Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
Msa0975330 | A0A2Z6PE00 | 77.778 | 45 | 8 | 1 | 7 | 51 | 148 | 190 | 6.27e-11 | 63.9 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
Msa0017510 | Msa0975330 | 0.839990 | 1.138189e-57 | -8.615850e-47 |
Msa0032430 | Msa0975330 | 0.807025 | 6.182003e-50 | -8.615850e-47 |
Msa0084380 | Msa0975330 | 0.813714 | 2.225681e-51 | -8.615850e-47 |
Msa0090360 | Msa0975330 | 0.800822 | 1.203217e-48 | -8.615850e-47 |
Msa0610430 | Msa0975330 | 0.809736 | 1.632966e-50 | -8.615850e-47 |
Msa0615710 | Msa0975330 | 0.807429 | 5.077290e-50 | -8.615850e-47 |
Msa0625720 | Msa0975330 | 0.809022 | 2.323164e-50 | -8.615850e-47 |
Msa0627450 | Msa0975330 | 0.801428 | 9.045773e-49 | -8.615850e-47 |
Msa0662500 | Msa0975330 | 0.804498 | 2.099318e-49 | -8.615850e-47 |
Msa0663390 | Msa0975330 | 0.825156 | 5.466876e-54 | -8.615850e-47 |
Msa0669320 | Msa0975330 | 0.812780 | 3.569039e-51 | -8.615850e-47 |
Msa0692040 | Msa0975330 | -0.806023 | 1.006000e-49 | -8.615850e-47 |
Msa0709400 | Msa0975330 | 0.819449 | 1.154518e-52 | -8.615850e-47 |
Msa0715700 | Msa0975330 | 0.814205 | 1.734789e-51 | -8.615850e-47 |
Msa0743720 | Msa0975330 | 0.804547 | 2.049656e-49 | -8.615850e-47 |
Msa0745790 | Msa0975330 | 0.811954 | 5.407528e-51 | -8.615850e-47 |
Msa0769920 | Msa0975330 | 0.810234 | 1.275464e-50 | -8.615850e-47 |
Msa0796530 | Msa0975330 | 0.806585 | 7.659216e-50 | -8.615850e-47 |
Msa0803890 | Msa0975330 | 0.808725 | 2.689239e-50 | -8.615850e-47 |
Msa0810220 | Msa0975330 | 0.805790 | 1.126316e-49 | -8.615850e-47 |
Msa0124060 | Msa0975330 | 0.817940 | 2.540465e-52 | -8.615850e-47 |
Msa0140780 | Msa0975330 | 0.802000 | 6.903679e-49 | -8.615850e-47 |
Msa0150820 | Msa0975330 | 0.811322 | 7.419536e-51 | -8.615850e-47 |
Msa0157290 | Msa0975330 | 0.840062 | 1.090049e-57 | -8.615850e-47 |
Msa0160550 | Msa0975330 | 0.805436 | 1.335902e-49 | -8.615850e-47 |
Msa0168500 | Msa0975330 | 0.803385 | 3.575685e-49 | -8.615850e-47 |
Msa0169310 | Msa0975330 | 0.806509 | 7.946076e-50 | -8.615850e-47 |
Msa0172070 | Msa0975330 | 0.805428 | 1.341403e-49 | -8.615850e-47 |
Msa0200260 | Msa0975330 | 0.804204 | 2.416413e-49 | -8.615850e-47 |
Msa0211150 | Msa0975330 | 0.806280 | 8.880432e-50 | -8.615850e-47 |
Msa0231650 | Msa0975330 | 0.805812 | 1.114239e-49 | -8.615850e-47 |
Msa0481530 | Msa0975330 | 0.817483 | 3.220833e-52 | -8.615850e-47 |
Msa0249690 | Msa0975330 | 0.805280 | 1.440579e-49 | -8.615850e-47 |
Msa0264150 | Msa0975330 | 0.810521 | 1.106259e-50 | -8.615850e-47 |
Msa0287650 | Msa0975330 | 0.807381 | 5.198349e-50 | -8.615850e-47 |
Msa0345970 | Msa0975330 | 0.804551 | 2.045988e-49 | -8.615850e-47 |
Msa0507680 | Msa0975330 | 0.801962 | 7.030047e-49 | -8.615850e-47 |
Msa0529890 | Msa0975330 | 0.810407 | 1.170297e-50 | -8.615850e-47 |
Msa0585560 | Msa0975330 | 0.821786 | 3.354232e-53 | -8.615850e-47 |
Msa0871260 | Msa0975330 | 0.828828 | 7.236743e-55 | -8.615850e-47 |
Msa0880020 | Msa0975330 | 0.800156 | 1.644645e-48 | -8.615850e-47 |
Msa0880140 | Msa0975330 | 0.835624 | 1.505586e-56 | -8.615850e-47 |
Msa0938210 | Msa0975330 | 0.812474 | 4.163655e-51 | -8.615850e-47 |
Msa0945970 | Msa0975330 | 0.800972 | 1.121366e-48 | -8.615850e-47 |
Msa0947660 | Msa0975330 | 0.842584 | 2.365078e-58 | -8.615850e-47 |
Msa0975330 | Msa1121440 | 0.807725 | 4.392930e-50 | -8.615850e-47 |
Msa0975330 | Msa1124960 | 0.813964 | 1.960316e-51 | -8.615850e-47 |
Msa0975330 | Msa1140210 | 0.809751 | 1.620994e-50 | -8.615850e-47 |
Msa0975330 | Msa1193290 | 0.800193 | 1.616823e-48 | -8.615850e-47 |
Msa0975330 | Msa1253020 | 0.810112 | 1.355213e-50 | -8.615850e-47 |
Msa0975330 | Msa1283840 | 0.800982 | 1.116052e-48 | -8.615850e-47 |
Msa0975330 | Msa1318990 | 0.808599 | 2.860982e-50 | -8.615850e-47 |
Msa0975330 | Msa1327680 | 0.806184 | 9.303167e-50 | -8.615850e-47 |
Msa0975330 | Msa1353980 | 0.819063 | 1.414087e-52 | -8.615850e-47 |
Msa0975330 | Msa1373030 | 0.801839 | 7.451352e-49 | -8.615850e-47 |
Msa0975330 | Msa1392780 | 0.810423 | 1.161546e-50 | -8.615850e-47 |
Msa0975330 | Msa1451160 | 0.800647 | 1.306627e-48 | -8.615850e-47 |
Msa0975330 | Msa1452240 | 0.821863 | 3.220133e-53 | -8.615850e-47 |
Msa0975330 | Msa1457910 | 0.808950 | 2.407920e-50 | -8.615850e-47 |
Msa0975330 | Msa1466540 | 0.825461 | 4.628993e-54 | -8.615850e-47 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Find 11 sgRNAs with CRISPR-Local
Find 20 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
AGCTTAAATCTTAATGATAA+TGG | 0.313708 | 6_4:+9109295 | Msa0975330:CDS |
GGACAACTTGGACTTGGGTT+TGG | 0.414715 | 6_4:+9109339 | Msa0975330:CDS |
TCATATAGAGACTTCAGATA+TGG | 0.434208 | 6_4:-9109367 | None:intergenic |
GATGTGGACAACTTGGACTT+GGG | 0.442076 | 6_4:+9109334 | Msa0975330:CDS |
AATGATAATGGAGACATTGA+AGG | 0.456097 | 6_4:+9109307 | Msa0975330:CDS |
TTGCGTGATGAATATGCTAC+TGG | 0.500573 | 6_4:+9109403 | Msa0975330:CDS |
AGATGTGGACAACTTGGACT+TGG | 0.514194 | 6_4:+9109333 | Msa0975330:CDS |
AGGTTTAGATGTGGACAACT+TGG | 0.514964 | 6_4:+9109327 | Msa0975330:CDS |
TTATCATCTTACCATCTCGA+AGG | 0.584228 | 6_4:-9109095 | None:intergenic |
AGACATTGAAGGTTTAGATG+TGG | 0.608979 | 6_4:+9109318 | Msa0975330:CDS |
TAATCAGAGTGCCTTCGAGA+TGG | 0.615533 | 6_4:+9109084 | Msa0975330:exon |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!! | TATATTAATTGTATTTGTAT+TGG | + | chr6_4:9109158-9109177 | Msa0975330:intron | 10.0% |
!! | AATTAATATAAGCAAGTAGT+AGG | - | chr6_4:9109148-9109167 | None:intergenic | 20.0% |
!!! | AATTGTATTTGTATTGGTAT+AGG | + | chr6_4:9109164-9109183 | Msa0975330:intron | 20.0% |
!! | AGCTTAAATCTTAATGATAA+TGG | + | chr6_4:9109295-9109314 | Msa0975330:CDS | 20.0% |
!! | AATGATAATGGAGACATTGA+AGG | + | chr6_4:9109307-9109326 | Msa0975330:CDS | 30.0% |
TCATATAGAGACTTCAGATA+TGG | - | chr6_4:9109370-9109389 | None:intergenic | 30.0% | |
TTATCATCTTACCATCTCGA+AGG | - | chr6_4:9109098-9109117 | None:intergenic | 35.0% | |
CTAAGAGAAGAAACCATTTG+AGG | + | chr6_4:9109193-9109212 | Msa0975330:intron | 35.0% | |
!!! | CCCTCAATATTGCTTTTTCT+CGG | - | chr6_4:9109268-9109287 | None:intergenic | 35.0% |
CCGAGAAAAAGCAATATTGA+GGG | + | chr6_4:9109265-9109284 | Msa0975330:CDS | 35.0% | |
AGACATTGAAGGTTTAGATG+TGG | + | chr6_4:9109318-9109337 | Msa0975330:CDS | 35.0% | |
AATGGTTTCTTCTCTTAGCG+TGG | - | chr6_4:9109191-9109210 | None:intergenic | 40.0% | |
! | TACGAGTCTTTTGCCTCAAA+TGG | - | chr6_4:9109209-9109228 | None:intergenic | 40.0% |
GCCGAGAAAAAGCAATATTG+AGG | + | chr6_4:9109264-9109283 | Msa0975330:intron | 40.0% | |
AGGTTTAGATGTGGACAACT+TGG | + | chr6_4:9109327-9109346 | Msa0975330:CDS | 40.0% | |
TTGCGTGATGAATATGCTAC+TGG | + | chr6_4:9109403-9109422 | Msa0975330:CDS | 40.0% | |
! | TAATCAGAGTGCCTTCGAGA+TGG | + | chr6_4:9109084-9109103 | Msa0975330:exon | 45.0% |
AGATGTGGACAACTTGGACT+TGG | + | chr6_4:9109333-9109352 | Msa0975330:CDS | 45.0% | |
GATGTGGACAACTTGGACTT+GGG | + | chr6_4:9109334-9109353 | Msa0975330:CDS | 45.0% | |
GGACAACTTGGACTTGGGTT+TGG | + | chr6_4:9109339-9109358 | Msa0975330:CDS | 50.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
chr6_4 | gene | 9109072 | 9109432 | 9109072 | ID=Msa0975330;Name=Msa0975330 |
chr6_4 | mRNA | 9109072 | 9109432 | 9109072 | ID=Msa0975330-mRNA-1;Parent=Msa0975330;Name=Msa0975330-mRNA-1;_AED=0.43;_eAED=0.90;_QI=31|0|0.5|1|1|1|2|0|56 |
chr6_4 | exon | 9109072 | 9109105 | 9109072 | ID=Msa0975330-mRNA-1:exon:3253;Parent=Msa0975330-mRNA-1 |
chr6_4 | exon | 9109265 | 9109432 | 9109265 | ID=Msa0975330-mRNA-1:exon:3254;Parent=Msa0975330-mRNA-1 |
chr6_4 | five_prime_UTR | 9109072 | 9109102 | 9109072 | ID=Msa0975330-mRNA-1:five_prime_utr;Parent=Msa0975330-mRNA-1 |
chr6_4 | CDS | 9109103 | 9109105 | 9109103 | ID=Msa0975330-mRNA-1:cds;Parent=Msa0975330-mRNA-1 |
chr6_4 | CDS | 9109265 | 9109432 | 9109265 | ID=Msa0975330-mRNA-1:cds;Parent=Msa0975330-mRNA-1 |
Gene Sequence |
Protein sequence |