Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0780040314.01.T01 | YP_009141619.1 | 98.361 | 61 | 1 | 0 | 1 | 61 | 1 | 61 | 3.54E-33 | 118 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0780040314.01.T01 | Q49L15 | 91.803 | 61 | 5 | 0 | 1 | 61 | 1 | 61 | 3.61E-34 | 113 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0780040314.01.T01 | A0A0K0LTP3 | 98.361 | 61 | 1 | 0 | 1 | 61 | 1 | 61 | 1.69e-33 | 118 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080048611.01 | MsG0780040314.01 | 0.808713 | 2.704822e-50 | 1.557616e-47 |
MsG0080048780.01 | MsG0780040314.01 | 0.802392 | 5.735139e-49 | 2.806167e-46 |
MsG0080049078.01 | MsG0780040314.01 | 0.871554 | 6.254483e-67 | 2.533664e-63 |
MsG0080049079.01 | MsG0780040314.01 | 0.853645 | 2.084076e-61 | 4.534000e-58 |
MsG0080049080.01 | MsG0780040314.01 | 0.830361 | 3.066780e-55 | 3.224007e-52 |
MsG0180001085.01 | MsG0780040314.01 | 0.814676 | 1.364830e-51 | 9.216767e-49 |
MsG0180003933.01 | MsG0780040314.01 | 0.830204 | 3.350481e-55 | 3.506398e-52 |
MsG0180004188.01 | MsG0780040314.01 | 0.816896 | 4.366810e-52 | 3.133195e-49 |
MsG0180004542.01 | MsG0780040314.01 | 0.821384 | 4.155382e-53 | 3.375517e-50 |
MsG0180004733.01 | MsG0780040314.01 | 0.804711 | 1.894493e-49 | 9.837450e-47 |
MsG0180004735.01 | MsG0780040314.01 | 0.815587 | 8.565137e-52 | 5.929451e-49 |
MsG0180004987.01 | MsG0780040314.01 | 0.847056 | 1.472193e-59 | 2.584921e-56 |
MsG0180005119.01 | MsG0780040314.01 | 0.806188 | 9.284515e-50 | 5.007631e-47 |
MsG0180005349.01 | MsG0780040314.01 | 0.802675 | 5.013708e-49 | 2.470781e-46 |
MsG0180005568.01 | MsG0780040314.01 | 0.835655 | 1.478360e-56 | 1.819595e-53 |
MsG0180005807.01 | MsG0780040314.01 | 0.804204 | 2.416857e-49 | 1.238624e-46 |
MsG0180005879.01 | MsG0780040314.01 | 0.813009 | 3.179065e-51 | 2.052012e-48 |
MsG0780040284.01 | MsG0780040314.01 | 0.809293 | 2.032626e-50 | 1.188846e-47 |
MsG0780040314.01 | MsG0780040315.01 | 0.811500 | 6.787427e-51 | 4.208539e-48 |
MsG0780040314.01 | MsG0780041004.01 | 0.812431 | 4.255426e-51 | 2.705320e-48 |
MsG0780040314.01 | MsG0880042290.01 | 0.828820 | 7.268487e-55 | 7.305005e-52 |
MsG0780040314.01 | MsG0880043075.01 | 0.813081 | 3.065110e-51 | 1.982228e-48 |
MsG0780040314.01 | MsG0880043541.01 | 0.821939 | 3.092937e-53 | 2.552077e-50 |
MsG0780040314.01 | MsG0880044314.01 | 0.824665 | 7.135933e-54 | 6.363144e-51 |
MsG0780040314.01 | MsG0880044414.01 | 0.809726 | 1.641324e-50 | 9.710991e-48 |
MsG0780040314.01 | MsG0880044884.01 | 0.816590 | 5.113707e-52 | 3.638543e-49 |
MsG0780040314.01 | MsG0880045283.01 | 0.824568 | 7.521537e-54 | 6.687777e-51 |
MsG0780040314.01 | MsG0880045361.01 | 0.822978 | 1.773501e-53 | 1.507391e-50 |
MsG0780040314.01 | MsG0880045412.01 | 0.811215 | 7.827269e-51 | 4.816649e-48 |
MsG0780040314.01 | MsG0880046736.01 | 0.804047 | 2.605995e-49 | 1.330242e-46 |
MsG0780040314.01 | MsG0880046764.01 | 0.809729 | 1.638756e-50 | 9.696624e-48 |
MsG0780040314.01 | MsG0880047156.01 | 0.805095 | 1.575059e-49 | 8.259697e-47 |
MsG0780040314.01 | MsG0880047451.01 | 0.821199 | 4.584577e-53 | 3.705327e-50 |
MsG0780040314.01 | MsG0880047614.01 | 0.802210 | 6.252009e-49 | 3.044691e-46 |
MsG0780040314.01 | MsG0880047719.01 | 0.803981 | 2.688721e-49 | 1.370215e-46 |
MsG0280010926.01 | MsG0780040314.01 | 0.831991 | 1.219138e-55 | 1.344923e-52 |
MsG0280010975.01 | MsG0780040314.01 | 0.808745 | 2.662943e-50 | 1.534822e-47 |
MsG0280011411.01 | MsG0780040314.01 | 0.805468 | 1.315807e-49 | 6.966701e-47 |
MsG0380013472.01 | MsG0780040314.01 | 0.837112 | 6.297551e-57 | 8.099022e-54 |
MsG0380013927.01 | MsG0780040314.01 | 0.935633 | 6.240235e-97 | 5.084782e-92 |
MsG0380013930.01 | MsG0780040314.01 | 0.803151 | 3.997616e-49 | 1.994160e-46 |
MsG0380013955.01 | MsG0780040314.01 | 0.883982 | 2.827082e-71 | 1.832292e-67 |
MsG0380013958.01 | MsG0780040314.01 | 0.850608 | 1.521066e-60 | 2.995911e-57 |
MsG0380013965.01 | MsG0780040314.01 | 0.800882 | 1.170063e-48 | 5.510075e-46 |
MsG0380013970.01 | MsG0780040314.01 | 0.889195 | 3.008698e-73 | 2.403379e-69 |
MsG0380013980.01 | MsG0780040314.01 | 0.805157 | 1.528546e-49 | 8.028744e-47 |
MsG0380013992.01 | MsG0780040314.01 | 0.800539 | 1.374469e-48 | 6.416196e-46 |
MsG0380013996.01 | MsG0780040314.01 | 0.852051 | 5.946674e-61 | 1.227415e-57 |
MsG0380014000.01 | MsG0780040314.01 | 0.833639 | 4.751156e-56 | 5.504251e-53 |
MsG0380014007.01 | MsG0780040314.01 | 0.894728 | 1.877318e-75 | 1.889513e-71 |
MsG0380014012.01 | MsG0780040314.01 | 0.938195 | 1.004141e-98 | 9.524805e-94 |
MsG0380014013.01 | MsG0780040314.01 | 0.899924 | 1.223677e-77 | 1.545602e-73 |
MsG0380014022.01 | MsG0780040314.01 | 0.885826 | 5.815472e-72 | 4.052811e-68 |
MsG0380014037.01 | MsG0780040314.01 | 0.869870 | 2.239146e-66 | 8.534178e-63 |
MsG0380014038.01 | MsG0780040314.01 | 0.811430 | 7.027288e-51 | 4.349180e-48 |
MsG0380014042.01 | MsG0780040314.01 | 0.814800 | 1.281284e-51 | 8.681654e-49 |
MsG0380014049.01 | MsG0780040314.01 | 0.802887 | 4.531815e-49 | 2.245480e-46 |
MsG0380014053.01 | MsG0780040314.01 | 0.843517 | 1.334896e-58 | 2.093727e-55 |
MsG0380014729.01 | MsG0780040314.01 | 0.805247 | 1.463661e-49 | 7.705409e-47 |
MsG0680032057.01 | MsG0780040314.01 | 0.832141 | 1.119937e-55 | 1.240728e-52 |
MsG0680032515.01 | MsG0780040314.01 | 0.803662 | 3.132803e-49 | 1.583331e-46 |
MsG0680033224.01 | MsG0780040314.01 | 0.833922 | 4.037998e-56 | 4.718807e-53 |
MsG0680033966.01 | MsG0780040314.01 | 0.825391 | 4.807939e-54 | 4.376468e-51 |
MsG0680034064.01 | MsG0780040314.01 | 0.835778 | 1.376250e-56 | 1.700189e-53 |
MsG0480019956.01 | MsG0780040314.01 | 0.810209 | 1.291685e-50 | 7.738913e-48 |
MsG0480019971.01 | MsG0780040314.01 | 0.809958 | 1.462851e-50 | 8.707907e-48 |
MsG0480020049.01 | MsG0780040314.01 | 0.822673 | 2.088880e-53 | 1.760191e-50 |
MsG0480020350.01 | MsG0780040314.01 | 0.823982 | 1.033161e-53 | 9.033483e-51 |
MsG0480020408.01 | MsG0780040314.01 | 0.801279 | 9.706010e-49 | 4.616738e-46 |
MsG0480020690.01 | MsG0780040314.01 | 0.805248 | 1.462770e-49 | 7.700960e-47 |
MsG0480021168.01 | MsG0780040314.01 | 0.815463 | 9.125089e-52 | 6.296039e-49 |
MsG0480021303.01 | MsG0780040314.01 | 0.860822 | 1.579931e-63 | 4.376303e-60 |
MsG0480022804.01 | MsG0780040314.01 | 0.808086 | 3.681801e-50 | 2.085729e-47 |
MsG0480023216.01 | MsG0780040314.01 | 0.819006 | 1.456451e-52 | 1.107576e-49 |
MsG0480023371.01 | MsG0780040314.01 | 0.811924 | 5.489737e-51 | 3.442009e-48 |
MsG0480023422.01 | MsG0780040314.01 | 0.815771 | 7.793726e-52 | 5.423066e-49 |
MsG0480023881.01 | MsG0780040314.01 | 0.800782 | 1.226443e-48 | 5.760471e-46 |
MsG0480023990.01 | MsG0780040314.01 | 0.800377 | 1.482881e-48 | 6.894264e-46 |
MsG0580024679.01 | MsG0780040314.01 | 0.818525 | 1.873399e-52 | 1.405696e-49 |
MsG0580024873.01 | MsG0780040314.01 | 0.843141 | 1.681977e-58 | 2.606763e-55 |
MsG0580024982.01 | MsG0780040314.01 | 0.824561 | 7.551050e-54 | 6.712466e-51 |
MsG0380015496.01 | MsG0780040314.01 | 0.822971 | 1.780759e-53 | 1.513205e-50 |
MsG0380015602.01 | MsG0780040314.01 | 0.807175 | 5.746962e-50 | 3.179155e-47 |
MsG0380015603.01 | MsG0780040314.01 | 0.811386 | 7.185283e-51 | 4.441569e-48 |
MsG0380016137.01 | MsG0780040314.01 | 0.827268 | 1.718795e-54 | 1.651199e-51 |
MsG0380016194.01 | MsG0780040314.01 | 0.810983 | 8.785604e-51 | 5.374203e-48 |
MsG0380016284.01 | MsG0780040314.01 | 0.826040 | 3.374161e-54 | 3.128718e-51 |
MsG0380016751.01 | MsG0780040314.01 | 0.811692 | 6.166193e-51 | 3.842359e-48 |
MsG0380016762.01 | MsG0780040314.01 | 0.837674 | 4.521545e-57 | 5.916957e-54 |
MsG0380017661.01 | MsG0780040314.01 | 0.801455 | 8.932596e-49 | 4.267675e-46 |
MsG0380017703.01 | MsG0780040314.01 | 0.806405 | 8.358311e-50 | 4.532743e-47 |
MsG0380017728.01 | MsG0780040314.01 | 0.827468 | 1.538761e-54 | 1.486885e-51 |
MsG0380018069.01 | MsG0780040314.01 | 0.822802 | 1.949302e-53 | 1.648519e-50 |
MsG0480018089.01 | MsG0780040314.01 | 0.830166 | 3.422413e-55 | 3.577624e-52 |
MsG0480018324.01 | MsG0780040314.01 | 0.807462 | 4.996678e-50 | 2.784843e-47 |
MsG0580026430.01 | MsG0780040314.01 | 0.858551 | 7.623256e-63 | 1.952933e-59 |
MsG0580027098.01 | MsG0780040314.01 | 0.807614 | 4.637944e-50 | 2.594982e-47 |
MsG0580027254.01 | MsG0780040314.01 | 0.816429 | 5.556921e-52 | 3.936318e-49 |
MsG0580028024.01 | MsG0780040314.01 | 0.820637 | 6.175083e-53 | 4.912528e-50 |
MsG0580028335.01 | MsG0780040314.01 | 0.808776 | 2.623369e-50 | 1.513184e-47 |
MsG0580028853.01 | MsG0780040314.01 | 0.819357 | 1.211605e-52 | 9.302049e-50 |
MsG0580029414.01 | MsG0780040314.01 | 0.814552 | 1.453370e-51 | 9.782421e-49 |
MsG0280006913.01 | MsG0780040314.01 | 0.804976 | 1.668143e-49 | 8.721445e-47 |
MsG0280007041.01 | MsG0780040314.01 | 0.843058 | 1.769093e-58 | 2.734571e-55 |
MsG0280010198.01 | MsG0780040314.01 | 0.808540 | 2.946140e-50 | 1.689005e-47 |
MsG0680035731.01 | MsG0780040314.01 | 0.817228 | 3.677466e-52 | 2.662660e-49 |
MsG0780036387.01 | MsG0780040314.01 | 0.807158 | 5.793355e-50 | 3.203395e-47 |
MsG0780037705.01 | MsG0780040314.01 | 0.936784 | 9.967212e-98 | 8.700546e-93 |
MsG0780037946.01 | MsG0780040314.01 | 0.801484 | 8.810491e-49 | 4.212485e-46 |
MsG0780038571.01 | MsG0780040314.01 | 0.818296 | 2.110918e-52 | 1.573895e-49 |
MsG0780039707.01 | MsG0780040314.01 | 0.820174 | 7.885051e-53 | 6.193989e-50 |
MsG0780039975.01 | MsG0780040314.01 | 0.840695 | 7.447960e-58 | 1.069408e-54 |
MsG0780040080.01 | MsG0780040314.01 | 0.804260 | 2.352351e-49 | 1.207320e-46 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0780040314.01.T01 | MTR_4g050880 | 96.721 | 61 | 2 | 0 | 1 | 61 | 1 | 61 | 1.97e-36 | 116 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0780040314.01.T01 | ATCG00070 | 77.049 | 61 | 14 | 0 | 1 | 61 | 1 | 61 | 2.87e-28 | 95.9 |
Find 2 sgRNAs with CRISPR-Local
Find 10 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TATGCTTAATATCTTTAGCT+TGG | 0.440922 | 7:-75833863 | MsG0780040314.01.T01:CDS |
ACTGGCATAAAATCTACAAT+TGG | 0.453871 | 7:+75833760 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!! | AGAAAAAACTACTTGAATAA+AGG | + | Chr7:75833746-75833765 | None:intergenic | 20.0% |
!! | GAAAAAACTACTTGAATAAA+GGG | + | Chr7:75833745-75833764 | None:intergenic | 20.0% |
!!! | TTATTCAAGTAGTTTTTTCT+TGG | - | Chr7:75833746-75833765 | MsG0780040314.01.T01:CDS | 20.0% |
!!! | TTTTTCTCTTAGCTTTTGTT+TGG | - | Chr7:75833838-75833857 | MsG0780040314.01.T01:CDS | 25.0% |
ACTGGCATAAAATCTACAAT+TGG | + | Chr7:75833804-75833823 | None:intergenic | 30.0% | |
AGCTAAGAGAAAAAAGAGTA+AGG | + | Chr7:75833832-75833851 | None:intergenic | 30.0% | |
GCTAAGAGAAAAAAGAGTAA+GGG | + | Chr7:75833831-75833850 | None:intergenic | 30.0% | |
! | AATTGGATTCAAAAAAGCGT+AGG | + | Chr7:75833787-75833806 | None:intergenic | 30.0% |
!! | AAAAAGAGTAAGGGTATTAC+TGG | + | Chr7:75833822-75833841 | None:intergenic | 30.0% |
! | TTCAAAAAAGCGTAGGCTTC+AGG | + | Chr7:75833780-75833799 | None:intergenic | 40.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr7 | gene | 75833699 | 75833884 | 75833699 | ID=MsG0780040314.01;Name=MsG0780040314.01 |
Chr7 | mRNA | 75833699 | 75833884 | 75833699 | ID=MsG0780040314.01.T01;Parent=MsG0780040314.01;Name=MsG0780040314.01.T01;_AED=0.50;_eAED=0.50;_QI=0|-1|0|1|-1|0|1|0|61 |
Chr7 | exon | 75833699 | 75833884 | 75833699 | ID=MsG0780040314.01.T01:exon:14556;Parent=MsG0780040314.01.T01 |
Chr7 | CDS | 75833699 | 75833884 | 75833699 | ID=MsG0780040314.01.T01:cds;Parent=MsG0780040314.01.T01 |
Gene Sequence |
Protein sequence |