Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1455320 | XP_003614581.1 | 92.208 | 77 | 4 | 2 | 1 | 75 | 1 | 77 | 2.72e-38 | 140 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1455320 | G7K0H0 | 92.208 | 77 | 4 | 2 | 1 | 75 | 1 | 77 | 1.30e-38 | 140 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0019600 | Msa1455320 | 0.862191 | 6.036326e-64 | -8.615850e-47 |
| Msa0066320 | Msa1455320 | 0.824330 | 8.558085e-54 | -8.615850e-47 |
| Msa1379970 | Msa1455320 | 0.816406 | 5.622012e-52 | -8.615850e-47 |
| Msa1394890 | Msa1455320 | 0.824781 | 6.699764e-54 | -8.615850e-47 |
| Msa1406780 | Msa1455320 | 0.831364 | 1.740488e-55 | -8.615850e-47 |
| Msa1420060 | Msa1455320 | 0.825649 | 4.178941e-54 | -8.615850e-47 |
| Msa1421550 | Msa1455320 | 0.854603 | 1.102838e-61 | -8.615850e-47 |
| Msa1423460 | Msa1455320 | 0.815248 | 1.018820e-51 | -8.615850e-47 |
| Msa1431850 | Msa1455320 | 0.831648 | 1.481491e-55 | -8.615850e-47 |
| Msa1437710 | Msa1455320 | 0.802156 | 6.413920e-49 | -8.615850e-47 |
| Msa1449940 | Msa1455320 | 0.826715 | 2.329680e-54 | -8.615850e-47 |
| Msa1455320 | Msa1459530 | 0.816501 | 5.352732e-52 | -8.615850e-47 |
| Msa1455320 | Msa1461060 | 0.829906 | 3.960249e-55 | -8.615850e-47 |
| Msa0641250 | Msa1455320 | 0.813992 | 1.932893e-51 | -8.615850e-47 |
| Msa0669840 | Msa1455320 | 0.861072 | 1.325935e-63 | -8.615850e-47 |
| Msa0680150 | Msa1455320 | 0.801963 | 7.026884e-49 | -8.615850e-47 |
| Msa0739580 | Msa1455320 | 0.838801 | 2.316817e-57 | -8.615850e-47 |
| Msa0748400 | Msa1455320 | 0.813807 | 2.123315e-51 | -8.615850e-47 |
| Msa0764820 | Msa1455320 | 0.833401 | 5.448491e-56 | -8.615850e-47 |
| Msa0770290 | Msa1455320 | 0.890160 | 1.266499e-73 | -8.615850e-47 |
| Msa0782360 | Msa1455320 | 0.813195 | 2.894689e-51 | -8.615850e-47 |
| Msa0124130 | Msa1455320 | 0.808722 | 2.693428e-50 | -8.615850e-47 |
| Msa0141120 | Msa1455320 | 0.804888 | 1.740353e-49 | -8.615850e-47 |
| Msa0156250 | Msa1455320 | 0.801223 | 9.965831e-49 | -8.615850e-47 |
| Msa0185490 | Msa1455320 | 0.813782 | 2.149856e-51 | -8.615850e-47 |
| Msa0212150 | Msa1455320 | 0.817436 | 3.301372e-52 | -8.615850e-47 |
| Msa0219190 | Msa1455320 | 0.807316 | 5.365245e-50 | -8.615850e-47 |
| Msa1228190 | Msa1455320 | 0.819264 | 1.272357e-52 | -8.615850e-47 |
| Msa1294290 | Msa1455320 | 0.808146 | 3.573654e-50 | -8.615850e-47 |
| Msa1305510 | Msa1455320 | 0.842597 | 2.345965e-58 | -8.615850e-47 |
| Msa0375680 | Msa1455320 | 0.850154 | 2.039664e-60 | -8.615850e-47 |
| Msa0392420 | Msa1455320 | 0.817600 | 3.030981e-52 | -8.615850e-47 |
| Msa0392460 | Msa1455320 | 0.816615 | 5.048661e-52 | -8.615850e-47 |
| Msa0392490 | Msa1455320 | 0.815966 | 7.048828e-52 | -8.615850e-47 |
| Msa0406000 | Msa1455320 | 0.863143 | 3.071296e-64 | -8.615850e-47 |
| Msa0424330 | Msa1455320 | 0.861070 | 1.328223e-63 | -8.615850e-47 |
| Msa0424340 | Msa1455320 | 0.842423 | 2.609797e-58 | -8.615850e-47 |
| Msa0424350 | Msa1455320 | 0.834960 | 2.215290e-56 | -8.615850e-47 |
| Msa0451400 | Msa1455320 | 0.882902 | 7.050951e-71 | -8.615850e-47 |
| Msa0471240 | Msa1455320 | 0.802502 | 5.442637e-49 | -8.615850e-47 |
| Msa0999300 | Msa1455320 | 0.851128 | 1.085427e-60 | -8.615850e-47 |
| Msa1001890 | Msa1455320 | 0.819305 | 1.245205e-52 | -8.615850e-47 |
| Msa1037770 | Msa1455320 | 0.849316 | 3.496384e-60 | -8.615850e-47 |
| Msa1037890 | Msa1455320 | 0.922780 | 6.294435e-89 | -8.615850e-47 |
| Msa1037900 | Msa1455320 | 0.847773 | 9.351230e-60 | -8.615850e-47 |
| Msa1037910 | Msa1455320 | 0.841306 | 5.148960e-58 | -8.615850e-47 |
| Msa1081570 | Msa1455320 | 0.811020 | 8.624955e-51 | -8.615850e-47 |
| Msa0252630 | Msa1455320 | 0.803824 | 2.899575e-49 | -8.615850e-47 |
| Msa0252770 | Msa1455320 | 0.823032 | 1.723139e-53 | -8.615850e-47 |
| Msa0289920 | Msa1455320 | 0.804750 | 1.859179e-49 | -8.615850e-47 |
| Msa0291330 | Msa1455320 | 0.801137 | 1.037865e-48 | -8.615850e-47 |
| Msa0298240 | Msa1455320 | 0.816802 | 4.584200e-52 | -8.615850e-47 |
| Msa0306120 | Msa1455320 | 0.816609 | 5.062442e-52 | -8.615850e-47 |
| Msa0329620 | Msa1455320 | 0.821552 | 3.799422e-53 | -8.615850e-47 |
| Msa0344570 | Msa1455320 | 0.801739 | 7.809442e-49 | -8.615850e-47 |
| Msa0359250 | Msa1455320 | 0.888429 | 5.952098e-73 | -8.615850e-47 |
| Msa1127140 | Msa1455320 | 0.805517 | 1.285191e-49 | -8.615850e-47 |
| Msa1129950 | Msa1455320 | 0.838404 | 2.933524e-57 | -8.615850e-47 |
| Msa1129960 | Msa1455320 | 0.828587 | 8.276263e-55 | -8.615850e-47 |
| Msa1129970 | Msa1455320 | 0.822356 | 2.474747e-53 | -8.615850e-47 |
| Msa1130010 | Msa1455320 | 0.832549 | 8.872669e-56 | -8.615850e-47 |
| Msa1145020 | Msa1455320 | 0.811923 | 5.491942e-51 | -8.615850e-47 |
| Msa1176160 | Msa1455320 | 0.803277 | 3.763859e-49 | -8.615850e-47 |
| Msa1201160 | Msa1455320 | 0.832295 | 1.025513e-55 | -8.615850e-47 |
| Msa0487570 | Msa1455320 | 0.819404 | 1.182153e-52 | -8.615850e-47 |
| Msa0487630 | Msa1455320 | 0.811590 | 6.488611e-51 | -8.615850e-47 |
| Msa0492190 | Msa1455320 | 0.847413 | 1.174773e-59 | -8.615850e-47 |
| Msa0515950 | Msa1455320 | 0.849052 | 4.141509e-60 | -8.615850e-47 |
| Msa0534930 | Msa1455320 | 0.832078 | 1.160601e-55 | -8.615850e-47 |
| Msa0535040 | Msa1455320 | 0.810145 | 1.333525e-50 | -8.615850e-47 |
| Msa0537920 | Msa1455320 | 0.804392 | 2.208262e-49 | -8.615850e-47 |
| Msa0591790 | Msa1455320 | 0.839643 | 1.401341e-57 | -8.615850e-47 |
| Msa0594090 | Msa1455320 | 0.839429 | 1.592827e-57 | -8.615850e-47 |
| Msa0844560 | Msa1455320 | 0.807269 | 5.489280e-50 | -8.615850e-47 |
| Msa0849280 | Msa1455320 | 0.849721 | 2.696553e-60 | -8.615850e-47 |
| Msa0851020 | Msa1455320 | 0.853531 | 2.246641e-61 | -8.615850e-47 |
| Msa0860280 | Msa1455320 | 0.826892 | 2.113789e-54 | -8.615850e-47 |
| Msa0867350 | Msa1455320 | 0.837722 | 4.395691e-57 | -8.615850e-47 |
| Msa0898730 | Msa1455320 | 0.843089 | 1.736233e-58 | -8.615850e-47 |
| Msa0916640 | Msa1455320 | 0.813871 | 2.055557e-51 | -8.615850e-47 |
| Msa0929870 | Msa1455320 | 0.829092 | 6.244576e-55 | -8.615850e-47 |
| Msa0944760 | Msa1455320 | 0.809444 | 1.886998e-50 | -8.615850e-47 |
| Msa0953540 | Msa1455320 | 0.825464 | 4.622301e-54 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1455320 | MtrunA17_Chr5g0423211 | 92.208 | 77 | 4 | 2 | 1 | 75 | 1 | 77 | 2.84e-42 | 140 |
| Msa1455320 | MtrunA17_Chr5g0420901 | 86.842 | 76 | 9 | 1 | 1 | 75 | 1 | 76 | 7.88e-40 | 133 |
| Msa1455320 | MtrunA17_Chr5g0420891 | 81.579 | 76 | 13 | 1 | 1 | 75 | 1 | 76 | 2.96e-38 | 124 |
| Msa1455320 | MtrunA17_Chr5g0420941 | 77.027 | 74 | 16 | 1 | 3 | 75 | 2 | 75 | 1.17e-35 | 122 |
| Msa1455320 | MtrunA17_Chr5g0421091 | 75.676 | 74 | 17 | 1 | 3 | 75 | 2 | 75 | 5.35e-33 | 115 |
| Msa1455320 | MtrunA17_Chr5g0420731 | 71.622 | 74 | 19 | 2 | 3 | 75 | 5 | 77 | 4.97e-30 | 102 |
| Msa1455320 | MtrunA17_Chr5g0421041 | 72.603 | 73 | 18 | 2 | 3 | 75 | 5 | 75 | 8.57e-30 | 107 |
| Msa1455320 | MtrunA17_Chr5g0423221 | 67.105 | 76 | 23 | 2 | 1 | 75 | 27 | 101 | 9.56e-28 | 102 |
| Msa1455320 | MtrunA17_Chr5g0421101 | 64.474 | 76 | 25 | 2 | 1 | 75 | 3 | 77 | 2.82e-27 | 100 |
| Msa1455320 | MtrunA17_Chr5g0423251 | 70.833 | 72 | 20 | 1 | 5 | 75 | 6 | 77 | 2.94e-27 | 100 |
| Msa1455320 | MtrunA17_Chr5g0423191 | 70.270 | 74 | 20 | 2 | 3 | 75 | 5 | 77 | 7.93e-26 | 97.1 |
| Msa1455320 | MtrunA17_Chr5g0420981 | 70.270 | 74 | 19 | 2 | 5 | 75 | 11 | 84 | 1.24e-25 | 96.7 |
| Msa1455320 | MtrunA17_Chr8g0365241 | 68.000 | 75 | 21 | 3 | 3 | 75 | 15 | 88 | 7.07e-25 | 94.4 |
| Msa1455320 | MtrunA17_Chr5g0421011 | 67.568 | 74 | 22 | 2 | 3 | 75 | 5 | 77 | 1.21e-24 | 94.0 |
| Msa1455320 | MtrunA17_Chr5g0423201 | 58.904 | 73 | 29 | 1 | 4 | 75 | 5 | 77 | 4.48e-24 | 92.4 |
| Msa1455320 | MtrunA17_Chr8g0375591 | 56.000 | 75 | 27 | 2 | 7 | 75 | 6 | 80 | 8.06e-22 | 82.0 |
| Msa1455320 | MtrunA17_Chr5g0420951 | 61.842 | 76 | 25 | 3 | 3 | 75 | 10 | 84 | 1.05e-20 | 83.2 |
| Msa1455320 | MtrunA17_Chr8g0375571 | 55.405 | 74 | 28 | 2 | 7 | 75 | 6 | 79 | 3.13e-20 | 82.0 |
| Msa1455320 | MtrunA17_Chr8g0375601 | 58.904 | 73 | 23 | 3 | 10 | 75 | 9 | 81 | 2.92e-19 | 79.3 |
| Msa1455320 | MtrunA17_Chr8g0375641 | 46.250 | 80 | 38 | 2 | 1 | 75 | 7 | 86 | 3.48e-19 | 76.6 |
| Msa1455320 | MtrunA17_Chr8g0375661 | 51.351 | 74 | 31 | 2 | 7 | 75 | 13 | 86 | 9.06e-19 | 75.1 |
| Msa1455320 | MtrunA17_Chr8g0375671 | 50.000 | 74 | 32 | 2 | 7 | 75 | 13 | 86 | 2.78e-18 | 76.6 |
| Msa1455320 | MtrunA17_Chr2g0314401 | 49.351 | 77 | 35 | 3 | 2 | 75 | 8 | 83 | 1.14e-15 | 69.3 |
| Msa1455320 | MtrunA17_Chr2g0314391 | 48.052 | 77 | 36 | 3 | 2 | 75 | 27 | 102 | 3.06e-15 | 68.2 |
| Msa1455320 | MtrunA17_Chr1g0162191 | 56.000 | 75 | 24 | 4 | 5 | 75 | 10 | 79 | 3.81e-15 | 67.8 |
| Msa1455320 | MtrunA17_Chr2g0314381 | 53.165 | 79 | 30 | 5 | 2 | 75 | 33 | 109 | 4.93e-15 | 67.8 |
| Msa1455320 | MtrunA17_Chr2g0314371 | 51.899 | 79 | 31 | 5 | 2 | 75 | 8 | 84 | 1.39e-14 | 66.2 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1455320 | AT4G25300.1 | 45.570 | 79 | 38 | 3 | 2 | 75 | 6 | 84 | 4.10e-13 | 62.8 |
| Msa1455320 | AT1G17020.1 | 43.038 | 79 | 40 | 3 | 2 | 75 | 7 | 85 | 7.83e-12 | 58.9 |
Find 19 sgRNAs with CRISPR-Local
Find 19 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| TAAGGAATGGGGCTTCTTCC+AGG | 0.276010 | tig0035675:+6294 | Msa1455320:CDS |
| TTTGGTTGAAGATATTGTTT+TGG | 0.389870 | tig0035675:-6160 | Msa1455320:intergenic |
| ACAAGAATAGGGTCTTGATT+TGG | 0.392068 | tig0035675:-6178 | Msa1455320:intergenic |
| AGTTTACTAAGATCGATTAC+TGG | 0.402285 | tig0035675:-6226 | Msa1455320:intergenic |
| AGATCATGCTTGTAAGGAAT+GGG | 0.407087 | tig0035675:+6282 | Msa1455320:CDS |
| GAAGTGTTAGATACAAGAAT+AGG | 0.428089 | tig0035675:-6190 | Msa1455320:intergenic |
| GGCTGGCACTTCTGTTGTCC+TGG | 0.436120 | tig0035675:+6093 | Msa1455320:CDS |
| GAAGCTAGATCATGCTTGTA+AGG | 0.463334 | tig0035675:+6276 | Msa1455320:CDS |
| AAGTGTTAGATACAAGAATA+GGG | 0.468845 | tig0035675:-6189 | Msa1455320:intergenic |
| TAGATCATGCTTGTAAGGAA+TGG | 0.493830 | tig0035675:+6281 | Msa1455320:CDS |
| TTCAGTCCAACAGTTGGAAA+AGG | 0.502521 | tig0035675:+6120 | Msa1455320:CDS |
| GATTACTGGGAGTTGTGGTA+AGG | 0.547348 | tig0035675:-6212 | Msa1455320:intergenic |
| ACTGTTGGACTGAAGGTGCC+AGG | 0.554620 | tig0035675:-6111 | Msa1455320:intergenic |
| GGCACCTTCAGTCCAACAGT+TGG | 0.571912 | tig0035675:+6114 | Msa1455320:CDS |
| AATCAGTCTCATCAAATGGC+TGG | 0.572592 | tig0035675:+6076 | None:intergenic |
| GTTTACTAAGATCGATTACT+GGG | 0.599834 | tig0035675:-6225 | Msa1455320:intergenic |
| GTCCAACAGTTGGAAAAGGA+AGG | 0.600875 | tig0035675:+6124 | Msa1455320:CDS |
| AGATCGATTACTGGGAGTTG+TGG | 0.610015 | tig0035675:-6217 | Msa1455320:intergenic |
| GATCATGCTTGTAAGGAATG+GGG | 0.669758 | tig0035675:+6283 | Msa1455320:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !! | TTTGGTTGAAGATATTGTTT+TGG | - | tig0035675:6163-6182 | Msa1455320:intergenic | 25.0% |
| ! | AAGTGTTAGATACAAGAATA+GGG | - | tig0035675:6192-6211 | Msa1455320:intergenic | 25.0% |
| ! | GAAGTGTTAGATACAAGAAT+AGG | - | tig0035675:6193-6212 | Msa1455320:intergenic | 30.0% |
| GTTTACTAAGATCGATTACT+GGG | - | tig0035675:6228-6247 | Msa1455320:intergenic | 30.0% | |
| AGTTTACTAAGATCGATTAC+TGG | - | tig0035675:6229-6248 | Msa1455320:intergenic | 30.0% | |
| ACAAGAATAGGGTCTTGATT+TGG | - | tig0035675:6181-6200 | Msa1455320:intergenic | 35.0% | |
| TAGATCATGCTTGTAAGGAA+TGG | + | tig0035675:6281-6300 | Msa1455320:CDS | 35.0% | |
| AGATCATGCTTGTAAGGAAT+GGG | + | tig0035675:6282-6301 | Msa1455320:CDS | 35.0% | |
| ! | TTTTCCAACTGTTGGACTGA+AGG | - | tig0035675:6121-6140 | Msa1455320:intergenic | 40.0% |
| TTCAGTCCAACAGTTGGAAA+AGG | + | tig0035675:6120-6139 | Msa1455320:CDS | 40.0% | |
| GAAGCTAGATCATGCTTGTA+AGG | + | tig0035675:6276-6295 | Msa1455320:CDS | 40.0% | |
| GATCATGCTTGTAAGGAATG+GGG | + | tig0035675:6283-6302 | Msa1455320:CDS | 40.0% | |
| GTCCAACAGTTGGAAAAGGA+AGG | + | tig0035675:6124-6143 | Msa1455320:CDS | 45.0% | |
| ! | TGCCTTCCTTTTCCAACTGT+TGG | - | tig0035675:6129-6148 | Msa1455320:intergenic | 45.0% |
| GATTACTGGGAGTTGTGGTA+AGG | - | tig0035675:6215-6234 | Msa1455320:intergenic | 45.0% | |
| AGATCGATTACTGGGAGTTG+TGG | - | tig0035675:6220-6239 | Msa1455320:intergenic | 45.0% | |
| !! | ACTGTTGGACTGAAGGTGCC+AGG | - | tig0035675:6114-6133 | Msa1455320:intergenic | 55.0% |
| GGCACCTTCAGTCCAACAGT+TGG | + | tig0035675:6114-6133 | Msa1455320:CDS | 55.0% | |
| GGCTGGCACTTCTGTTGTCC+TGG | + | tig0035675:6093-6112 | Msa1455320:CDS | 60.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| tig0035675 | gene | 6091 | 6315 | 6091 | ID=Msa1455320;Name=Msa1455320 |
| tig0035675 | mRNA | 6091 | 6315 | 6091 | ID=Msa1455320-mRNA-1;Parent=Msa1455320;Name=Msa1455320-mRNA-1;_AED=0.04;_eAED=0.04;_QI=0|-1|0|1|-1|1|1|0|75 |
| tig0035675 | exon | 6091 | 6315 | 6091 | ID=Msa1455320-mRNA-1:exon:20220;Parent=Msa1455320-mRNA-1 |
| tig0035675 | CDS | 6091 | 6315 | 6091 | ID=Msa1455320-mRNA-1:cds;Parent=Msa1455320-mRNA-1 |
| Gene Sequence |
| Protein sequence |
