Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa1143150 | RDY14692.1 | 90.722 | 97 | 9 | 0 | 1 | 97 | 4 | 100 | 7.75e-56 | 178 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa1143150 | sp|Q49L15|PSBK_EUCGG | 91.667 | 60 | 5 | 0 | 1 | 60 | 1 | 60 | 1.80e-32 | 110 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa1143150 | A0A371II05 | 90.722 | 97 | 9 | 0 | 1 | 97 | 4 | 100 | 3.70e-56 | 178 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
Msa0095140 | Msa1143150 | 0.802291 | 6.015502e-49 | -8.615850e-47 |
Msa0095180 | Msa1143150 | 0.829951 | 3.862167e-55 | -8.615850e-47 |
Msa0095270 | Msa1143150 | 0.805840 | 1.099001e-49 | -8.615850e-47 |
Msa0983710 | Msa1143150 | 0.832879 | 7.347300e-56 | -8.615850e-47 |
Msa0992570 | Msa1143150 | 0.804011 | 2.650302e-49 | -8.615850e-47 |
Msa1030280 | Msa1143150 | 0.832873 | 7.373104e-56 | -8.615850e-47 |
Msa1086060 | Msa1143150 | 0.843966 | 1.012140e-58 | -8.615850e-47 |
Msa1086160 | Msa1143150 | 0.819641 | 1.043834e-52 | -8.615850e-47 |
Msa1086170 | Msa1143150 | 0.868849 | 4.807257e-66 | -8.615850e-47 |
Msa1086290 | Msa1143150 | 0.845074 | 5.094182e-59 | -8.615850e-47 |
Msa1086370 | Msa1143150 | 0.857140 | 1.999343e-62 | -8.615850e-47 |
Msa1086440 | Msa1143150 | 0.837659 | 4.561832e-57 | -8.615850e-47 |
Msa1086480 | Msa1143150 | 0.815437 | 9.247421e-52 | -8.615850e-47 |
Msa1086870 | Msa1143150 | 0.825076 | 5.710387e-54 | -8.615850e-47 |
Msa1091690 | Msa1143150 | 0.801253 | 9.822638e-49 | -8.615850e-47 |
Msa0268180 | Msa1143150 | 0.830407 | 2.988453e-55 | -8.615850e-47 |
Msa0268380 | Msa1143150 | 0.855992 | 4.348126e-62 | -8.615850e-47 |
Msa0268420 | Msa1143150 | 0.832352 | 9.926323e-56 | -8.615850e-47 |
Msa0268540 | Msa1143150 | 0.835686 | 1.451995e-56 | -8.615850e-47 |
Msa0268650 | Msa1143150 | 0.837336 | 5.521050e-57 | -8.615850e-47 |
Msa0268730 | Msa1143150 | 0.850317 | 1.835716e-60 | -8.615850e-47 |
Msa0268850 | Msa1143150 | 0.824834 | 6.510208e-54 | -8.615850e-47 |
Msa0268930 | Msa1143150 | 0.827436 | 1.566342e-54 | -8.615850e-47 |
Msa0269060 | Msa1143150 | 0.829262 | 5.680638e-55 | -8.615850e-47 |
Msa0344290 | Msa1143150 | 0.803836 | 2.881850e-49 | -8.615850e-47 |
Msa1143140 | Msa1143150 | 0.804016 | 2.644432e-49 | -8.615850e-47 |
Msa1143150 | Msa1354890 | 0.873418 | 1.493472e-67 | -8.615850e-47 |
Msa1143150 | Msa1355060 | 0.830483 | 2.863265e-55 | -8.615850e-47 |
Msa1143150 | Msa1380580 | 0.837625 | 4.653331e-57 | -8.615850e-47 |
Msa1143150 | Msa1394050 | 0.816759 | 4.686889e-52 | -8.615850e-47 |
Msa1143150 | Msa1394140 | 0.835505 | 1.613880e-56 | -8.615850e-47 |
Msa1143150 | Msa1394240 | 0.831128 | 1.989514e-55 | -8.615850e-47 |
Msa0582530 | Msa1143150 | 0.804424 | 2.174291e-49 | -8.615850e-47 |
Msa0582620 | Msa1143150 | 0.819801 | 9.595093e-53 | -8.615850e-47 |
Msa0582740 | Msa1143150 | 0.865988 | 3.958551e-65 | -8.615850e-47 |
Msa0582830 | Msa1143150 | 0.808936 | 2.424626e-50 | -8.615850e-47 |
Msa0582900 | Msa1143150 | 0.834527 | 2.846945e-56 | -8.615850e-47 |
Msa0924860 | Msa1143150 | 0.806652 | 7.411760e-50 | -8.615850e-47 |
Msa0931090 | Msa1143150 | 0.813430 | 2.569481e-51 | -8.615850e-47 |
Msa0931150 | Msa1143150 | 0.832573 | 8.749636e-56 | -8.615850e-47 |
Msa0931200 | Msa1143150 | 0.821930 | 3.107607e-53 | -8.615850e-47 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa1143150 | MtrunA17_Chr4g0015681 | 96.667 | 60 | 2 | 0 | 1 | 60 | 1 | 60 | 7.64e-35 | 113 |
Msa1143150 | MtrunA17_CPg0492901 | 96.667 | 60 | 2 | 0 | 1 | 60 | 1 | 60 | 7.64e-35 | 113 |
Msa1143150 | MtrunA17_Chr4g0016771 | 96.667 | 60 | 2 | 0 | 1 | 60 | 1 | 60 | 7.64e-35 | 113 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa1143150 | ATCG00070.1 | 76.667 | 60 | 14 | 0 | 1 | 60 | 1 | 60 | 3.76e-26 | 92.0 |
Msa1143150 | ATCG00080.1 | 97.222 | 36 | 1 | 0 | 62 | 97 | 1 | 36 | 2.92e-19 | 73.9 |
Find 6 sgRNAs with CRISPR-Local
Find 30 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TATGCTTAATATCTTTAGCT+TGG | 0.440922 | 7_4:+18353286 | None:intergenic |
ACTGGCATAAAATCTACAAT+TGG | 0.453871 | 7_4:-18353389 | None:intergenic |
AATGATCCAGGACGTAATCC+TGG | 0.474800 | 7_4:+18353936 | Msa1143150:CDS |
GGATTCCTATCTAATGATCC+AGG | 0.536202 | 7_4:+18353924 | Msa1143150:CDS |
TCACGTCCAGGATTACGTCC+TGG | 0.548081 | 7_4:-18353942 | None:intergenic |
TACGTCCTGGATCATTAGAT+AGG | 0.581605 | 7_4:-18353929 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!!! | ATTCCAAATATTAAAATTTT+TGG | + | chr7_4:18353576-18353595 | Msa1143150:intron | 10.0% |
!!! | TATCCAAAAATTTTAATATT+TGG | - | chr7_4:18353582-18353601 | None:intergenic | 10.0% |
!! | ATTTCAAAAAAAAAAAACTT+AGG | - | chr7_4:18353733-18353752 | None:intergenic | 10.0% |
!!! | AATTTTAATATTTGGAATCA+AGG | - | chr7_4:18353574-18353593 | None:intergenic | 15.0% |
!!! | CGTTTTTTTTTTAATTATCT+TGG | + | chr7_4:18353828-18353847 | Msa1143150:intron | 15.0% |
!! | GAAAAAACTACTTGAATAAA+GGG | - | chr7_4:18353333-18353352 | None:intergenic | 20.0% |
!! | AGAAAAAACTACTTGAATAA+AGG | - | chr7_4:18353334-18353353 | None:intergenic | 20.0% |
!!! | TTATTCAAGTAGTTTTTTCT+TGG | + | chr7_4:18353334-18353353 | Msa1143150:CDS | 20.0% |
!! | TGAAAATTCTATTATTCGAT+TGG | + | chr7_4:18353620-18353639 | Msa1143150:intron | 20.0% |
!!! | TGTGGATATGAAAAAAATTT+TGG | + | chr7_4:18353671-18353690 | Msa1143150:intron | 20.0% |
!! | TCTTATAAACTTAGTATCAA+AGG | + | chr7_4:18353762-18353781 | Msa1143150:intron | 20.0% |
!!! | TTTTTCTCTTAGCTTTTGTT+TGG | + | chr7_4:18353426-18353445 | Msa1143150:CDS | 25.0% |
!!! | TTTGTTTCTCTTTTCATCTT+CGG | + | chr7_4:18353903-18353922 | Msa1143150:CDS | 25.0% |
! | AATTGGATTCAAAAAAGCGT+AGG | - | chr7_4:18353375-18353394 | None:intergenic | 30.0% |
ACTGGCATAAAATCTACAAT+TGG | - | chr7_4:18353392-18353411 | None:intergenic | 30.0% | |
!! | AAAAAGAGTAAGGGTATTAC+TGG | - | chr7_4:18353410-18353429 | None:intergenic | 30.0% |
GCTAAGAGAAAAAAGAGTAA+GGG | - | chr7_4:18353419-18353438 | None:intergenic | 30.0% | |
AGCTAAGAGAAAAAAGAGTA+AGG | - | chr7_4:18353420-18353439 | None:intergenic | 30.0% | |
!! | AATCAAGATCTAGGTATTGG+TGG | - | chr7_4:18353652-18353671 | None:intergenic | 35.0% |
CACAATCAAGATCTAGGTAT+TGG | - | chr7_4:18353655-18353674 | None:intergenic | 35.0% | |
CAATACCTAGATCTTGATTG+TGG | + | chr7_4:18353653-18353672 | Msa1143150:intron | 35.0% | |
CATATCCACAATCAAGATCT+AGG | - | chr7_4:18353661-18353680 | None:intergenic | 35.0% | |
GAGAATCTATTCTCTTTCTC+TGG | + | chr7_4:18353805-18353824 | Msa1143150:intron | 35.0% | |
! | TTCAAAAAAGCGTAGGCTTC+AGG | - | chr7_4:18353368-18353387 | None:intergenic | 40.0% |
GGATTCCTATCTAATGATCC+AGG | + | chr7_4:18353924-18353943 | Msa1143150:CDS | 40.0% | |
TACGTCCTGGATCATTAGAT+AGG | - | chr7_4:18353932-18353951 | None:intergenic | 40.0% | |
!! | CAAGATCTAGGTATTGGTGG+TGG | - | chr7_4:18353649-18353668 | None:intergenic | 45.0% |
AATGATCCAGGACGTAATCC+TGG | + | chr7_4:18353936-18353955 | Msa1143150:CDS | 45.0% | |
!!! | AATAAATTCTTAATTTTTTT+CGG | - | chr7_4:18353497-18353516 | None:intergenic | 5.0% |
TCACGTCCAGGATTACGTCC+TGG | - | chr7_4:18353945-18353964 | None:intergenic | 55.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
chr7_4 | gene | 18353287 | 18353971 | 18353287 | ID=Msa1143150;Name=Msa1143150 |
chr7_4 | mRNA | 18353287 | 18353971 | 18353287 | ID=Msa1143150-mRNA-1;Parent=Msa1143150;Name=Msa1143150-mRNA-1;_AED=0.50;_eAED=0.50;_QI=0|0|0|1|0|0|2|0|97 |
chr7_4 | exon | 18353287 | 18353461 | 18353287 | ID=Msa1143150-mRNA-1:exon:4100;Parent=Msa1143150-mRNA-1 |
chr7_4 | exon | 18353853 | 18353971 | 18353853 | ID=Msa1143150-mRNA-1:exon:4101;Parent=Msa1143150-mRNA-1 |
chr7_4 | CDS | 18353287 | 18353461 | 18353287 | ID=Msa1143150-mRNA-1:cds;Parent=Msa1143150-mRNA-1 |
chr7_4 | CDS | 18353853 | 18353971 | 18353853 | ID=Msa1143150-mRNA-1:cds;Parent=Msa1143150-mRNA-1 |
Gene Sequence |
Protein sequence |