Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1380580 | RDY14692.1 | 90.722 | 97 | 9 | 0 | 1 | 97 | 4 | 100 | 7.75e-56 | 178 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1380580 | sp|Q49L15|PSBK_EUCGG | 91.667 | 60 | 5 | 0 | 1 | 60 | 1 | 60 | 1.80e-32 | 110 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1380580 | A0A371II05 | 90.722 | 97 | 9 | 0 | 1 | 97 | 4 | 100 | 3.70e-56 | 178 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0095200 | Msa1380580 | 0.821774 | 3.375969e-53 | -8.615850e-47 |
| Msa1354890 | Msa1380580 | 0.855664 | 5.418988e-62 | -8.615850e-47 |
| Msa1355060 | Msa1380580 | 0.821899 | 3.158633e-53 | -8.615850e-47 |
| Msa1367940 | Msa1380580 | 0.805223 | 1.480903e-49 | -8.615850e-47 |
| Msa1380580 | Msa1394050 | 0.800134 | 1.662071e-48 | -8.615850e-47 |
| Msa1380580 | Msa1394140 | 0.806926 | 6.487254e-50 | -8.615850e-47 |
| Msa1380580 | Msa1394240 | 0.805116 | 1.559393e-49 | -8.615850e-47 |
| Msa0640880 | Msa1380580 | 0.802192 | 6.302805e-49 | -8.615850e-47 |
| Msa0739570 | Msa1380580 | 0.805590 | 1.240552e-49 | -8.615850e-47 |
| Msa0782330 | Msa1380580 | 0.803103 | 4.090186e-49 | -8.615850e-47 |
| Msa0146020 | Msa1380580 | 0.821118 | 4.785032e-53 | -8.615850e-47 |
| Msa0222070 | Msa1380580 | 0.808782 | 2.615154e-50 | -8.615850e-47 |
| Msa0222120 | Msa1380580 | 0.803914 | 2.776945e-49 | -8.615850e-47 |
| Msa1323060 | Msa1380580 | 0.803342 | 3.649515e-49 | -8.615850e-47 |
| Msa1342030 | Msa1380580 | 0.801422 | 9.073966e-49 | -8.615850e-47 |
| Msa0983710 | Msa1380580 | 0.817727 | 2.838465e-52 | -8.615850e-47 |
| Msa0992570 | Msa1380580 | 0.819866 | 9.276292e-53 | -8.615850e-47 |
| Msa1002040 | Msa1380580 | 0.816394 | 5.657776e-52 | -8.615850e-47 |
| Msa1030280 | Msa1380580 | 0.801682 | 8.024992e-49 | -8.615850e-47 |
| Msa1086060 | Msa1380580 | 0.834293 | 3.258260e-56 | -8.615850e-47 |
| Msa1086170 | Msa1380580 | 0.836751 | 7.786708e-57 | -8.615850e-47 |
| Msa1086290 | Msa1380580 | 0.807571 | 4.735865e-50 | -8.615850e-47 |
| Msa1086370 | Msa1380580 | 0.815509 | 8.912669e-52 | -8.615850e-47 |
| Msa1086870 | Msa1380580 | 0.800195 | 1.615269e-48 | -8.615850e-47 |
| Msa0263620 | Msa1380580 | 0.805938 | 1.048250e-49 | -8.615850e-47 |
| Msa0268180 | Msa1380580 | 0.837566 | 4.818786e-57 | -8.615850e-47 |
| Msa0268380 | Msa1380580 | 0.832135 | 1.123313e-55 | -8.615850e-47 |
| Msa0268420 | Msa1380580 | 0.840215 | 9.941995e-58 | -8.615850e-47 |
| Msa0268540 | Msa1380580 | 0.833180 | 6.185061e-56 | -8.615850e-47 |
| Msa0268650 | Msa1380580 | 0.814611 | 1.410995e-51 | -8.615850e-47 |
| Msa0268730 | Msa1380580 | 0.819430 | 1.166063e-52 | -8.615850e-47 |
| Msa0268850 | Msa1380580 | 0.824052 | 9.948706e-54 | -8.615850e-47 |
| Msa0268930 | Msa1380580 | 0.835294 | 1.824387e-56 | -8.615850e-47 |
| Msa0269060 | Msa1380580 | 0.819259 | 1.275524e-52 | -8.615850e-47 |
| Msa0306130 | Msa1380580 | 0.815781 | 7.752798e-52 | -8.615850e-47 |
| Msa0344200 | Msa1380580 | 0.814772 | 1.299761e-51 | -8.615850e-47 |
| Msa1143140 | Msa1380580 | 0.827995 | 1.149267e-54 | -8.615850e-47 |
| Msa1143150 | Msa1380580 | 0.837625 | 4.653331e-57 | -8.615850e-47 |
| Msa0582530 | Msa1380580 | 0.819595 | 1.069413e-52 | -8.615850e-47 |
| Msa0582620 | Msa1380580 | 0.805674 | 1.191222e-49 | -8.615850e-47 |
| Msa0582740 | Msa1380580 | 0.865710 | 4.846620e-65 | -8.615850e-47 |
| Msa0582830 | Msa1380580 | 0.803324 | 3.681047e-49 | -8.615850e-47 |
| Msa0582900 | Msa1380580 | 0.838318 | 3.088045e-57 | -8.615850e-47 |
| Msa0860270 | Msa1380580 | 0.804996 | 1.651523e-49 | -8.615850e-47 |
| Msa0924860 | Msa1380580 | 0.817294 | 3.552537e-52 | -8.615850e-47 |
| Msa0931090 | Msa1380580 | 0.829721 | 4.392520e-55 | -8.615850e-47 |
| Msa0931150 | Msa1380580 | 0.803574 | 3.267547e-49 | -8.615850e-47 |
| Msa0931200 | Msa1380580 | 0.816202 | 6.244570e-52 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1380580 | MtrunA17_Chr4g0015681 | 96.667 | 60 | 2 | 0 | 1 | 60 | 1 | 60 | 7.64e-35 | 113 |
| Msa1380580 | MtrunA17_CPg0492901 | 96.667 | 60 | 2 | 0 | 1 | 60 | 1 | 60 | 7.64e-35 | 113 |
| Msa1380580 | MtrunA17_Chr4g0016771 | 96.667 | 60 | 2 | 0 | 1 | 60 | 1 | 60 | 7.64e-35 | 113 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1380580 | ATCG00070.1 | 76.667 | 60 | 14 | 0 | 1 | 60 | 1 | 60 | 3.76e-26 | 92.0 |
| Msa1380580 | ATCG00080.1 | 97.222 | 36 | 1 | 0 | 62 | 97 | 1 | 36 | 2.92e-19 | 73.9 |
Find 6 sgRNAs with CRISPR-Local
Find 30 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| TATGCTTAATATCTTTAGCT+TGG | 0.440922 | tig0020386:+17877 | None:intergenic |
| ACTGGCATAAAATCTACAAT+TGG | 0.453871 | tig0020386:-17980 | None:intergenic |
| AATGATCCAGGACGTAATCC+TGG | 0.474800 | tig0020386:+18527 | Msa1380580:CDS |
| GGATTCCTATCTAATGATCC+AGG | 0.536202 | tig0020386:+18515 | Msa1380580:CDS |
| TCACGTCCAGGATTACGTCC+TGG | 0.548081 | tig0020386:-18533 | None:intergenic |
| TACGTCCTGGATCATTAGAT+AGG | 0.581605 | tig0020386:-18520 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !!! | ATTCCAAATATTAAAATTTT+TGG | + | tig0020386:18167-18186 | Msa1380580:intron | 10.0% |
| !!! | TATCCAAAAATTTTAATATT+TGG | - | tig0020386:18173-18192 | None:intergenic | 10.0% |
| !! | ATTTCAAAAAAAAAAAACTT+AGG | - | tig0020386:18324-18343 | None:intergenic | 10.0% |
| !!! | AATTTTAATATTTGGAATCA+AGG | - | tig0020386:18165-18184 | None:intergenic | 15.0% |
| !!! | CGTTTTTTTTTTAATTATCT+TGG | + | tig0020386:18419-18438 | Msa1380580:intron | 15.0% |
| !! | GAAAAAACTACTTGAATAAA+GGG | - | tig0020386:17924-17943 | None:intergenic | 20.0% |
| !! | AGAAAAAACTACTTGAATAA+AGG | - | tig0020386:17925-17944 | None:intergenic | 20.0% |
| !!! | TTATTCAAGTAGTTTTTTCT+TGG | + | tig0020386:17925-17944 | Msa1380580:CDS | 20.0% |
| !! | TGAAAATTCTATTATTCGAT+TGG | + | tig0020386:18211-18230 | Msa1380580:intron | 20.0% |
| !!! | TGTGGATATGAAAAAAATTT+TGG | + | tig0020386:18262-18281 | Msa1380580:intron | 20.0% |
| !! | TCTTATAAACTTAGTATCAA+AGG | + | tig0020386:18353-18372 | Msa1380580:intron | 20.0% |
| !!! | TTTTTCTCTTAGCTTTTGTT+TGG | + | tig0020386:18017-18036 | Msa1380580:CDS | 25.0% |
| !!! | TTTGTTTCTCTTTTCATCTT+CGG | + | tig0020386:18494-18513 | Msa1380580:CDS | 25.0% |
| ! | AATTGGATTCAAAAAAGCGT+AGG | - | tig0020386:17966-17985 | None:intergenic | 30.0% |
| ACTGGCATAAAATCTACAAT+TGG | - | tig0020386:17983-18002 | None:intergenic | 30.0% | |
| !! | AAAAAGAGTAAGGGTATTAC+TGG | - | tig0020386:18001-18020 | None:intergenic | 30.0% |
| GCTAAGAGAAAAAAGAGTAA+GGG | - | tig0020386:18010-18029 | None:intergenic | 30.0% | |
| AGCTAAGAGAAAAAAGAGTA+AGG | - | tig0020386:18011-18030 | None:intergenic | 30.0% | |
| !! | AATCAAGATCTAGGTATTGG+TGG | - | tig0020386:18243-18262 | None:intergenic | 35.0% |
| CACAATCAAGATCTAGGTAT+TGG | - | tig0020386:18246-18265 | None:intergenic | 35.0% | |
| CAATACCTAGATCTTGATTG+TGG | + | tig0020386:18244-18263 | Msa1380580:intron | 35.0% | |
| CATATCCACAATCAAGATCT+AGG | - | tig0020386:18252-18271 | None:intergenic | 35.0% | |
| GAGAATCTATTCTCTTTCTC+TGG | + | tig0020386:18396-18415 | Msa1380580:intron | 35.0% | |
| ! | TTCAAAAAAGCGTAGGCTTC+AGG | - | tig0020386:17959-17978 | None:intergenic | 40.0% |
| GGATTCCTATCTAATGATCC+AGG | + | tig0020386:18515-18534 | Msa1380580:CDS | 40.0% | |
| TACGTCCTGGATCATTAGAT+AGG | - | tig0020386:18523-18542 | None:intergenic | 40.0% | |
| !! | CAAGATCTAGGTATTGGTGG+TGG | - | tig0020386:18240-18259 | None:intergenic | 45.0% |
| AATGATCCAGGACGTAATCC+TGG | + | tig0020386:18527-18546 | Msa1380580:CDS | 45.0% | |
| !!! | AATAAATTCTTAATTTTTTT+CGG | - | tig0020386:18088-18107 | None:intergenic | 5.0% |
| TCACGTCCAGGATTACGTCC+TGG | - | tig0020386:18536-18555 | None:intergenic | 55.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| tig0020386 | gene | 17878 | 18562 | 17878 | ID=Msa1380580;Name=Msa1380580 |
| tig0020386 | mRNA | 17878 | 18562 | 17878 | ID=Msa1380580-mRNA-1;Parent=Msa1380580;Name=Msa1380580-mRNA-1;_AED=0.46;_eAED=0.46;_QI=0|0|0|1|0|0|2|0|97 |
| tig0020386 | exon | 17878 | 18052 | 17878 | ID=Msa1380580-mRNA-1:exon:7202;Parent=Msa1380580-mRNA-1 |
| tig0020386 | exon | 18444 | 18562 | 18444 | ID=Msa1380580-mRNA-1:exon:7203;Parent=Msa1380580-mRNA-1 |
| tig0020386 | CDS | 17878 | 18052 | 17878 | ID=Msa1380580-mRNA-1:cds;Parent=Msa1380580-mRNA-1 |
| tig0020386 | CDS | 18444 | 18562 | 18444 | ID=Msa1380580-mRNA-1:cds;Parent=Msa1380580-mRNA-1 |
| Gene Sequence |
| Protein sequence |
