Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1143140 | RDY14692.1 | 90.722 | 97 | 9 | 0 | 1 | 97 | 4 | 100 | 7.75e-56 | 178 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1143140 | sp|Q49L15|PSBK_EUCGG | 91.667 | 60 | 5 | 0 | 1 | 60 | 1 | 60 | 1.80e-32 | 110 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1143140 | A0A371II05 | 90.722 | 97 | 9 | 0 | 1 | 97 | 4 | 100 | 3.70e-56 | 178 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0087880 | Msa1143140 | 0.801326 | 9.493136e-49 | -8.615850e-47 |
| Msa0095140 | Msa1143140 | 0.858120 | 1.024678e-62 | -8.615850e-47 |
| Msa0095200 | Msa1143140 | 0.837631 | 4.637324e-57 | -8.615850e-47 |
| Msa0095240 | Msa1143140 | 0.820926 | 5.298647e-53 | -8.615850e-47 |
| Msa0095270 | Msa1143140 | 0.850144 | 2.053643e-60 | -8.615850e-47 |
| Msa0727020 | Msa1143140 | 0.832358 | 9.896288e-56 | -8.615850e-47 |
| Msa0766880 | Msa1143140 | 0.810642 | 1.041654e-50 | -8.615850e-47 |
| Msa0772210 | Msa1143140 | 0.804778 | 1.834448e-49 | -8.615850e-47 |
| Msa0804930 | Msa1143140 | 0.815045 | 1.130428e-51 | -8.615850e-47 |
| Msa0139740 | Msa1143140 | 0.802259 | 6.105965e-49 | -8.615850e-47 |
| Msa0175900 | Msa1143140 | 0.813220 | 2.857358e-51 | -8.615850e-47 |
| Msa0221860 | Msa1143140 | 0.824683 | 7.068843e-54 | -8.615850e-47 |
| Msa0417630 | Msa1143140 | 0.806627 | 7.503285e-50 | -8.615850e-47 |
| Msa0482020 | Msa1143140 | 0.813356 | 2.668300e-51 | -8.615850e-47 |
| Msa0983670 | Msa1143140 | 0.805893 | 1.071443e-49 | -8.615850e-47 |
| Msa0983710 | Msa1143140 | 0.820789 | 5.697028e-53 | -8.615850e-47 |
| Msa0992570 | Msa1143140 | 0.827033 | 1.955744e-54 | -8.615850e-47 |
| Msa0992590 | Msa1143140 | 0.810743 | 9.901190e-51 | -8.615850e-47 |
| Msa1002040 | Msa1143140 | 0.809162 | 2.168048e-50 | -8.615850e-47 |
| Msa1030280 | Msa1143140 | 0.813102 | 3.033436e-51 | -8.615850e-47 |
| Msa1049440 | Msa1143140 | 0.800140 | 1.657544e-48 | -8.615850e-47 |
| Msa1086020 | Msa1143140 | 0.838584 | 2.636803e-57 | -8.615850e-47 |
| Msa1086060 | Msa1143140 | 0.880028 | 7.688497e-70 | -8.615850e-47 |
| Msa1086160 | Msa1143140 | 0.840522 | 8.264911e-58 | -8.615850e-47 |
| Msa1086170 | Msa1143140 | 0.899984 | 1.152672e-77 | -8.615850e-47 |
| Msa1086260 | Msa1143140 | 0.824510 | 7.762190e-54 | -8.615850e-47 |
| Msa1086290 | Msa1143140 | 0.868944 | 4.480362e-66 | -8.615850e-47 |
| Msa1086330 | Msa1143140 | 0.816785 | 4.623660e-52 | -8.615850e-47 |
| Msa1086340 | Msa1143140 | 0.837922 | 3.905038e-57 | -8.615850e-47 |
| Msa1086370 | Msa1143140 | 0.886434 | 3.430735e-72 | -8.615850e-47 |
| Msa1086440 | Msa1143140 | 0.836946 | 6.944643e-57 | -8.615850e-47 |
| Msa1086480 | Msa1143140 | 0.858372 | 8.618663e-63 | -8.615850e-47 |
| Msa1086520 | Msa1143140 | 0.804440 | 2.157959e-49 | -8.615850e-47 |
| Msa1086630 | Msa1143140 | 0.830737 | 2.481784e-55 | -8.615850e-47 |
| Msa1086690 | Msa1143140 | 0.819119 | 1.373125e-52 | -8.615850e-47 |
| Msa1086830 | Msa1143140 | 0.821128 | 4.760287e-53 | -8.615850e-47 |
| Msa1086870 | Msa1143140 | 0.868400 | 6.716715e-66 | -8.615850e-47 |
| Msa1091690 | Msa1143140 | 0.841285 | 5.214227e-58 | -8.615850e-47 |
| Msa0253410 | Msa1143140 | 0.802731 | 4.881591e-49 | -8.615850e-47 |
| Msa0268180 | Msa1143140 | 0.894984 | 1.473052e-75 | -8.615850e-47 |
| Msa0268220 | Msa1143140 | 0.821167 | 4.662382e-53 | -8.615850e-47 |
| Msa0268340 | Msa1143140 | 0.817224 | 3.684119e-52 | -8.615850e-47 |
| Msa0268380 | Msa1143140 | 0.875361 | 3.273514e-68 | -8.615850e-47 |
| Msa0268420 | Msa1143140 | 0.898744 | 3.929407e-77 | -8.615850e-47 |
| Msa0268460 | Msa1143140 | 0.823111 | 1.651116e-53 | -8.615850e-47 |
| Msa0268500 | Msa1143140 | 0.821663 | 3.582289e-53 | -8.615850e-47 |
| Msa0268540 | Msa1143140 | 0.910325 | 2.125015e-82 | -8.615850e-47 |
| Msa0268650 | Msa1143140 | 0.873116 | 1.885968e-67 | -8.615850e-47 |
| Msa0268690 | Msa1143140 | 0.815073 | 1.114502e-51 | -8.615850e-47 |
| Msa0268730 | Msa1143140 | 0.862807 | 3.900571e-64 | -8.615850e-47 |
| Msa0268760 | Msa1143140 | 0.803242 | 3.826752e-49 | -8.615850e-47 |
| Msa0268850 | Msa1143140 | 0.890318 | 1.097715e-73 | -8.615850e-47 |
| Msa0268900 | Msa1143140 | 0.838908 | 2.173900e-57 | -8.615850e-47 |
| Msa0268930 | Msa1143140 | 0.875453 | 3.044873e-68 | -8.615850e-47 |
| Msa0269060 | Msa1143140 | 0.891727 | 3.050578e-74 | -8.615850e-47 |
| Msa0269100 | Msa1143140 | 0.814524 | 1.474503e-51 | -8.615850e-47 |
| Msa0344200 | Msa1143140 | 0.859030 | 5.482250e-63 | -8.615850e-47 |
| Msa0344250 | Msa1143140 | 0.828823 | 7.258258e-55 | -8.615850e-47 |
| Msa0344290 | Msa1143140 | 0.801050 | 1.081023e-48 | -8.615850e-47 |
| Msa1143140 | Msa1143150 | 0.804016 | 2.644432e-49 | -8.615850e-47 |
| Msa1143140 | Msa1195860 | 0.803249 | 3.815103e-49 | -8.615850e-47 |
| Msa1143140 | Msa1209390 | 0.809101 | 2.234585e-50 | -8.615850e-47 |
| Msa1143140 | Msa1352820 | 0.803068 | 4.158250e-49 | -8.615850e-47 |
| Msa1143140 | Msa1354850 | 0.850404 | 1.735246e-60 | -8.615850e-47 |
| Msa1143140 | Msa1354890 | 0.885013 | 1.171821e-71 | -8.615850e-47 |
| Msa1143140 | Msa1355020 | 0.836253 | 1.043058e-56 | -8.615850e-47 |
| Msa1143140 | Msa1355060 | 0.851202 | 1.034533e-60 | -8.615850e-47 |
| Msa1143140 | Msa1380540 | 0.831475 | 1.634296e-55 | -8.615850e-47 |
| Msa1143140 | Msa1380580 | 0.827995 | 1.149267e-54 | -8.615850e-47 |
| Msa1143140 | Msa1394090 | 0.835501 | 1.617099e-56 | -8.615850e-47 |
| Msa1143140 | Msa1394100 | 0.818541 | 1.857979e-52 | -8.615850e-47 |
| Msa1143140 | Msa1394140 | 0.828541 | 8.491424e-55 | -8.615850e-47 |
| Msa1143140 | Msa1394170 | 0.818293 | 2.114505e-52 | -8.615850e-47 |
| Msa1143140 | Msa1394240 | 0.865899 | 4.223522e-65 | -8.615850e-47 |
| Msa1143140 | Msa1394280 | 0.808112 | 3.635204e-50 | -8.615850e-47 |
| Msa1143140 | Msa1415120 | 0.802044 | 6.762354e-49 | -8.615850e-47 |
| Msa0582530 | Msa1143140 | 0.874244 | 7.856614e-68 | -8.615850e-47 |
| Msa0582570 | Msa1143140 | 0.829797 | 4.211037e-55 | -8.615850e-47 |
| Msa0582580 | Msa1143140 | 0.847072 | 1.456868e-59 | -8.615850e-47 |
| Msa0582620 | Msa1143140 | 0.904743 | 8.920760e-80 | -8.615850e-47 |
| Msa0582710 | Msa1143140 | 0.871144 | 8.547438e-67 | -8.615850e-47 |
| Msa0582740 | Msa1143140 | 0.888967 | 3.687664e-73 | -8.615850e-47 |
| Msa0582830 | Msa1143140 | 0.856555 | 2.972096e-62 | -8.615850e-47 |
| Msa0582900 | Msa1143140 | 0.852345 | 4.906854e-61 | -8.615850e-47 |
| Msa0582930 | Msa1143140 | 0.803933 | 2.751720e-49 | -8.615850e-47 |
| Msa0591370 | Msa1143140 | 0.815310 | 9.870065e-52 | -8.615850e-47 |
| Msa0924860 | Msa1143140 | 0.847312 | 1.252412e-59 | -8.615850e-47 |
| Msa0924890 | Msa1143140 | 0.821790 | 3.347522e-53 | -8.615850e-47 |
| Msa0925020 | Msa1143140 | 0.815161 | 1.065177e-51 | -8.615850e-47 |
| Msa0931090 | Msa1143140 | 0.892665 | 1.287042e-74 | -8.615850e-47 |
| Msa0931150 | Msa1143140 | 0.880373 | 5.789545e-70 | -8.615850e-47 |
| Msa0931200 | Msa1143140 | 0.846655 | 1.895459e-59 | -8.615850e-47 |
| Msa0931280 | Msa1143140 | 0.856483 | 3.120447e-62 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1143140 | MtrunA17_Chr4g0015681 | 96.667 | 60 | 2 | 0 | 1 | 60 | 1 | 60 | 7.64e-35 | 113 |
| Msa1143140 | MtrunA17_CPg0492901 | 96.667 | 60 | 2 | 0 | 1 | 60 | 1 | 60 | 7.64e-35 | 113 |
| Msa1143140 | MtrunA17_Chr4g0016771 | 96.667 | 60 | 2 | 0 | 1 | 60 | 1 | 60 | 7.64e-35 | 113 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1143140 | ATCG00070.1 | 76.667 | 60 | 14 | 0 | 1 | 60 | 1 | 60 | 3.76e-26 | 92.0 |
| Msa1143140 | ATCG00080.1 | 97.222 | 36 | 1 | 0 | 62 | 97 | 1 | 36 | 2.92e-19 | 73.9 |
Find 6 sgRNAs with CRISPR-Local
Find 30 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| TATGCTTAATATCTTTAGCT+TGG | 0.440922 | 7_4:-18343140 | Msa1143140:CDS |
| ACTGGCATAAAATCTACAAT+TGG | 0.453871 | 7_4:+18343037 | None:intergenic |
| AATGATCCAGGACGTAATCC+TGG | 0.474800 | 7_4:-18342491 | Msa1143140:CDS |
| GGATTCCTATCTAATGATCC+AGG | 0.536202 | 7_4:-18342503 | Msa1143140:CDS |
| TCACGTCCAGGATTACGTCC+TGG | 0.548081 | 7_4:+18342485 | None:intergenic |
| TACGTCCTGGATCATTAGAT+AGG | 0.581605 | 7_4:+18342498 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !!! | ATTCCAAATATTAAAATTTT+TGG | - | chr7_4:18342767-18342786 | Msa1143140:intron | 10.0% |
| !!! | TATCCAAAAATTTTAATATT+TGG | + | chr7_4:18342773-18342792 | None:intergenic | 10.0% |
| !! | AATTTCAAAAAAAAAAACTT+AGG | + | chr7_4:18342924-18342943 | None:intergenic | 10.0% |
| !!! | AATTTTAATATTTGGAATCA+AGG | + | chr7_4:18342765-18342784 | None:intergenic | 15.0% |
| !!! | CGTTTTTTTTTTAATTATCT+TGG | - | chr7_4:18343018-18343037 | Msa1143140:CDS | 15.0% |
| !! | GAAAAAACTACTTGAATAAA+GGG | + | chr7_4:18342524-18342543 | None:intergenic | 20.0% |
| !! | AGAAAAAACTACTTGAATAA+AGG | + | chr7_4:18342525-18342544 | None:intergenic | 20.0% |
| !!! | TTATTCAAGTAGTTTTTTCT+TGG | - | chr7_4:18342525-18342544 | Msa1143140:CDS | 20.0% |
| !! | TGAAAATTCTATTATTCGAT+TGG | - | chr7_4:18342811-18342830 | Msa1143140:intron | 20.0% |
| !!! | TGTGGATATGAAAAAAATTT+TGG | - | chr7_4:18342862-18342881 | Msa1143140:intron | 20.0% |
| !! | TCTTATAAACTTAGTATCAA+AGG | - | chr7_4:18342952-18342971 | Msa1143140:intron | 20.0% |
| !!! | TTTTTCTCTTAGCTTTTGTT+TGG | - | chr7_4:18342617-18342636 | Msa1143140:intron | 25.0% |
| !!! | TTTGTTTCTCTTTTCATCTT+CGG | - | chr7_4:18343093-18343112 | Msa1143140:CDS | 25.0% |
| ! | AATTGGATTCAAAAAAGCGT+AGG | + | chr7_4:18342566-18342585 | None:intergenic | 30.0% |
| ACTGGCATAAAATCTACAAT+TGG | + | chr7_4:18342583-18342602 | None:intergenic | 30.0% | |
| !! | AAAAAGAGTAAGGGTATTAC+TGG | + | chr7_4:18342601-18342620 | None:intergenic | 30.0% |
| GCTAAGAGAAAAAAGAGTAA+GGG | + | chr7_4:18342610-18342629 | None:intergenic | 30.0% | |
| AGCTAAGAGAAAAAAGAGTA+AGG | + | chr7_4:18342611-18342630 | None:intergenic | 30.0% | |
| !! | AATCAAGATCTAGGTATTGG+TGG | + | chr7_4:18342843-18342862 | None:intergenic | 35.0% |
| CACAATCAAGATCTAGGTAT+TGG | + | chr7_4:18342846-18342865 | None:intergenic | 35.0% | |
| CAATACCTAGATCTTGATTG+TGG | - | chr7_4:18342844-18342863 | Msa1143140:intron | 35.0% | |
| CATATCCACAATCAAGATCT+AGG | + | chr7_4:18342852-18342871 | None:intergenic | 35.0% | |
| GAGAATCTATTCTCTTTCTC+TGG | - | chr7_4:18342995-18343014 | Msa1143140:CDS | 35.0% | |
| ! | TTCAAAAAAGCGTAGGCTTC+AGG | + | chr7_4:18342559-18342578 | None:intergenic | 40.0% |
| GGATTCCTATCTAATGATCC+AGG | - | chr7_4:18343114-18343133 | Msa1143140:CDS | 40.0% | |
| TACGTCCTGGATCATTAGAT+AGG | + | chr7_4:18343122-18343141 | None:intergenic | 40.0% | |
| !! | CAAGATCTAGGTATTGGTGG+TGG | + | chr7_4:18342840-18342859 | None:intergenic | 45.0% |
| AATGATCCAGGACGTAATCC+TGG | - | chr7_4:18343126-18343145 | Msa1143140:CDS | 45.0% | |
| !!! | AATAAATTCTTAATTTTTTT+CGG | + | chr7_4:18342688-18342707 | None:intergenic | 5.0% |
| TCACGTCCAGGATTACGTCC+TGG | + | chr7_4:18343135-18343154 | None:intergenic | 55.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| chr7_4 | gene | 18342478 | 18343161 | 18342478 | ID=Msa1143140;Name=Msa1143140 |
| chr7_4 | mRNA | 18342478 | 18343161 | 18342478 | ID=Msa1143140-mRNA-1;Parent=Msa1143140;Name=Msa1143140-mRNA-1;_AED=0.50;_eAED=0.50;_QI=0|0|0|1|0|0|2|0|97 |
| chr7_4 | exon | 18342987 | 18343161 | 18342987 | ID=Msa1143140-mRNA-1:exon:4103;Parent=Msa1143140-mRNA-1 |
| chr7_4 | exon | 18342478 | 18342596 | 18342478 | ID=Msa1143140-mRNA-1:exon:4102;Parent=Msa1143140-mRNA-1 |
| chr7_4 | CDS | 18342987 | 18343161 | 18342987 | ID=Msa1143140-mRNA-1:cds;Parent=Msa1143140-mRNA-1 |
| chr7_4 | CDS | 18342478 | 18342596 | 18342478 | ID=Msa1143140-mRNA-1:cds;Parent=Msa1143140-mRNA-1 |
| Gene Sequence |
| Protein sequence |
