |
| Msa0372520 | Msa0440750 | 0.800803 | 1.214322e-48 | -8.615850e-47 |
| Msa0372520 | Msa0484780 | 0.823093 | 1.667685e-53 | -8.615850e-47 |
| Msa0372520 | Msa0512890 | 0.840538 | 8.188348e-58 | -8.615850e-47 |
| Msa0372520 | Msa0512900 | 0.841482 | 4.627394e-58 | -8.615850e-47 |
| Msa0372520 | Msa0657970 | 0.819984 | 8.715216e-53 | -8.615850e-47 |
| Msa0372520 | Msa0760130 | 0.800951 | 1.132398e-48 | -8.615850e-47 |
| Msa0372520 | Msa0793640 | 0.804891 | 1.737446e-49 | -8.615850e-47 |
| Msa0372520 | Msa0880140 | 0.819418 | 1.173688e-52 | -8.615850e-47 |
| Msa0372520 | Msa0909120 | 0.807303 | 5.397767e-50 | -8.615850e-47 |
| Msa0372520 | Msa0909140 | 0.806393 | 8.407807e-50 | -8.615850e-47 |
| Msa0372520 | Msa0954130 | 0.805078 | 1.587592e-49 | -8.615850e-47 |
| Msa0372520 | Msa0954550 | 0.805668 | 1.194243e-49 | -8.615850e-47 |
| Msa0372520 | Msa0969450 | 0.809820 | 1.566024e-50 | -8.615850e-47 |
| Msa0372520 | Msa0969520 | 0.806507 | 7.956231e-50 | -8.615850e-47 |
| Msa0372520 | Msa1014540 | 0.804215 | 2.403748e-49 | -8.615850e-47 |
| Msa0372520 | Msa1045200 | 0.804067 | 2.581195e-49 | -8.615850e-47 |
| Msa0372520 | Msa1075220 | -0.802943 | 4.413435e-49 | -8.615850e-47 |
| Msa0372520 | Msa1082500 | 0.830354 | 3.078362e-55 | -8.615850e-47 |
| Msa0372520 | Msa1162550 | -0.800083 | 1.702280e-48 | -8.615850e-47 |
| Msa0372520 | Msa1233890 | 0.800318 | 1.524359e-48 | -8.615850e-47 |
| Msa0372520 | Msa1306850 | 0.805418 | 1.347736e-49 | -8.615850e-47 |
| Msa0372520 | Msa1324500 | 0.800651 | 1.304099e-48 | -8.615850e-47 |
| Msa0372520 | Msa1372760 | 0.801827 | 7.491869e-49 | -8.615850e-47 |
| Msa0372520 | Msa1397860 | 0.805690 | 1.181990e-49 | -8.615850e-47 |
| Msa0372520 | Msa1438250 | 0.819591 | 1.071757e-52 | -8.615850e-47 |
| Msa0372520 | Msa1439320 | 0.800222 | 1.594660e-48 | -8.615850e-47 |
| Msa0372520 | Msa1452120 | 0.803182 | 3.938069e-49 | -8.615850e-47 |
| Msa0243100 | Msa0372520 | 0.819502 | 1.123011e-52 | -8.615850e-47 |
| Msa0287650 | Msa0372520 | 0.803863 | 2.845290e-49 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 12 sgRNAs with CRISPR-Local
Find 14 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| CATGCCAACGACGGAAATTA+TGG | 0.252778 | 3_1:-71100545 | None:intergenic |
| ACTTCAATTCTGGAAACGTC+TGG | 0.458723 | 3_1:-71100513 | None:intergenic |
| TGACAATAAGAAGAATGTTT+CGG | 0.460187 | 3_1:+71100429 | Msa0372520:CDS |
| ATGGCCATAATTTCCGTCGT+TGG | 0.472194 | 3_1:+71100541 | Msa0372520:CDS |
| ACAATCTAAGGAATTATGGC+TGG | 0.522622 | 3_1:+71100391 | None:intergenic |
| TACTGATCCTCCTCCGACAG+TGG | 0.555859 | 3_1:+71100471 | Msa0372520:CDS |
| TAGGTGACCACTGTCGGAGG+AGG | 0.579910 | 3_1:-71100478 | None:intergenic |
| TTTGCATAGGTGACCACTGT+CGG | 0.584337 | 3_1:-71100484 | None:intergenic |
| GAGGATCAGTAGCAACAACA+AGG | 0.606584 | 3_1:-71100459 | None:intergenic |
| AGATGCGTTCATGCCAACGA+CGG | 0.660184 | 3_1:-71100554 | None:intergenic |
| GCATAGGTGACCACTGTCGG+AGG | 0.668853 | 3_1:-71100481 | None:intergenic |
| AGGATCAGTAGCAACAACAA+GGG | 0.691715 | 3_1:-71100458 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| ! | TGACAATAAGAAGAATGTTT+CGG | + | chr3_1:71100429-71100448 | Msa0372520:CDS | 25.0% |
| ! | TCCAGAATTGAAGTTTTTGA+TGG | + | chr3_1:71100522-71100541 | Msa0372520:CDS | 30.0% |
| GCCATCAAAAACTTCAATTC+TGG | - | chr3_1:71100526-71100545 | None:intergenic | 35.0% | |
| AGGATCAGTAGCAACAACAA+GGG | - | chr3_1:71100461-71100480 | None:intergenic | 40.0% | |
| ! | ACTTCAATTCTGGAAACGTC+TGG | - | chr3_1:71100516-71100535 | None:intergenic | 40.0% |
| GAGGATCAGTAGCAACAACA+AGG | - | chr3_1:71100462-71100481 | None:intergenic | 45.0% | |
| TTTGCATAGGTGACCACTGT+CGG | - | chr3_1:71100487-71100506 | None:intergenic | 45.0% | |
| !! | CGTCTGGAACTGTTTTGCAT+AGG | - | chr3_1:71100500-71100519 | None:intergenic | 45.0% |
| ATGGCCATAATTTCCGTCGT+TGG | + | chr3_1:71100541-71100560 | Msa0372520:CDS | 45.0% | |
| CATGCCAACGACGGAAATTA+TGG | - | chr3_1:71100548-71100567 | None:intergenic | 45.0% | |
| AGATGCGTTCATGCCAACGA+CGG | - | chr3_1:71100557-71100576 | None:intergenic | 50.0% | |
| TACTGATCCTCCTCCGACAG+TGG | + | chr3_1:71100471-71100490 | Msa0372520:CDS | 55.0% | |
| TAGGTGACCACTGTCGGAGG+AGG | - | chr3_1:71100481-71100500 | None:intergenic | 60.0% | |
| GCATAGGTGACCACTGTCGG+AGG | - | chr3_1:71100484-71100503 | None:intergenic | 60.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| chr3_1 | gene | 71100406 | 71100588 | 71100406 | ID=Msa0372520;Name=Msa0372520 |
| chr3_1 | mRNA | 71100406 | 71100588 | 71100406 | ID=Msa0372520-mRNA-1;Parent=Msa0372520;Name=Msa0372520-mRNA-1;_AED=0.52;_eAED=1.00;_QI=0|-1|0|1|-1|1|1|0|60 |
| chr3_1 | exon | 71100406 | 71100588 | 71100406 | ID=Msa0372520-mRNA-1:exon:15625;Parent=Msa0372520-mRNA-1 |
| chr3_1 | CDS | 71100406 | 71100588 | 71100406 | ID=Msa0372520-mRNA-1:cds;Parent=Msa0372520-mRNA-1 |
| Gene Sequence |
| Protein sequence |