Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1336290 | AFK39951.1 | 98.718 | 78 | 1 | 0 | 1 | 78 | 277 | 354 | 1.49e-46 | 161 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1336290 | I3SI59 | 98.718 | 78 | 1 | 0 | 1 | 78 | 277 | 354 | 7.11e-47 | 161 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0101500 | Msa1336290 | -0.805882 | 1.077213e-49 | -8.615850e-47 |
| Msa0115790 | Msa1336290 | 0.815048 | 1.128714e-51 | -8.615850e-47 |
| Msa0658890 | Msa1336290 | 0.830803 | 2.391002e-55 | -8.615850e-47 |
| Msa0802010 | Msa1336290 | 0.822213 | 2.670852e-53 | -8.615850e-47 |
| Msa0827930 | Msa1336290 | 0.804731 | 1.876319e-49 | -8.615850e-47 |
| Msa0189320 | Msa1336290 | 0.807291 | 5.429658e-50 | -8.615850e-47 |
| Msa1257750 | Msa1336290 | 0.825454 | 4.645908e-54 | -8.615850e-47 |
| Msa1300700 | Msa1336290 | 0.803972 | 2.701265e-49 | -8.615850e-47 |
| Msa1329200 | Msa1336290 | 0.803522 | 3.348290e-49 | -8.615850e-47 |
| Msa1336290 | Msa1358500 | 0.809272 | 2.054096e-50 | -8.615850e-47 |
| Msa1336290 | Msa1453610 | 0.828492 | 8.722817e-55 | -8.615850e-47 |
| Msa1336290 | Msa1457620 | 0.810849 | 9.394068e-51 | -8.615850e-47 |
| Msa1336290 | Msa1466230 | 0.808057 | 3.733192e-50 | -8.615850e-47 |
| Msa0392830 | Msa1336290 | 0.804325 | 2.280898e-49 | -8.615850e-47 |
| Msa0398670 | Msa1336290 | 0.840468 | 8.541015e-58 | -8.615850e-47 |
| Msa0440990 | Msa1336290 | 0.825680 | 4.108662e-54 | -8.615850e-47 |
| Msa0454360 | Msa1336290 | 0.804769 | 1.842313e-49 | -8.615850e-47 |
| Msa1081980 | Msa1336290 | 0.821891 | 3.172425e-53 | -8.615850e-47 |
| Msa0240920 | Msa1336290 | 0.829681 | 4.492194e-55 | -8.615850e-47 |
| Msa0261090 | Msa1336290 | 0.818211 | 2.206241e-52 | -8.615850e-47 |
| Msa0271510 | Msa1336290 | 0.839876 | 1.219190e-57 | -8.615850e-47 |
| Msa0305410 | Msa1336290 | 0.817334 | 3.479612e-52 | -8.615850e-47 |
| Msa0316390 | Msa1336290 | 0.803182 | 3.938613e-49 | -8.615850e-47 |
| Msa0318680 | Msa1336290 | 0.806234 | 9.079928e-50 | -8.615850e-47 |
| Msa1160560 | Msa1336290 | 0.814791 | 1.287008e-51 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1336290 | MtrunA17_Chr3g0145171 | 98.718 | 78 | 1 | 0 | 1 | 78 | 277 | 354 | 1.44e-50 | 161 |
| Msa1336290 | MtrunA17_Chr8g0370711 | 66.667 | 78 | 26 | 0 | 1 | 78 | 277 | 354 | 1.19e-35 | 123 |
| Msa1336290 | MtrunA17_Chr8g0370721 | 67.949 | 78 | 25 | 0 | 1 | 78 | 277 | 354 | 6.76e-35 | 121 |
| Msa1336290 | MtrunA17_Chr3g0145181 | 58.974 | 78 | 31 | 1 | 1 | 78 | 277 | 353 | 3.10e-25 | 95.5 |
| Msa1336290 | MtrunA17_Chr3g0145201 | 58.974 | 78 | 31 | 1 | 1 | 78 | 912 | 988 | 7.62e-25 | 95.9 |
| Msa1336290 | MtrunA17_Chr4g0064781 | 50.000 | 78 | 39 | 0 | 1 | 78 | 271 | 348 | 2.10e-20 | 82.4 |
| Msa1336290 | MtrunA17_Chr4g0064771 | 51.429 | 70 | 34 | 0 | 1 | 70 | 136 | 205 | 1.66e-18 | 75.5 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1336290 | AT5G20400.1 | 65.385 | 78 | 27 | 0 | 1 | 78 | 271 | 348 | 6.83e-32 | 113 |
| Msa1336290 | AT5G20550.1 | 66.667 | 78 | 26 | 0 | 1 | 78 | 272 | 349 | 7.74e-31 | 110 |
| Msa1336290 | AT1G49390.2 | 60.256 | 78 | 31 | 0 | 1 | 78 | 192 | 269 | 7.47e-29 | 103 |
| Msa1336290 | AT1G49390.1 | 60.256 | 78 | 31 | 0 | 1 | 78 | 271 | 348 | 2.30e-28 | 104 |
| Msa1336290 | AT5G54000.1 | 55.128 | 78 | 35 | 0 | 1 | 78 | 192 | 269 | 4.24e-25 | 94.4 |
| Msa1336290 | AT5G54000.2 | 55.128 | 78 | 35 | 0 | 1 | 78 | 272 | 349 | 1.24e-24 | 94.4 |
| Msa1336290 | AT1G78550.2 | 40.000 | 80 | 46 | 1 | 1 | 78 | 199 | 278 | 1.88e-12 | 60.5 |
| Msa1336290 | AT1G78550.1 | 40.000 | 80 | 46 | 1 | 1 | 78 | 277 | 356 | 2.96e-12 | 60.5 |
| Msa1336290 | AT3G21420.1 | 42.683 | 82 | 42 | 3 | 1 | 78 | 282 | 362 | 5.25e-12 | 59.7 |
Find 14 sgRNAs with CRISPR-Local
Find 17 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| TTAATCTCTTGTTCTGAATC+TGG | 0.210279 | tig0001000:-152 | Msa1336290:intergenic |
| ACATAACTATGATTAAATTT+TGG | 0.220701 | tig0001000:-288 | Msa1336290:intergenic |
| AATATTACCAACAGGGAAAA+AGG | 0.234600 | tig0001000:+252 | Msa1336290:CDS |
| TTCACTGGTCTGTATAATAT+TGG | 0.322104 | tig0001000:-206 | Msa1336290:intergenic |
| TAATCTCTTGTTCTGAATCT+GGG | 0.407176 | tig0001000:-151 | Msa1336290:intergenic |
| AGTAGTGATAAATGAAGAAA+AGG | 0.420128 | tig0001000:+100 | Msa1336290:CDS |
| TTTATCACTACTCTGTGTAC+TGG | 0.484624 | tig0001000:-89 | Msa1336290:intergenic |
| CTACTCTGTGTACTGGACTC+TGG | 0.522493 | tig0001000:-82 | Msa1336290:intergenic |
| CCGTCCACTAGTCTGTCGAC+TGG | 0.584898 | tig0001000:-176 | Msa1336290:intergenic |
| CAGTCGACAGACTAGTGGAC+GGG | 0.592554 | tig0001000:+177 | Msa1336290:CDS |
| TGATAAATGAAGAAAAGGAA+AGG | 0.617930 | tig0001000:+105 | Msa1336290:CDS |
| GTTACACAGATAATGAGCAA+TGG | 0.639099 | tig0001000:+53 | None:intergenic |
| TAAACCAGTCGACAGACTAG+TGG | 0.643978 | tig0001000:+172 | Msa1336290:CDS |
| CCAGTCGACAGACTAGTGGA+CGG | 0.661367 | tig0001000:+176 | Msa1336290:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !!! | ATATTTTCAATATTACCAAC+AGG | + | tig0001000:244-263 | Msa1336290:CDS | 20.0% |
| !!! | TATTTTCAATATTACCAACA+GGG | + | tig0001000:245-264 | Msa1336290:CDS | 20.0% |
| ! | AGTAGTGATAAATGAAGAAA+AGG | + | tig0001000:100-119 | Msa1336290:CDS | 25.0% |
| ! | TGATAAATGAAGAAAAGGAA+AGG | + | tig0001000:105-124 | Msa1336290:CDS | 25.0% |
| !! | AAATCAACATAGTTTTTCAC+TGG | - | tig0001000:224-243 | Msa1336290:intergenic | 25.0% |
| !!! | TAAATTTTGGAAGCTTCAAT+TGG | - | tig0001000:278-297 | Msa1336290:intergenic | 25.0% |
| ! | TAATCTCTTGTTCTGAATCT+GGG | - | tig0001000:154-173 | Msa1336290:intergenic | 30.0% |
| ! | TTAATCTCTTGTTCTGAATC+TGG | - | tig0001000:155-174 | Msa1336290:intergenic | 30.0% |
| ! | TTCACTGGTCTGTATAATAT+TGG | - | tig0001000:209-228 | Msa1336290:intergenic | 30.0% |
| AATATTACCAACAGGGAAAA+AGG | + | tig0001000:252-271 | Msa1336290:CDS | 30.0% | |
| TTTATCACTACTCTGTGTAC+TGG | - | tig0001000:92-111 | Msa1188860:intergenic | 35.0% | |
| TAAACCAGTCGACAGACTAG+TGG | + | tig0001000:172-191 | Msa1336290:CDS | 45.0% | |
| !!! | CAATTGGCCTTTTTCCCTGT+TGG | - | tig0001000:262-281 | Msa1336290:intergenic | 45.0% |
| CTACTCTGTGTACTGGACTC+TGG | - | tig0001000:85-104 | Msa1188860:intergenic | 50.0% | |
| CCAGTCGACAGACTAGTGGA+CGG | + | tig0001000:176-195 | Msa1336290:CDS | 55.0% | |
| ! | CAGTCGACAGACTAGTGGAC+GGG | + | tig0001000:177-196 | Msa1336290:CDS | 55.0% |
| ! | CCGTCCACTAGTCTGTCGAC+TGG | - | tig0001000:179-198 | Msa1336290:intergenic | 60.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| tig0001000 | gene | 62 | 298 | 62 | ID=Msa1336290;Name=Msa1336290 |
| tig0001000 | mRNA | 62 | 298 | 62 | ID=Msa1336290-mRNA-1;Parent=Msa1336290;Name=Msa1336290-mRNA-1;_AED=0.48;_eAED=0.48;_QI=0|-1|0|1|-1|1|1|0|78 |
| tig0001000 | exon | 62 | 298 | 62 | ID=Msa1336290-mRNA-1:exon:675;Parent=Msa1336290-mRNA-1 |
| tig0001000 | CDS | 62 | 298 | 62 | ID=Msa1336290-mRNA-1:cds;Parent=Msa1336290-mRNA-1 |
| Gene Sequence |
| Protein sequence |
