Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0580026430.01.T01 | YP_009656679.1 | 100 | 57 | 0 | 0 | 1 | 57 | 173 | 229 | 6.91E-32 | 119 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0580026430.01.T01 | A6MM48 | 96.491 | 57 | 2 | 0 | 1 | 57 | 170 | 226 | 3.49E-33 | 115 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0580026430.01.T01 | A0A4P8F2D4 | 100.000 | 57 | 0 | 0 | 1 | 57 | 173 | 229 | 3.30e-32 | 119 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080047910.01 | MsG0580026430.01 | 0.802326 | 5.915552e-49 | 2.889662e-46 |
MsG0080048068.01 | MsG0580026430.01 | 0.817508 | 3.180727e-52 | 2.320865e-49 |
MsG0080048611.01 | MsG0580026430.01 | 0.806035 | 1.000122e-49 | 5.373003e-47 |
MsG0080048845.01 | MsG0580026430.01 | 0.819609 | 1.061528e-52 | 8.207491e-50 |
MsG0080049078.01 | MsG0580026430.01 | 0.874098 | 8.803647e-68 | 3.912276e-64 |
MsG0080049079.01 | MsG0580026430.01 | 0.877456 | 6.191762e-69 | 3.115438e-65 |
MsG0080049080.01 | MsG0580026430.01 | 0.842791 | 2.084341e-58 | 3.195043e-55 |
MsG0080049130.01 | MsG0580026430.01 | 0.808470 | 3.049123e-50 | 1.744936e-47 |
MsG0180000677.01 | MsG0580026430.01 | 0.812391 | 4.340377e-51 | 2.756326e-48 |
MsG0180000843.01 | MsG0580026430.01 | 0.811966 | 5.374419e-51 | 3.373689e-48 |
MsG0180001085.01 | MsG0580026430.01 | 0.803411 | 3.531388e-49 | 1.773355e-46 |
MsG0180001270.01 | MsG0580026430.01 | 0.801974 | 6.989770e-49 | 3.383495e-46 |
MsG0180001371.01 | MsG0580026430.01 | 0.805999 | 1.017746e-49 | 5.462823e-47 |
MsG0180003198.01 | MsG0580026430.01 | 0.825471 | 4.603355e-54 | 4.199634e-51 |
MsG0180003933.01 | MsG0580026430.01 | 0.832017 | 1.201527e-55 | 1.326442e-52 |
MsG0180003949.01 | MsG0580026430.01 | 0.809502 | 1.833144e-50 | 1.078125e-47 |
MsG0180004188.01 | MsG0580026430.01 | 0.822329 | 2.510968e-53 | 2.095198e-50 |
MsG0180004302.01 | MsG0580026430.01 | 0.809023 | 2.321834e-50 | 1.348147e-47 |
MsG0180004542.01 | MsG0580026430.01 | 0.807452 | 5.019730e-50 | 2.797028e-47 |
MsG0180004733.01 | MsG0580026430.01 | 0.805955 | 1.039813e-49 | 5.574807e-47 |
MsG0180004735.01 | MsG0580026430.01 | 0.808092 | 3.670806e-50 | 2.079868e-47 |
MsG0180004937.01 | MsG0580026430.01 | 0.820754 | 5.804070e-53 | 4.632872e-50 |
MsG0180004987.01 | MsG0580026430.01 | 0.861712 | 8.462651e-64 | 2.416069e-60 |
MsG0180005119.01 | MsG0580026430.01 | 0.823062 | 1.695117e-53 | 1.444230e-50 |
MsG0180005150.01 | MsG0580026430.01 | 0.806764 | 7.019192e-50 | 3.841773e-47 |
MsG0180005391.01 | MsG0580026430.01 | 0.801670 | 8.068629e-49 | 3.875907e-46 |
MsG0180005568.01 | MsG0580026430.01 | 0.861119 | 1.282875e-63 | 3.590253e-60 |
MsG0180005807.01 | MsG0580026430.01 | 0.802364 | 5.809490e-49 | 2.840580e-46 |
MsG0180005879.01 | MsG0580026430.01 | 0.802801 | 4.721685e-49 | 2.334496e-46 |
MsG0180006223.01 | MsG0580026430.01 | 0.802681 | 4.998455e-49 | 2.463676e-46 |
MsG0280010926.01 | MsG0580026430.01 | 0.837367 | 5.419081e-57 | 7.023494e-54 |
MsG0280010974.01 | MsG0580026430.01 | 0.811669 | 6.236007e-51 | 3.883452e-48 |
MsG0280010975.01 | MsG0580026430.01 | 0.834581 | 2.758770e-56 | 3.288120e-53 |
MsG0280011067.01 | MsG0580026430.01 | 0.812394 | 4.335135e-51 | 2.753229e-48 |
MsG0280011270.01 | MsG0580026430.01 | 0.824744 | 6.838400e-54 | 6.111420e-51 |
MsG0280011411.01 | MsG0580026430.01 | 0.830665 | 2.584396e-55 | 2.741082e-52 |
MsG0380011495.01 | MsG0580026430.01 | 0.800849 | 1.188299e-48 | 5.591171e-46 |
MsG0380012443.01 | MsG0580026430.01 | 0.809896 | 1.508782e-50 | 8.966191e-48 |
MsG0380013177.01 | MsG0580026430.01 | 0.807643 | 4.572392e-50 | 2.560303e-47 |
MsG0380013472.01 | MsG0580026430.01 | 0.830347 | 3.091833e-55 | 3.248978e-52 |
MsG0380013927.01 | MsG0580026430.01 | 0.874697 | 5.516943e-68 | 2.507099e-64 |
MsG0380013930.01 | MsG0580026430.01 | 0.806697 | 7.253909e-50 | 3.963313e-47 |
MsG0380013939.01 | MsG0580026430.01 | 0.820122 | 8.103906e-53 | 6.357098e-50 |
MsG0380013955.01 | MsG0580026430.01 | 0.878476 | 2.723821e-69 | 1.424406e-65 |
MsG0380013958.01 | MsG0580026430.01 | 0.865529 | 5.526553e-65 | 1.804036e-61 |
MsG0380013965.01 | MsG0580026430.01 | 0.810540 | 1.095502e-50 | 6.621330e-48 |
MsG0380013970.01 | MsG0580026430.01 | 0.883140 | 5.771476e-71 | 3.615147e-67 |
MsG0380013979.01 | MsG0580026430.01 | 0.808522 | 2.971919e-50 | 1.703038e-47 |
MsG0380013980.01 | MsG0580026430.01 | 0.810406 | 1.170939e-50 | 7.052009e-48 |
MsG0380013992.01 | MsG0580026430.01 | 0.833230 | 6.007981e-56 | 6.876114e-53 |
MsG0380013996.01 | MsG0580026430.01 | 0.854399 | 1.263095e-61 | 2.817075e-58 |
MsG0380014000.01 | MsG0580026430.01 | 0.828812 | 7.300691e-55 | 7.335539e-52 |
MsG0380014007.01 | MsG0580026430.01 | 0.887615 | 1.221838e-72 | 9.150726e-69 |
MsG0380014012.01 | MsG0580026430.01 | 0.866602 | 2.529211e-65 | 8.574456e-62 |
MsG0380014013.01 | MsG0580026430.01 | 0.838582 | 2.639185e-57 | 3.550694e-54 |
MsG0380014022.01 | MsG0580026430.01 | 0.894791 | 1.768833e-75 | 1.785664e-71 |
MsG0380014037.01 | MsG0580026430.01 | 0.879761 | 9.568044e-70 | 5.252099e-66 |
MsG0380014038.01 | MsG0580026430.01 | 0.819402 | 1.183655e-52 | 9.099248e-50 |
MsG0380014042.01 | MsG0580026430.01 | 0.814547 | 1.457144e-51 | 9.806338e-49 |
MsG0380014053.01 | MsG0580026430.01 | 0.845230 | 4.622093e-59 | 7.651238e-56 |
MsG0380014056.01 | MsG0580026430.01 | 0.800422 | 1.452295e-48 | 6.759750e-46 |
MsG0380014729.01 | MsG0580026430.01 | 0.811328 | 7.396527e-51 | 4.564960e-48 |
MsG0480018844.01 | MsG0580026430.01 | 0.800170 | 1.633755e-48 | 7.555519e-46 |
MsG0480018983.01 | MsG0580026430.01 | 0.823201 | 1.573616e-53 | 1.345886e-50 |
MsG0480019582.01 | MsG0580026430.01 | 0.830302 | 3.170458e-55 | 3.327063e-52 |
MsG0480019592.01 | MsG0580026430.01 | 0.832995 | 6.874103e-56 | 7.812736e-53 |
MsG0480019641.01 | MsG0580026430.01 | 0.803267 | 3.782681e-49 | 1.892524e-46 |
MsG0480019971.01 | MsG0580026430.01 | 0.825430 | 4.707680e-54 | 4.289789e-51 |
MsG0480019974.01 | MsG0580026430.01 | 0.809339 | 1.986884e-50 | 1.163504e-47 |
MsG0480020049.01 | MsG0580026430.01 | 0.854398 | 1.263866e-61 | 2.818729e-58 |
MsG0480020350.01 | MsG0580026430.01 | 0.822891 | 1.858805e-53 | 1.575965e-50 |
MsG0480020408.01 | MsG0580026430.01 | 0.807875 | 4.082770e-50 | 2.299927e-47 |
MsG0480020783.01 | MsG0580026430.01 | 0.800854 | 1.185311e-48 | 5.577911e-46 |
MsG0480021168.01 | MsG0580026430.01 | 0.812466 | 4.179712e-51 | 2.659708e-48 |
MsG0480021294.01 | MsG0580026430.01 | 0.841897 | 3.596815e-58 | 5.360889e-55 |
MsG0480021303.01 | MsG0580026430.01 | 0.838840 | 2.263959e-57 | 3.069743e-54 |
MsG0480021367.01 | MsG0580026430.01 | 0.830534 | 2.782680e-55 | 2.939807e-52 |
MsG0480021420.01 | MsG0580026430.01 | 0.833957 | 3.955400e-56 | 4.627134e-53 |
MsG0480022537.01 | MsG0580026430.01 | 0.801347 | 9.400246e-49 | 4.478914e-46 |
MsG0480022804.01 | MsG0580026430.01 | 0.817638 | 2.972248e-52 | 2.176405e-49 |
MsG0480023166.01 | MsG0580026430.01 | 0.803326 | 3.676514e-49 | 1.842174e-46 |
MsG0480023216.01 | MsG0580026430.01 | 0.822392 | 2.427652e-53 | 2.029439e-50 |
MsG0480023351.01 | MsG0580026430.01 | 0.800340 | 1.509297e-48 | 7.010374e-46 |
MsG0480023371.01 | MsG0580026430.01 | 0.818752 | 1.663419e-52 | 1.255972e-49 |
MsG0480023395.01 | MsG0580026430.01 | 0.809244 | 2.082812e-50 | 1.216605e-47 |
MsG0480023422.01 | MsG0580026430.01 | 0.827167 | 1.817027e-54 | 1.740344e-51 |
MsG0480023505.01 | MsG0580026430.01 | 0.834151 | 3.537372e-56 | 4.161423e-53 |
MsG0480023881.01 | MsG0580026430.01 | 0.824450 | 8.018658e-54 | 7.104547e-51 |
MsG0480023990.01 | MsG0580026430.01 | 0.821236 | 4.493751e-53 | 3.635521e-50 |
MsG0480023992.01 | MsG0580026430.01 | 0.808328 | 3.268340e-50 | 1.863497e-47 |
MsG0580024679.01 | MsG0580026430.01 | 0.802039 | 6.777182e-49 | 3.286193e-46 |
MsG0580024873.01 | MsG0580026430.01 | 0.831556 | 1.561093e-55 | 1.700158e-52 |
MsG0580024982.01 | MsG0580026430.01 | 0.820504 | 6.623025e-53 | 5.249919e-50 |
MsG0580025377.01 | MsG0580026430.01 | 0.801990 | 6.937229e-49 | 3.359531e-46 |
MsG0580025589.01 | MsG0580026430.01 | 0.822985 | 1.767406e-53 | 1.502498e-50 |
MsG0380015496.01 | MsG0580026430.01 | 0.802211 | 6.246194e-49 | 3.042031e-46 |
MsG0380015545.01 | MsG0580026430.01 | 0.817048 | 4.036022e-52 | 2.908122e-49 |
MsG0380015603.01 | MsG0580026430.01 | 0.803149 | 4.001294e-49 | 1.995863e-46 |
MsG0380015898.01 | MsG0580026430.01 | 0.808100 | 3.655455e-50 | 2.071593e-47 |
MsG0380016194.01 | MsG0580026430.01 | 0.805651 | 1.204496e-49 | 6.407442e-47 |
MsG0380016284.01 | MsG0580026430.01 | 0.821962 | 3.054317e-53 | 2.521875e-50 |
MsG0380016452.01 | MsG0580026430.01 | 0.817280 | 3.578279e-52 | 2.594532e-49 |
MsG0380016459.01 | MsG0580026430.01 | 0.829016 | 6.515949e-55 | 6.586143e-52 |
MsG0380016751.01 | MsG0580026430.01 | 0.843354 | 1.475182e-58 | 2.302118e-55 |
MsG0380016762.01 | MsG0580026430.01 | 0.864420 | 1.231827e-64 | 3.865430e-61 |
MsG0380017661.01 | MsG0580026430.01 | 0.813671 | 2.274970e-51 | 1.495068e-48 |
MsG0380017728.01 | MsG0580026430.01 | 0.813382 | 2.633540e-51 | 1.717238e-48 |
MsG0380017976.01 | MsG0580026430.01 | 0.820807 | 5.641986e-53 | 4.510358e-50 |
MsG0380018069.01 | MsG0580026430.01 | 0.814244 | 1.700714e-51 | 1.135187e-48 |
MsG0480018089.01 | MsG0580026430.01 | 0.846896 | 1.627774e-59 | 2.843201e-56 |
MsG0480018297.01 | MsG0580026430.01 | 0.805085 | 1.582556e-49 | 8.296990e-47 |
MsG0480018323.01 | MsG0580026430.01 | 0.810233 | 1.276265e-50 | 7.651565e-48 |
MsG0480018324.01 | MsG0580026430.01 | 0.834478 | 2.928375e-56 | 3.479483e-53 |
MsG0580026430.01 | MsG0580027098.01 | 0.819105 | 1.382863e-52 | 1.054386e-49 |
MsG0580026430.01 | MsG0580027254.01 | 0.825675 | 4.119062e-54 | 3.779905e-51 |
MsG0580026430.01 | MsG0580028024.01 | 0.842962 | 1.876552e-58 | 2.892028e-55 |
MsG0580026430.01 | MsG0580028101.01 | 0.807544 | 4.799857e-50 | 2.680780e-47 |
MsG0580026430.01 | MsG0580028335.01 | 0.831815 | 1.347819e-55 | 1.479251e-52 |
MsG0580026430.01 | MsG0580028723.01 | 0.817687 | 2.898236e-52 | 2.125088e-49 |
MsG0580026430.01 | MsG0580028853.01 | 0.850048 | 2.184516e-60 | 4.225211e-57 |
MsG0580026430.01 | MsG0580028925.01 | 0.818308 | 2.097753e-52 | 1.564607e-49 |
MsG0580026430.01 | MsG0580029414.01 | 0.837032 | 6.603693e-57 | 8.472224e-54 |
MsG0580026430.01 | MsG0680032057.01 | 0.810720 | 1.001911e-50 | 6.085185e-48 |
MsG0580026430.01 | MsG0680032515.01 | 0.804544 | 2.052764e-49 | 1.061281e-46 |
MsG0580026430.01 | MsG0680032954.01 | 0.800231 | 1.587809e-48 | 7.354602e-46 |
MsG0580026430.01 | MsG0680033224.01 | 0.803790 | 2.946518e-49 | 1.494165e-46 |
MsG0580026430.01 | MsG0680033966.01 | 0.814562 | 1.446111e-51 | 9.736173e-49 |
MsG0580026430.01 | MsG0680034064.01 | 0.818306 | 2.100256e-52 | 1.566380e-49 |
MsG0580026430.01 | MsG0680035308.01 | 0.817785 | 2.753906e-52 | 2.024772e-49 |
MsG0580026430.01 | MsG0680035731.01 | 0.806356 | 8.560267e-50 | 4.636439e-47 |
MsG0580026430.01 | MsG0780036387.01 | 0.810244 | 1.269024e-50 | 7.610635e-48 |
MsG0580026430.01 | MsG0780037638.01 | 0.816258 | 6.067354e-52 | 4.278311e-49 |
MsG0580026430.01 | MsG0780037705.01 | 0.865860 | 4.344727e-65 | 1.434870e-61 |
MsG0580026430.01 | MsG0780037915.01 | 0.838212 | 3.287680e-57 | 4.373089e-54 |
MsG0580026430.01 | MsG0780037946.01 | 0.828699 | 7.775587e-55 | 7.787368e-52 |
MsG0580026430.01 | MsG0780038571.01 | 0.833127 | 6.373116e-56 | 7.272388e-53 |
MsG0580026430.01 | MsG0780038653.01 | 0.809633 | 1.718023e-50 | 1.014041e-47 |
MsG0580026430.01 | MsG0780038986.01 | 0.813802 | 2.129016e-51 | 1.404122e-48 |
MsG0580026430.01 | MsG0780039233.01 | 0.810323 | 1.220230e-50 | 7.333050e-48 |
MsG0580026430.01 | MsG0780039707.01 | 0.832721 | 8.041813e-56 | 9.065043e-53 |
MsG0580026430.01 | MsG0780039859.01 | 0.803422 | 3.512749e-49 | 1.764536e-46 |
MsG0580026430.01 | MsG0780039975.01 | 0.853663 | 2.059697e-61 | 4.483763e-58 |
MsG0580026430.01 | MsG0780040314.01 | 0.858551 | 7.623256e-63 | 1.952933e-59 |
MsG0580026430.01 | MsG0780040315.01 | 0.826747 | 2.289672e-54 | 2.166234e-51 |
MsG0580026430.01 | MsG0780040343.01 | 0.809376 | 1.950938e-50 | 1.143599e-47 |
MsG0580026430.01 | MsG0780040350.01 | 0.804422 | 2.176983e-49 | 1.121951e-46 |
MsG0580026430.01 | MsG0780040935.01 | 0.808746 | 2.662070e-50 | 1.534355e-47 |
MsG0580026430.01 | MsG0780041004.01 | 0.825254 | 5.181752e-54 | 4.698515e-51 |
MsG0580026430.01 | MsG0880042021.01 | 0.803019 | 4.257087e-49 | 2.116284e-46 |
MsG0580026430.01 | MsG0880042290.01 | 0.824737 | 6.865160e-54 | 6.134020e-51 |
MsG0580026430.01 | MsG0880042931.01 | 0.831333 | 1.771311e-55 | 1.916151e-52 |
MsG0580026430.01 | MsG0880043075.01 | 0.811176 | 7.978484e-51 | 4.904736e-48 |
MsG0580026430.01 | MsG0880043541.01 | 0.841599 | 4.309419e-58 | 6.364319e-55 |
MsG0580026430.01 | MsG0880044312.01 | 0.802209 | 6.253736e-49 | 3.045475e-46 |
MsG0580026430.01 | MsG0880044314.01 | 0.830012 | 3.731791e-55 | 3.883507e-52 |
MsG0580026430.01 | MsG0880044392.01 | 0.800989 | 1.112299e-48 | 5.252558e-46 |
MsG0580026430.01 | MsG0880044558.01 | 0.802811 | 4.698959e-49 | 2.323915e-46 |
MsG0580026430.01 | MsG0880044884.01 | 0.843482 | 1.364014e-58 | 2.137042e-55 |
MsG0580026430.01 | MsG0880045261.01 | 0.815336 | 9.739587e-52 | 6.696298e-49 |
MsG0580026430.01 | MsG0880045283.01 | 0.848327 | 6.576033e-60 | 1.202512e-56 |
MsG0580026430.01 | MsG0880045361.01 | 0.816170 | 6.348016e-52 | 4.465364e-49 |
MsG0580026430.01 | MsG0880045412.01 | 0.843078 | 1.747986e-58 | 2.703636e-55 |
MsG0580026430.01 | MsG0880046764.01 | 0.804100 | 2.540768e-49 | 1.298701e-46 |
MsG0580026430.01 | MsG0880047156.01 | 0.828971 | 6.680280e-55 | 6.743332e-52 |
MsG0580026430.01 | MsG0880047451.01 | 0.831223 | 1.885809e-55 | 2.033359e-52 |
MsG0580026430.01 | MsG0880047605.01 | 0.808015 | 3.811548e-50 | 2.155191e-47 |
MsG0580026430.01 | MsG0880047614.01 | 0.818095 | 2.343516e-52 | 1.737583e-49 |
MsG0280006913.01 | MsG0580026430.01 | 0.801982 | 6.962213e-49 | 3.370922e-46 |
MsG0280007041.01 | MsG0580026430.01 | 0.857783 | 1.290191e-62 | 3.220989e-59 |
MsG0280007628.01 | MsG0580026430.01 | 0.821506 | 3.893524e-53 | 3.173504e-50 |
MsG0280008227.01 | MsG0580026430.01 | 0.804852 | 1.770632e-49 | 9.228071e-47 |
MsG0280010198.01 | MsG0580026430.01 | 0.833107 | 6.448563e-56 | 7.353913e-53 |
MsG0280010496.01 | MsG0580026430.01 | 0.800694 | 1.278165e-48 | 5.990119e-46 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0580026430.01.T01 | ATCG00530 | 82.456 | 57 | 10 | 0 | 1 | 57 | 173 | 229 | 4.69e-29 | 102 |
Find 8 sgRNAs with CRISPR-Local
Find 7 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
GGGTCTGTCTATAAAGATTT+TGG | 0.195951 | 5:-37129211 | MsG0580026430.01.T01:CDS |
CAGAATGATCAAATTATATC+TGG | 0.400622 | 5:-37129181 | MsG0580026430.01.T01:CDS |
CATGGTTGGGAACTAATGAT+TGG | 0.443529 | 5:-37129232 | None:intergenic |
AAAATTGTATCTAAAATGAC+TGG | 0.459050 | 5:+37129142 | None:intergenic |
ATCTAAAATGACTGGAAAAG+TGG | 0.472631 | 5:+37129150 | None:intergenic |
ATGGTTGGGAACTAATGATT+GGG | 0.515648 | 5:-37129231 | None:intergenic |
GAGATACACGATTTAAATAA+CGG | 0.522190 | 5:+37129104 | None:intergenic |
TGATAAATCACTACAAGTGA+CGG | 0.591823 | 5:+37129082 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!!! | TAGATACAATTTTAAAATAC+TGG | - | Chr5:37129151-37129170 | MsG0580026430.01.T01:CDS | 15.0% |
!!! | AAAATTGTATCTAAAATGAC+TGG | + | Chr5:37129144-37129163 | None:intergenic | 20.0% |
! | CAGAATGATCAAATTATATC+TGG | - | Chr5:37129102-37129121 | MsG0580026430.01.T01:CDS | 25.0% |
! | GAGATACACGATTTAAATAA+CGG | + | Chr5:37129182-37129201 | None:intergenic | 25.0% |
TGATAAATCACTACAAGTGA+CGG | + | Chr5:37129204-37129223 | None:intergenic | 30.0% | |
! | ATCTAAAATGACTGGAAAAG+TGG | + | Chr5:37129136-37129155 | None:intergenic | 30.0% |
! | GGGTCTGTCTATAAAGATTT+TGG | - | Chr5:37129072-37129091 | MsG0580026430.01.T01:CDS | 35.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr5 | gene | 37129066 | 37129239 | 37129066 | ID=MsG0580026430.01;Name=MsG0580026430.01 |
Chr5 | mRNA | 37129066 | 37129239 | 37129066 | ID=MsG0580026430.01.T01;Parent=MsG0580026430.01;Name=MsG0580026430.01.T01;_AED=0.49;_eAED=0.49;_QI=0|-1|0|1|-1|0|1|0|57 |
Chr5 | exon | 37129066 | 37129239 | 37129066 | ID=MsG0580026430.01.T01:exon:7192;Parent=MsG0580026430.01.T01 |
Chr5 | CDS | 37129066 | 37129239 | 37129066 | ID=MsG0580026430.01.T01:cds;Parent=MsG0580026430.01.T01 |
Chr5 | mRNA | 37129152 | 37129199 | 37129152 | ID=MsG0580026430.01.T02;Parent=MsG0580026430.01;Name=MsG0580026430.01.T02;_AED=0.50;_eAED=0.50;_QI=0|-1|0|1|-1|0|1|0|15 |
Chr5 | exon | 37129152 | 37129199 | 37129152 | ID=MsG0580026430.01.T02:exon:7193;Parent=MsG0580026430.01.T02 |
Chr5 | CDS | 37129152 | 37129199 | 37129152 | ID=MsG0580026430.01.T02:cds;Parent=MsG0580026430.01.T02 |
Chr5 | mRNA | 37129066 | 37129077 | 37129066 | ID=MsG0580026430.01.T03;Parent=MsG0580026430.01;Name=MsG0580026430.01.T03;_AED=0.50;_eAED=0.50;_QI=0|-1|0|1|-1|0|1|0|3 |
Chr5 | exon | 37129066 | 37129077 | 37129066 | ID=MsG0580026430.01.T03:exon:7194;Parent=MsG0580026430.01.T03 |
Chr5 | CDS | 37129066 | 37129077 | 37129066 | ID=MsG0580026430.01.T03:cds;Parent=MsG0580026430.01.T03 |
Gene Sequence |
Protein sequence |