Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1394050 | RDY14692.1 | 93.103 | 58 | 4 | 0 | 1 | 58 | 43 | 100 | 8.53e-31 | 113 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1394050 | sp|P62104|PSBI_WHEAT | 97.222 | 36 | 1 | 0 | 23 | 58 | 1 | 36 | 1.25e-18 | 73.2 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1394050 | A0A371II05 | 93.103 | 58 | 4 | 0 | 1 | 58 | 43 | 100 | 4.08e-31 | 113 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0095200 | Msa1394050 | 0.807757 | 4.324579e-50 | -8.615850e-47 |
| Msa1354890 | Msa1394050 | 0.844718 | 6.356007e-59 | -8.615850e-47 |
| Msa1355060 | Msa1394050 | 0.855066 | 8.092028e-62 | -8.615850e-47 |
| Msa1380580 | Msa1394050 | 0.800134 | 1.662071e-48 | -8.615850e-47 |
| Msa1394050 | Msa1394140 | 0.824889 | 6.318625e-54 | -8.615850e-47 |
| Msa1394050 | Msa1394240 | 0.865532 | 5.515126e-65 | -8.615850e-47 |
| Msa1394050 | Msa1422750 | 0.805201 | 1.496819e-49 | -8.615850e-47 |
| Msa0772210 | Msa1394050 | 0.804269 | 2.342052e-49 | -8.615850e-47 |
| Msa0983710 | Msa1394050 | 0.835212 | 1.913332e-56 | -8.615850e-47 |
| Msa1002040 | Msa1394050 | 0.801233 | 9.918013e-49 | -8.615850e-47 |
| Msa1030280 | Msa1394050 | 0.818340 | 2.062912e-52 | -8.615850e-47 |
| Msa1086060 | Msa1394050 | 0.842364 | 2.705949e-58 | -8.615850e-47 |
| Msa1086160 | Msa1394050 | 0.814273 | 1.675690e-51 | -8.615850e-47 |
| Msa1086170 | Msa1394050 | 0.852748 | 3.765889e-61 | -8.615850e-47 |
| Msa1086290 | Msa1394050 | 0.808310 | 3.297639e-50 | -8.615850e-47 |
| Msa1086370 | Msa1394050 | 0.821984 | 3.018361e-53 | -8.615850e-47 |
| Msa1086870 | Msa1394050 | 0.826075 | 3.309814e-54 | -8.615850e-47 |
| Msa1091690 | Msa1394050 | 0.806394 | 8.403868e-50 | -8.615850e-47 |
| Msa0268180 | Msa1394050 | 0.822695 | 2.064568e-53 | -8.615850e-47 |
| Msa0268380 | Msa1394050 | 0.846932 | 1.592032e-59 | -8.615850e-47 |
| Msa0268420 | Msa1394050 | 0.819326 | 1.231634e-52 | -8.615850e-47 |
| Msa0268540 | Msa1394050 | 0.817181 | 3.767876e-52 | -8.615850e-47 |
| Msa0268650 | Msa1394050 | 0.800098 | 1.690428e-48 | -8.615850e-47 |
| Msa0268730 | Msa1394050 | 0.809550 | 1.790388e-50 | -8.615850e-47 |
| Msa0268850 | Msa1394050 | 0.821691 | 3.529778e-53 | -8.615850e-47 |
| Msa0268930 | Msa1394050 | 0.810450 | 1.145659e-50 | -8.615850e-47 |
| Msa0269060 | Msa1394050 | 0.820066 | 8.347446e-53 | -8.615850e-47 |
| Msa0306130 | Msa1394050 | 0.801684 | 8.015620e-49 | -8.615850e-47 |
| Msa1120540 | Msa1394050 | 0.810934 | 9.005078e-51 | -8.615850e-47 |
| Msa1143150 | Msa1394050 | 0.816759 | 4.686889e-52 | -8.615850e-47 |
| Msa0582530 | Msa1394050 | 0.846238 | 2.462964e-59 | -8.615850e-47 |
| Msa0582620 | Msa1394050 | 0.839571 | 1.463409e-57 | -8.615850e-47 |
| Msa0582710 | Msa1394050 | 0.839462 | 1.562126e-57 | -8.615850e-47 |
| Msa0582740 | Msa1394050 | 0.850174 | 2.013758e-60 | -8.615850e-47 |
| Msa0582830 | Msa1394050 | 0.821588 | 3.727142e-53 | -8.615850e-47 |
| Msa0582900 | Msa1394050 | 0.837177 | 6.061052e-57 | -8.615850e-47 |
| Msa0924860 | Msa1394050 | 0.848857 | 4.689810e-60 | -8.615850e-47 |
| Msa0931090 | Msa1394050 | 0.834994 | 2.172441e-56 | -8.615850e-47 |
| Msa0931200 | Msa1394050 | 0.814484 | 1.505065e-51 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1394050 | ATCG00080.1 | 97.222 | 36 | 1 | 0 | 23 | 58 | 1 | 36 | 1.27e-19 | 73.2 |
Find 5 sgRNAs with CRISPR-Local
Find 30 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| ACTGGCATAAAATCTACAAT+TGG | 0.453871 | tig0021785:+8346 | None:intergenic |
| AATGATCCAGGACGTAATCC+TGG | 0.474800 | tig0021785:-7799 | Msa1394050:CDS |
| GGATTCCTATCTAATGATCC+AGG | 0.536202 | tig0021785:-7811 | Msa1394050:CDS |
| TCACGTCCAGGATTACGTCC+TGG | 0.548081 | tig0021785:+7793 | None:intergenic |
| TACGTCCTGGATCATTAGAT+AGG | 0.581605 | tig0021785:+7806 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !!! | ATTCCAAATATTAAAATTTT+TGG | - | tig0021785:8062-8081 | Msa1394050:intron | 10.0% |
| !!! | TATCCAAAAATTTTAATATT+TGG | + | tig0021785:8068-8087 | None:intergenic | 10.0% |
| !! | ATTTCAAAAAAAAAAAACTT+AGG | + | tig0021785:8219-8238 | None:intergenic | 10.0% |
| !!! | AATTTTAATATTTGGAATCA+AGG | + | tig0021785:8060-8079 | None:intergenic | 15.0% |
| !!! | CGTTTTTTTTTTAATTATCT+TGG | - | tig0021785:8314-8333 | Msa1394050:CDS | 15.0% |
| !! | AAAAACACTACTTGAATAAA+GGG | + | tig0021785:7817-7836 | None:intergenic | 20.0% |
| !! | AAAAAACACTACTTGAATAA+AGG | + | tig0021785:7818-7837 | None:intergenic | 20.0% |
| !! | TGAAAATTCTATTATTCGAT+TGG | - | tig0021785:8106-8125 | Msa1394050:intron | 20.0% |
| !!! | TGTGGATATGAAAAAAATTT+TGG | - | tig0021785:8157-8176 | Msa1394050:intron | 20.0% |
| !! | TCTTATAAACTTAGTATCAA+AGG | - | tig0021785:8248-8267 | Msa1394050:intron | 20.0% |
| !!! | ATTCAAGTAGTGTTTTTTCT+TGG | - | tig0021785:7820-7839 | Msa1394050:CDS | 25.0% |
| !!! | TTTTTCTCTTAGCTTTTGTT+TGG | - | tig0021785:7912-7931 | Msa1394050:intron | 25.0% |
| !!! | TTTGTTTCTCTTTTCATCTT+CGG | - | tig0021785:8389-8408 | Msa1394050:five_prime_UTR | 25.0% |
| ! | AATTGGATTCAAAAAAGCGT+AGG | + | tig0021785:7861-7880 | None:intergenic | 30.0% |
| ACTGGCATAAAATCTACAAT+TGG | + | tig0021785:7878-7897 | None:intergenic | 30.0% | |
| !! | AAAAAGAGTAAGGGTATTAC+TGG | + | tig0021785:7896-7915 | None:intergenic | 30.0% |
| GCTAAGAGAAAAAAGAGTAA+GGG | + | tig0021785:7905-7924 | None:intergenic | 30.0% | |
| AGCTAAGAGAAAAAAGAGTA+AGG | + | tig0021785:7906-7925 | None:intergenic | 30.0% | |
| !! | AATCAAGATCTAGGTATTGG+TGG | + | tig0021785:8138-8157 | None:intergenic | 35.0% |
| CACAATCAAGATCTAGGTAT+TGG | + | tig0021785:8141-8160 | None:intergenic | 35.0% | |
| CAATACCTAGATCTTGATTG+TGG | - | tig0021785:8139-8158 | Msa1394050:intron | 35.0% | |
| CATATCCACAATCAAGATCT+AGG | + | tig0021785:8147-8166 | None:intergenic | 35.0% | |
| GAGAATCTATTCTCTTTCTC+TGG | - | tig0021785:8291-8310 | Msa1394050:intron | 35.0% | |
| ! | TTCAAAAAAGCGTAGGCTTC+AGG | + | tig0021785:7854-7873 | None:intergenic | 40.0% |
| GGATTCCTATCTAATGATCC+AGG | - | tig0021785:8410-8429 | Msa1394050:intron | 40.0% | |
| TACGTCCTGGATCATTAGAT+AGG | + | tig0021785:8418-8437 | None:intergenic | 40.0% | |
| !! | CAAGATCTAGGTATTGGTGG+TGG | + | tig0021785:8135-8154 | None:intergenic | 45.0% |
| AATGATCCAGGACGTAATCC+TGG | - | tig0021785:8422-8441 | Msa1394050:intron | 45.0% | |
| !!! | AATAAATTCTTAATTTTTTT+CGG | + | tig0021785:7983-8002 | None:intergenic | 5.0% |
| TCACGTCCAGGATTACGTCC+TGG | + | tig0021785:8431-8450 | None:intergenic | 55.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| tig0021785 | gene | 7789 | 8454 | 7789 | ID=Msa1394050;Name=Msa1394050 |
| tig0021785 | mRNA | 7789 | 8454 | 7789 | ID=Msa1394050-mRNA-1;Parent=Msa1394050;Name=Msa1394050-mRNA-1;_AED=0.46;_eAED=0.61;_QI=67|0|0|1|0|0|3|0|58 |
| tig0021785 | exon | 8448 | 8454 | 8448 | ID=Msa1394050-mRNA-1:exon:14258;Parent=Msa1394050-mRNA-1 |
| tig0021785 | exon | 8296 | 8413 | 8296 | ID=Msa1394050-mRNA-1:exon:14257;Parent=Msa1394050-mRNA-1 |
| tig0021785 | exon | 7789 | 7904 | 7789 | ID=Msa1394050-mRNA-1:exon:14256;Parent=Msa1394050-mRNA-1 |
| tig0021785 | five_prime_UTR | 8448 | 8454 | 8448 | ID=Msa1394050-mRNA-1:five_prime_utr;Parent=Msa1394050-mRNA-1 |
| tig0021785 | five_prime_UTR | 8354 | 8413 | 8354 | ID=Msa1394050-mRNA-1:five_prime_utr;Parent=Msa1394050-mRNA-1 |
| tig0021785 | CDS | 8296 | 8353 | 8296 | ID=Msa1394050-mRNA-1:cds;Parent=Msa1394050-mRNA-1 |
| tig0021785 | CDS | 7789 | 7904 | 7789 | ID=Msa1394050-mRNA-1:cds;Parent=Msa1394050-mRNA-1 |
| Gene Sequence |
| Protein sequence |
