Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0752070 | XP_003610640.1 | 94.521 | 73 | 2 | 1 | 1 | 73 | 1 | 71 | 3.08e-37 | 129 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0752070 | G7K0Z0 | 94.521 | 73 | 2 | 1 | 1 | 73 | 1 | 71 | 1.47e-37 | 129 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0065680 | Msa0752070 | -0.806994 | 6.277645e-50 | -8.615850e-47 |
| Msa0610130 | Msa0752070 | 0.808262 | 3.376504e-50 | -8.615850e-47 |
| Msa0614920 | Msa0752070 | 0.801326 | 9.493905e-49 | -8.615850e-47 |
| Msa0620620 | Msa0752070 | 0.806497 | 7.994886e-50 | -8.615850e-47 |
| Msa0711150 | Msa0752070 | 0.878178 | 3.464071e-69 | -8.615850e-47 |
| Msa0738030 | Msa0752070 | 0.802641 | 5.094784e-49 | -8.615850e-47 |
| Msa0741440 | Msa0752070 | 0.801670 | 8.069894e-49 | -8.615850e-47 |
| Msa0750850 | Msa0752070 | 0.829093 | 6.243150e-55 | -8.615850e-47 |
| Msa0752070 | Msa0784480 | 0.800601 | 1.335105e-48 | -8.615850e-47 |
| Msa0752070 | Msa0822500 | 0.819051 | 1.422493e-52 | -8.615850e-47 |
| Msa0752070 | Msa0826760 | 0.802238 | 6.168058e-49 | -8.615850e-47 |
| Msa0752070 | Msa0830230 | 0.847743 | 9.534710e-60 | -8.615850e-47 |
| Msa0752070 | Msa0861470 | 0.829088 | 6.258896e-55 | -8.615850e-47 |
| Msa0752070 | Msa0861570 | 0.826505 | 2.614435e-54 | -8.615850e-47 |
| Msa0752070 | Msa0894710 | 0.811560 | 6.586867e-51 | -8.615850e-47 |
| Msa0752070 | Msa0932100 | 0.823005 | 1.748054e-53 | -8.615850e-47 |
| Msa0752070 | Msa0932190 | 0.804916 | 1.717111e-49 | -8.615850e-47 |
| Msa0752070 | Msa0970230 | 0.821188 | 4.611230e-53 | -8.615850e-47 |
| Msa0752070 | Msa1071320 | 0.826493 | 2.632074e-54 | -8.615850e-47 |
| Msa0752070 | Msa1089450 | 0.807832 | 4.169025e-50 | -8.615850e-47 |
| Msa0752070 | Msa1089460 | 0.839711 | 1.345490e-57 | -8.615850e-47 |
| Msa0752070 | Msa1096070 | 0.808543 | 2.941187e-50 | -8.615850e-47 |
| Msa0752070 | Msa1206310 | 0.805095 | 1.575253e-49 | -8.615850e-47 |
| Msa0752070 | Msa1206360 | 0.812144 | 4.914652e-51 | -8.615850e-47 |
| Msa0752070 | Msa1276340 | 0.817319 | 3.507840e-52 | -8.615850e-47 |
| Msa0752070 | Msa1316360 | 0.807763 | 4.312198e-50 | -8.615850e-47 |
| Msa0752070 | Msa1346840 | 0.814301 | 1.651560e-51 | -8.615850e-47 |
| Msa0752070 | Msa1355890 | 0.830584 | 2.705229e-55 | -8.615850e-47 |
| Msa0752070 | Msa1380220 | 0.864658 | 1.037500e-64 | -8.615850e-47 |
| Msa0752070 | Msa1382790 | 0.814270 | 1.677768e-51 | -8.615850e-47 |
| Msa0752070 | Msa1389880 | 0.810492 | 1.122047e-50 | -8.615850e-47 |
| Msa0752070 | Msa1419690 | 0.802049 | 6.745415e-49 | -8.615850e-47 |
| Msa0138020 | Msa0752070 | 0.821605 | 3.695359e-53 | -8.615850e-47 |
| Msa0160960 | Msa0752070 | 0.807313 | 5.372414e-50 | -8.615850e-47 |
| Msa0217700 | Msa0752070 | 0.824560 | 7.556479e-54 | -8.615850e-47 |
| Msa0231060 | Msa0752070 | 0.803033 | 4.228983e-49 | -8.615850e-47 |
| Msa0233370 | Msa0752070 | 0.813715 | 2.224147e-51 | -8.615850e-47 |
| Msa0417330 | Msa0752070 | 0.806710 | 7.207176e-50 | -8.615850e-47 |
| Msa0432160 | Msa0752070 | 0.802891 | 4.524846e-49 | -8.615850e-47 |
| Msa0476680 | Msa0752070 | 0.805182 | 1.510344e-49 | -8.615850e-47 |
| Msa0241140 | Msa0752070 | 0.810112 | 1.354951e-50 | -8.615850e-47 |
| Msa0257520 | Msa0752070 | 0.815609 | 8.469204e-52 | -8.615850e-47 |
| Msa0278580 | Msa0752070 | 0.826067 | 3.324192e-54 | -8.615850e-47 |
| Msa0296820 | Msa0752070 | 0.816622 | 5.028089e-52 | -8.615850e-47 |
| Msa0317960 | Msa0752070 | 0.830902 | 2.260741e-55 | -8.615850e-47 |
| Msa0317970 | Msa0752070 | 0.804954 | 1.685349e-49 | -8.615850e-47 |
| Msa0347750 | Msa0752070 | 0.802464 | 5.540389e-49 | -8.615850e-47 |
| Msa0521010 | Msa0752070 | 0.806388 | 8.426643e-50 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0752070 | MtrunA17_Chr5g0393861 | 94.521 | 73 | 2 | 1 | 1 | 73 | 1 | 71 | 2.83e-41 | 129 |
| Msa0752070 | MtrunA17_Chr7g0221301 | 67.500 | 40 | 11 | 1 | 28 | 67 | 22 | 59 | 9.59e-11 | 52.0 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0752070 | AT3G19660.1 | 58.333 | 60 | 22 | 1 | 1 | 60 | 1 | 57 | 4.62e-14 | 60.5 |
Find 14 sgRNAs with CRISPR-Local
Find 11 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| CTCTTGTCCATCTTTATGTA+TGG | 0.307750 | 5_2:-5726197 | None:intergenic |
| AATAAGAATAAGAAATTATA+TGG | 0.312903 | 5_2:-5726330 | None:intergenic |
| ATTATTATCAGCAGCTTTCA+AGG | 0.340671 | 5_2:-5726276 | None:intergenic |
| GGCAAATCAGCTGGGAAATC+TGG | 0.373442 | 5_2:+5726118 | Msa0752070:CDS |
| GGTGACGTTGTGCTTGGTCT+TGG | 0.437766 | 5_2:-5726309 | None:intergenic |
| TAGAAGAATGGCAAATCAGC+TGG | 0.458624 | 5_2:+5726109 | None:intergenic |
| AAAGAAGCCATACATAAAGA+TGG | 0.499886 | 5_2:+5726190 | Msa0752070:CDS |
| TCAACGTTGAAGATGAAGAA+AGG | 0.541828 | 5_2:+5726167 | Msa0752070:CDS |
| TTATATGGTGACGTTGTGCT+TGG | 0.549241 | 5_2:-5726315 | None:intergenic |
| TTGTGCTTGGTCTTGGTGTG+TGG | 0.557118 | 5_2:-5726302 | None:intergenic |
| GGTGGAGTCAATAAAGTCAA+AGG | 0.580028 | 5_2:+5726139 | Msa0752070:CDS |
| AGAAGAATGGCAAATCAGCT+GGG | 0.603317 | 5_2:+5726110 | None:intergenic |
| AAATCAGCTGGGAAATCTGG+TGG | 0.634337 | 5_2:+5726121 | Msa0752070:CDS |
| GGACAAGAGTGCAAGTGTGA+AGG | 0.667874 | 5_2:+5726211 | Msa0752070:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| AAAGAAGCCATACATAAAGA+TGG | + | chr5_2:5726190-5726209 | Msa0752070:CDS | 30.0% | |
| ATTATTATCAGCAGCTTTCA+AGG | - | chr5_2:5726279-5726298 | None:intergenic | 30.0% | |
| TCAACGTTGAAGATGAAGAA+AGG | + | chr5_2:5726167-5726186 | Msa0752070:CDS | 35.0% | |
| CTCTTGTCCATCTTTATGTA+TGG | - | chr5_2:5726200-5726219 | None:intergenic | 35.0% | |
| GGTGGAGTCAATAAAGTCAA+AGG | + | chr5_2:5726139-5726158 | Msa0752070:CDS | 40.0% | |
| ! | TTATATGGTGACGTTGTGCT+TGG | - | chr5_2:5726318-5726337 | None:intergenic | 40.0% |
| AAATCAGCTGGGAAATCTGG+TGG | + | chr5_2:5726121-5726140 | Msa0752070:CDS | 45.0% | |
| GGCAAATCAGCTGGGAAATC+TGG | + | chr5_2:5726118-5726137 | Msa0752070:CDS | 50.0% | |
| ! | GGACAAGAGTGCAAGTGTGA+AGG | + | chr5_2:5726211-5726230 | Msa0752070:CDS | 50.0% |
| !! | TTGTGCTTGGTCTTGGTGTG+TGG | - | chr5_2:5726305-5726324 | None:intergenic | 50.0% |
| GGTGACGTTGTGCTTGGTCT+TGG | - | chr5_2:5726312-5726331 | None:intergenic | 55.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| chr5_2 | gene | 5726116 | 5726337 | 5726116 | ID=Msa0752070;Name=Msa0752070 |
| chr5_2 | mRNA | 5726116 | 5726337 | 5726116 | ID=Msa0752070-mRNA-1;Parent=Msa0752070;Name=Msa0752070-mRNA-1;_AED=0.01;_eAED=0.01;_QI=0|-1|0|1|-1|1|1|0|73 |
| chr5_2 | exon | 5726116 | 5726337 | 5726116 | ID=Msa0752070-mRNA-1:exon:2289;Parent=Msa0752070-mRNA-1 |
| chr5_2 | CDS | 5726116 | 5726337 | 5726116 | ID=Msa0752070-mRNA-1:cds;Parent=Msa0752070-mRNA-1 |
| Gene Sequence |
| Protein sequence |
