Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1392420 | VVA28551.1 | 78.571 | 42 | 9 | 0 | 1 | 42 | 54 | 95 | 1.42e-14 | 72.4 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1392420 | sp|Q93Y09|SCP45_ARATH | 66.667 | 42 | 14 | 0 | 1 | 42 | 52 | 93 | 1.90e-13 | 65.5 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1392420 | A0A5E4FMN4 | 78.571 | 42 | 9 | 0 | 1 | 42 | 54 | 95 | 6.81e-15 | 72.4 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0012040 | Msa1392420 | 0.812005 | 5.268778e-51 | -8.615850e-47 |
| Msa0054730 | Msa1392420 | -0.826198 | 3.094723e-54 | -8.615850e-47 |
| Msa0106370 | Msa1392420 | -0.803699 | 3.077400e-49 | -8.615850e-47 |
| Msa1392420 | Msa1411070 | 0.812573 | 3.961495e-51 | -8.615850e-47 |
| Msa1392420 | Msa1430680 | 0.808386 | 3.177947e-50 | -8.615850e-47 |
| Msa1392420 | Msa1440000 | 0.811452 | 6.953583e-51 | -8.615850e-47 |
| Msa1392420 | Msa1453780 | -0.804430 | 2.168261e-49 | -8.615850e-47 |
| Msa1392420 | Msa1464940 | 0.814237 | 1.706496e-51 | -8.615850e-47 |
| Msa0610430 | Msa1392420 | 0.809564 | 1.777484e-50 | -8.615850e-47 |
| Msa0647450 | Msa1392420 | -0.818372 | 2.028423e-52 | -8.615850e-47 |
| Msa0661190 | Msa1392420 | -0.827381 | 1.614589e-54 | -8.615850e-47 |
| Msa0662650 | Msa1392420 | 0.800164 | 1.638804e-48 | -8.615850e-47 |
| Msa0708860 | Msa1392420 | 0.801304 | 9.592208e-49 | -8.615850e-47 |
| Msa0743720 | Msa1392420 | 0.822479 | 2.317600e-53 | -8.615850e-47 |
| Msa0771720 | Msa1392420 | 0.823052 | 1.704395e-53 | -8.615850e-47 |
| Msa0773840 | Msa1392420 | 0.808338 | 3.252937e-50 | -8.615850e-47 |
| Msa0795920 | Msa1392420 | 0.807701 | 4.443971e-50 | -8.615850e-47 |
| Msa0133130 | Msa1392420 | 0.817460 | 3.260846e-52 | -8.615850e-47 |
| Msa0185640 | Msa1392420 | -0.804369 | 2.232935e-49 | -8.615850e-47 |
| Msa1233500 | Msa1392420 | 0.805906 | 1.064571e-49 | -8.615850e-47 |
| Msa1233890 | Msa1392420 | 0.816793 | 4.605564e-52 | -8.615850e-47 |
| Msa1247250 | Msa1392420 | 0.804291 | 2.317793e-49 | -8.615850e-47 |
| Msa1296880 | Msa1392420 | 0.802924 | 4.452712e-49 | -8.615850e-47 |
| Msa1296960 | Msa1392420 | -0.801346 | 9.404549e-49 | -8.615850e-47 |
| Msa1302190 | Msa1392420 | -0.815063 | 1.120104e-51 | -8.615850e-47 |
| Msa1322190 | Msa1392420 | 0.821550 | 3.804347e-53 | -8.615850e-47 |
| Msa1327550 | Msa1392420 | 0.807335 | 5.315333e-50 | -8.615850e-47 |
| Msa0379640 | Msa1392420 | 0.820427 | 6.900670e-53 | -8.615850e-47 |
| Msa0428930 | Msa1392420 | 0.815266 | 1.009664e-51 | -8.615850e-47 |
| Msa0442200 | Msa1392420 | 0.809812 | 1.572567e-50 | -8.615850e-47 |
| Msa0442850 | Msa1392420 | 0.805660 | 1.199054e-49 | -8.615850e-47 |
| Msa0453890 | Msa1392420 | 0.806919 | 6.511096e-50 | -8.615850e-47 |
| Msa0458010 | Msa1392420 | 0.800339 | 1.509589e-48 | -8.615850e-47 |
| Msa0475490 | Msa1392420 | 0.801070 | 1.071027e-48 | -8.615850e-47 |
| Msa0477130 | Msa1392420 | -0.801504 | 8.729256e-49 | -8.615850e-47 |
| Msa0479660 | Msa1392420 | 0.806608 | 7.572913e-50 | -8.615850e-47 |
| Msa0993290 | Msa1392420 | 0.800743 | 1.248822e-48 | -8.615850e-47 |
| Msa1075220 | Msa1392420 | -0.800540 | 1.374013e-48 | -8.615850e-47 |
| Msa0249700 | Msa1392420 | 0.841702 | 4.047206e-58 | -8.615850e-47 |
| Msa0269450 | Msa1392420 | 0.800485 | 1.409807e-48 | -8.615850e-47 |
| Msa0298700 | Msa1392420 | 0.803848 | 2.866013e-49 | -8.615850e-47 |
| Msa0306210 | Msa1392420 | -0.807384 | 5.188488e-50 | -8.615850e-47 |
| Msa0336420 | Msa1392420 | 0.800579 | 1.348720e-48 | -8.615850e-47 |
| Msa1124540 | Msa1392420 | -0.817329 | 3.490188e-52 | -8.615850e-47 |
| Msa1143930 | Msa1392420 | -0.824892 | 6.309074e-54 | -8.615850e-47 |
| Msa1205010 | Msa1392420 | -0.801744 | 7.792083e-49 | -8.615850e-47 |
| Msa1205130 | Msa1392420 | 0.818805 | 1.617963e-52 | -8.615850e-47 |
| Msa1217430 | Msa1392420 | -0.802960 | 4.378736e-49 | -8.615850e-47 |
| Msa0500360 | Msa1392420 | 0.803875 | 2.829053e-49 | -8.615850e-47 |
| Msa0502100 | Msa1392420 | 0.802885 | 4.537502e-49 | -8.615850e-47 |
| Msa0540070 | Msa1392420 | 0.808825 | 2.560468e-50 | -8.615850e-47 |
| Msa0585000 | Msa1392420 | -0.809562 | 1.779267e-50 | -8.615850e-47 |
| Msa0597330 | Msa1392420 | 0.802662 | 5.045156e-49 | -8.615850e-47 |
| Msa0876850 | Msa1392420 | -0.807237 | 5.574410e-50 | -8.615850e-47 |
| Msa0979100 | Msa1392420 | 0.803761 | 2.987686e-49 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1392420 | MtrunA17_Chr3g0094811 | 73.810 | 42 | 11 | 0 | 1 | 42 | 51 | 92 | 1.37e-16 | 70.9 |
| Msa1392420 | MtrunA17_Chr2g0304931 | 76.190 | 42 | 10 | 0 | 1 | 42 | 59 | 100 | 2.78e-16 | 70.1 |
| Msa1392420 | MtrunA17_Chr1g0165811 | 71.429 | 42 | 12 | 0 | 1 | 42 | 51 | 92 | 6.60e-16 | 68.2 |
| Msa1392420 | MtrunA17_Chr8g0385871 | 69.048 | 42 | 13 | 0 | 1 | 42 | 54 | 95 | 1.07e-14 | 65.9 |
| Msa1392420 | MtrunA17_Chr7g0229611 | 70.000 | 40 | 12 | 0 | 3 | 42 | 47 | 86 | 3.68e-14 | 60.5 |
| Msa1392420 | MtrunA17_Chr3g0131731 | 64.286 | 42 | 15 | 0 | 1 | 42 | 52 | 93 | 4.53e-14 | 63.9 |
| Msa1392420 | MtrunA17_Chr7g0229621 | 70.000 | 40 | 12 | 0 | 3 | 42 | 47 | 86 | 1.02e-13 | 59.7 |
| Msa1392420 | MtrunA17_Chr7g0229631 | 70.000 | 40 | 12 | 0 | 3 | 42 | 55 | 94 | 1.83e-13 | 60.1 |
| Msa1392420 | MtrunA17_Chr1g0204191 | 64.286 | 42 | 15 | 0 | 1 | 42 | 112 | 153 | 2.64e-13 | 61.6 |
| Msa1392420 | MtrunA17_Chr7g0221551 | 64.286 | 42 | 15 | 0 | 1 | 42 | 51 | 92 | 3.49e-13 | 61.2 |
| Msa1392420 | MtrunA17_Chr1g0153931 | 53.061 | 49 | 23 | 0 | 1 | 49 | 97 | 145 | 2.09e-12 | 58.9 |
| Msa1392420 | MtrunA17_Chr2g0281621 | 55.102 | 49 | 22 | 0 | 1 | 49 | 56 | 104 | 2.40e-12 | 58.9 |
| Msa1392420 | MtrunA17_Chr1g0153941 | 53.061 | 49 | 23 | 0 | 1 | 49 | 99 | 147 | 5.20e-12 | 58.2 |
| Msa1392420 | MtrunA17_Chr4g0068841 | 57.143 | 42 | 18 | 0 | 1 | 42 | 60 | 101 | 6.64e-12 | 57.8 |
| Msa1392420 | MtrunA17_Chr3g0126051 | 64.286 | 42 | 15 | 0 | 1 | 42 | 54 | 95 | 8.39e-12 | 57.4 |
| Msa1392420 | MtrunA17_Chr4g0068861 | 57.143 | 42 | 18 | 0 | 1 | 42 | 106 | 147 | 1.60e-11 | 56.6 |
| Msa1392420 | MtrunA17_Chr4g0047861 | 51.020 | 49 | 24 | 0 | 1 | 49 | 74 | 122 | 3.68e-11 | 55.5 |
| Msa1392420 | MtrunA17_Chr5g0431301 | 61.905 | 42 | 16 | 0 | 1 | 42 | 50 | 91 | 4.78e-11 | 55.5 |
| Msa1392420 | MtrunA17_Chr3g0118891 | 59.524 | 42 | 17 | 0 | 1 | 42 | 99 | 140 | 7.65e-11 | 54.7 |
| Msa1392420 | MtrunA17_Chr1g0153881 | 48.980 | 49 | 25 | 0 | 1 | 49 | 111 | 159 | 9.88e-11 | 54.3 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1392420 | AT1G28110.1 | 66.667 | 42 | 14 | 0 | 1 | 42 | 52 | 93 | 1.94e-14 | 65.5 |
| Msa1392420 | AT1G28110.2 | 66.667 | 42 | 14 | 0 | 1 | 42 | 52 | 93 | 1.94e-14 | 65.5 |
| Msa1392420 | AT2G33530.1 | 66.667 | 42 | 14 | 0 | 1 | 42 | 54 | 95 | 1.52e-13 | 62.8 |
| Msa1392420 | AT1G61130.1 | 58.696 | 46 | 19 | 0 | 4 | 49 | 55 | 100 | 6.89e-12 | 58.2 |
| Msa1392420 | AT1G11080.2 | 53.061 | 49 | 23 | 0 | 1 | 49 | 71 | 119 | 1.71e-11 | 57.0 |
| Msa1392420 | AT1G11080.1 | 53.061 | 49 | 23 | 0 | 1 | 49 | 71 | 119 | 1.93e-11 | 57.0 |
| Msa1392420 | AT5G23210.1 | 54.762 | 42 | 19 | 0 | 1 | 42 | 72 | 113 | 2.06e-11 | 56.6 |
| Msa1392420 | AT5G23210.3 | 54.762 | 42 | 19 | 0 | 1 | 42 | 72 | 113 | 2.32e-11 | 56.6 |
| Msa1392420 | AT1G43780.1 | 72.222 | 36 | 10 | 0 | 7 | 42 | 64 | 99 | 3.30e-11 | 56.2 |
| Msa1392420 | AT2G12480.3 | 61.905 | 42 | 16 | 0 | 1 | 42 | 52 | 93 | 3.46e-11 | 56.2 |
| Msa1392420 | AT4G15100.1 | 53.061 | 49 | 23 | 0 | 1 | 49 | 65 | 113 | 3.50e-11 | 56.2 |
| Msa1392420 | AT2G12480.4 | 61.905 | 42 | 16 | 0 | 1 | 42 | 52 | 93 | 4.12e-11 | 55.8 |
| Msa1392420 | AT2G12480.1 | 61.905 | 42 | 16 | 0 | 1 | 42 | 52 | 93 | 4.29e-11 | 55.8 |
| Msa1392420 | AT2G12480.2 | 61.905 | 42 | 16 | 0 | 1 | 42 | 52 | 93 | 4.29e-11 | 55.8 |
| Msa1392420 | AT5G42230.1 | 72.222 | 36 | 10 | 0 | 7 | 42 | 55 | 90 | 7.21e-11 | 55.1 |
| Msa1392420 | AT5G42230.2 | 72.222 | 36 | 10 | 0 | 7 | 42 | 55 | 90 | 7.21e-11 | 55.1 |
Find 22 sgRNAs with CRISPR-Local
Find 38 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| AAAATCACTCGGTTGAAATT+AGG | 0.196260 | tig0021499:+72555 | None:intergenic |
| AAAAGAAGCATACTTGGTTA+TGG | 0.347326 | tig0021499:+72523 | None:intergenic |
| TACTGATAACTGGAATCTTT+AGG | 0.349143 | tig0021499:-72690 | Msa1392420:three_prime_UTR |
| TACCGGTCAAAATCTACTTT+TGG | 0.356029 | tig0021499:+73033 | None:intergenic |
| GTATGCAAATTACATTACTA+TGG | 0.372719 | tig0021499:-73013 | Msa1392420:exon |
| GGTTGCTCTTCCGTTGGCCT+AGG | 0.383442 | tig0021499:-72799 | Msa1392420:CDS |
| ACATTGAAGCTAAGCTAGAT+AGG | 0.384366 | tig0021499:+72583 | None:intergenic |
| GGAGCACCAAGGAGCGTTGC+TGG | 0.387042 | tig0021499:-72778 | Msa1392420:CDS |
| TGCTAGAATGTACTGATAAC+TGG | 0.395632 | tig0021499:-72700 | Msa1392420:three_prime_UTR |
| CTTTAGGTTCATAAATATAG+TGG | 0.414606 | tig0021499:-72674 | Msa1392420:three_prime_UTR |
| GGGCTTGGTTGCTCTTCCGT+TGG | 0.455046 | tig0021499:-72805 | Msa1392420:CDS |
| TCATAACCAGCAACGCTCCT+TGG | 0.495051 | tig0021499:+72772 | None:intergenic |
| CTAAGATTATTTGTAAATGT+CGG | 0.511902 | tig0021499:-72644 | Msa1392420:three_prime_UTR |
| CAACGCTCCTTGGTGCTCCT+AGG | 0.521898 | tig0021499:+72782 | None:intergenic |
| ATAATCTTCAGAGACTAGTA+AGG | 0.528473 | tig0021499:-73073 | None:intergenic |
| CGATCCAGCTTCAAAACCAT+TGG | 0.537499 | tig0021499:-72941 | Msa1392420:CDS |
| TAGTAATGTAATTTGCATAC+CGG | 0.545218 | tig0021499:+73016 | None:intergenic |
| CCATTCAACAAAAGCACCAA+TGG | 0.551134 | tig0021499:+72925 | None:intergenic |
| CCTTGGTGCTCCTAGGCCAA+CGG | 0.580344 | tig0021499:+72789 | None:intergenic |
| ATCAGTACATTCTAGCAGCA+AGG | 0.600578 | tig0021499:+72706 | None:intergenic |
| GGTTTGCCATGAAAATCACT+CGG | 0.641055 | tig0021499:+72544 | None:intergenic |
| CCGTTGGCCTAGGAGCACCA+AGG | 0.726967 | tig0021499:-72789 | Msa1392420:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !!! | TCTTACTTTTTTTTTTTTTT+TGG | - | tig0021499:72760-72779 | Msa1392420:exon | 10.0% |
| !!! | CTTACTTTTTTTTTTTTTTT+GGG | - | tig0021499:72761-72780 | Msa1392420:exon | 10.0% |
| !! | TATGCAAATGATAATATATT+CGG | - | tig0021499:72710-72729 | Msa1392420:three_prime_UTR | 15.0% |
| !!! | AATAGAAAAGTTTTCTATCT+TGG | + | tig0021499:72617-72636 | None:intergenic | 20.0% |
| !!! | TTTTTTTTTTGGGATTTTGA+AGG | - | tig0021499:72771-72790 | Msa1392420:CDS | 20.0% |
| !!! | TTTTTTTTTGGGATTTTGAA+GGG | - | tig0021499:72772-72791 | Msa1392420:CDS | 20.0% |
| !! | CTAAGATTATTTGTAAATGT+CGG | - | tig0021499:72953-72972 | Msa1392420:CDS | 20.0% |
| !! | TAGTAATGTAATTTGCATAC+CGG | + | tig0021499:72584-72603 | None:intergenic | 25.0% |
| ! | GTATGCAAATTACATTACTA+TGG | - | tig0021499:72584-72603 | Msa1392420:three_prime_UTR | 25.0% |
| !! | CTTTAGGTTCATAAATATAG+TGG | - | tig0021499:72923-72942 | Msa1392420:CDS | 25.0% |
| ! | ACTTTTCTATTATTTCGTCG+AGG | - | tig0021499:72626-72645 | Msa1392420:three_prime_UTR | 30.0% |
| TACTGATAACTGGAATCTTT+AGG | - | tig0021499:72907-72926 | Msa1392420:intron | 30.0% | |
| AAAATCACTCGGTTGAAATT+AGG | + | tig0021499:73045-73064 | None:intergenic | 30.0% | |
| !! | AAATCTACTTTTGGCTGATC+AGG | + | tig0021499:72558-72577 | None:intergenic | 35.0% |
| !! | AGCCAAAAGTAGATTTTGAC+CGG | - | tig0021499:72562-72581 | Msa1392420:three_prime_UTR | 35.0% |
| ! | TACCGGTCAAAATCTACTTT+TGG | + | tig0021499:72567-72586 | None:intergenic | 35.0% |
| TATATTCGGATGTAAACCAC+TGG | - | tig0021499:72724-72743 | Msa1392420:three_prime_UTR | 35.0% | |
| ! | TGCTAGAATGTACTGATAAC+TGG | - | tig0021499:72897-72916 | Msa1392420:intron | 35.0% |
| ACATTGAAGCTAAGCTAGAT+AGG | + | tig0021499:73017-73036 | None:intergenic | 35.0% | |
| ! | TTTCAACCGAGTGATTTTCA+TGG | - | tig0021499:73047-73066 | Msa1392420:five_prime_UTR | 35.0% |
| !!! | CAATGGTTTTGAAGCTGGAT+CGG | + | tig0021499:72658-72677 | None:intergenic | 40.0% |
| !! | CCATTCAACAAAAGCACCAA+TGG | + | tig0021499:72675-72694 | None:intergenic | 40.0% |
| !! | CCATTGGTGCTTTTGTTGAA+TGG | - | tig0021499:72672-72691 | Msa1392420:three_prime_UTR | 40.0% |
| !! | TTGGTGCTTTTGTTGAATGG+AGG | - | tig0021499:72675-72694 | Msa1392420:three_prime_UTR | 40.0% |
| ! | GCTTTTGTTGAATGGAGGTA+AGG | - | tig0021499:72680-72699 | Msa1392420:three_prime_UTR | 40.0% |
| !!! | TTTTGGGATTTTGAAGGGCT+TGG | - | tig0021499:72777-72796 | Msa1392420:CDS | 40.0% |
| ATCAGTACATTCTAGCAGCA+AGG | + | tig0021499:72894-72913 | None:intergenic | 40.0% | |
| GGTTTGCCATGAAAATCACT+CGG | + | tig0021499:73056-73075 | None:intergenic | 40.0% | |
| CGATCCAGCTTCAAAACCAT+TGG | - | tig0021499:72656-72675 | Msa1392420:three_prime_UTR | 45.0% | |
| !!! | AGCACCAATGGTTTTGAAGC+TGG | + | tig0021499:72663-72682 | None:intergenic | 45.0% |
| ! | AGATCAGATCAAAGCACCAG+TGG | + | tig0021499:72743-72762 | None:intergenic | 45.0% |
| TCATAACCAGCAACGCTCCT+TGG | + | tig0021499:72828-72847 | None:intergenic | 50.0% | |
| ! | GGGCTTGGTTGCTCTTCCGT+TGG | - | tig0021499:72792-72811 | Msa1392420:CDS | 60.0% |
| ! | GGTTGCTCTTCCGTTGGCCT+AGG | - | tig0021499:72798-72817 | Msa1392420:CDS | 60.0% |
| !! | CCTTGGTGCTCCTAGGCCAA+CGG | + | tig0021499:72811-72830 | None:intergenic | 60.0% |
| !! | CAACGCTCCTTGGTGCTCCT+AGG | + | tig0021499:72818-72837 | None:intergenic | 60.0% |
| !! | CCGTTGGCCTAGGAGCACCA+AGG | - | tig0021499:72808-72827 | Msa1392420:intron | 65.0% |
| !! | GGAGCACCAAGGAGCGTTGC+TGG | - | tig0021499:72819-72838 | Msa1392420:intron | 65.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| tig0021499 | gene | 72535 | 73084 | 72535 | ID=Msa1392420;Name=Msa1392420 |
| tig0021499 | mRNA | 72535 | 73084 | 72535 | ID=Msa1392420-mRNA-1;Parent=Msa1392420;Name=Msa1392420-mRNA-1;_AED=0.00;_eAED=0.00;_QI=68|1|1|1|1|1|2|227|52 |
| tig0021499 | exon | 72535 | 72826 | 72535 | ID=Msa1392420-mRNA-1:exon:13144;Parent=Msa1392420-mRNA-1 |
| tig0021499 | exon | 72923 | 73084 | 72923 | ID=Msa1392420-mRNA-1:exon:13143;Parent=Msa1392420-mRNA-1 |
| tig0021499 | five_prime_UTR | 73017 | 73084 | 73017 | ID=Msa1392420-mRNA-1:five_prime_utr;Parent=Msa1392420-mRNA-1 |
| tig0021499 | CDS | 72923 | 73016 | 72923 | ID=Msa1392420-mRNA-1:cds;Parent=Msa1392420-mRNA-1 |
| tig0021499 | CDS | 72762 | 72826 | 72762 | ID=Msa1392420-mRNA-1:cds;Parent=Msa1392420-mRNA-1 |
| tig0021499 | three_prime_UTR | 72535 | 72761 | 72535 | ID=Msa1392420-mRNA-1:three_prime_utr;Parent=Msa1392420-mRNA-1 |
| Gene Sequence |
| Protein sequence |
