Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa1419010 | G7JXX8 | 74.000 | 50 | 12 | 1 | 3 | 52 | 5 | 53 | 8.08e-18 | 79.0 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0011720 | Msa1419010 | 0.816927 | 4.295988e-52 | -8.615850e-47 |
| Msa0012440 | Msa1419010 | 0.820737 | 5.855217e-53 | -8.615850e-47 |
| Msa0057240 | Msa1419010 | 0.815496 | 8.973547e-52 | -8.615850e-47 |
| Msa0060600 | Msa1419010 | 0.812823 | 3.492794e-51 | -8.615850e-47 |
| Msa0105340 | Msa1419010 | 0.821833 | 3.271471e-53 | -8.615850e-47 |
| Msa0105420 | Msa1419010 | 0.802665 | 5.037966e-49 | -8.615850e-47 |
| Msa0113160 | Msa1419010 | 0.801036 | 1.088123e-48 | -8.615850e-47 |
| Msa1365040 | Msa1419010 | -0.807668 | 4.518181e-50 | -8.615850e-47 |
| Msa1374440 | Msa1419010 | 0.832402 | 9.649357e-56 | -8.615850e-47 |
| Msa1379990 | Msa1419010 | 0.825486 | 4.565359e-54 | -8.615850e-47 |
| Msa1419010 | Msa1420060 | 0.806477 | 8.072466e-50 | -8.615850e-47 |
| Msa1419010 | Msa1422270 | 0.821992 | 3.005699e-53 | -8.615850e-47 |
| Msa1419010 | Msa1423990 | 0.802623 | 5.137543e-49 | -8.615850e-47 |
| Msa1419010 | Msa1429420 | 0.820586 | 6.341441e-53 | -8.615850e-47 |
| Msa1419010 | Msa1440340 | 0.808997 | 2.352735e-50 | -8.615850e-47 |
| Msa1419010 | Msa1453710 | 0.805409 | 1.353658e-49 | -8.615850e-47 |
| Msa1419010 | Msa1456810 | 0.800805 | 1.213163e-48 | -8.615850e-47 |
| Msa1419010 | Msa1464560 | 0.804787 | 1.826798e-49 | -8.615850e-47 |
| Msa0619980 | Msa1419010 | 0.825407 | 4.766146e-54 | -8.615850e-47 |
| Msa0621890 | Msa1419010 | 0.818649 | 1.755347e-52 | -8.615850e-47 |
| Msa0638280 | Msa1419010 | 0.810732 | 9.958131e-51 | -8.615850e-47 |
| Msa0638320 | Msa1419010 | 0.804221 | 2.396901e-49 | -8.615850e-47 |
| Msa0649970 | Msa1419010 | 0.802798 | 4.728601e-49 | -8.615850e-47 |
| Msa0651190 | Msa1419010 | 0.803162 | 3.976021e-49 | -8.615850e-47 |
| Msa0652980 | Msa1419010 | 0.808575 | 2.895264e-50 | -8.615850e-47 |
| Msa0663090 | Msa1419010 | 0.819483 | 1.134340e-52 | -8.615850e-47 |
| Msa0694250 | Msa1419010 | 0.806375 | 8.479289e-50 | -8.615850e-47 |
| Msa0706370 | Msa1419010 | 0.855393 | 6.501431e-62 | -8.615850e-47 |
| Msa0724050 | Msa1419010 | 0.803353 | 3.630102e-49 | -8.615850e-47 |
| Msa0726770 | Msa1419010 | 0.811219 | 7.810968e-51 | -8.615850e-47 |
| Msa0726780 | Msa1419010 | 0.817622 | 2.997602e-52 | -8.615850e-47 |
| Msa0743640 | Msa1419010 | 0.816927 | 4.297476e-52 | -8.615850e-47 |
| Msa0772150 | Msa1419010 | 0.800124 | 1.669653e-48 | -8.615850e-47 |
| Msa0815320 | Msa1419010 | 0.801662 | 8.101643e-49 | -8.615850e-47 |
| Msa0149560 | Msa1419010 | 0.818755 | 1.661400e-52 | -8.615850e-47 |
| Msa0189350 | Msa1419010 | 0.808695 | 2.730041e-50 | -8.615850e-47 |
| Msa0213080 | Msa1419010 | 0.818143 | 2.285817e-52 | -8.615850e-47 |
| Msa0223290 | Msa1419010 | 0.803823 | 2.899758e-49 | -8.615850e-47 |
| Msa0223380 | Msa1419010 | 0.804405 | 2.194989e-49 | -8.615850e-47 |
| Msa0230770 | Msa1419010 | 0.804700 | 1.905179e-49 | -8.615850e-47 |
| Msa0235890 | Msa1419010 | 0.828361 | 9.383143e-55 | -8.615850e-47 |
| Msa1233500 | Msa1419010 | 0.810634 | 1.045765e-50 | -8.615850e-47 |
| Msa1238490 | Msa1419010 | 0.813544 | 2.425318e-51 | -8.615850e-47 |
| Msa1280130 | Msa1419010 | 0.821003 | 5.087426e-53 | -8.615850e-47 |
| Msa0371560 | Msa1419010 | 0.803915 | 2.775548e-49 | -8.615850e-47 |
| Msa0397090 | Msa1419010 | 0.806886 | 6.615570e-50 | -8.615850e-47 |
| Msa0411280 | Msa1419010 | 0.828339 | 9.499886e-55 | -8.615850e-47 |
| Msa0419970 | Msa1419010 | 0.801227 | 9.944077e-49 | -8.615850e-47 |
| Msa0436460 | Msa1419010 | 0.815892 | 7.323352e-52 | -8.615850e-47 |
| Msa0442880 | Msa1419010 | 0.804667 | 1.934869e-49 | -8.615850e-47 |
| Msa0452410 | Msa1419010 | 0.812966 | 3.248580e-51 | -8.615850e-47 |
| Msa0980440 | Msa1419010 | 0.801285 | 9.677134e-49 | -8.615850e-47 |
| Msa1002300 | Msa1419010 | 0.808651 | 2.789456e-50 | -8.615850e-47 |
| Msa1020720 | Msa1419010 | 0.823805 | 1.136464e-53 | -8.615850e-47 |
| Msa1026760 | Msa1419010 | 0.801559 | 8.505099e-49 | -8.615850e-47 |
| Msa1026790 | Msa1419010 | 0.804264 | 2.347900e-49 | -8.615850e-47 |
| Msa1027240 | Msa1419010 | 0.800786 | 1.224028e-48 | -8.615850e-47 |
| Msa1033560 | Msa1419010 | 0.802468 | 5.530941e-49 | -8.615850e-47 |
| Msa1044040 | Msa1419010 | 0.802666 | 5.034042e-49 | -8.615850e-47 |
| Msa1056640 | Msa1419010 | 0.803752 | 3.000757e-49 | -8.615850e-47 |
| Msa1064500 | Msa1419010 | 0.801064 | 1.073744e-48 | -8.615850e-47 |
| Msa1072350 | Msa1419010 | 0.809718 | 1.647777e-50 | -8.615850e-47 |
| Msa1073350 | Msa1419010 | 0.823180 | 1.591099e-53 | -8.615850e-47 |
| Msa1097380 | Msa1419010 | 0.803054 | 4.186771e-49 | -8.615850e-47 |
| Msa0253370 | Msa1419010 | 0.800679 | 1.287302e-48 | -8.615850e-47 |
| Msa0257680 | Msa1419010 | 0.800367 | 1.489715e-48 | -8.615850e-47 |
| Msa0273570 | Msa1419010 | 0.812088 | 5.055098e-51 | -8.615850e-47 |
| Msa0280490 | Msa1419010 | 0.805688 | 1.183254e-49 | -8.615850e-47 |
| Msa0292180 | Msa1419010 | 0.814468 | 1.517412e-51 | -8.615850e-47 |
| Msa0296760 | Msa1419010 | 0.800793 | 1.219936e-48 | -8.615850e-47 |
| Msa0313920 | Msa1419010 | 0.815390 | 9.476401e-52 | -8.615850e-47 |
| Msa0335270 | Msa1419010 | 0.804680 | 1.922998e-49 | -8.615850e-47 |
| Msa0350670 | Msa1419010 | 0.809557 | 1.783738e-50 | -8.615850e-47 |
| Msa0352000 | Msa1419010 | 0.830838 | 2.343416e-55 | -8.615850e-47 |
| Msa0352010 | Msa1419010 | 0.814952 | 1.185136e-51 | -8.615850e-47 |
| Msa0363980 | Msa1419010 | 0.807782 | 4.272025e-50 | -8.615850e-47 |
| Msa1139410 | Msa1419010 | 0.811110 | 8.245651e-51 | -8.615850e-47 |
| Msa1160400 | Msa1419010 | 0.804485 | 2.112009e-49 | -8.615850e-47 |
| Msa0484690 | Msa1419010 | 0.829759 | 4.301618e-55 | -8.615850e-47 |
| Msa0490350 | Msa1419010 | 0.801447 | 8.964547e-49 | -8.615850e-47 |
| Msa0508200 | Msa1419010 | 0.802797 | 4.731682e-49 | -8.615850e-47 |
| Msa0508610 | Msa1419010 | 0.802309 | 5.963044e-49 | -8.615850e-47 |
| Msa0508650 | Msa1419010 | 0.802604 | 5.185494e-49 | -8.615850e-47 |
| Msa0512420 | Msa1419010 | 0.821531 | 3.842646e-53 | -8.615850e-47 |
| Msa0517330 | Msa1419010 | 0.804369 | 2.232956e-49 | -8.615850e-47 |
| Msa0535030 | Msa1419010 | 0.800216 | 1.599418e-48 | -8.615850e-47 |
| Msa0546380 | Msa1419010 | 0.803201 | 3.903030e-49 | -8.615850e-47 |
| Msa0556240 | Msa1419010 | 0.803271 | 3.775066e-49 | -8.615850e-47 |
| Msa0598250 | Msa1419010 | 0.820772 | 5.748356e-53 | -8.615850e-47 |
| Msa0847990 | Msa1419010 | 0.812270 | 4.613615e-51 | -8.615850e-47 |
| Msa0855310 | Msa1419010 | 0.814673 | 1.366824e-51 | -8.615850e-47 |
| Msa0863760 | Msa1419010 | 0.819360 | 1.210141e-52 | -8.615850e-47 |
| Msa0870620 | Msa1419010 | 0.834554 | 2.803487e-56 | -8.615850e-47 |
| Msa0870690 | Msa1419010 | 0.849365 | 3.388303e-60 | -8.615850e-47 |
| Msa0898370 | Msa1419010 | 0.816244 | 6.111389e-52 | -8.615850e-47 |
| Msa0903730 | Msa1419010 | 0.812344 | 4.444532e-51 | -8.615850e-47 |
| Msa0937940 | Msa1419010 | 0.809514 | 1.822317e-50 | -8.615850e-47 |
| Msa0946320 | Msa1419010 | 0.827750 | 1.316490e-54 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 20 sgRNAs with CRISPR-Local
Find 27 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| CCCCATGAGTTTCATTAATA+TGG | 0.183207 | tig0024663:-6304 | Msa1419010:CDS |
| AAGAGAATATGGTTGGAGTT+TGG | 0.225607 | tig0024663:-6338 | Msa1419010:CDS |
| GGGCAACTTTGAAGAGAATA+TGG | 0.298068 | tig0024663:-6349 | Msa1419010:CDS |
| AGAGAATATGGTTGGAGTTT+GGG | 0.298441 | tig0024663:-6337 | Msa1419010:CDS |
| CAAGTATATGTATCTATTTA+TGG | 0.308121 | tig0024663:-6269 | Msa1419010:CDS |
| TCTTCAAAGTTGCCCCAAAA+AGG | 0.390045 | tig0024663:+6357 | None:intergenic |
| TCTGAAAACAAGCATGGAAA+TGG | 0.391099 | tig0024663:-6381 | Msa1419010:CDS |
| TAAATGTCAAATGGATTCAT+TGG | 0.413489 | tig0024663:-6245 | Msa1419010:CDS |
| ATTTATGGCTAAATGTCAAA+TGG | 0.431655 | tig0024663:-6254 | Msa1419010:CDS |
| TATGGTTGGAGTTTGGGGTC+AGG | 0.432917 | tig0024663:-6331 | Msa1419010:CDS |
| AGATACATATACTTGTCCTT+TGG | 0.454505 | tig0024663:+6277 | None:intergenic |
| GAGAATATGGTTGGAGTTTG+GGG | 0.481399 | tig0024663:-6336 | Msa1419010:CDS |
| TACATATACTTGTCCTTTGG+TGG | 0.494432 | tig0024663:+6280 | None:intergenic |
| GTCCATATTAATGAAACTCA+TGG | 0.498900 | tig0024663:+6302 | None:intergenic |
| TCCATATTAATGAAACTCAT+GGG | 0.514689 | tig0024663:+6303 | None:intergenic |
| AACTTTGAAGAGAATATGGT+TGG | 0.531598 | tig0024663:-6345 | Msa1419010:CDS |
| GGTTGGAGTTTGGGGTCAGG+AGG | 0.545206 | tig0024663:-6328 | Msa1419010:CDS |
| TCATTAATATGGACCACCAA+AGG | 0.591867 | tig0024663:-6293 | Msa1419010:CDS |
| GCTGAATCTGAAAACAAGCA+TGG | 0.598695 | tig0024663:-6387 | Msa1419010:CDS |
| CCATATTAATGAAACTCATG+GGG | 0.670436 | tig0024663:+6304 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !! | CAAGTATATGTATCTATTTA+TGG | - | tig0024663:6437-6456 | Msa1419010:intron | 20.0% |
| ! | TCCATATTAATGAAACTCAT+GGG | + | tig0024663:6406-6425 | None:intergenic | 25.0% |
| ! | ATTTATGGCTAAATGTCAAA+TGG | - | tig0024663:6452-6471 | Msa1419010:intron | 25.0% |
| !! | TAAATGTCAAATGGATTCAT+TGG | - | tig0024663:6461-6480 | Msa1419010:intron | 25.0% |
| !!! | GGTTTTTCTGTCTTGTTATT+AGG | - | tig0024663:6254-6273 | Msa1419010:CDS | 30.0% |
| TTGTGTGAGAATGTTGTAAA+AGG | - | tig0024663:6291-6310 | Msa1419010:CDS | 30.0% | |
| TGTGTGAGAATGTTGTAAAA+GGG | - | tig0024663:6292-6311 | Msa1419010:CDS | 30.0% | |
| ! | AACTTTGAAGAGAATATGGT+TGG | - | tig0024663:6361-6380 | Msa1419010:CDS | 30.0% |
| CCATATTAATGAAACTCATG+GGG | + | tig0024663:6405-6424 | None:intergenic | 30.0% | |
| GTCCATATTAATGAAACTCA+TGG | + | tig0024663:6407-6426 | None:intergenic | 30.0% | |
| AGATACATATACTTGTCCTT+TGG | + | tig0024663:6432-6451 | None:intergenic | 30.0% | |
| TCTGAAAACAAGCATGGAAA+TGG | - | tig0024663:6325-6344 | Msa1419010:CDS | 35.0% | |
| AAGAGAATATGGTTGGAGTT+TGG | - | tig0024663:6368-6387 | Msa1419010:CDS | 35.0% | |
| AGAGAATATGGTTGGAGTTT+GGG | - | tig0024663:6369-6388 | Msa1419010:CDS | 35.0% | |
| CCCCATGAGTTTCATTAATA+TGG | - | tig0024663:6402-6421 | Msa1419010:intron | 35.0% | |
| TCATTAATATGGACCACCAA+AGG | - | tig0024663:6413-6432 | Msa1419010:intron | 35.0% | |
| TACATATACTTGTCCTTTGG+TGG | + | tig0024663:6429-6448 | None:intergenic | 35.0% | |
| TCTCACACAACACAACTCTA+TGG | + | tig0024663:6281-6300 | None:intergenic | 40.0% | |
| GCTGAATCTGAAAACAAGCA+TGG | - | tig0024663:6319-6338 | Msa1419010:CDS | 40.0% | |
| ! | AGCATGGAAATGGACCTTTT+TGG | - | tig0024663:6335-6354 | Msa1419010:CDS | 40.0% |
| ! | GCATGGAAATGGACCTTTTT+GGG | - | tig0024663:6336-6355 | Msa1419010:CDS | 40.0% |
| ! | CATGGAAATGGACCTTTTTG+GGG | - | tig0024663:6337-6356 | Msa1419010:CDS | 40.0% |
| TCTTCAAAGTTGCCCCAAAA+AGG | + | tig0024663:6352-6371 | None:intergenic | 40.0% | |
| ! | GGGCAACTTTGAAGAGAATA+TGG | - | tig0024663:6357-6376 | Msa1419010:CDS | 40.0% |
| GAGAATATGGTTGGAGTTTG+GGG | - | tig0024663:6370-6389 | Msa1419010:CDS | 40.0% | |
| ! | TATGGTTGGAGTTTGGGGTC+AGG | - | tig0024663:6375-6394 | Msa1419010:CDS | 50.0% |
| ! | GGTTGGAGTTTGGGGTCAGG+AGG | - | tig0024663:6378-6397 | Msa1419010:CDS | 60.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| tig0024663 | gene | 6242 | 6486 | 6242 | ID=Msa1419010;Name=Msa1419010 |
| tig0024663 | mRNA | 6242 | 6486 | 6242 | ID=Msa1419010-mRNA-1;Parent=Msa1419010;Name=Msa1419010-mRNA-1;_AED=0.35;_eAED=0.45;_QI=0|0|0|0.5|0|0|2|0|59 |
| tig0024663 | exon | 6481 | 6486 | 6481 | ID=Msa1419010-mRNA-1:exon:708;Parent=Msa1419010-mRNA-1 |
| tig0024663 | exon | 6242 | 6415 | 6242 | ID=Msa1419010-mRNA-1:exon:707;Parent=Msa1419010-mRNA-1 |
| tig0024663 | CDS | 6481 | 6486 | 6481 | ID=Msa1419010-mRNA-1:cds;Parent=Msa1419010-mRNA-1 |
| tig0024663 | CDS | 6242 | 6415 | 6242 | ID=Msa1419010-mRNA-1:cds;Parent=Msa1419010-mRNA-1 |
| Gene Sequence |
| Protein sequence |
