Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0019600 | Msa1129950 | 0.895267 | 1.126954e-75 | -8.615850e-47 |
| Msa0050040 | Msa1129950 | 0.821123 | 4.773111e-53 | -8.615850e-47 |
| Msa0066320 | Msa1129950 | 0.865544 | 5.469583e-65 | -8.615850e-47 |
| Msa0102990 | Msa1129950 | 0.822247 | 2.623167e-53 | -8.615850e-47 |
| Msa0111750 | Msa1129950 | 0.847686 | 9.885773e-60 | -8.615850e-47 |
| Msa0620260 | Msa1129950 | 0.802726 | 4.893989e-49 | -8.615850e-47 |
| Msa0641250 | Msa1129950 | 0.819044 | 1.428087e-52 | -8.615850e-47 |
| Msa0669840 | Msa1129950 | 0.898667 | 4.238903e-77 | -8.615850e-47 |
| Msa0680150 | Msa1129950 | 0.821375 | 4.175341e-53 | -8.615850e-47 |
| Msa0685330 | Msa1129950 | 0.804131 | 2.502871e-49 | -8.615850e-47 |
| Msa0688500 | Msa1129950 | 0.829279 | 5.625772e-55 | -8.615850e-47 |
| Msa0707220 | Msa1129950 | 0.803587 | 3.246332e-49 | -8.615850e-47 |
| Msa0752840 | Msa1129950 | 0.809827 | 1.560849e-50 | -8.615850e-47 |
| Msa0764820 | Msa1129950 | 0.855998 | 4.328086e-62 | -8.615850e-47 |
| Msa0770290 | Msa1129950 | 0.808388 | 3.174589e-50 | -8.615850e-47 |
| Msa0778930 | Msa1129950 | 0.816170 | 6.348819e-52 | -8.615850e-47 |
| Msa0831940 | Msa1129950 | 0.806182 | 9.314596e-50 | -8.615850e-47 |
| Msa0840500 | Msa1129950 | 0.820619 | 6.234783e-53 | -8.615850e-47 |
| Msa0212080 | Msa1129950 | 0.840247 | 9.754695e-58 | -8.615850e-47 |
| Msa0217230 | Msa1129950 | 0.818790 | 1.630969e-52 | -8.615850e-47 |
| Msa0219190 | Msa1129950 | 0.852709 | 3.862800e-61 | -8.615850e-47 |
| Msa0375680 | Msa1129950 | 0.801835 | 7.464208e-49 | -8.615850e-47 |
| Msa0392420 | Msa1129950 | 0.838091 | 3.534009e-57 | -8.615850e-47 |
| Msa0392460 | Msa1129950 | 0.839599 | 1.439339e-57 | -8.615850e-47 |
| Msa0392490 | Msa1129950 | 0.835870 | 1.304641e-56 | -8.615850e-47 |
| Msa0406000 | Msa1129950 | 0.857510 | 1.554172e-62 | -8.615850e-47 |
| Msa0413930 | Msa1129950 | 0.803535 | 3.328034e-49 | -8.615850e-47 |
| Msa0424330 | Msa1129950 | 0.825630 | 4.221675e-54 | -8.615850e-47 |
| Msa0424340 | Msa1129950 | 0.824004 | 1.020562e-53 | -8.615850e-47 |
| Msa0424350 | Msa1129950 | 0.839254 | 1.768811e-57 | -8.615850e-47 |
| Msa0451400 | Msa1129950 | 0.876180 | 1.714380e-68 | -8.615850e-47 |
| Msa0477460 | Msa1129950 | 0.803450 | 3.465315e-49 | -8.615850e-47 |
| Msa0999300 | Msa1129950 | 0.842099 | 3.180491e-58 | -8.615850e-47 |
| Msa1001890 | Msa1129950 | 0.808230 | 3.430472e-50 | -8.615850e-47 |
| Msa1032450 | Msa1129950 | 0.819575 | 1.081029e-52 | -8.615850e-47 |
| Msa1037890 | Msa1129950 | 0.920377 | 1.381854e-87 | -8.615850e-47 |
| Msa1037900 | Msa1129950 | 0.881145 | 3.060634e-70 | -8.615850e-47 |
| Msa1037910 | Msa1129950 | 0.862103 | 6.420833e-64 | -8.615850e-47 |
| Msa1041530 | Msa1129950 | 0.822727 | 2.029646e-53 | -8.615850e-47 |
| Msa1045780 | Msa1129950 | 0.812848 | 3.447698e-51 | -8.615850e-47 |
| Msa1081570 | Msa1129950 | 0.832483 | 9.214834e-56 | -8.615850e-47 |
| Msa1084520 | Msa1129950 | 0.805974 | 1.030178e-49 | -8.615850e-47 |
| Msa0252630 | Msa1129950 | 0.830414 | 2.976544e-55 | -8.615850e-47 |
| Msa0291330 | Msa1129950 | 0.825541 | 4.432518e-54 | -8.615850e-47 |
| Msa0298240 | Msa1129950 | 0.856457 | 3.176526e-62 | -8.615850e-47 |
| Msa0336090 | Msa1129950 | 0.807283 | 5.453158e-50 | -8.615850e-47 |
| Msa0344570 | Msa1129950 | 0.832165 | 1.104551e-55 | -8.615850e-47 |
| Msa0351770 | Msa1129950 | 0.835667 | 1.468640e-56 | -8.615850e-47 |
| Msa0359250 | Msa1129950 | 0.879268 | 1.431440e-69 | -8.615850e-47 |
| Msa1123880 | Msa1129950 | 0.808039 | 3.767417e-50 | -8.615850e-47 |
| Msa1127140 | Msa1129950 | 0.834131 | 3.578731e-56 | -8.615850e-47 |
| Msa1129950 | Msa1129960 | 0.882415 | 1.062354e-70 | -8.615850e-47 |
| Msa1129950 | Msa1129970 | 0.875807 | 2.301917e-68 | -8.615850e-47 |
| Msa1129950 | Msa1130010 | 0.870143 | 1.822724e-66 | -8.615850e-47 |
| Msa1129950 | Msa1145020 | 0.846493 | 2.097925e-59 | -8.615850e-47 |
| Msa1129950 | Msa1166400 | 0.830479 | 2.870100e-55 | -8.615850e-47 |
| Msa1129950 | Msa1169990 | 0.807126 | 5.885234e-50 | -8.615850e-47 |
| Msa1129950 | Msa1201110 | 0.801056 | 1.078084e-48 | -8.615850e-47 |
| Msa1129950 | Msa1201160 | 0.833680 | 4.639962e-56 | -8.615850e-47 |
| Msa1129950 | Msa1282840 | 0.804251 | 2.363116e-49 | -8.615850e-47 |
| Msa1129950 | Msa1294290 | 0.819745 | 9.885030e-53 | -8.615850e-47 |
| Msa1129950 | Msa1305510 | 0.815694 | 8.108854e-52 | -8.615850e-47 |
| Msa1129950 | Msa1336780 | 0.825451 | 4.653260e-54 | -8.615850e-47 |
| Msa1129950 | Msa1378870 | 0.803835 | 2.883476e-49 | -8.615850e-47 |
| Msa1129950 | Msa1394890 | 0.828392 | 9.225284e-55 | -8.615850e-47 |
| Msa1129950 | Msa1420060 | 0.873799 | 1.110752e-67 | -8.615850e-47 |
| Msa1129950 | Msa1421550 | 0.854706 | 1.029708e-61 | -8.615850e-47 |
| Msa1129950 | Msa1455320 | 0.838404 | 2.933524e-57 | -8.615850e-47 |
| Msa1129950 | Msa1459530 | 0.815795 | 7.697448e-52 | -8.615850e-47 |
| Msa1129950 | Msa1461060 | 0.800642 | 1.309546e-48 | -8.615850e-47 |
| Msa0487570 | Msa1129950 | 0.840464 | 8.561588e-58 | -8.615850e-47 |
| Msa0487630 | Msa1129950 | 0.830946 | 2.205646e-55 | -8.615850e-47 |
| Msa0492190 | Msa1129950 | 0.839651 | 1.395280e-57 | -8.615850e-47 |
| Msa0515950 | Msa1129950 | 0.818386 | 2.014155e-52 | -8.615850e-47 |
| Msa0534930 | Msa1129950 | 0.838467 | 2.826413e-57 | -8.615850e-47 |
| Msa0535040 | Msa1129950 | 0.823256 | 1.527579e-53 | -8.615850e-47 |
| Msa0537920 | Msa1129950 | 0.800758 | 1.240430e-48 | -8.615850e-47 |
| Msa0538220 | Msa1129950 | 0.803430 | 3.498685e-49 | -8.615850e-47 |
| Msa0575740 | Msa1129950 | 0.803031 | 4.232644e-49 | -8.615850e-47 |
| Msa0591790 | Msa1129950 | 0.836582 | 8.598211e-57 | -8.615850e-47 |
| Msa0594090 | Msa1129950 | 0.832626 | 8.490575e-56 | -8.615850e-47 |
| Msa0867350 | Msa1129950 | 0.838111 | 3.492027e-57 | -8.615850e-47 |
| Msa0898730 | Msa1129950 | 0.844873 | 5.771421e-59 | -8.615850e-47 |
| Msa0929870 | Msa1129950 | 0.869990 | 2.045105e-66 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1129950 | MtrunA17_Chr7g0274981 | 87.500 | 32 | 4 | 0 | 1 | 32 | 29 | 60 | 3.50e-12 | 55.1 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 8 sgRNAs with CRISPR-Local
Find 32 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| CAATCCAGTGGATGCAAAAT+TGG | 0.229600 | 7_3:-82015912 | None:intergenic |
| GTTGGAGAGAAGCTTGTAAT+TGG | 0.310945 | 7_3:+82015887 | Msa1129950:CDS |
| CATCCACTGGATTGTATTCA+AGG | 0.353753 | 7_3:+82015921 | Msa1129950:CDS |
| TATTTGTGCCCACTACTAGT+TGG | 0.475875 | 7_3:+82015869 | Msa1129950:CDS |
| AGCTTCTCTCCAACTAGTAG+TGG | 0.538262 | 7_3:-82015878 | None:intergenic |
| TCGTCATCGTCTTCAGTATG+TGG | 0.544092 | 7_3:+82016476 | Msa1129950:CDS |
| GCTTCTCTCCAACTAGTAGT+GGG | 0.634311 | 7_3:-82015877 | None:intergenic |
| AAACCTTGAATACAATCCAG+TGG | 0.710261 | 7_3:-82015924 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !! | TTCTCAATCAAAGTTATATA+TGG | - | chr7_3:82016374-82016393 | None:intergenic | 20.0% |
| !!! | TTACCAAACTATAGTTTTGA+TGG | + | chr7_3:82016003-82016022 | Msa1129950:intron | 25.0% |
| !!! | TACCAAACTATAGTTTTGAT+GGG | + | chr7_3:82016004-82016023 | Msa1129950:intron | 25.0% |
| ! | TGTAATGTTTGGATACTAAA+GGG | + | chr7_3:82016174-82016193 | Msa1129950:intron | 25.0% |
| !!! | TGTTATTTCATCCATCTTAT+GGG | - | chr7_3:82016236-82016255 | None:intergenic | 25.0% |
| !!! | TTGTTATTTCATCCATCTTA+TGG | - | chr7_3:82016237-82016256 | None:intergenic | 25.0% |
| ! | GAAAAGTCAAGAAAAAGATT+TGG | + | chr7_3:82016403-82016422 | Msa1129950:intron | 25.0% |
| TACCCATCAAAACTATAGTT+TGG | - | chr7_3:82016009-82016028 | None:intergenic | 30.0% | |
| ! | CTTGCCTTTTGTGAAATTAT+CGG | - | chr7_3:82016093-82016112 | None:intergenic | 30.0% |
| CTGTAATGTTTGGATACTAA+AGG | + | chr7_3:82016173-82016192 | Msa1129950:intron | 30.0% | |
| AAACCTTGAATACAATCCAG+TGG | - | chr7_3:82015927-82015946 | None:intergenic | 35.0% | |
| TATCGGACAGATTTATGATG+AGG | - | chr7_3:82016076-82016095 | None:intergenic | 35.0% | |
| CTGTCCGATAATTTCACAAA+AGG | + | chr7_3:82016086-82016105 | Msa1129950:intron | 35.0% | |
| TATGCTTGCAATTGTTTGTG+AGG | - | chr7_3:82016133-82016152 | None:intergenic | 35.0% | |
| CAATGTGATGCTGTAATGTT+TGG | + | chr7_3:82016163-82016182 | Msa1129950:intron | 35.0% | |
| ! | AGCAGCAAGTTTAAGATATG+AGG | + | chr7_3:82016296-82016315 | Msa1129950:intron | 35.0% |
| TCGAAGGAAACAATATCTCA+GGG | - | chr7_3:82016433-82016452 | None:intergenic | 35.0% | |
| TATTTGTGCCCACTACTAGT+TGG | + | chr7_3:82015869-82015888 | Msa1129950:CDS | 40.0% | |
| GTTGGAGAGAAGCTTGTAAT+TGG | + | chr7_3:82015887-82015906 | Msa1129950:CDS | 40.0% | |
| CAATCCAGTGGATGCAAAAT+TGG | - | chr7_3:82015915-82015934 | None:intergenic | 40.0% | |
| CATCCACTGGATTGTATTCA+AGG | + | chr7_3:82015921-82015940 | Msa1129950:CDS | 40.0% | |
| CTCGAAGGAAACAATATCTC+AGG | - | chr7_3:82016434-82016453 | None:intergenic | 40.0% | |
| GATATTGTTTCCTTCGAGCA+TGG | + | chr7_3:82016436-82016455 | Msa1129950:intron | 40.0% | |
| GCTTCTCTCCAACTAGTAGT+GGG | - | chr7_3:82015880-82015899 | None:intergenic | 45.0% | |
| AGCTTCTCTCCAACTAGTAG+TGG | - | chr7_3:82015881-82015900 | None:intergenic | 45.0% | |
| GCTTGCAATTGTTTGTGAGG+AGG | - | chr7_3:82016130-82016149 | None:intergenic | 45.0% | |
| CATCCATCTTATGGGATGCA+AGG | - | chr7_3:82016228-82016247 | None:intergenic | 45.0% | |
| TCGTCATCGTCTTCAGTATG+TGG | + | chr7_3:82016476-82016495 | Msa1129950:CDS | 45.0% | |
| ! | GGTGCCAATTTTGCATCCAC+TGG | + | chr7_3:82015908-82015927 | Msa1129950:CDS | 50.0% |
| CTGCCTTGCATCCCATAAGA+TGG | + | chr7_3:82016222-82016241 | Msa1129950:intron | 50.0% | |
| CATCTGCAAACCATGCTCGA+AGG | - | chr7_3:82016449-82016468 | None:intergenic | 50.0% | |
| ! | CTTCGAGCATGGTTTGCAGA+TGG | + | chr7_3:82016447-82016466 | Msa1129950:intron | 50.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| chr7_3 | gene | 82015851 | 82016508 | 82015851 | ID=Msa1129950;Name=Msa1129950 |
| chr7_3 | mRNA | 82015851 | 82016508 | 82015851 | ID=Msa1129950-mRNA-1;Parent=Msa1129950;Name=Msa1129950-mRNA-1;_AED=0.47;_eAED=0.65;_QI=0|0|0|1|0|0|2|0|44 |
| chr7_3 | exon | 82015851 | 82015942 | 82015851 | ID=Msa1129950-mRNA-1:exon:24078;Parent=Msa1129950-mRNA-1 |
| chr7_3 | exon | 82016466 | 82016508 | 82016466 | ID=Msa1129950-mRNA-1:exon:24079;Parent=Msa1129950-mRNA-1 |
| chr7_3 | CDS | 82015851 | 82015942 | 82015851 | ID=Msa1129950-mRNA-1:cds;Parent=Msa1129950-mRNA-1 |
| chr7_3 | CDS | 82016466 | 82016508 | 82016466 | ID=Msa1129950-mRNA-1:cds;Parent=Msa1129950-mRNA-1 |
| Gene Sequence |
| Protein sequence |
