Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049079.01.T01 | AES77160.1 | 100 | 70 | 0 | 0 | 1 | 70 | 1 | 70 | 1.46E-43 | 145 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049079.01.T01 | Q2PMU4 | 96 | 50 | 2 | 0 | 21 | 70 | 119 | 168 | 1.43E-29 | 105 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049079.01.T01 | A0A2Z4KH56 | 100.000 | 70 | 0 | 0 | 1 | 70 | 1 | 70 | 6.95e-44 | 145 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080047910.01 | MsG0080049079.01 | 0.830641 | 2.618633e-55 | 2.775464e-52 |
MsG0080047945.01 | MsG0080049079.01 | 0.815590 | 8.549916e-52 | 5.919516e-49 |
MsG0080048068.01 | MsG0080049079.01 | 0.814701 | 1.347650e-51 | 9.106969e-49 |
MsG0080048273.01 | MsG0080049079.01 | 0.823729 | 1.184292e-53 | 1.028280e-50 |
MsG0080048611.01 | MsG0080049079.01 | 0.853018 | 3.151856e-61 | 6.714059e-58 |
MsG0080048689.01 | MsG0080049079.01 | 0.855522 | 5.964034e-62 | 1.380697e-58 |
MsG0080048929.01 | MsG0080049079.01 | 0.827871 | 1.231576e-54 | 1.204047e-51 |
MsG0080049016.01 | MsG0080049079.01 | 0.803382 | 3.580564e-49 | 1.796655e-46 |
MsG0080049072.01 | MsG0080049079.01 | 0.806881 | 6.631239e-50 | 3.640484e-47 |
MsG0080049078.01 | MsG0080049079.01 | 0.905134 | 5.916930e-80 | 9.440917e-76 |
MsG0080049079.01 | MsG0080049080.01 | 0.854833 | 9.456145e-62 | 2.139739e-58 |
MsG0080049079.01 | MsG0080049129.01 | 0.842271 | 2.862797e-58 | 4.317892e-55 |
MsG0080049079.01 | MsG0180000325.01 | 0.848838 | 4.749425e-60 | 8.830033e-57 |
MsG0080049079.01 | MsG0180000502.01 | 0.816778 | 4.640816e-52 | 3.319126e-49 |
MsG0080049079.01 | MsG0180000638.01 | 0.800668 | 1.293464e-48 | 6.058147e-46 |
MsG0080049079.01 | MsG0180000677.01 | 0.806937 | 6.453647e-50 | 3.548048e-47 |
MsG0080049079.01 | MsG0180000878.01 | 0.818571 | 1.828902e-52 | 1.373977e-49 |
MsG0080049079.01 | MsG0180001084.01 | -0.810986 | 8.773029e-51 | 5.366969e-48 |
MsG0080049079.01 | MsG0180001249.01 | 0.848077 | 7.712351e-60 | 1.398689e-56 |
MsG0080049079.01 | MsG0180001772.01 | 0.800047 | 1.730789e-48 | 7.979408e-46 |
MsG0080049079.01 | MsG0180002227.01 | 0.816346 | 5.798225e-52 | 4.098457e-49 |
MsG0080049079.01 | MsG0180003198.01 | 0.827146 | 1.838353e-54 | 1.759605e-51 |
MsG0080049079.01 | MsG0180003274.01 | 0.816667 | 4.912733e-52 | 3.503042e-49 |
MsG0080049079.01 | MsG0180003442.01 | 0.822513 | 2.275154e-53 | 1.908491e-50 |
MsG0080049079.01 | MsG0180003933.01 | 0.883978 | 2.837526e-71 | 1.838711e-67 |
MsG0080049079.01 | MsG0180003949.01 | 0.814826 | 1.264031e-51 | 8.570704e-49 |
MsG0080049079.01 | MsG0180004188.01 | 0.800159 | 1.642820e-48 | 7.595062e-46 |
MsG0080049079.01 | MsG0180004292.01 | 0.804647 | 1.953547e-49 | 1.012721e-46 |
MsG0080049079.01 | MsG0180004302.01 | 0.846136 | 2.624894e-59 | 4.473624e-56 |
MsG0080049079.01 | MsG0180004311.01 | 0.800617 | 1.325338e-48 | 6.199154e-46 |
MsG0080049079.01 | MsG0180004424.01 | -0.804195 | 2.427264e-49 | 1.243680e-46 |
MsG0080049079.01 | MsG0180004937.01 | 0.853977 | 1.672305e-61 | 3.678815e-58 |
MsG0080049079.01 | MsG0180004987.01 | 0.862514 | 4.801967e-64 | 1.410137e-60 |
MsG0080049079.01 | MsG0180005119.01 | 0.861856 | 7.644687e-64 | 2.193485e-60 |
MsG0080049079.01 | MsG0180005150.01 | 0.854680 | 1.047590e-61 | 2.358418e-58 |
MsG0080049079.01 | MsG0180005283.01 | 0.809122 | 2.212053e-50 | 1.287872e-47 |
MsG0080049079.01 | MsG0180005568.01 | 0.860176 | 2.479430e-63 | 6.717699e-60 |
MsG0080049079.01 | MsG0180005760.01 | 0.803511 | 3.365970e-49 | 1.694744e-46 |
MsG0080049079.01 | MsG0180005806.01 | 0.804101 | 2.539516e-49 | 1.298097e-46 |
MsG0080049079.01 | MsG0180005879.01 | 0.845857 | 3.126068e-59 | 5.281109e-56 |
MsG0080049079.01 | MsG0180006223.01 | 0.834178 | 3.482512e-56 | 4.100169e-53 |
MsG0080049079.01 | MsG0280006319.01 | 0.805396 | 1.362230e-49 | 7.199000e-47 |
MsG0080049079.01 | MsG0280006349.01 | 0.812444 | 4.226799e-51 | 2.688081e-48 |
MsG0080049079.01 | MsG0280006706.01 | 0.800615 | 1.326327e-48 | 6.203512e-46 |
MsG0080049079.01 | MsG0280006913.01 | 0.810862 | 9.335407e-51 | 5.691495e-48 |
MsG0080049079.01 | MsG0280007026.01 | 0.821131 | 4.752480e-53 | 3.833651e-50 |
MsG0080049079.01 | MsG0280007041.01 | 0.897788 | 1.000605e-76 | 1.148489e-72 |
MsG0080049079.01 | MsG0280007042.01 | 0.875489 | 2.960039e-68 | 1.384481e-64 |
MsG0080049079.01 | MsG0280007069.01 | 0.817140 | 3.848745e-52 | 2.780079e-49 |
MsG0080049079.01 | MsG0280007102.01 | 0.803072 | 4.149482e-49 | 2.065614e-46 |
MsG0080049079.01 | MsG0280007600.01 | 0.817321 | 3.502926e-52 | 2.542822e-49 |
MsG0080049079.01 | MsG0280007628.01 | 0.814652 | 1.381372e-51 | 9.322683e-49 |
MsG0080049079.01 | MsG0280008227.01 | 0.820610 | 6.263787e-53 | 4.979530e-50 |
MsG0080049079.01 | MsG0280009751.01 | 0.834344 | 3.164272e-56 | 3.744683e-53 |
MsG0080049079.01 | MsG0280009761.01 | 0.808953 | 2.404128e-50 | 1.393288e-47 |
MsG0080049079.01 | MsG0280009863.01 | 0.847892 | 8.673952e-60 | 1.564165e-56 |
MsG0080049079.01 | MsG0280010198.01 | 0.842593 | 2.351805e-58 | 3.583251e-55 |
MsG0080049079.01 | MsG0280010417.01 | -0.807176 | 5.743336e-50 | 3.177250e-47 |
MsG0080049079.01 | MsG0280010496.01 | 0.830750 | 2.463717e-55 | 2.619638e-52 |
MsG0080049079.01 | MsG0280010926.01 | 0.839367 | 1.652779e-57 | 2.277542e-54 |
MsG0080049079.01 | MsG0280010974.01 | 0.817049 | 4.034019e-52 | 2.906756e-49 |
MsG0080049079.01 | MsG0280010975.01 | 0.817458 | 3.264031e-52 | 2.378456e-49 |
MsG0080049079.01 | MsG0280011067.01 | 0.828385 | 9.258105e-55 | 9.188437e-52 |
MsG0080049079.01 | MsG0280011270.01 | 0.827353 | 1.639444e-54 | 1.579011e-51 |
MsG0080049079.01 | MsG0280011279.01 | 0.809130 | 2.202853e-50 | 1.282819e-47 |
MsG0080049079.01 | MsG0280011411.01 | 0.805411 | 1.352323e-49 | 7.149559e-47 |
MsG0080049079.01 | MsG0380011739.01 | 0.819960 | 8.823996e-53 | 6.890344e-50 |
MsG0080049079.01 | MsG0380012443.01 | 0.851761 | 7.188558e-61 | 1.470059e-57 |
MsG0080049079.01 | MsG0380013111.01 | 0.833936 | 4.005339e-56 | 4.682573e-53 |
MsG0080049079.01 | MsG0380013177.01 | 0.807619 | 4.626114e-50 | 2.588813e-47 |
MsG0080049079.01 | MsG0380013472.01 | 0.841140 | 5.692147e-58 | 8.286266e-55 |
MsG0080049079.01 | MsG0380013530.01 | 0.819335 | 1.225719e-52 | 9.404185e-50 |
MsG0080049079.01 | MsG0380013889.01 | 0.817610 | 3.016770e-52 | 2.207325e-49 |
MsG0080049079.01 | MsG0380013918.01 | 0.819950 | 8.872189e-53 | 6.925931e-50 |
MsG0080049079.01 | MsG0380013919.01 | 0.843268 | 1.555961e-58 | 2.421502e-55 |
MsG0080049079.01 | MsG0380013927.01 | 0.882034 | 1.460682e-70 | 8.759190e-67 |
MsG0080049079.01 | MsG0380013930.01 | 0.845237 | 4.602894e-59 | 7.621164e-56 |
MsG0080049079.01 | MsG0380013932.01 | 0.834109 | 3.625060e-56 | 4.259627e-53 |
MsG0080049079.01 | MsG0380013938.01 | 0.830973 | 2.171120e-55 | 2.323829e-52 |
MsG0080049079.01 | MsG0380013939.01 | 0.840765 | 7.140314e-58 | 1.027458e-54 |
MsG0080049079.01 | MsG0380013955.01 | 0.898222 | 6.551609e-77 | 7.672634e-73 |
MsG0080049079.01 | MsG0380013958.01 | 0.912494 | 1.825614e-83 | 4.117992e-79 |
MsG0080049079.01 | MsG0380013964.01 | 0.848385 | 6.341278e-60 | 1.161669e-56 |
MsG0080049079.01 | MsG0380013965.01 | 0.856990 | 2.213952e-62 | 5.381835e-59 |
MsG0080049079.01 | MsG0380013970.01 | 0.907587 | 4.314408e-81 | 7.705786e-77 |
MsG0080049079.01 | MsG0380013976.01 | 0.809027 | 2.317374e-50 | 1.345737e-47 |
MsG0080049079.01 | MsG0380013978.01 | 0.863074 | 3.226067e-64 | 9.657368e-61 |
MsG0080049079.01 | MsG0380013979.01 | 0.838682 | 2.487554e-57 | 3.356745e-54 |
MsG0080049079.01 | MsG0380013980.01 | 0.870076 | 1.916882e-66 | 7.360054e-63 |
MsG0080049079.01 | MsG0380013983.01 | 0.819530 | 1.106752e-52 | 8.539058e-50 |
MsG0080049079.01 | MsG0380013992.01 | 0.856964 | 2.253154e-62 | 5.472582e-59 |
MsG0080049079.01 | MsG0380013996.01 | 0.888780 | 4.356344e-73 | 3.421359e-69 |
MsG0080049079.01 | MsG0380014000.01 | 0.851135 | 1.081146e-60 | 2.166880e-57 |
MsG0080049079.01 | MsG0380014007.01 | 0.895450 | 9.472880e-76 | 9.836450e-72 |
MsG0080049079.01 | MsG0380014009.01 | 0.824421 | 8.147632e-54 | 7.212816e-51 |
MsG0080049079.01 | MsG0380014012.01 | 0.883273 | 5.158579e-71 | 3.248253e-67 |
MsG0080049079.01 | MsG0380014013.01 | 0.878602 | 2.460090e-69 | 1.292545e-65 |
MsG0080049079.01 | MsG0380014022.01 | 0.912176 | 2.629528e-83 | 5.838478e-79 |
MsG0080049079.01 | MsG0380014028.01 | 0.809007 | 2.340244e-50 | 1.358261e-47 |
MsG0080049079.01 | MsG0380014035.01 | 0.851859 | 6.744354e-61 | 1.383340e-57 |
MsG0080049079.01 | MsG0380014036.01 | 0.823013 | 1.741039e-53 | 1.481292e-50 |
MsG0080049079.01 | MsG0380014037.01 | 0.918823 | 9.678634e-87 | 3.007909e-82 |
MsG0080049079.01 | MsG0380014038.01 | 0.842177 | 3.031234e-58 | 4.558179e-55 |
MsG0080049079.01 | MsG0380014041.01 | 0.822372 | 2.454026e-53 | 2.050324e-50 |
MsG0080049079.01 | MsG0380014042.01 | 0.814968 | 1.175847e-51 | 8.003257e-49 |
MsG0080049079.01 | MsG0380014048.01 | 0.803765 | 2.982085e-49 | 1.511223e-46 |
MsG0080049079.01 | MsG0380014050.01 | 0.819829 | 9.455875e-53 | 7.356513e-50 |
MsG0080049079.01 | MsG0380014052.01 | 0.801047 | 1.082766e-48 | 5.120432e-46 |
MsG0080049079.01 | MsG0380014053.01 | 0.887996 | 8.727624e-73 | 6.640714e-69 |
MsG0080049079.01 | MsG0380014055.01 | 0.825379 | 4.841798e-54 | 4.405578e-51 |
MsG0080049079.01 | MsG0380014056.01 | 0.807120 | 5.902603e-50 | 3.260467e-47 |
MsG0080049079.01 | MsG0380014183.01 | 0.814840 | 1.255149e-51 | 8.513634e-49 |
MsG0080049079.01 | MsG0380014646.01 | 0.803776 | 2.966935e-49 | 1.503929e-46 |
MsG0080049079.01 | MsG0380014729.01 | 0.851978 | 6.239082e-61 | 1.284431e-57 |
MsG0080049079.01 | MsG0380014933.01 | 0.812101 | 5.022605e-51 | 3.164450e-48 |
MsG0080049079.01 | MsG0380015077.01 | 0.808491 | 3.017282e-50 | 1.727623e-47 |
MsG0080049079.01 | MsG0380015129.01 | 0.807944 | 3.945512e-50 | 2.226776e-47 |
MsG0080049079.01 | MsG0380015496.01 | 0.838531 | 2.720931e-57 | 3.654720e-54 |
MsG0080049079.01 | MsG0380015530.01 | 0.811997 | 5.290623e-51 | 3.323945e-48 |
MsG0080049079.01 | MsG0380015545.01 | 0.818275 | 2.133848e-52 | 1.590013e-49 |
MsG0080049079.01 | MsG0380015733.01 | 0.812965 | 3.251605e-51 | 2.096255e-48 |
MsG0080049079.01 | MsG0380015898.01 | 0.819925 | 8.990177e-53 | 7.013100e-50 |
MsG0080049079.01 | MsG0380015974.01 | 0.815696 | 8.097136e-52 | 5.622343e-49 |
MsG0080049079.01 | MsG0380016194.01 | 0.802209 | 6.252377e-49 | 3.044850e-46 |
MsG0080049079.01 | MsG0380016344.01 | 0.806651 | 7.418280e-50 | 4.048080e-47 |
MsG0080049079.01 | MsG0380016354.01 | 0.806356 | 8.560905e-50 | 4.636770e-47 |
MsG0080049079.01 | MsG0380016452.01 | 0.836618 | 8.421045e-57 | 1.066874e-53 |
MsG0080049079.01 | MsG0380016459.01 | 0.840364 | 9.089240e-58 | 1.291745e-54 |
MsG0080049079.01 | MsG0380016723.01 | 0.848987 | 4.315907e-60 | 8.063141e-57 |
MsG0080049079.01 | MsG0380016751.01 | 0.856883 | 2.380181e-62 | 5.765467e-59 |
MsG0080049079.01 | MsG0380016762.01 | 0.860426 | 2.082495e-63 | 5.690468e-60 |
MsG0080049079.01 | MsG0380017006.01 | 0.805511 | 1.288653e-49 | 6.830213e-47 |
MsG0080049079.01 | MsG0380017074.01 | 0.802361 | 5.819315e-49 | 2.845126e-46 |
MsG0080049079.01 | MsG0380017309.01 | 0.806716 | 7.187799e-50 | 3.929121e-47 |
MsG0080049079.01 | MsG0380017661.01 | 0.801769 | 7.702465e-49 | 3.709134e-46 |
MsG0080049079.01 | MsG0380017739.01 | 0.811533 | 6.674951e-51 | 4.142323e-48 |
MsG0080049079.01 | MsG0380017976.01 | 0.831312 | 1.793040e-55 | 1.938423e-52 |
MsG0080049079.01 | MsG0480018089.01 | 0.891277 | 4.602190e-74 | 4.007757e-70 |
MsG0080049079.01 | MsG0480018297.01 | 0.800238 | 1.583128e-48 | 7.334060e-46 |
MsG0080049079.01 | MsG0480018323.01 | 0.826922 | 2.079417e-54 | 1.977566e-51 |
MsG0080049079.01 | MsG0480018324.01 | 0.825784 | 3.881435e-54 | 3.573125e-51 |
MsG0080049079.01 | MsG0480018329.01 | 0.818357 | 2.044613e-52 | 1.527144e-49 |
MsG0080049079.01 | MsG0480018330.01 | 0.803507 | 3.372658e-49 | 1.697924e-46 |
MsG0080049079.01 | MsG0480018629.01 | 0.802986 | 4.324882e-49 | 2.148191e-46 |
MsG0080049079.01 | MsG0480018631.01 | 0.818722 | 1.690064e-52 | 1.275004e-49 |
MsG0080049079.01 | MsG0480018844.01 | 0.829894 | 3.986127e-55 | 4.134682e-52 |
MsG0080049079.01 | MsG0480018983.01 | 0.854804 | 9.646130e-62 | 2.180798e-58 |
MsG0080049079.01 | MsG0480019582.01 | 0.812644 | 3.821187e-51 | 2.442847e-48 |
MsG0080049079.01 | MsG0480019592.01 | 0.846164 | 2.580008e-59 | 4.401164e-56 |
MsG0080049079.01 | MsG0480019971.01 | 0.800781 | 1.227029e-48 | 5.763067e-46 |
MsG0080049079.01 | MsG0480019974.01 | 0.820151 | 7.982963e-53 | 6.266773e-50 |
MsG0080049079.01 | MsG0480020049.01 | 0.887475 | 1.381690e-72 | 1.029032e-68 |
MsG0080049079.01 | MsG0480020122.01 | 0.815283 | 1.000857e-51 | 6.871262e-49 |
MsG0080049079.01 | MsG0480020350.01 | 0.843794 | 1.125165e-58 | 1.780138e-55 |
MsG0080049079.01 | MsG0480020533.01 | 0.822589 | 2.185430e-53 | 1.837281e-50 |
MsG0080049079.01 | MsG0480021294.01 | 0.818910 | 1.532055e-52 | 1.161944e-49 |
MsG0080049079.01 | MsG0480021303.01 | 0.857818 | 1.259739e-62 | 3.148883e-59 |
MsG0080049079.01 | MsG0480021346.01 | 0.807640 | 4.580204e-50 | 2.564451e-47 |
MsG0080049079.01 | MsG0480021367.01 | 0.839691 | 1.362179e-57 | 1.895660e-54 |
MsG0080049079.01 | MsG0480021420.01 | 0.858445 | 8.198861e-63 | 2.093026e-59 |
MsG0080049079.01 | MsG0480021521.01 | 0.803263 | 3.789598e-49 | 1.895797e-46 |
MsG0080049079.01 | MsG0480021709.01 | 0.800336 | 1.512103e-48 | 7.022602e-46 |
MsG0080049079.01 | MsG0480021999.01 | 0.800357 | 1.496990e-48 | 6.956236e-46 |
MsG0080049079.01 | MsG0480022300.01 | 0.839934 | 1.177291e-57 | 1.650947e-54 |
MsG0080049079.01 | MsG0480022804.01 | 0.845137 | 4.897668e-59 | 8.082852e-56 |
MsG0080049079.01 | MsG0480023216.01 | 0.801540 | 8.579678e-49 | 4.107897e-46 |
MsG0080049079.01 | MsG0480023371.01 | 0.851999 | 6.152492e-61 | 1.267564e-57 |
MsG0080049079.01 | MsG0480023395.01 | 0.824918 | 6.221437e-54 | 5.587759e-51 |
MsG0080049079.01 | MsG0480023422.01 | 0.837007 | 6.698425e-57 | 8.587683e-54 |
MsG0080049079.01 | MsG0480023502.01 | 0.800123 | 1.670294e-48 | 7.715474e-46 |
MsG0080049079.01 | MsG0480023505.01 | 0.862630 | 4.421855e-64 | 1.303554e-60 |
MsG0080049079.01 | MsG0480023708.01 | 0.817535 | 3.136236e-52 | 2.290022e-49 |
MsG0080049079.01 | MsG0480023850.01 | 0.805185 | 1.508247e-49 | 7.927673e-47 |
MsG0080049079.01 | MsG0480023881.01 | 0.864879 | 8.849447e-65 | 2.821531e-61 |
MsG0080049079.01 | MsG0480023989.01 | 0.806896 | 6.583697e-50 | 3.615660e-47 |
MsG0080049079.01 | MsG0480023991.01 | 0.805724 | 1.162585e-49 | 6.196537e-47 |
MsG0080049079.01 | MsG0480023992.01 | 0.800801 | 1.215209e-48 | 5.710582e-46 |
MsG0080049079.01 | MsG0580024128.01 | 0.807950 | 3.934565e-50 | 2.220937e-47 |
MsG0080049079.01 | MsG0580024537.01 | 0.805726 | 1.161561e-49 | 6.191309e-47 |
MsG0080049079.01 | MsG0580024567.01 | 0.850411 | 1.728302e-60 | 3.382603e-57 |
MsG0080049079.01 | MsG0580024679.01 | 0.803021 | 4.252327e-49 | 2.114042e-46 |
MsG0080049079.01 | MsG0580024763.01 | 0.814964 | 1.178371e-51 | 8.019645e-49 |
MsG0080049079.01 | MsG0580024782.01 | -0.820925 | 5.301043e-53 | 4.251724e-50 |
MsG0080049079.01 | MsG0580024836.01 | 0.813143 | 2.971579e-51 | 1.924910e-48 |
MsG0080049079.01 | MsG0580024944.01 | 0.802728 | 4.888899e-49 | 2.412697e-46 |
MsG0080049079.01 | MsG0580024982.01 | 0.856731 | 2.637642e-62 | 6.355615e-59 |
MsG0080049079.01 | MsG0580025054.01 | 0.818604 | 1.797023e-52 | 1.351273e-49 |
MsG0080049079.01 | MsG0580025589.01 | 0.837967 | 3.802089e-57 | 5.020181e-54 |
MsG0080049079.01 | MsG0580026430.01 | 0.877456 | 6.191762e-69 | 3.115438e-65 |
MsG0080049079.01 | MsG0580027098.01 | 0.867836 | 1.019951e-65 | 3.611317e-62 |
MsG0080049079.01 | MsG0580027099.01 | 0.839762 | 1.305004e-57 | 1.820098e-54 |
MsG0080049079.01 | MsG0580027249.01 | 0.823134 | 1.631160e-53 | 1.392550e-50 |
MsG0080049079.01 | MsG0580027254.01 | 0.871652 | 5.803548e-67 | 2.359442e-63 |
MsG0080049079.01 | MsG0580027983.01 | 0.820083 | 8.270143e-53 | 6.480391e-50 |
MsG0080049079.01 | MsG0580028024.01 | 0.809698 | 1.663497e-50 | 9.834871e-48 |
MsG0080049079.01 | MsG0580028101.01 | 0.802781 | 4.767424e-49 | 2.355914e-46 |
MsG0080049079.01 | MsG0580028335.01 | 0.817109 | 3.910231e-52 | 2.822025e-49 |
MsG0080049079.01 | MsG0580028853.01 | 0.861304 | 1.127342e-63 | 3.175818e-60 |
MsG0080049079.01 | MsG0580028925.01 | 0.831619 | 1.506208e-55 | 1.643368e-52 |
MsG0080049079.01 | MsG0580029414.01 | 0.809056 | 2.284312e-50 | 1.327589e-47 |
MsG0080049079.01 | MsG0580029673.01 | 0.805793 | 1.124509e-49 | 6.003914e-47 |
MsG0080049079.01 | MsG0580029719.01 | 0.839615 | 1.425423e-57 | 1.979146e-54 |
MsG0080049079.01 | MsG0680030290.01 | 0.829245 | 5.735186e-55 | 5.837117e-52 |
MsG0080049079.01 | MsG0680030776.01 | 0.805992 | 1.021305e-49 | 5.480863e-47 |
MsG0080049079.01 | MsG0680032055.01 | 0.842967 | 1.871206e-58 | 2.884182e-55 |
MsG0080049079.01 | MsG0680032057.01 | 0.821322 | 4.294407e-53 | 3.482437e-50 |
MsG0080049079.01 | MsG0680032515.01 | 0.830688 | 2.550117e-55 | 2.706706e-52 |
MsG0080049079.01 | MsG0680033224.01 | 0.821774 | 3.375766e-53 | 2.772609e-50 |
MsG0080049079.01 | MsG0680033902.01 | 0.804169 | 2.458129e-49 | 1.258666e-46 |
MsG0080049079.01 | MsG0680033966.01 | 0.845814 | 3.210717e-59 | 5.416696e-56 |
MsG0080049079.01 | MsG0680034724.01 | 0.818113 | 2.322244e-52 | 1.722732e-49 |
MsG0080049079.01 | MsG0680035308.01 | 0.813300 | 2.744078e-51 | 1.785258e-48 |
MsG0080049079.01 | MsG0680035612.01 | 0.810143 | 1.334717e-50 | 7.983258e-48 |
MsG0080049079.01 | MsG0780036387.01 | 0.815654 | 8.275007e-52 | 5.739396e-49 |
MsG0080049079.01 | MsG0780036677.01 | 0.809349 | 1.977259e-50 | 1.158215e-47 |
MsG0080049079.01 | MsG0780036925.01 | 0.810622 | 1.051788e-50 | 6.371313e-48 |
MsG0080049079.01 | MsG0780037705.01 | 0.862097 | 6.450525e-64 | 1.866466e-60 |
MsG0080049079.01 | MsG0780037915.01 | 0.859159 | 5.014019e-63 | 1.311520e-59 |
MsG0080049079.01 | MsG0780037946.01 | 0.815422 | 9.319561e-52 | 6.422611e-49 |
MsG0080049079.01 | MsG0780037963.01 | 0.800794 | 1.219508e-48 | 5.729664e-46 |
MsG0080049079.01 | MsG0780038496.01 | 0.819346 | 1.219010e-52 | 9.355420e-50 |
MsG0080049079.01 | MsG0780038571.01 | 0.835999 | 1.209933e-56 | 1.504714e-53 |
MsG0080049079.01 | MsG0780038653.01 | 0.840610 | 7.838776e-58 | 1.122494e-54 |
MsG0080049079.01 | MsG0780038986.01 | 0.826107 | 3.252189e-54 | 3.021371e-51 |
MsG0080049079.01 | MsG0780039449.01 | 0.803507 | 3.372540e-49 | 1.697867e-46 |
MsG0080049079.01 | MsG0780039596.01 | 0.836417 | 9.470894e-57 | 1.192834e-53 |
MsG0080049079.01 | MsG0780039707.01 | 0.870030 | 1.985489e-66 | 7.611484e-63 |
MsG0080049079.01 | MsG0780039859.01 | 0.850163 | 2.027601e-60 | 3.936249e-57 |
MsG0080049079.01 | MsG0780039975.01 | 0.824297 | 8.710721e-54 | 7.683997e-51 |
MsG0080049079.01 | MsG0780040080.01 | 0.807384 | 5.190066e-50 | 2.886747e-47 |
MsG0080049079.01 | MsG0780040314.01 | 0.853645 | 2.084076e-61 | 4.534000e-58 |
MsG0080049079.01 | MsG0780040315.01 | 0.863213 | 2.922955e-64 | 8.792927e-61 |
MsG0080049079.01 | MsG0780040316.01 | 0.810715 | 1.004386e-50 | 6.099402e-48 |
MsG0080049079.01 | MsG0780040317.01 | 0.807657 | 4.541503e-50 | 2.543939e-47 |
MsG0080049079.01 | MsG0780040343.01 | 0.810055 | 1.393896e-50 | 8.318430e-48 |
MsG0080049079.01 | MsG0780040350.01 | 0.831410 | 1.695937e-55 | 1.838757e-52 |
MsG0080049079.01 | MsG0780040437.01 | 0.805036 | 1.620292e-49 | 8.484071e-47 |
MsG0080049079.01 | MsG0780040644.01 | 0.813040 | 3.129817e-51 | 2.021913e-48 |
MsG0080049079.01 | MsG0780041004.01 | 0.846719 | 1.820803e-59 | 3.162785e-56 |
MsG0080049079.01 | MsG0780041022.01 | 0.802613 | 5.162333e-49 | 2.540082e-46 |
MsG0080049079.01 | MsG0780041024.01 | 0.814904 | 1.214976e-51 | 8.255047e-49 |
MsG0080049079.01 | MsG0780041249.01 | 0.820498 | 6.643272e-53 | 5.265238e-50 |
MsG0080049079.01 | MsG0780041289.01 | 0.826666 | 2.393580e-54 | 2.259385e-51 |
MsG0080049079.01 | MsG0780041792.01 | 0.823679 | 1.216412e-53 | 1.054656e-50 |
MsG0080049079.01 | MsG0880042006.01 | 0.844210 | 8.703567e-59 | 1.395195e-55 |
MsG0080049079.01 | MsG0880042021.01 | 0.814933 | 1.196804e-51 | 8.138159e-49 |
MsG0080049079.01 | MsG0880042290.01 | 0.826642 | 2.425281e-54 | 2.287715e-51 |
MsG0080049079.01 | MsG0880042921.01 | 0.816145 | 6.429783e-52 | 4.519790e-49 |
MsG0080049079.01 | MsG0880042931.01 | 0.814450 | 1.530861e-51 | 1.027542e-48 |
MsG0080049079.01 | MsG0880043032.01 | 0.816196 | 6.263740e-52 | 4.409203e-49 |
MsG0080049079.01 | MsG0880043075.01 | 0.849175 | 3.827697e-60 | 7.196257e-57 |
MsG0080049079.01 | MsG0880043259.01 | 0.802770 | 4.791765e-49 | 2.367266e-46 |
MsG0080049079.01 | MsG0880043541.01 | 0.874361 | 7.170638e-68 | 3.218644e-64 |
MsG0080049079.01 | MsG0880044312.01 | 0.849880 | 2.433676e-60 | 4.680892e-57 |
MsG0080049079.01 | MsG0880044314.01 | 0.873209 | 1.755216e-67 | 7.554903e-64 |
MsG0080049079.01 | MsG0880044440.01 | 0.837377 | 5.388674e-57 | 6.986043e-54 |
MsG0080049079.01 | MsG0880044558.01 | 0.807792 | 4.250948e-50 | 2.389674e-47 |
MsG0080049079.01 | MsG0880044884.01 | 0.827259 | 1.726617e-54 | 1.658352e-51 |
MsG0080049079.01 | MsG0880045073.01 | 0.826993 | 1.999811e-54 | 1.905655e-51 |
MsG0080049079.01 | MsG0880045252.01 | 0.826639 | 2.429692e-54 | 2.291685e-51 |
MsG0080049079.01 | MsG0880045261.01 | 0.842334 | 2.755893e-58 | 4.165042e-55 |
MsG0080049079.01 | MsG0880045283.01 | 0.890189 | 1.233011e-73 | 1.026079e-69 |
MsG0080049079.01 | MsG0880045412.01 | 0.867447 | 1.359896e-65 | 4.749695e-62 |
MsG0080049079.01 | MsG0880046288.01 | 0.840842 | 6.815851e-58 | 9.831348e-55 |
MsG0080049079.01 | MsG0880046735.01 | 0.803747 | 3.007076e-49 | 1.523184e-46 |
MsG0080049079.01 | MsG0880046856.01 | 0.806552 | 7.783715e-50 | 4.237185e-47 |
MsG0080049079.01 | MsG0880046866.01 | 0.829965 | 3.832000e-55 | 3.982503e-52 |
MsG0080049079.01 | MsG0880047156.01 | 0.804910 | 1.721654e-49 | 8.986598e-47 |
MsG0080049079.01 | MsG0880047157.01 | 0.805158 | 1.528075e-49 | 8.026354e-47 |
MsG0080049079.01 | MsG0880047451.01 | 0.828671 | 7.895514e-55 | 7.901191e-52 |
MsG0080049079.01 | MsG0880047605.01 | 0.828776 | 7.449479e-55 | 7.477146e-52 |
MsG0080049079.01 | MsG0880047614.01 | 0.803935 | 2.749579e-49 | 1.399585e-46 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049079.01.T01 | MTR_6g092730 | 100.000 | 70 | 0 | 0 | 1 | 70 | 1 | 70 | 1.76e-47 | 145 |
MsG0080049079.01.T01 | MTR_3g035590 | 98.571 | 70 | 1 | 0 | 1 | 70 | 1 | 70 | 3.00e-46 | 141 |
MsG0080049079.01.T01 | MTR_0002s0590 | 92.453 | 53 | 4 | 0 | 18 | 70 | 282 | 334 | 3.01e-30 | 108 |
MsG0080049079.01.T01 | MTR_4g051210 | 100.000 | 46 | 0 | 0 | 25 | 70 | 77 | 122 | 1.25e-28 | 99.0 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049079.01.T01 | ATCG00360 | 86.000 | 50 | 7 | 0 | 21 | 70 | 77 | 126 | 3.19e-26 | 93.2 |
Find 27 sgRNAs with CRISPR-Local
Find 26 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
AACTCTCAAGTACGGTTCTA+AGG | 0.265886 | contig65end:-8494 | MsG0080049079.01.T01:CDS |
TTGATCAAGCCGCTGAATAT+TGG | 0.308340 | contig65end:-8393 | MsG0080049079.01.T01:CDS |
CTGTTCTCCGCGGTCGGAAT+AGG | 0.311511 | contig65end:+8456 | None:intergenic |
ATTCTGAAATTGCGGAATCT+TGG | 0.383817 | contig65end:-8417 | MsG0080049079.01.T01:CDS |
ATTATATTGAAGCACAGAAT+TGG | 0.407853 | contig65end:-8342 | MsG0080049079.01.T01:CDS |
CTATTCCGACCGCGGAGAAC+AGG | 0.412079 | contig65end:-8455 | MsG0080049079.01.T01:CDS |
CAATATAATTCCCAGGGGTA+AGG | 0.423950 | contig65end:+8356 | None:intergenic |
CGGAGAACAGGCCATTCGAC+AGG | 0.449760 | contig65end:-8443 | MsG0080049079.01.T01:CDS |
ACTGTTGAGCCGTATGAGTC+AGG | 0.464317 | contig65end:-8518 | None:intergenic |
CAGAATTGGTTGAAGATCAC+AGG | 0.505448 | contig65end:-8328 | MsG0080049079.01.T01:CDS |
CAAGCTATAGCCCTTACCCC+TGG | 0.522286 | contig65end:-8367 | MsG0080049079.01.T01:CDS |
TGTGCTTCAATATAATTCCC+AGG | 0.522936 | contig65end:+8349 | None:intergenic |
AATATAATTCCCAGGGGTAA+GGG | 0.530205 | contig65end:+8357 | None:intergenic |
ACTCTCAAGTACGGTTCTAA+GGG | 0.543497 | contig65end:-8493 | MsG0080049079.01.T01:CDS |
AATGGCCTGTTCTCCGCGGT+CGG | 0.545774 | contig65end:+8450 | None:intergenic |
GTGCTTCAATATAATTCCCA+GGG | 0.548774 | contig65end:+8350 | None:intergenic |
TTCAGAATCTCCCTGTCGAA+TGG | 0.562027 | contig65end:+8432 | None:intergenic |
AAGCTATAGCCCTTACCCCT+GGG | 0.575228 | contig65end:-8366 | MsG0080049079.01.T01:CDS |
AGCTTGTTTCCAATATTCAG+CGG | 0.581772 | contig65end:+8384 | None:intergenic |
AGTCAGGAAACTCTCAAGTA+CGG | 0.591143 | contig65end:-8502 | MsG0080049079.01.T01:CDS |
ACAGGGAGATTCTGAAATTG+CGG | 0.592934 | contig65end:-8425 | MsG0080049079.01.T01:CDS |
TCAAGTACGGTTCTAAGGGA+AGG | 0.605491 | contig65end:-8489 | MsG0080049079.01.T01:CDS |
GGAGAACAGGCCATTCGACA+GGG | 0.615464 | contig65end:-8442 | MsG0080049079.01.T01:CDS |
GTCGAATGGCCTGTTCTCCG+CGG | 0.644787 | contig65end:+8446 | None:intergenic |
TTACTCACCTATTCCGACCG+CGG | 0.663047 | contig65end:-8463 | MsG0080049079.01.T01:CDS |
AGAATTGGTTGAAGATCACA+GGG | 0.667313 | contig65end:-8327 | MsG0080049079.01.T01:CDS |
TGCTTCAATATAATTCCCAG+GGG | 0.722159 | contig65end:+8351 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
! | ATTATATTGAAGCACAGAAT+TGG | - | contig65end:8478-8497 | MsG0080049079.01.T01:CDS | 25.0% |
AATATAATTCCCAGGGGTAA+GGG | + | contig65end:8466-8485 | None:intergenic | 35.0% | |
AGAATTGGTTGAAGATCACA+GGG | - | contig65end:8493-8512 | MsG0080049079.01.T01:CDS | 35.0% | |
GTGCTTCAATATAATTCCCA+GGG | + | contig65end:8473-8492 | None:intergenic | 35.0% | |
TGCTTCAATATAATTCCCAG+GGG | + | contig65end:8472-8491 | None:intergenic | 35.0% | |
TGTGCTTCAATATAATTCCC+AGG | + | contig65end:8474-8493 | None:intergenic | 35.0% | |
! | AGCTTGTTTCCAATATTCAG+CGG | + | contig65end:8439-8458 | None:intergenic | 35.0% |
!! | ATTCTGAAATTGCGGAATCT+TGG | - | contig65end:8403-8422 | MsG0080049079.01.T01:CDS | 35.0% |
AACTCTCAAGTACGGTTCTA+AGG | - | contig65end:8326-8345 | MsG0080049079.01.T01:CDS | 40.0% | |
AGTCAGGAAACTCTCAAGTA+CGG | - | contig65end:8318-8337 | MsG0080049079.01.T01:CDS | 40.0% | |
CAATATAATTCCCAGGGGTA+AGG | + | contig65end:8467-8486 | None:intergenic | 40.0% | |
CAGAATTGGTTGAAGATCAC+AGG | - | contig65end:8492-8511 | MsG0080049079.01.T01:CDS | 40.0% | |
TTGATCAAGCCGCTGAATAT+TGG | - | contig65end:8427-8446 | MsG0080049079.01.T01:CDS | 40.0% | |
! | ACTCTCAAGTACGGTTCTAA+GGG | - | contig65end:8327-8346 | MsG0080049079.01.T01:CDS | 40.0% |
!! | ACAGGGAGATTCTGAAATTG+CGG | - | contig65end:8395-8414 | MsG0080049079.01.T01:CDS | 40.0% |
TTCAGAATCTCCCTGTCGAA+TGG | + | contig65end:8391-8410 | None:intergenic | 45.0% | |
!! | TCAAGTACGGTTCTAAGGGA+AGG | - | contig65end:8331-8350 | MsG0080049079.01.T01:CDS | 45.0% |
AAGCTATAGCCCTTACCCCT+GGG | - | contig65end:8454-8473 | MsG0080049079.01.T01:CDS | 50.0% | |
TTACTCACCTATTCCGACCG+CGG | - | contig65end:8357-8376 | MsG0080049079.01.T01:CDS | 50.0% | |
CAAGCTATAGCCCTTACCCC+TGG | - | contig65end:8453-8472 | MsG0080049079.01.T01:CDS | 55.0% | |
GGAGAACAGGCCATTCGACA+GGG | - | contig65end:8378-8397 | MsG0080049079.01.T01:CDS | 55.0% | |
AATGGCCTGTTCTCCGCGGT+CGG | + | contig65end:8373-8392 | None:intergenic | 60.0% | |
CGGAGAACAGGCCATTCGAC+AGG | - | contig65end:8377-8396 | MsG0080049079.01.T01:CDS | 60.0% | |
CTATTCCGACCGCGGAGAAC+AGG | - | contig65end:8365-8384 | MsG0080049079.01.T01:CDS | 60.0% | |
CTGTTCTCCGCGGTCGGAAT+AGG | + | contig65end:8367-8386 | None:intergenic | 60.0% | |
GTCGAATGGCCTGTTCTCCG+CGG | + | contig65end:8377-8396 | None:intergenic | 60.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
contig65end | gene | 8315 | 8527 | 8315 | ID=MsG0080049079.01;Name=MsG0080049079.01 |
contig65end | mRNA | 8315 | 8527 | 8315 | ID=MsG0080049079.01.T01;Parent=MsG0080049079.01;Name=MsG0080049079.01.T01;_AED=0.50;_eAED=0.50;_QI=0|-1|0|1|-1|1|1|0|70 |
contig65end | exon | 8315 | 8527 | 8315 | ID=MsG0080049079.01.T01:exon:11322;Parent=MsG0080049079.01.T01 |
contig65end | CDS | 8315 | 8527 | 8315 | ID=MsG0080049079.01.T01:cds;Parent=MsG0080049079.01.T01 |
Gene Sequence |
Protein sequence |