Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0143540 | XP_013447974.1 | 100.000 | 69 | 0 | 0 | 1 | 69 | 1 | 69 | 1.10e-40 | 137 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0143540 | I3SYL4 | 100.000 | 69 | 0 | 0 | 1 | 69 | 1 | 69 | 5.27e-41 | 137 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0048000 | Msa0143540 | 0.811768 | 5.935291e-51 | -8.615850e-47 |
| Msa0077450 | Msa0143540 | 0.803117 | 4.063118e-49 | -8.615850e-47 |
| Msa0085960 | Msa0143540 | 0.802510 | 5.422690e-49 | -8.615850e-47 |
| Msa0143540 | Msa0170140 | 0.817291 | 3.559445e-52 | -8.615850e-47 |
| Msa0143540 | Msa0170570 | 0.814617 | 1.406683e-51 | -8.615850e-47 |
| Msa0143540 | Msa0173070 | 0.807828 | 4.176466e-50 | -8.615850e-47 |
| Msa0143540 | Msa0195630 | 0.812722 | 3.675488e-51 | -8.615850e-47 |
| Msa0143540 | Msa0237410 | 0.820702 | 5.964037e-53 | -8.615850e-47 |
| Msa0143540 | Msa0243710 | 0.801753 | 7.760839e-49 | -8.615850e-47 |
| Msa0143540 | Msa0259500 | 0.812435 | 4.246231e-51 | -8.615850e-47 |
| Msa0143540 | Msa0286670 | 0.804945 | 1.692669e-49 | -8.615850e-47 |
| Msa0143540 | Msa0305700 | 0.820426 | 6.902332e-53 | -8.615850e-47 |
| Msa0143540 | Msa0334360 | 0.823838 | 1.116696e-53 | -8.615850e-47 |
| Msa0143540 | Msa0341540 | 0.817073 | 3.983154e-52 | -8.615850e-47 |
| Msa0143540 | Msa0564130 | 0.802278 | 6.052756e-49 | -8.615850e-47 |
| Msa0143540 | Msa0572420 | 0.810149 | 1.330273e-50 | -8.615850e-47 |
| Msa0143540 | Msa0700650 | 0.824575 | 7.491956e-54 | -8.615850e-47 |
| Msa0143540 | Msa0721280 | 0.819832 | 9.442734e-53 | -8.615850e-47 |
| Msa0143540 | Msa0773590 | 0.812167 | 4.857584e-51 | -8.615850e-47 |
| Msa0143540 | Msa0811040 | 0.803731 | 3.030290e-49 | -8.615850e-47 |
| Msa0143540 | Msa0820770 | 0.801471 | 8.866749e-49 | -8.615850e-47 |
| Msa0143540 | Msa0861090 | 0.802313 | 5.952388e-49 | -8.615850e-47 |
| Msa0143540 | Msa0861540 | 0.813308 | 2.733330e-51 | -8.615850e-47 |
| Msa0143540 | Msa0957870 | 0.808676 | 2.755100e-50 | -8.615850e-47 |
| Msa0143540 | Msa0962840 | 0.800628 | 1.318389e-48 | -8.615850e-47 |
| Msa0143540 | Msa0974060 | 0.808627 | 2.822470e-50 | -8.615850e-47 |
| Msa0143540 | Msa0980880 | 0.816347 | 5.795850e-52 | -8.615850e-47 |
| Msa0143540 | Msa1045180 | 0.985320 | 3.356021e-163 | -8.615850e-47 |
| Msa0143540 | Msa1080160 | 0.805915 | 1.059900e-49 | -8.615850e-47 |
| Msa0143540 | Msa1087980 | 0.804520 | 2.077084e-49 | -8.615850e-47 |
| Msa0143540 | Msa1094190 | 0.812495 | 4.119702e-51 | -8.615850e-47 |
| Msa0143540 | Msa1161150 | 0.801760 | 7.733100e-49 | -8.615850e-47 |
| Msa0143540 | Msa1256470 | 0.804317 | 2.289373e-49 | -8.615850e-47 |
| Msa0143540 | Msa1353470 | 0.824215 | 9.108693e-54 | -8.615850e-47 |
| Msa0143540 | Msa1357890 | 0.814705 | 1.344348e-51 | -8.615850e-47 |
| Msa0143540 | Msa1366300 | 0.812648 | 3.813775e-51 | -8.615850e-47 |
| Msa0143540 | Msa1371240 | 0.802898 | 4.509855e-49 | -8.615850e-47 |
| Msa0143540 | Msa1398090 | 0.813735 | 2.202156e-51 | -8.615850e-47 |
| Msa0143540 | Msa1404940 | 0.803155 | 3.989929e-49 | -8.615850e-47 |
| Msa0143540 | Msa1422580 | 0.809034 | 2.310222e-50 | -8.615850e-47 |
| Msa0143540 | Msa1458610 | 0.803371 | 3.599529e-49 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0143540 | MtrunA17_Chr7g0225151 | 100.000 | 69 | 0 | 0 | 1 | 69 | 1 | 69 | 1.01e-44 | 137 |
| Msa0143540 | MtrunA17_Chr7g0225011 | 47.761 | 67 | 35 | 0 | 1 | 67 | 1 | 67 | 8.23e-19 | 72.4 |
| Msa0143540 | MtrunA17_Chr8g0386301 | 44.776 | 67 | 37 | 0 | 1 | 67 | 1 | 67 | 2.28e-18 | 71.2 |
| Msa0143540 | MtrunA17_Chr3g0122331 | 46.970 | 66 | 35 | 0 | 1 | 66 | 1 | 66 | 2.63e-18 | 70.9 |
| Msa0143540 | MtrunA17_Chr8g0377511 | 42.647 | 68 | 39 | 0 | 1 | 68 | 1 | 68 | 3.65e-18 | 70.5 |
| Msa0143540 | MtrunA17_Chr7g0224981 | 45.455 | 66 | 36 | 0 | 1 | 66 | 1 | 66 | 1.15e-16 | 67.0 |
| Msa0143540 | MtrunA17_Chr7g0224941 | 45.455 | 66 | 36 | 0 | 1 | 66 | 1 | 66 | 1.15e-16 | 67.0 |
| Msa0143540 | MtrunA17_Chr8g0347211 | 39.706 | 68 | 41 | 0 | 1 | 68 | 1 | 68 | 2.13e-16 | 66.2 |
| Msa0143540 | MtrunA17_Chr3g0122341 | 42.647 | 68 | 39 | 0 | 1 | 68 | 1 | 68 | 2.15e-16 | 66.2 |
| Msa0143540 | MtrunA17_Chr7g0225171 | 38.806 | 67 | 41 | 0 | 1 | 67 | 1 | 67 | 6.28e-15 | 62.4 |
| Msa0143540 | MtrunA17_Chr7g0225041 | 38.462 | 65 | 40 | 0 | 3 | 67 | 4 | 68 | 2.05e-14 | 61.2 |
| Msa0143540 | MtrunA17_Chr7g0225141 | 40.299 | 67 | 40 | 0 | 1 | 67 | 1 | 67 | 4.86e-14 | 60.1 |
| Msa0143540 | MtrunA17_Chr7g0225061 | 35.385 | 65 | 42 | 0 | 3 | 67 | 4 | 68 | 1.91e-13 | 58.5 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0143540 | AT5G40960.1 | 71.642 | 67 | 19 | 0 | 1 | 67 | 1 | 67 | 4.54e-25 | 88.6 |
| Msa0143540 | AT5G08391.1 | 42.647 | 68 | 39 | 0 | 1 | 68 | 1 | 68 | 3.21e-17 | 68.6 |
| Msa0143540 | AT3G48660.1 | 43.284 | 67 | 38 | 0 | 1 | 67 | 1 | 67 | 3.90e-17 | 68.9 |
| Msa0143540 | AT5G63500.1 | 43.284 | 67 | 38 | 0 | 1 | 67 | 1 | 67 | 2.36e-16 | 66.2 |
| Msa0143540 | AT3G27027.1 | 37.879 | 66 | 41 | 0 | 2 | 67 | 3 | 68 | 2.74e-14 | 61.2 |
| Msa0143540 | AT5G14110.1 | 37.879 | 66 | 41 | 0 | 3 | 68 | 4 | 69 | 1.53e-13 | 59.3 |
| Msa0143540 | AT5G40980.1 | 51.020 | 49 | 24 | 0 | 3 | 51 | 4 | 52 | 1.96e-13 | 58.9 |
| Msa0143540 | AT3G27030.1 | 40.299 | 67 | 40 | 0 | 1 | 67 | 74 | 140 | 2.28e-13 | 60.8 |
| Msa0143540 | AT3G27030.1 | 36.364 | 66 | 42 | 0 | 1 | 66 | 1 | 66 | 1.41e-11 | 56.2 |
| Msa0143540 | AT3G01950.1 | 38.462 | 65 | 40 | 0 | 3 | 67 | 4 | 68 | 6.99e-13 | 57.8 |
Find 9 sgRNAs with CRISPR-Local
Find 11 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| TTTGTACACACTGTTCTTTA+TGG | 0.216202 | 1_4:+2472077 | Msa0143540:CDS |
| AGGGATAGACAATGAATAAT+TGG | 0.218789 | 1_4:+2471934 | None:intergenic |
| TCATAGCTGCAGCTCTATTT+TGG | 0.248610 | 1_4:+2471967 | Msa0143540:CDS |
| GGGATAGACAATGAATAATT+GGG | 0.433197 | 1_4:+2471935 | None:intergenic |
| TCCAATGGTGAATTCTTCCC+TGG | 0.455815 | 1_4:-2472020 | None:intergenic |
| TCCAGGGAAGAATTCACCAT+TGG | 0.544316 | 1_4:+2472019 | Msa0143540:CDS |
| TTCATATTCATAAACTCCAA+TGG | 0.593728 | 1_4:-2472035 | None:intergenic |
| AATAGAGCTGCAGCTATGAG+AGG | 0.636515 | 1_4:-2471963 | None:intergenic |
| AGAGCTGCAGCTATGAGAGG+AGG | 0.659838 | 1_4:-2471960 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| ! | TTCATATTCATAAACTCCAA+TGG | - | chr1_4:2472038-2472057 | None:intergenic | 25.0% |
| TTTGTACACACTGTTCTTTA+TGG | + | chr1_4:2472077-2472096 | Msa0143540:CDS | 30.0% | |
| !!! | CTATTTTGGCTATTATCACC+AGG | + | chr1_4:2471981-2472000 | Msa0143540:CDS | 35.0% |
| !! | GAATGATTTTTCAGCTTCCA+GGG | + | chr1_4:2472003-2472022 | Msa0143540:CDS | 35.0% |
| ! | TCATAGCTGCAGCTCTATTT+TGG | + | chr1_4:2471967-2471986 | Msa0143540:CDS | 40.0% |
| GGAAGCTGAAAAATCATTCC+TGG | - | chr1_4:2472002-2472021 | None:intergenic | 40.0% | |
| !! | GGAATGATTTTTCAGCTTCC+AGG | + | chr1_4:2472002-2472021 | Msa0143540:CDS | 40.0% |
| AATAGAGCTGCAGCTATGAG+AGG | - | chr1_4:2471966-2471985 | None:intergenic | 45.0% | |
| TCCAGGGAAGAATTCACCAT+TGG | + | chr1_4:2472019-2472038 | Msa0143540:CDS | 45.0% | |
| TCCAATGGTGAATTCTTCCC+TGG | - | chr1_4:2472023-2472042 | None:intergenic | 45.0% | |
| AGAGCTGCAGCTATGAGAGG+AGG | - | chr1_4:2471963-2471982 | None:intergenic | 55.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| chr1_4 | gene | 2471945 | 2472154 | 2471945 | ID=Msa0143540;Name=Msa0143540 |
| chr1_4 | mRNA | 2471945 | 2472154 | 2471945 | ID=Msa0143540-mRNA-1;Parent=Msa0143540;Name=Msa0143540-mRNA-1;_AED=0.04;_eAED=0.04;_QI=0|-1|0|1|-1|1|1|0|69 |
| chr1_4 | exon | 2471945 | 2472154 | 2471945 | ID=Msa0143540-mRNA-1:exon:1060;Parent=Msa0143540-mRNA-1 |
| chr1_4 | CDS | 2471945 | 2472154 | 2471945 | ID=Msa0143540-mRNA-1:cds;Parent=Msa0143540-mRNA-1 |
| Gene Sequence |
| Protein sequence |
