Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0199820 | XP_039686033.1 | 96.154 | 52 | 0 | 1 | 1 | 52 | 1 | 50 | 2.90e-24 | 96.3 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0199820 | A0A396J551 | 96.154 | 52 | 0 | 1 | 1 | 52 | 1 | 50 | 1.39e-24 | 96.3 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0048000 | Msa0199820 | 0.812837 | 3.467113e-51 | -8.615850e-47 |
| Msa0050760 | Msa0199820 | 0.809328 | 1.997793e-50 | -8.615850e-47 |
| Msa0069310 | Msa0199820 | 0.811560 | 6.585925e-51 | -8.615850e-47 |
| Msa0140910 | Msa0199820 | 0.803835 | 2.884239e-49 | -8.615850e-47 |
| Msa0172350 | Msa0199820 | 0.806769 | 7.003019e-50 | -8.615850e-47 |
| Msa0199820 | Msa0217400 | 0.829286 | 5.604290e-55 | -8.615850e-47 |
| Msa0199820 | Msa0233300 | 0.809509 | 1.826876e-50 | -8.615850e-47 |
| Msa0199820 | Msa0249560 | 0.803618 | 3.198874e-49 | -8.615850e-47 |
| Msa0199820 | Msa0258760 | 0.809914 | 1.494751e-50 | -8.615850e-47 |
| Msa0199820 | Msa0260810 | 0.827088 | 1.897259e-54 | -8.615850e-47 |
| Msa0199820 | Msa0267760 | 0.802298 | 5.995096e-49 | -8.615850e-47 |
| Msa0199820 | Msa0280570 | 0.966867 | 1.692140e-126 | -8.615850e-47 |
| Msa0199820 | Msa0323080 | 0.835495 | 1.622816e-56 | -8.615850e-47 |
| Msa0199820 | Msa0335040 | 0.828605 | 8.194019e-55 | -8.615850e-47 |
| Msa0199820 | Msa0344830 | 0.815371 | 9.565467e-52 | -8.615850e-47 |
| Msa0199820 | Msa0377530 | 0.810295 | 1.237620e-50 | -8.615850e-47 |
| Msa0199820 | Msa0449760 | 0.808205 | 3.471562e-50 | -8.615850e-47 |
| Msa0199820 | Msa0449830 | 0.802536 | 5.356202e-49 | -8.615850e-47 |
| Msa0199820 | Msa0473240 | 0.811000 | 8.713835e-51 | -8.615850e-47 |
| Msa0199820 | Msa0484780 | 0.805729 | 1.160051e-49 | -8.615850e-47 |
| Msa0199820 | Msa0492880 | 0.805121 | 1.555274e-49 | -8.615850e-47 |
| Msa0199820 | Msa0517490 | 0.817305 | 3.533240e-52 | -8.615850e-47 |
| Msa0199820 | Msa0526710 | 0.811939 | 5.447893e-51 | -8.615850e-47 |
| Msa0199820 | Msa0562440 | 0.820672 | 6.061366e-53 | -8.615850e-47 |
| Msa0199820 | Msa0587690 | 0.821488 | 3.930802e-53 | -8.615850e-47 |
| Msa0199820 | Msa0613460 | 0.814691 | 1.353945e-51 | -8.615850e-47 |
| Msa0199820 | Msa0649800 | 0.802427 | 5.640716e-49 | -8.615850e-47 |
| Msa0199820 | Msa0743680 | 0.804180 | 2.445132e-49 | -8.615850e-47 |
| Msa0199820 | Msa0908170 | 0.814884 | 1.227004e-51 | -8.615850e-47 |
| Msa0199820 | Msa0992490 | -0.818040 | 2.412118e-52 | -8.615850e-47 |
| Msa0199820 | Msa1027290 | 0.804739 | 1.868967e-49 | -8.615850e-47 |
| Msa0199820 | Msa1028270 | 0.803467 | 3.437434e-49 | -8.615850e-47 |
| Msa0199820 | Msa1075220 | -0.810090 | 1.370204e-50 | -8.615850e-47 |
| Msa0199820 | Msa1087470 | 0.840914 | 6.524648e-58 | -8.615850e-47 |
| Msa0199820 | Msa1095480 | 0.824977 | 6.024163e-54 | -8.615850e-47 |
| Msa0199820 | Msa1162550 | -0.814858 | 1.243440e-51 | -8.615850e-47 |
| Msa0199820 | Msa1362880 | 0.816984 | 4.171502e-52 | -8.615850e-47 |
| Msa0199820 | Msa1363890 | 0.810671 | 1.026701e-50 | -8.615850e-47 |
| Msa0199820 | Msa1369530 | 0.816358 | 5.762625e-52 | -8.615850e-47 |
| Msa0199820 | Msa1390120 | 0.827540 | 1.478430e-54 | -8.615850e-47 |
| Msa0199820 | Msa1395530 | 0.829062 | 6.351031e-55 | -8.615850e-47 |
| Msa0199820 | Msa1396830 | 0.810715 | 1.004052e-50 | -8.615850e-47 |
| Msa0199820 | Msa1404540 | 0.820844 | 5.532742e-53 | -8.615850e-47 |
| Msa0199820 | Msa1408790 | 0.836735 | 7.859817e-57 | -8.615850e-47 |
| Msa0199820 | Msa1431060 | 0.811774 | 5.916289e-51 | -8.615850e-47 |
| Msa0199820 | Msa1436040 | 0.833491 | 5.174300e-56 | -8.615850e-47 |
| Msa0199820 | Msa1440600 | 0.808646 | 2.796171e-50 | -8.615850e-47 |
| Msa0199820 | Msa1451620 | -0.801807 | 7.563956e-49 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0199820 | MtrunA17_Chr2g0294531 | 96.154 | 52 | 0 | 1 | 1 | 52 | 1 | 50 | 2.67e-28 | 96.3 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 10 sgRNAs with CRISPR-Local
Find 10 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| GACTTTGAATTTGAAGCAAT+CGG | 0.406582 | 2_1:-19206262 | None:intergenic |
| CTCAACTGTTGATCTTTGCA+CGG | 0.434979 | 2_1:-19206391 | None:intergenic |
| CATTCAACAACCATGGCAAC+GGG | 0.455582 | 2_1:+19206354 | Msa0199820:CDS |
| TGAGTTTGCAGTGCCATGAT+TGG | 0.461841 | 2_1:-19206333 | None:intergenic |
| AGTCTTGCTTCCCGTTGCCA+TGG | 0.528592 | 2_1:-19206364 | None:intergenic |
| TCATTCAACAACCATGGCAA+CGG | 0.561765 | 2_1:+19206353 | Msa0199820:CDS |
| TCAACTGTTGATCTTTGCAC+GGG | 0.562450 | 2_1:-19206390 | None:intergenic |
| AAACTTCTTGAGACTGAGGA+AGG | 0.625104 | 2_1:+19206290 | Msa0199820:CDS |
| GCAAACTCATTCAACAACCA+TGG | 0.640162 | 2_1:+19206347 | Msa0199820:CDS |
| ACGCAAACTTCTTGAGACTG+AGG | 0.679118 | 2_1:+19206286 | Msa0199820:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| ! | GACTTTGAATTTGAAGCAAT+CGG | - | chr2_1:19206265-19206284 | None:intergenic | 30.0% |
| ! | GAACTTTTCAACTCCAATCA+TGG | + | chr2_1:19206320-19206339 | Msa0199820:CDS | 35.0% |
| AAACTTCTTGAGACTGAGGA+AGG | + | chr2_1:19206290-19206309 | Msa0199820:CDS | 40.0% | |
| GCAAACTCATTCAACAACCA+TGG | + | chr2_1:19206347-19206366 | Msa0199820:CDS | 40.0% | |
| TCATTCAACAACCATGGCAA+CGG | + | chr2_1:19206353-19206372 | Msa0199820:CDS | 40.0% | |
| TCAACTGTTGATCTTTGCAC+GGG | - | chr2_1:19206393-19206412 | None:intergenic | 40.0% | |
| ACGCAAACTTCTTGAGACTG+AGG | + | chr2_1:19206286-19206305 | Msa0199820:CDS | 45.0% | |
| TGAGTTTGCAGTGCCATGAT+TGG | - | chr2_1:19206336-19206355 | None:intergenic | 45.0% | |
| CATTCAACAACCATGGCAAC+GGG | + | chr2_1:19206354-19206373 | Msa0199820:CDS | 45.0% | |
| AGTCTTGCTTCCCGTTGCCA+TGG | - | chr2_1:19206367-19206386 | None:intergenic | 55.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| chr2_1 | gene | 19206254 | 19206412 | 19206254 | ID=Msa0199820;Name=Msa0199820 |
| chr2_1 | mRNA | 19206254 | 19206412 | 19206254 | ID=Msa0199820-mRNA-1;Parent=Msa0199820;Name=Msa0199820-mRNA-1;_AED=0.49;_eAED=0.74;_QI=0|-1|0|1|-1|1|1|0|52 |
| chr2_1 | exon | 19206254 | 19206412 | 19206254 | ID=Msa0199820-mRNA-1:exon:8017;Parent=Msa0199820-mRNA-1 |
| chr2_1 | CDS | 19206254 | 19206412 | 19206254 | ID=Msa0199820-mRNA-1:cds;Parent=Msa0199820-mRNA-1 |
| Gene Sequence |
| Protein sequence |
