Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1339580 | AES61501.1 | 93.827 | 81 | 5 | 0 | 1 | 81 | 1 | 81 | 3.99e-49 | 159 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1339580 | G7IAC0 | 93.827 | 81 | 5 | 0 | 1 | 81 | 1 | 81 | 1.91e-49 | 159 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0006980 | Msa1339580 | 0.801034 | 1.089140e-48 | -8.615850e-47 |
| Msa0080910 | Msa1339580 | 0.801007 | 1.102918e-48 | -8.615850e-47 |
| Msa0080990 | Msa1339580 | 0.961261 | 1.692799e-119 | -8.615850e-47 |
| Msa0109880 | Msa1339580 | 0.802724 | 4.897362e-49 | -8.615850e-47 |
| Msa0739580 | Msa1339580 | 0.821895 | 3.165735e-53 | -8.615850e-47 |
| Msa0748000 | Msa1339580 | 0.961040 | 3.041946e-119 | -8.615850e-47 |
| Msa0828830 | Msa1339580 | 0.806059 | 9.885597e-50 | -8.615850e-47 |
| Msa0124130 | Msa1339580 | 0.803533 | 3.331317e-49 | -8.615850e-47 |
| Msa0156250 | Msa1339580 | 0.806906 | 6.553194e-50 | -8.615850e-47 |
| Msa0212150 | Msa1339580 | 0.819869 | 9.259519e-53 | -8.615850e-47 |
| Msa1228190 | Msa1339580 | 0.831757 | 1.392828e-55 | -8.615850e-47 |
| Msa1271260 | Msa1339580 | 0.807684 | 4.481482e-50 | -8.615850e-47 |
| Msa1307150 | Msa1339580 | 0.805547 | 1.266250e-49 | -8.615850e-47 |
| Msa1339580 | Msa1356990 | 0.961011 | 3.286301e-119 | -8.615850e-47 |
| Msa1339580 | Msa1379970 | 0.816656 | 4.941227e-52 | -8.615850e-47 |
| Msa1339580 | Msa1406780 | 0.812103 | 5.017492e-51 | -8.615850e-47 |
| Msa1339580 | Msa1421550 | 0.820469 | 6.747559e-53 | -8.615850e-47 |
| Msa1339580 | Msa1431850 | 0.820180 | 7.860035e-53 | -8.615850e-47 |
| Msa1339580 | Msa1443140 | 0.820943 | 5.250153e-53 | -8.615850e-47 |
| Msa0406000 | Msa1339580 | 0.807894 | 4.044934e-50 | -8.615850e-47 |
| Msa0451400 | Msa1339580 | 0.808375 | 3.194851e-50 | -8.615850e-47 |
| Msa0999300 | Msa1339580 | 0.835248 | 1.874138e-56 | -8.615850e-47 |
| Msa1001890 | Msa1339580 | 0.817041 | 4.050020e-52 | -8.615850e-47 |
| Msa0252770 | Msa1339580 | 0.845495 | 3.919720e-59 | -8.615850e-47 |
| Msa0289920 | Msa1339580 | 0.817538 | 3.131460e-52 | -8.615850e-47 |
| Msa0306120 | Msa1339580 | 0.824627 | 7.287294e-54 | -8.615850e-47 |
| Msa0329620 | Msa1339580 | 0.861363 | 1.081640e-63 | -8.615850e-47 |
| Msa0359250 | Msa1339580 | 0.810388 | 1.181938e-50 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1339580 | MtrunA17_Chr1g0193271 | 80.723 | 83 | 14 | 1 | 1 | 81 | 1 | 83 | 7.35e-43 | 134 |
| Msa1339580 | MtrunA17_Chr1g0193251 | 83.750 | 80 | 13 | 0 | 2 | 81 | 4 | 83 | 5.68e-36 | 116 |
| Msa1339580 | MtrunA17_Chr7g0271321 | 48.101 | 79 | 38 | 2 | 1 | 76 | 1 | 79 | 4.12e-19 | 73.9 |
| Msa1339580 | MtrunA17_Chr1g0193261 | 56.923 | 65 | 22 | 3 | 15 | 73 | 18 | 82 | 2.23e-17 | 69.7 |
| Msa1339580 | MtrunA17_Chr1g0193231 | 56.923 | 65 | 22 | 3 | 15 | 73 | 18 | 82 | 2.25e-17 | 69.7 |
| Msa1339580 | MtrunA17_Chr1g0193301 | 56.923 | 65 | 22 | 3 | 15 | 73 | 19 | 83 | 2.63e-17 | 69.7 |
| Msa1339580 | MtrunA17_Chr1g0193291 | 59.016 | 61 | 20 | 3 | 18 | 73 | 20 | 80 | 1.01e-15 | 65.5 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1339580 | AT3G05858.1 | 45.882 | 85 | 39 | 4 | 1 | 79 | 1 | 84 | 2.57e-12 | 57.4 |
Find 16 sgRNAs with CRISPR-Local
Find 13 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| GTGATGAAGACAAAGGTAAC+TGG | 0.348340 | tig0003359:-2756 | Msa1339580:CDS |
| GGTAAGACTAAGTCTTCTTC+AGG | 0.365971 | tig0003359:-2865 | Msa1339580:CDS |
| TCAGCTCTCATGTTAATGTT+AGG | 0.378896 | tig0003359:+2721 | None:intergenic |
| AAACTCGATTCTTGTATTTG+CGG | 0.401356 | tig0003359:+2689 | None:intergenic |
| TGGATCAACTTCATAGCGTT+CGG | 0.459202 | tig0003359:+2660 | None:intergenic |
| TTACCTTTGTCTTCATCACT+AGG | 0.502543 | tig0003359:+2760 | None:intergenic |
| TATTATGCATTCTAGACCGC+TGG | 0.510025 | tig0003359:+2640 | None:intergenic |
| TCAAAGAATAAGTCTAGAGC+AGG | 0.540317 | tig0003359:-2814 | Msa1339580:CDS |
| TGATGAAGACAAAGGTAACT+GGG | 0.585582 | tig0003359:-2755 | Msa1339580:CDS |
| GCATTAATCATCATGGGAGG+TGG | 0.588766 | tig0003359:-2886 | None:intergenic |
| GCAGGATACTATGATGATTG+CGG | 0.626514 | tig0003359:-2796 | Msa1339580:CDS |
| ATGATTGCGGATGCAAGACA+TGG | 0.656100 | tig0003359:-2783 | Msa1339580:CDS |
| ACGCTATGAAGTTGATCCAG+CGG | 0.687155 | tig0003359:-2656 | Msa1339580:CDS |
| TGGCCTAGTGATGAAGACAA+AGG | 0.708445 | tig0003359:-2763 | Msa1339580:CDS |
| GCAGCATTAATCATCATGGG+AGG | 0.708531 | tig0003359:-2889 | None:intergenic |
| GATGAAGACAAAGGTAACTG+GGG | 0.719672 | tig0003359:-2754 | Msa1339580:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| AAACTCGATTCTTGTATTTG+CGG | + | tig0003359:2839-2858 | None:intergenic | 30.0% | |
| ! | TCAAAGAATAAGTCTAGAGC+AGG | - | tig0003359:2711-2730 | Msa1339580:CDS | 35.0% |
| TTACCTTTGTCTTCATCACT+AGG | + | tig0003359:2768-2787 | None:intergenic | 35.0% | |
| TGATGAAGACAAAGGTAACT+GGG | - | tig0003359:2770-2789 | Msa1339580:CDS | 35.0% | |
| TCAGCTCTCATGTTAATGTT+AGG | + | tig0003359:2807-2826 | None:intergenic | 35.0% | |
| GGTAAGACTAAGTCTTCTTC+AGG | - | tig0003359:2660-2679 | Msa1339580:CDS | 40.0% | |
| GCAGGATACTATGATGATTG+CGG | - | tig0003359:2729-2748 | Msa1339580:CDS | 40.0% | |
| GTGATGAAGACAAAGGTAAC+TGG | - | tig0003359:2769-2788 | Msa1339580:CDS | 40.0% | |
| GATGAAGACAAAGGTAACTG+GGG | - | tig0003359:2771-2790 | Msa1339580:CDS | 40.0% | |
| TGGATCAACTTCATAGCGTT+CGG | + | tig0003359:2868-2887 | None:intergenic | 40.0% | |
| ATGATTGCGGATGCAAGACA+TGG | - | tig0003359:2742-2761 | Msa1339580:CDS | 45.0% | |
| TGGCCTAGTGATGAAGACAA+AGG | - | tig0003359:2762-2781 | Msa1339580:CDS | 45.0% | |
| ! | ACGCTATGAAGTTGATCCAG+CGG | - | tig0003359:2869-2888 | Msa1339580:CDS | 45.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| tig0003359 | gene | 2651 | 2896 | 2651 | ID=Msa1339580;Name=Msa1339580 |
| tig0003359 | mRNA | 2651 | 2896 | 2651 | ID=Msa1339580-mRNA-1;Parent=Msa1339580;Name=Msa1339580-mRNA-1;_AED=0.39;_eAED=0.39;_QI=0|-1|0|1|-1|1|1|0|81 |
| tig0003359 | exon | 2651 | 2896 | 2651 | ID=Msa1339580-mRNA-1:exon:2242;Parent=Msa1339580-mRNA-1 |
| tig0003359 | CDS | 2651 | 2896 | 2651 | ID=Msa1339580-mRNA-1:cds;Parent=Msa1339580-mRNA-1 |
| Gene Sequence |
| Protein sequence |
