Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0380015877.01.T01 | XP_003601315.3 | 92.308 | 65 | 5 | 0 | 1 | 65 | 423 | 487 | 2.88E-33 | 130 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0380015877.01.T01 | Q9XF23 | 52.542 | 59 | 27 | 1 | 5 | 63 | 393 | 450 | 2.00E-13 | 66.6 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0380015877.01.T01 | A0A396ITH9 | 92.308 | 65 | 5 | 0 | 1 | 65 | 423 | 487 | 1.38e-33 | 130 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080048177.01 | MsG0380015877.01 | 0.834447 | 2.981834e-56 | 3.539718e-53 |
MsG0080048178.01 | MsG0380015877.01 | 0.832319 | 1.011583e-55 | 1.126531e-52 |
MsG0080048915.01 | MsG0380015877.01 | 0.844419 | 7.647323e-59 | 1.233855e-55 |
MsG0180000154.01 | MsG0380015877.01 | 0.821033 | 5.006875e-53 | 4.028141e-50 |
MsG0180000585.01 | MsG0380015877.01 | 0.815939 | 7.149283e-52 | 4.997022e-49 |
MsG0180000822.01 | MsG0380015877.01 | 0.826587 | 2.499767e-54 | 2.354158e-51 |
MsG0180001904.01 | MsG0380015877.01 | 0.823808 | 1.134666e-53 | 9.873350e-51 |
MsG0180002894.01 | MsG0380015877.01 | 0.821104 | 4.821117e-53 | 3.886149e-50 |
MsG0180002952.01 | MsG0380015877.01 | 0.812957 | 3.264674e-51 | 2.104164e-48 |
MsG0180004060.01 | MsG0380015877.01 | 0.812101 | 5.022358e-51 | 3.164306e-48 |
MsG0180004114.01 | MsG0380015877.01 | 0.820746 | 5.826656e-53 | 4.649831e-50 |
MsG0180005172.01 | MsG0380015877.01 | 0.814910 | 1.211085e-51 | 8.229994e-49 |
MsG0180005278.01 | MsG0380015877.01 | 0.800260 | 1.566658e-48 | 7.261869e-46 |
MsG0180005279.01 | MsG0380015877.01 | 0.823115 | 1.647597e-53 | 1.405840e-50 |
MsG0180005692.01 | MsG0380015877.01 | 0.801062 | 1.075132e-48 | 5.086170e-46 |
MsG0180006257.01 | MsG0380015877.01 | 0.808945 | 2.413108e-50 | 1.398211e-47 |
MsG0280010614.01 | MsG0380015877.01 | 0.840381 | 8.997351e-58 | 1.279400e-54 |
MsG0280010648.01 | MsG0380015877.01 | 0.804886 | 1.741997e-49 | 9.087153e-47 |
MsG0280010698.01 | MsG0380015877.01 | 0.812032 | 5.198660e-51 | 3.269113e-48 |
MsG0280011024.01 | MsG0380015877.01 | 0.843834 | 1.098124e-58 | 1.739643e-55 |
MsG0280011052.01 | MsG0380015877.01 | 0.809757 | 1.615630e-50 | 9.567171e-48 |
MsG0280011163.01 | MsG0380015877.01 | 0.802761 | 4.812628e-49 | 2.376998e-46 |
MsG0280011293.01 | MsG0380015877.01 | 0.801735 | 7.826700e-49 | 3.765737e-46 |
MsG0280011334.01 | MsG0380015877.01 | 0.808995 | 2.354369e-50 | 1.366024e-47 |
MsG0380011663.01 | MsG0380015877.01 | 0.827275 | 1.711393e-54 | 1.644428e-51 |
MsG0380011754.01 | MsG0380015877.01 | 0.811041 | 8.536796e-51 | 5.229468e-48 |
MsG0380012021.01 | MsG0380015877.01 | 0.824348 | 8.472715e-54 | 7.485175e-51 |
MsG0380012033.01 | MsG0380015877.01 | 0.845904 | 3.036181e-59 | 5.136929e-56 |
MsG0380013176.01 | MsG0380015877.01 | 0.840721 | 7.333290e-58 | 1.053796e-54 |
MsG0380013436.01 | MsG0380015877.01 | 0.833436 | 5.339726e-56 | 6.149145e-53 |
MsG0380014122.01 | MsG0380015877.01 | 0.812477 | 4.156146e-51 | 2.645425e-48 |
MsG0380014135.01 | MsG0380015877.01 | 0.809733 | 1.635644e-50 | 9.679182e-48 |
MsG0380014163.01 | MsG0380015877.01 | 0.803226 | 3.857587e-49 | 1.927938e-46 |
MsG0380014573.01 | MsG0380015877.01 | 0.847187 | 1.354881e-59 | 2.388979e-56 |
MsG0380015852.01 | MsG0380015877.01 | 0.838093 | 3.529216e-57 | 4.677271e-54 |
MsG0380015877.01 | MsG0380015878.01 | 0.895222 | 1.176059e-75 | 1.209052e-71 |
MsG0380015877.01 | MsG0380015931.01 | 0.826020 | 3.411657e-54 | 3.161697e-51 |
MsG0380015877.01 | MsG0380015986.01 | 0.824021 | 1.011481e-53 | 8.853049e-51 |
MsG0380015877.01 | MsG0380016236.01 | 0.809331 | 1.995301e-50 | 1.168166e-47 |
MsG0380015877.01 | MsG0380016909.01 | 0.814129 | 1.802765e-51 | 1.199532e-48 |
MsG0380015877.01 | MsG0380017140.01 | 0.803635 | 3.172583e-49 | 1.602390e-46 |
MsG0380015877.01 | MsG0380017940.01 | 0.844964 | 5.453674e-59 | 8.952016e-56 |
MsG0380015877.01 | MsG0480018321.01 | 0.805701 | 1.175712e-49 | 6.262693e-47 |
MsG0380015877.01 | MsG0480018640.01 | 0.808819 | 2.567552e-50 | 1.482739e-47 |
MsG0380015877.01 | MsG0480019034.01 | 0.801357 | 9.354840e-49 | 4.458467e-46 |
MsG0380015877.01 | MsG0480019329.01 | 0.806775 | 6.982598e-50 | 3.822739e-47 |
MsG0380015877.01 | MsG0480019435.01 | 0.809269 | 2.056403e-50 | 1.201977e-47 |
MsG0380015877.01 | MsG0480020445.01 | 0.800620 | 1.322950e-48 | 6.188610e-46 |
MsG0380015877.01 | MsG0480020886.01 | 0.805095 | 1.574991e-49 | 8.259348e-47 |
MsG0380015877.01 | MsG0480021021.01 | 0.823371 | 1.435942e-53 | 1.233933e-50 |
MsG0380015877.01 | MsG0480021438.01 | 0.832245 | 1.055303e-55 | 1.172684e-52 |
MsG0380015877.01 | MsG0480021441.01 | 0.823095 | 1.665281e-53 | 1.420126e-50 |
MsG0380015877.01 | MsG0480021900.01 | 0.814852 | 1.247443e-51 | 8.464046e-49 |
MsG0380015877.01 | MsG0480021927.01 | 0.809581 | 1.762974e-50 | 1.039096e-47 |
MsG0380015877.01 | MsG0480022406.01 | 0.812401 | 4.318871e-51 | 2.743484e-48 |
MsG0380015877.01 | MsG0480022451.01 | 0.818832 | 1.595457e-52 | 1.207338e-49 |
MsG0380015877.01 | MsG0480022575.01 | 0.808393 | 3.166627e-50 | 1.808526e-47 |
MsG0380015877.01 | MsG0480022597.01 | 0.807498 | 4.908459e-50 | 2.738288e-47 |
MsG0380015877.01 | MsG0480022598.01 | 0.805755 | 1.145322e-49 | 6.109308e-47 |
MsG0380015877.01 | MsG0480022862.01 | 0.813066 | 3.089405e-51 | 1.997116e-48 |
MsG0380015877.01 | MsG0480023223.01 | 0.800363 | 1.492640e-48 | 6.937119e-46 |
MsG0380015877.01 | MsG0480023224.01 | 0.825471 | 4.605066e-54 | 4.201099e-51 |
MsG0380015877.01 | MsG0480023245.01 | 0.803300 | 3.722662e-49 | 1.864040e-46 |
MsG0380015877.01 | MsG0480023248.01 | 0.804013 | 2.648107e-49 | 1.350577e-46 |
MsG0380015877.01 | MsG0480023427.01 | 0.803541 | 3.317973e-49 | 1.671873e-46 |
MsG0380015877.01 | MsG0480023898.01 | 0.835369 | 1.746238e-56 | 2.131132e-53 |
MsG0380015877.01 | MsG0480023900.01 | 0.811255 | 7.671378e-51 | 4.725727e-48 |
MsG0380015877.01 | MsG0480023903.01 | 0.852860 | 3.498649e-61 | 7.413238e-58 |
MsG0380015877.01 | MsG0580024157.01 | 0.801925 | 7.153660e-49 | 3.458686e-46 |
MsG0380015877.01 | MsG0580024205.01 | 0.839367 | 1.652855e-57 | 2.277637e-54 |
MsG0380015877.01 | MsG0580024305.01 | 0.800522 | 1.385678e-48 | 6.465779e-46 |
MsG0380015877.01 | MsG0580024306.01 | 0.804276 | 2.334479e-49 | 1.198653e-46 |
MsG0380015877.01 | MsG0580024433.01 | 0.801512 | 8.695588e-49 | 4.160424e-46 |
MsG0380015877.01 | MsG0580024682.01 | 0.815179 | 1.055244e-51 | 7.223529e-49 |
MsG0380015877.01 | MsG0580024781.01 | 0.804977 | 1.667403e-49 | 8.717757e-47 |
MsG0380015877.01 | MsG0580024826.01 | 0.817913 | 2.577329e-52 | 1.901488e-49 |
MsG0380015877.01 | MsG0580024853.01 | 0.822120 | 2.807014e-53 | 2.328174e-50 |
MsG0380015877.01 | MsG0580024856.01 | 0.808360 | 3.218768e-50 | 1.836726e-47 |
MsG0380015877.01 | MsG0580024918.01 | 0.805517 | 1.284739e-49 | 6.810594e-47 |
MsG0380015877.01 | MsG0580025008.01 | 0.835144 | 1.990322e-56 | 2.412377e-53 |
MsG0380015877.01 | MsG0580025022.01 | 0.817910 | 2.580298e-52 | 1.903565e-49 |
MsG0380015877.01 | MsG0580025206.01 | 0.808735 | 2.676770e-50 | 1.542308e-47 |
MsG0380015877.01 | MsG0580027129.01 | 0.819177 | 1.332067e-52 | 1.017624e-49 |
MsG0380015877.01 | MsG0580027617.01 | 0.812447 | 4.221220e-51 | 2.684706e-48 |
MsG0380015877.01 | MsG0580027661.01 | 0.806823 | 6.823164e-50 | 3.740168e-47 |
MsG0380015877.01 | MsG0580027773.01 | 0.812292 | 4.563497e-51 | 2.890247e-48 |
MsG0380015877.01 | MsG0580027827.01 | 0.808943 | 2.415713e-50 | 1.399655e-47 |
MsG0380015877.01 | MsG0580027832.01 | 0.815733 | 7.946855e-52 | 5.523827e-49 |
MsG0380015877.01 | MsG0580027838.01 | 0.819548 | 1.096374e-52 | 8.462860e-50 |
MsG0380015877.01 | MsG0580028529.01 | 0.810441 | 1.151153e-50 | 6.939296e-48 |
MsG0380015877.01 | MsG0580028969.01 | 0.801425 | 9.058465e-49 | 4.324545e-46 |
MsG0380015877.01 | MsG0580029101.01 | 0.814668 | 1.370463e-51 | 9.252624e-49 |
MsG0380015877.01 | MsG0680030629.01 | 0.873246 | 1.705927e-67 | 7.352061e-64 |
MsG0380015877.01 | MsG0680030685.01 | 0.815696 | 8.099675e-52 | 5.624025e-49 |
MsG0380015877.01 | MsG0680030694.01 | 0.881011 | 3.421182e-70 | 1.971329e-66 |
MsG0380015877.01 | MsG0680030695.01 | 0.860076 | 2.657406e-63 | 7.175308e-60 |
MsG0380015877.01 | MsG0680030696.01 | 0.821418 | 4.080394e-53 | 3.317853e-50 |
MsG0380015877.01 | MsG0680030995.01 | 0.814375 | 1.591072e-51 | 1.065785e-48 |
MsG0380015877.01 | MsG0680031459.01 | 0.801894 | 7.258141e-49 | 3.506637e-46 |
MsG0380015877.01 | MsG0680031719.01 | 0.819389 | 1.191902e-52 | 9.158805e-50 |
MsG0380015877.01 | MsG0680034036.01 | 0.803360 | 3.618607e-49 | 1.814679e-46 |
MsG0380015877.01 | MsG0680034091.01 | 0.810179 | 1.310892e-50 | 7.848014e-48 |
MsG0380015877.01 | MsG0680034093.01 | 0.811454 | 6.946591e-51 | 4.301802e-48 |
MsG0380015877.01 | MsG0680034753.01 | 0.818727 | 1.685522e-52 | 1.271761e-49 |
MsG0380015877.01 | MsG0680034843.01 | 0.800227 | 1.590846e-48 | 7.367849e-46 |
MsG0380015877.01 | MsG0680035444.01 | 0.807172 | 5.755637e-50 | 3.183682e-47 |
MsG0380015877.01 | MsG0680035455.01 | 0.819279 | 1.262785e-52 | 9.674025e-50 |
MsG0380015877.01 | MsG0680035460.01 | 0.857301 | 1.791571e-62 | 4.401208e-59 |
MsG0380015877.01 | MsG0680035573.01 | 0.800557 | 1.362808e-48 | 6.364819e-46 |
MsG0380015877.01 | MsG0680035656.01 | 0.854006 | 1.640272e-61 | 3.611794e-58 |
MsG0380015877.01 | MsG0680035666.01 | 0.803187 | 3.928864e-49 | 1.961666e-46 |
MsG0380015877.01 | MsG0680035716.01 | 0.807714 | 4.416510e-50 | 2.477668e-47 |
MsG0380015877.01 | MsG0680035844.01 | 0.831386 | 1.718969e-55 | 1.862558e-52 |
MsG0380015877.01 | MsG0780035958.01 | 0.837771 | 4.270378e-57 | 5.605042e-54 |
MsG0380015877.01 | MsG0780037630.01 | 0.801759 | 7.738689e-49 | 3.725628e-46 |
MsG0380015877.01 | MsG0780037859.01 | 0.827593 | 1.435809e-54 | 1.392256e-51 |
MsG0380015877.01 | MsG0780038113.01 | 0.875418 | 3.129914e-68 | 1.460138e-64 |
MsG0380015877.01 | MsG0780038386.01 | 0.846793 | 1.737212e-59 | 3.024750e-56 |
MsG0380015877.01 | MsG0780038401.01 | 0.838097 | 3.521323e-57 | 4.667266e-54 |
MsG0380015877.01 | MsG0780038597.01 | 0.804444 | 2.154304e-49 | 1.110897e-46 |
MsG0380015877.01 | MsG0780038825.01 | 0.812392 | 4.338252e-51 | 2.755084e-48 |
MsG0380015877.01 | MsG0780038829.01 | 0.814889 | 1.224200e-51 | 8.314424e-49 |
MsG0380015877.01 | MsG0780038836.01 | 0.806766 | 7.012082e-50 | 3.838104e-47 |
MsG0380015877.01 | MsG0780039252.01 | 0.832763 | 7.852398e-56 | 8.862136e-53 |
MsG0380015877.01 | MsG0780039655.01 | 0.808875 | 2.498429e-50 | 1.444928e-47 |
MsG0380015877.01 | MsG0780039875.01 | 0.815924 | 7.205018e-52 | 5.033816e-49 |
MsG0380015877.01 | MsG0780040186.01 | 0.802300 | 5.989643e-49 | 2.923865e-46 |
MsG0380015877.01 | MsG0780040516.01 | 0.837830 | 4.124385e-57 | 5.422833e-54 |
MsG0380015877.01 | MsG0780040679.01 | 0.862617 | 4.464072e-64 | 1.315411e-60 |
MsG0380015877.01 | MsG0780040704.01 | 0.823347 | 1.454549e-53 | 1.249111e-50 |
MsG0380015877.01 | MsG0780041485.01 | 0.880175 | 6.814112e-70 | 3.800992e-66 |
MsG0380015877.01 | MsG0780041753.01 | 0.808637 | 2.808991e-50 | 1.614370e-47 |
MsG0380015877.01 | MsG0780041777.01 | 0.889049 | 3.428168e-73 | 2.722429e-69 |
MsG0380015877.01 | MsG0880042965.01 | 0.814018 | 1.907554e-51 | 1.265482e-48 |
MsG0380015877.01 | MsG0880042967.01 | 0.813274 | 2.781069e-51 | 1.808024e-48 |
MsG0380015877.01 | MsG0880045106.01 | 0.808397 | 3.159966e-50 | 1.804908e-47 |
MsG0380015877.01 | MsG0880045314.01 | 0.804347 | 2.257041e-49 | 1.161010e-46 |
MsG0380015877.01 | MsG0880045372.01 | 0.801632 | 8.218017e-49 | 3.943741e-46 |
MsG0380015877.01 | MsG0880045590.01 | 0.834686 | 2.596883e-56 | 3.104319e-53 |
MsG0380015877.01 | MsG0880045639.01 | 0.806162 | 9.405501e-50 | 5.069382e-47 |
MsG0380015877.01 | MsG0880045782.01 | 0.806655 | 7.400974e-50 | 4.039178e-47 |
MsG0380015877.01 | MsG0880045827.01 | 0.807006 | 6.238787e-50 | 3.436120e-47 |
MsG0380015877.01 | MsG0880045888.01 | 0.810037 | 1.406605e-50 | 8.390542e-48 |
MsG0380015877.01 | MsG0880046020.01 | 0.807593 | 4.687018e-50 | 2.620938e-47 |
MsG0380015877.01 | MsG0880046023.01 | 0.814455 | 1.527099e-51 | 1.025157e-48 |
MsG0380015877.01 | MsG0880046440.01 | 0.827398 | 1.598995e-54 | 1.542081e-51 |
MsG0380015877.01 | MsG0880046586.01 | 0.801922 | 7.162190e-49 | 3.462561e-46 |
MsG0380015877.01 | MsG0880046642.01 | 0.827540 | 1.478878e-54 | 1.431883e-51 |
MsG0380015877.01 | MsG0880046731.01 | 0.801266 | 9.762488e-49 | 4.642085e-46 |
MsG0380015877.01 | MsG0880047337.01 | 0.802277 | 6.056360e-49 | 2.954568e-46 |
MsG0280006510.01 | MsG0380015877.01 | 0.803973 | 2.699448e-49 | 1.375352e-46 |
MsG0280006586.01 | MsG0380015877.01 | 0.825601 | 4.288615e-54 | 3.927316e-51 |
MsG0280006781.01 | MsG0380015877.01 | 0.804410 | 2.189201e-49 | 1.127922e-46 |
MsG0280007481.01 | MsG0380015877.01 | 0.884360 | 2.049092e-71 | 1.347797e-67 |
MsG0280007529.01 | MsG0380015877.01 | 0.802821 | 4.677678e-49 | 2.313937e-46 |
MsG0280007826.01 | MsG0380015877.01 | 0.803533 | 3.330985e-49 | 1.678076e-46 |
MsG0280008073.01 | MsG0380015877.01 | 0.895331 | 1.060408e-75 | 1.095435e-71 |
MsG0280008220.01 | MsG0380015877.01 | 0.825011 | 5.915592e-54 | 5.327219e-51 |
MsG0280008270.01 | MsG0380015877.01 | 0.812453 | 4.208124e-51 | 2.676848e-48 |
MsG0280008295.01 | MsG0380015877.01 | 0.821123 | 4.772048e-53 | 3.848636e-50 |
MsG0280008384.01 | MsG0380015877.01 | 0.801713 | 7.906284e-49 | 3.802034e-46 |
MsG0280008615.01 | MsG0380015877.01 | 0.801306 | 9.583435e-49 | 4.561501e-46 |
MsG0280009024.01 | MsG0380015877.01 | 0.820382 | 7.063741e-53 | 5.580908e-50 |
MsG0280010170.01 | MsG0380015877.01 | 0.825527 | 4.464899e-54 | 4.079907e-51 |
MsG0280010459.01 | MsG0380015877.01 | 0.805358 | 1.387266e-49 | 7.324438e-47 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0380015877.01.T01 | MTR_3g079340 | 92.308 | 65 | 5 | 0 | 1 | 65 | 413 | 477 | 3.71e-37 | 130 |
MsG0380015877.01.T01 | MTR_3g078633 | 57.971 | 69 | 28 | 1 | 1 | 69 | 345 | 412 | 2.46e-18 | 77.8 |
MsG0380015877.01.T01 | MTR_3g078633 | 57.971 | 69 | 28 | 1 | 1 | 69 | 417 | 484 | 2.49e-18 | 77.8 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0380015877.01.T01 | AT3G48090 | 50.847 | 59 | 28 | 1 | 5 | 63 | 393 | 450 | 4.12e-14 | 65.9 |
MsG0380015877.01.T01 | AT3G48090 | 50.847 | 59 | 28 | 1 | 5 | 63 | 285 | 342 | 4.41e-14 | 65.9 |
MsG0380015877.01.T01 | AT3G48080 | 42.424 | 66 | 37 | 1 | 4 | 69 | 397 | 461 | 9.09e-13 | 62.0 |
Find 15 sgRNAs with CRISPR-Local
Find 18 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
GACTTGTGCTTGCAGGAGTA+TGG | 0.270068 | 3:-76200152 | MsG0380015877.01.T01:CDS |
CGTCCCAAGCATGAGGGATT+TGG | 0.356445 | 3:-76200274 | None:intergenic |
ACAAGTCTCTTCACGTTGCT+TGG | 0.364881 | 3:+76200168 | None:intergenic |
ACGTTGCTTGGGAAATCCTT+TGG | 0.372544 | 3:+76200180 | None:intergenic |
GTGAAGAGACTTGTGCTTGC+AGG | 0.386249 | 3:-76200159 | MsG0380015877.01.T01:CDS |
CAAGTCTCTTCACGTTGCTT+GGG | 0.408050 | 3:+76200169 | None:intergenic |
TGATGCCTTCAAGGTGCAAA+AGG | 0.480497 | 3:-76200205 | MsG0380015877.01.T01:CDS |
TGTGAGATAAACAATGGAAA+AGG | 0.505004 | 3:-76200234 | MsG0380015877.01.T01:CDS |
AGGTTATTATGATGCCTTCA+AGG | 0.524131 | 3:-76200214 | MsG0380015877.01.T01:CDS |
CTAGAGGCTCAACAAGTTGA+CGG | 0.528764 | 3:+76200044 | None:intergenic |
AACTGCCAGATGAGTTTGAA+GGG | 0.559752 | 3:-76200098 | MsG0380015877.01.T01:CDS |
ACTTGTGCTTGCAGGAGTAT+GGG | 0.592966 | 3:-76200151 | MsG0380015877.01.T01:CDS |
CAAGGTGCAAAAGGATCCAA+AGG | 0.597796 | 3:-76200196 | MsG0380015877.01.T01:CDS |
GAACTGCCAGATGAGTTTGA+AGG | 0.604489 | 3:-76200099 | MsG0380015877.01.T01:CDS |
TCAACATGTGAGATAAACAA+TGG | 0.616431 | 3:-76200240 | MsG0380015877.01.T01:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
TCAACATGTGAGATAAACAA+TGG | - | Chr3:76200068-76200087 | MsG0380015877.01.T01:CDS | 30.0% | |
TGTGAGATAAACAATGGAAA+AGG | - | Chr3:76200074-76200093 | MsG0380015877.01.T01:CDS | 30.0% | |
!! | GAAAAAGAATGGATTGAACT+CGG | - | Chr3:76200232-76200251 | MsG0380015877.01.T01:CDS | 30.0% |
AGGTTATTATGATGCCTTCA+AGG | - | Chr3:76200094-76200113 | MsG0380015877.01.T01:CDS | 35.0% | |
GAGTTTGAAGGGAAAAAGAA+TGG | - | Chr3:76200221-76200240 | MsG0380015877.01.T01:CDS | 35.0% | |
! | TTTTTCCCTTCAAACTCATC+TGG | + | Chr3:76200218-76200237 | None:intergenic | 35.0% |
AACTGCCAGATGAGTTTGAA+GGG | - | Chr3:76200210-76200229 | MsG0380015877.01.T01:CDS | 40.0% | |
ACAAGTCTCTTCACGTTGCT+TGG | + | Chr3:76200143-76200162 | None:intergenic | 45.0% | |
ACGTTGCTTGGGAAATCCTT+TGG | + | Chr3:76200131-76200150 | None:intergenic | 45.0% | |
CAAGGTGCAAAAGGATCCAA+AGG | - | Chr3:76200112-76200131 | MsG0380015877.01.T01:CDS | 45.0% | |
CAAGTCTCTTCACGTTGCTT+GGG | + | Chr3:76200142-76200161 | None:intergenic | 45.0% | |
GAACTGCCAGATGAGTTTGA+AGG | - | Chr3:76200209-76200228 | MsG0380015877.01.T01:CDS | 45.0% | |
TGATGCCTTCAAGGTGCAAA+AGG | - | Chr3:76200103-76200122 | MsG0380015877.01.T01:CDS | 45.0% | |
! | ACTTGTGCTTGCAGGAGTAT+GGG | - | Chr3:76200157-76200176 | MsG0380015877.01.T01:CDS | 45.0% |
! | CTAGAGGCTCAACAAGTTGA+CGG | + | Chr3:76200267-76200286 | None:intergenic | 45.0% |
! | TGGATCCTTTTGCACCTTGA+AGG | + | Chr3:76200111-76200130 | None:intergenic | 45.0% |
GACTTGTGCTTGCAGGAGTA+TGG | - | Chr3:76200156-76200175 | MsG0380015877.01.T01:CDS | 50.0% | |
GTGAAGAGACTTGTGCTTGC+AGG | - | Chr3:76200149-76200168 | MsG0380015877.01.T01:CDS | 50.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr3 | gene | 76200044 | 76200286 | 76200044 | ID=MsG0380015877.01;Name=MsG0380015877.01 |
Chr3 | mRNA | 76200044 | 76200286 | 76200044 | ID=MsG0380015877.01.T01;Parent=MsG0380015877.01;Name=MsG0380015877.01.T01;_AED=0.49;_eAED=0.50;_QI=0|-1|0|1|-1|1|1|0|80 |
Chr3 | exon | 76200044 | 76200286 | 76200044 | ID=MsG0380015877.01.T01:exon:1168;Parent=MsG0380015877.01.T01 |
Chr3 | CDS | 76200044 | 76200286 | 76200044 | ID=MsG0380015877.01.T01:cds;Parent=MsG0380015877.01.T01 |
Gene Sequence |
Protein sequence |