Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0007440 | Msa0835700 | 0.815913 | 7.246700e-52 | -8.615850e-47 |
| Msa0028660 | Msa0835700 | 0.802359 | 5.825375e-49 | -8.615850e-47 |
| Msa0037540 | Msa0835700 | -0.818073 | 2.371267e-52 | -8.615850e-47 |
| Msa0037570 | Msa0835700 | -0.811726 | 6.060641e-51 | -8.615850e-47 |
| Msa0037590 | Msa0835700 | -0.818462 | 1.935654e-52 | -8.615850e-47 |
| Msa0054750 | Msa0835700 | 0.803266 | 3.783547e-49 | -8.615850e-47 |
| Msa0056030 | Msa0835700 | 0.814099 | 1.830434e-51 | -8.615850e-47 |
| Msa0068740 | Msa0835700 | -0.809434 | 1.895565e-50 | -8.615850e-47 |
| Msa0096030 | Msa0835700 | 0.808077 | 3.697694e-50 | -8.615850e-47 |
| Msa0109590 | Msa0835700 | 0.800800 | 1.215954e-48 | -8.615850e-47 |
| Msa0610130 | Msa0835700 | 0.800421 | 1.452537e-48 | -8.615850e-47 |
| Msa0610430 | Msa0835700 | 0.813753 | 2.181733e-51 | -8.615850e-47 |
| Msa0617640 | Msa0835700 | 0.814514 | 1.482158e-51 | -8.615850e-47 |
| Msa0649350 | Msa0835700 | 0.803009 | 4.277531e-49 | -8.615850e-47 |
| Msa0661190 | Msa0835700 | -0.806392 | 8.412104e-50 | -8.615850e-47 |
| Msa0711100 | Msa0835700 | 0.815576 | 8.613524e-52 | -8.615850e-47 |
| Msa0804230 | Msa0835700 | 0.847125 | 1.409581e-59 | -8.615850e-47 |
| Msa0831870 | Msa0835700 | 0.814132 | 1.800348e-51 | -8.615850e-47 |
| Msa0832150 | Msa0835700 | 0.809311 | 2.014441e-50 | -8.615850e-47 |
| Msa0833460 | Msa0835700 | 0.807267 | 5.493897e-50 | -8.615850e-47 |
| Msa0835700 | Msa1012830 | 0.827894 | 1.215940e-54 | -8.615850e-47 |
| Msa0835700 | Msa1172400 | 0.844157 | 8.995209e-59 | -8.615850e-47 |
| Msa0835700 | Msa1181250 | 0.816413 | 5.603112e-52 | -8.615850e-47 |
| Msa0835700 | Msa1181330 | 0.812582 | 3.943138e-51 | -8.615850e-47 |
| Msa0835700 | Msa1207470 | -0.801970 | 7.002497e-49 | -8.615850e-47 |
| Msa0835700 | Msa1388860 | 0.829258 | 5.692942e-55 | -8.615850e-47 |
| Msa0835700 | Msa1403340 | 0.821523 | 3.858871e-53 | -8.615850e-47 |
| Msa0129190 | Msa0835700 | -0.827389 | 1.607547e-54 | -8.615850e-47 |
| Msa0217680 | Msa0835700 | 0.815491 | 8.998843e-52 | -8.615850e-47 |
| Msa0383800 | Msa0835700 | 0.810673 | 1.025492e-50 | -8.615850e-47 |
| Msa0385490 | Msa0835700 | 0.836535 | 8.838197e-57 | -8.615850e-47 |
| Msa0394340 | Msa0835700 | 0.820109 | 8.161018e-53 | -8.615850e-47 |
| Msa0404030 | Msa0835700 | 0.801656 | 8.122728e-49 | -8.615850e-47 |
| Msa0412840 | Msa0835700 | 0.821549 | 3.806726e-53 | -8.615850e-47 |
| Msa0434180 | Msa0835700 | 0.802968 | 4.361994e-49 | -8.615850e-47 |
| Msa0457510 | Msa0835700 | 0.824033 | 1.004912e-53 | -8.615850e-47 |
| Msa0241390 | Msa0835700 | 0.823791 | 1.145318e-53 | -8.615850e-47 |
| Msa0257500 | Msa0835700 | 0.828015 | 1.137037e-54 | -8.615850e-47 |
| Msa0272450 | Msa0835700 | 0.803148 | 4.002972e-49 | -8.615850e-47 |
| Msa0279240 | Msa0835700 | 0.819032 | 1.436861e-52 | -8.615850e-47 |
| Msa0303360 | Msa0835700 | 0.802775 | 4.780019e-49 | -8.615850e-47 |
| Msa0318980 | Msa0835700 | 0.815684 | 8.149408e-52 | -8.615850e-47 |
| Msa0489610 | Msa0835700 | 0.804790 | 1.824014e-49 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 8 sgRNAs with CRISPR-Local
Find 23 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| CATTGATGCGCTCCAATTCT+TGG | 0.260045 | 5_4:-9066543 | None:intergenic |
| TCATTCATCTGTCCAAGAAT+TGG | 0.340023 | 5_4:+9066531 | Msa0835700:CDS |
| GACTCACACTCTGAGTATTA+AGG | 0.392352 | 5_4:-9066566 | None:intergenic |
| GTTGAAAATTATTTCCAACT+TGG | 0.469895 | 5_4:-9066481 | None:intergenic |
| AAATTATTTCCAACTTGGAA+TGG | 0.499500 | 5_4:-9066476 | None:intergenic |
| CACATCTTGTATATCATCAT+CGG | 0.550546 | 5_4:-9066613 | None:intergenic |
| CGATGATGATATACAAGATG+TGG | 0.569550 | 5_4:+9066614 | Msa0835700:CDS |
| AGGGTGTGGCCATTCCAAGT+TGG | 0.611939 | 5_4:+9066467 | Msa0835700:intron |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !!! | TATTTGCTTTTGAAAAACAT+TGG | + | chr5_4:9066249-9066268 | Msa0835700:intron | 20.0% |
| !!! | TTTTGAAAAACATTGGATTT+GGG | + | chr5_4:9066256-9066275 | Msa0835700:intron | 20.0% |
| ! | TTCAAAAGCAAATAGAAACA+TGG | - | chr5_4:9066243-9066262 | None:intergenic | 25.0% |
| !!! | CTTTTGAAAAACATTGGATT+TGG | + | chr5_4:9066255-9066274 | Msa0835700:intron | 25.0% |
| ! | CTTCTCTTATTCAAATGTAA+GGG | + | chr5_4:9066448-9066467 | Msa0835700:intron | 25.0% |
| ! | AAATTATTTCCAACTTGGAA+TGG | - | chr5_4:9066479-9066498 | None:intergenic | 25.0% |
| ! | GTTGAAAATTATTTCCAACT+TGG | - | chr5_4:9066484-9066503 | None:intergenic | 25.0% |
| ! | TTCAACAAAAATAATGCAAC+TGG | + | chr5_4:9066498-9066517 | Msa0835700:CDS | 25.0% |
| ! | TCAACAAAAATAATGCAACT+GGG | + | chr5_4:9066499-9066518 | Msa0835700:CDS | 25.0% |
| !! | AGGTACGATTTGACTTTTAT+AGG | + | chr5_4:9066337-9066356 | Msa0835700:intron | 30.0% |
| CAATGTTGCTAATGTATTGA+TGG | + | chr5_4:9066393-9066412 | Msa0835700:intron | 30.0% | |
| TGGTATGCTTATACTACTTT+AGG | + | chr5_4:9066413-9066432 | Msa0835700:intron | 30.0% | |
| GCTTCTCTTATTCAAATGTA+AGG | + | chr5_4:9066447-9066466 | Msa0835700:intron | 30.0% | |
| CACATCTTGTATATCATCAT+CGG | - | chr5_4:9066616-9066635 | None:intergenic | 30.0% | |
| TGAAAAACATTGGATTTGGG+TGG | + | chr5_4:9066259-9066278 | Msa0835700:intron | 35.0% | |
| CATTGTTACTACAAGTGAAG+AGG | + | chr5_4:9066296-9066315 | Msa0835700:intron | 35.0% | |
| GGTTTGACGAAATTATCTTC+AGG | + | chr5_4:9066317-9066336 | Msa0835700:intron | 35.0% | |
| CTTATTCAAATGTAAGGGTG+TGG | + | chr5_4:9066453-9066472 | Msa0835700:intron | 35.0% | |
| TCATTCATCTGTCCAAGAAT+TGG | + | chr5_4:9066531-9066550 | Msa0835700:CDS | 35.0% | |
| CGATGATGATATACAAGATG+TGG | + | chr5_4:9066614-9066633 | Msa0835700:CDS | 35.0% | |
| GACTCACACTCTGAGTATTA+AGG | - | chr5_4:9066569-9066588 | None:intergenic | 40.0% | |
| CATTGATGCGCTCCAATTCT+TGG | - | chr5_4:9066546-9066565 | None:intergenic | 45.0% | |
| AGGGTGTGGCCATTCCAAGT+TGG | + | chr5_4:9066467-9066486 | Msa0835700:intron | 55.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| chr5_4 | gene | 9066224 | 9066657 | 9066224 | ID=Msa0835700;Name=Msa0835700 |
| chr5_4 | mRNA | 9066224 | 9066657 | 9066224 | ID=Msa0835700-mRNA-1;Parent=Msa0835700;Name=Msa0835700-mRNA-1;_AED=0.36;_eAED=0.37;_QI=0|0|0.5|1|0|0|2|13|59 |
| chr5_4 | exon | 9066224 | 9066227 | 9066224 | ID=Msa0835700-mRNA-1:exon:3967;Parent=Msa0835700-mRNA-1 |
| chr5_4 | exon | 9066469 | 9066657 | 9066469 | ID=Msa0835700-mRNA-1:exon:3968;Parent=Msa0835700-mRNA-1 |
| chr5_4 | CDS | 9066224 | 9066227 | 9066224 | ID=Msa0835700-mRNA-1:cds;Parent=Msa0835700-mRNA-1 |
| chr5_4 | CDS | 9066469 | 9066644 | 9066469 | ID=Msa0835700-mRNA-1:cds;Parent=Msa0835700-mRNA-1 |
| chr5_4 | three_prime_UTR | 9066645 | 9066657 | 9066645 | ID=Msa0835700-mRNA-1:three_prime_utr;Parent=Msa0835700-mRNA-1 |
| Gene Sequence |
| Protein sequence |
