Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa0432290 | KEH19346.1 | 48.462 | 130 | 53 | 5 | 2 | 119 | 57 | 184 | 5.48e-24 | 102 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa0432290 | A0A072TQ93 | 48.462 | 130 | 53 | 5 | 2 | 119 | 57 | 184 | 2.62e-24 | 102 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
Msa0142220 | Msa0432290 | 0.830997 | 2.142174e-55 | -8.615850e-47 |
Msa0153910 | Msa0432290 | 0.823962 | 1.044352e-53 | -8.615850e-47 |
Msa0221060 | Msa0432290 | 0.802842 | 4.629554e-49 | -8.615850e-47 |
Msa0399300 | Msa0432290 | 0.805433 | 1.337879e-49 | -8.615850e-47 |
Msa0431690 | Msa0432290 | 0.804716 | 1.890121e-49 | -8.615850e-47 |
Msa0432290 | Msa0432300 | 0.826190 | 3.107454e-54 | -8.615850e-47 |
Msa0432290 | Msa0437990 | 0.821627 | 3.651908e-53 | -8.615850e-47 |
Msa0432290 | Msa0456200 | 0.821932 | 3.104050e-53 | -8.615850e-47 |
Msa0432290 | Msa0512890 | 0.804274 | 2.336943e-49 | -8.615850e-47 |
Msa0432290 | Msa0512900 | 0.820925 | 5.300521e-53 | -8.615850e-47 |
Msa0432290 | Msa0532350 | 0.804458 | 2.139146e-49 | -8.615850e-47 |
Msa0432290 | Msa0604350 | 0.816056 | 6.731133e-52 | -8.615850e-47 |
Msa0432290 | Msa0627410 | 0.815954 | 7.092579e-52 | -8.615850e-47 |
Msa0432290 | Msa0636170 | 0.835980 | 1.223472e-56 | -8.615850e-47 |
Msa0432290 | Msa0657970 | 0.816863 | 4.441361e-52 | -8.615850e-47 |
Msa0432290 | Msa0673450 | 0.812115 | 4.987488e-51 | -8.615850e-47 |
Msa0432290 | Msa0678930 | 0.807664 | 4.525125e-50 | -8.615850e-47 |
Msa0432290 | Msa0726140 | 0.815616 | 8.436515e-52 | -8.615850e-47 |
Msa0432290 | Msa0741570 | 0.818417 | 1.981434e-52 | -8.615850e-47 |
Msa0432290 | Msa0764960 | 0.815693 | 8.112754e-52 | -8.615850e-47 |
Msa0432290 | Msa0766630 | 0.815511 | 8.903444e-52 | -8.615850e-47 |
Msa0432290 | Msa0767720 | 0.807371 | 5.221896e-50 | -8.615850e-47 |
Msa0432290 | Msa0789250 | 0.815116 | 1.090026e-51 | -8.615850e-47 |
Msa0432290 | Msa0793640 | 0.806091 | 9.735621e-50 | -8.615850e-47 |
Msa0432290 | Msa0806090 | 0.811997 | 5.289939e-51 | -8.615850e-47 |
Msa0432290 | Msa0874980 | 0.801225 | 9.953131e-49 | -8.615850e-47 |
Msa0432290 | Msa0885280 | 0.844305 | 8.208989e-59 | -8.615850e-47 |
Msa0432290 | Msa0885290 | 0.842672 | 2.241878e-58 | -8.615850e-47 |
Msa0432290 | Msa0887990 | 0.822544 | 2.238548e-53 | -8.615850e-47 |
Msa0432290 | Msa0897880 | 0.802154 | 6.419641e-49 | -8.615850e-47 |
Msa0432290 | Msa0909120 | 0.800055 | 1.724473e-48 | -8.615850e-47 |
Msa0432290 | Msa0954910 | 0.807786 | 4.263721e-50 | -8.615850e-47 |
Msa0432290 | Msa0954920 | 0.804232 | 2.384199e-49 | -8.615850e-47 |
Msa0432290 | Msa0965750 | 0.831289 | 1.816261e-55 | -8.615850e-47 |
Msa0432290 | Msa1014540 | 0.808474 | 3.042552e-50 | -8.615850e-47 |
Msa0432290 | Msa1071110 | 0.810011 | 1.424613e-50 | -8.615850e-47 |
Msa0432290 | Msa1079180 | 0.808101 | 3.653674e-50 | -8.615850e-47 |
Msa0432290 | Msa1082500 | 0.811869 | 5.642248e-51 | -8.615850e-47 |
Msa0432290 | Msa1084240 | 0.802501 | 5.444110e-49 | -8.615850e-47 |
Msa0432290 | Msa1116260 | 0.823402 | 1.412027e-53 | -8.615850e-47 |
Msa0432290 | Msa1136090 | 0.806319 | 8.714536e-50 | -8.615850e-47 |
Msa0432290 | Msa1160670 | 0.831816 | 1.347365e-55 | -8.615850e-47 |
Msa0432290 | Msa1162550 | -0.801034 | 1.089090e-48 | -8.615850e-47 |
Msa0432290 | Msa1187940 | 0.833351 | 5.607326e-56 | -8.615850e-47 |
Msa0432290 | Msa1187950 | 0.818454 | 1.944316e-52 | -8.615850e-47 |
Msa0432290 | Msa1297210 | 0.826479 | 2.652015e-54 | -8.615850e-47 |
Msa0432290 | Msa1342840 | 0.816370 | 5.727314e-52 | -8.615850e-47 |
Msa0432290 | Msa1397610 | 0.804731 | 1.876901e-49 | -8.615850e-47 |
Msa0432290 | Msa1435650 | 0.813980 | 1.944856e-51 | -8.615850e-47 |
Msa0432290 | Msa1451570 | 0.817233 | 3.667683e-52 | -8.615850e-47 |
Msa0262510 | Msa0432290 | 0.806068 | 9.840897e-50 | -8.615850e-47 |
Msa0270520 | Msa0432290 | 0.801226 | 9.951842e-49 | -8.615850e-47 |
Msa0294950 | Msa0432290 | 0.802576 | 5.255491e-49 | -8.615850e-47 |
Msa0309020 | Msa0432290 | 0.807469 | 4.979107e-50 | -8.615850e-47 |
Msa0326200 | Msa0432290 | 0.823363 | 1.442128e-53 | -8.615850e-47 |
Msa0329190 | Msa0432290 | 0.830468 | 2.887725e-55 | -8.615850e-47 |
Msa0338110 | Msa0432290 | 0.804633 | 1.967456e-49 | -8.615850e-47 |
Msa0353190 | Msa0432290 | 0.809160 | 2.170672e-50 | -8.615850e-47 |
Msa0363300 | Msa0432290 | 0.801151 | 1.030713e-48 | -8.615850e-47 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa0432290 | MtrunA17_Chr8g0356491 | 48.462 | 130 | 53 | 5 | 2 | 119 | 57 | 184 | 1.09e-25 | 101 |
Msa0432290 | MtrunA17_Chr5g0397151 | 46.154 | 130 | 56 | 5 | 2 | 119 | 60 | 187 | 2.82e-23 | 94.4 |
Msa0432290 | MtrunA17_Chr1g0173981 | 38.168 | 131 | 68 | 4 | 2 | 119 | 50 | 180 | 5.72e-14 | 67.8 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Find 19 sgRNAs with CRISPR-Local
Find 24 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TTTCAAGAATGCCTTTAAAT+TGG | 0.183175 | 3_2:-84482466 | Msa0432290:CDS |
TTAACTATTGCTCATGAAAT+AGG | 0.189431 | 3_2:-84482409 | Msa0432290:CDS |
ATAATGATTGACAAAATTAT+TGG | 0.198219 | 3_2:+84482281 | None:intergenic |
TAAGGAACCGTCCAATTTAA+AGG | 0.251990 | 3_2:+84482455 | None:intergenic |
AAGTGGGATGATGAACTATC+AGG | 0.416467 | 3_2:-84482511 | Msa0432290:CDS |
CAGATGTATATCAAAGAAAG+TGG | 0.506950 | 3_2:-84482528 | Msa0432290:CDS |
AAGAATGCCTTTAAATTGGA+CGG | 0.514925 | 3_2:-84482462 | Msa0432290:intron |
GGAAAGATCCACTACACCCT+TGG | 0.522954 | 3_2:-84482388 | Msa0432290:CDS |
CAAAATCAATCCCTCGAGAG+AGG | 0.523585 | 3_2:+84482610 | None:intergenic |
CAATCCCTCGAGAGAGGGAA+AGG | 0.542174 | 3_2:+84482616 | None:intergenic |
CTCTGCCTTTCCCTCTCTCG+AGG | 0.551667 | 3_2:-84482621 | Msa0432290:CDS |
TCTGCCTTTCCCTCTCTCGA+GGG | 0.552631 | 3_2:-84482620 | Msa0432290:CDS |
TCACATTTCCAAGGGTGTAG+TGG | 0.568795 | 3_2:+84482380 | None:intergenic |
TCTGTAACATCACATTTCCA+AGG | 0.586222 | 3_2:+84482371 | None:intergenic |
ATTGCAGAATAGTAAGAACT+AGG | 0.596249 | 3_2:+84482348 | None:intergenic |
AAAATCAATCCCTCGAGAGA+GGG | 0.610614 | 3_2:+84482611 | None:intergenic |
AGATGTATATCAAAGAAAGT+GGG | 0.627286 | 3_2:-84482527 | Msa0432290:CDS |
TAGTATCAACTATAATCGAA+AGG | 0.630605 | 3_2:-84482326 | Msa0432290:CDS |
CTGTAACATCACATTTCCAA+GGG | 0.635027 | 3_2:+84482372 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!!! | ATAAAAAAATTTGTTATTAG+TGG | - | chr3_2:84482614-84482633 | Msa0432290:CDS | 10.0% |
!! | ATAATGATTGACAAAATTAT+TGG | + | chr3_2:84482540-84482559 | None:intergenic | 15.0% |
!!! | AATAATTTTGTCAATCATTA+TGG | - | chr3_2:84482539-84482558 | Msa0432290:CDS | 15.0% |
!!! | TTATTGGACATTTTCATATT+TGG | + | chr3_2:84482524-84482543 | None:intergenic | 20.0% |
!! | TTTTGACAAAGTTTCAACAT+TGG | + | chr3_2:84482240-84482259 | None:intergenic | 25.0% |
! | AGATGTATATCAAAGAAAGT+GGG | - | chr3_2:84482291-84482310 | Msa0432290:CDS | 25.0% |
! | TTTCAAGAATGCCTTTAAAT+TGG | - | chr3_2:84482352-84482371 | Msa0432290:CDS | 25.0% |
!!! | CTTTTGACTCTAATTTGATA+AGG | + | chr3_2:84482384-84482403 | None:intergenic | 25.0% |
! | TTAACTATTGCTCATGAAAT+AGG | - | chr3_2:84482409-84482428 | Msa0432290:CDS | 25.0% |
! | TAGTATCAACTATAATCGAA+AGG | - | chr3_2:84482492-84482511 | Msa0432290:CDS | 25.0% |
CAGATGTATATCAAAGAAAG+TGG | - | chr3_2:84482290-84482309 | Msa0432290:CDS | 30.0% | |
AAGAATGCCTTTAAATTGGA+CGG | - | chr3_2:84482356-84482375 | Msa0432290:intron | 30.0% | |
ATTGCAGAATAGTAAGAACT+AGG | + | chr3_2:84482473-84482492 | None:intergenic | 30.0% | |
TAAGGAACCGTCCAATTTAA+AGG | + | chr3_2:84482366-84482385 | None:intergenic | 35.0% | |
CTGTAACATCACATTTCCAA+GGG | + | chr3_2:84482449-84482468 | None:intergenic | 35.0% | |
TCTGTAACATCACATTTCCA+AGG | + | chr3_2:84482450-84482469 | None:intergenic | 35.0% | |
AAAATCAATCCCTCGAGAGA+GGG | + | chr3_2:84482210-84482229 | None:intergenic | 40.0% | |
AAGTGGGATGATGAACTATC+AGG | - | chr3_2:84482307-84482326 | Msa0432290:CDS | 40.0% | |
CAAAATCAATCCCTCGAGAG+AGG | + | chr3_2:84482211-84482230 | None:intergenic | 45.0% | |
! | TCACATTTCCAAGGGTGTAG+TGG | + | chr3_2:84482441-84482460 | None:intergenic | 45.0% |
GGAAAGATCCACTACACCCT+TGG | - | chr3_2:84482430-84482449 | Msa0432290:intron | 50.0% | |
TCTGCCTTTCCCTCTCTCGA+GGG | - | chr3_2:84482198-84482217 | Msa0432290:CDS | 55.0% | |
CAATCCCTCGAGAGAGGGAA+AGG | + | chr3_2:84482205-84482224 | None:intergenic | 55.0% | |
CTCTGCCTTTCCCTCTCTCG+AGG | - | chr3_2:84482197-84482216 | Msa0432290:CDS | 60.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
chr3_2 | gene | 84482194 | 84482646 | 84482194 | ID=Msa0432290;Name=Msa0432290 |
chr3_2 | mRNA | 84482194 | 84482646 | 84482194 | ID=Msa0432290-mRNA-1;Parent=Msa0432290;Name=Msa0432290-mRNA-1;_AED=0.18;_eAED=0.32;_QI=0|0|0|1|0|0|3|0|142 |
chr3_2 | exon | 84482463 | 84482646 | 84482463 | ID=Msa0432290-mRNA-1:exon:23897;Parent=Msa0432290-mRNA-1 |
chr3_2 | exon | 84482379 | 84482445 | 84482379 | ID=Msa0432290-mRNA-1:exon:23896;Parent=Msa0432290-mRNA-1 |
chr3_2 | exon | 84482194 | 84482371 | 84482194 | ID=Msa0432290-mRNA-1:exon:23895;Parent=Msa0432290-mRNA-1 |
chr3_2 | CDS | 84482463 | 84482646 | 84482463 | ID=Msa0432290-mRNA-1:cds;Parent=Msa0432290-mRNA-1 |
chr3_2 | CDS | 84482379 | 84482445 | 84482379 | ID=Msa0432290-mRNA-1:cds;Parent=Msa0432290-mRNA-1 |
chr3_2 | CDS | 84482194 | 84482371 | 84482194 | ID=Msa0432290-mRNA-1:cds;Parent=Msa0432290-mRNA-1 |
Gene Sequence |
Protein sequence |