Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0480022240.01.T01 | XP_003607784.1 | 89.474 | 57 | 5 | 1 | 1 | 56 | 1 | 57 | 3.39E-17 | 78.6 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0480022240.01.T01 | G7JHG4 | 89.474 | 57 | 5 | 1 | 1 | 56 | 1 | 57 | 1.62e-17 | 78.6 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080048748.01 | MsG0480022240.01 | 0.815292 | 9.963488e-52 | 6.841865e-49 |
MsG0080049069.01 | MsG0480022240.01 | 0.818353 | 2.049204e-52 | 1.530414e-49 |
MsG0080049070.01 | MsG0480022240.01 | 0.840350 | 9.170362e-58 | 1.302645e-54 |
MsG0180000017.01 | MsG0480022240.01 | 0.807021 | 6.194339e-50 | 3.412953e-47 |
MsG0180000040.01 | MsG0480022240.01 | 0.801746 | 7.783916e-49 | 3.746313e-46 |
MsG0180000246.01 | MsG0480022240.01 | 0.812418 | 4.282698e-51 | 2.721703e-48 |
MsG0180000489.01 | MsG0480022240.01 | 0.833909 | 4.067951e-56 | 4.751988e-53 |
MsG0180000549.01 | MsG0480022240.01 | 0.829196 | 5.893334e-55 | 5.989548e-52 |
MsG0180000599.01 | MsG0480022240.01 | 0.800017 | 1.755777e-48 | 8.088290e-46 |
MsG0180000843.01 | MsG0480022240.01 | 0.832546 | 8.887370e-56 | 9.965821e-53 |
MsG0180000942.01 | MsG0480022240.01 | 0.836100 | 1.140442e-56 | 1.422722e-53 |
MsG0180000976.01 | MsG0480022240.01 | 0.800048 | 1.729987e-48 | 7.975896e-46 |
MsG0180001270.01 | MsG0480022240.01 | 0.801217 | 9.991837e-49 | 4.745223e-46 |
MsG0180001548.01 | MsG0480022240.01 | 0.879648 | 1.049848e-69 | 5.737126e-66 |
MsG0180002523.01 | MsG0480022240.01 | 0.814995 | 1.159693e-51 | 7.899485e-49 |
MsG0180002700.01 | MsG0480022240.01 | 0.866941 | 1.972655e-65 | 6.768033e-62 |
MsG0180003196.01 | MsG0480022240.01 | 0.874773 | 5.195761e-68 | 2.368091e-64 |
MsG0180003514.01 | MsG0480022240.01 | 0.804806 | 1.809860e-49 | 9.421391e-47 |
MsG0180004792.01 | MsG0480022240.01 | 0.862415 | 5.152454e-64 | 1.507811e-60 |
MsG0180005130.01 | MsG0480022240.01 | -0.805157 | 1.528827e-49 | 8.030138e-47 |
MsG0180005143.01 | MsG0480022240.01 | -0.801785 | 7.642564e-49 | 3.681963e-46 |
MsG0180005184.01 | MsG0480022240.01 | 0.837368 | 5.416719e-57 | 7.020660e-54 |
MsG0180005339.01 | MsG0480022240.01 | 0.858829 | 6.294414e-63 | 1.627956e-59 |
MsG0180005391.01 | MsG0480022240.01 | 0.851813 | 6.951625e-61 | 1.423924e-57 |
MsG0180005418.01 | MsG0480022240.01 | 0.805687 | 1.183638e-49 | 6.302538e-47 |
MsG0180005898.01 | MsG0480022240.01 | 0.806293 | 8.826366e-50 | 4.773016e-47 |
MsG0180006028.01 | MsG0480022240.01 | 0.809328 | 1.997391e-50 | 1.169333e-47 |
MsG0180006217.01 | MsG0480022240.01 | 0.829771 | 4.271003e-55 | 4.414594e-52 |
MsG0180006253.01 | MsG0480022240.01 | -0.842321 | 2.776682e-58 | 4.194829e-55 |
MsG0280006319.01 | MsG0480022240.01 | 0.818591 | 1.809304e-52 | 1.360019e-49 |
MsG0280010564.01 | MsG0480022240.01 | 0.814462 | 1.521525e-51 | 1.021632e-48 |
MsG0280010728.01 | MsG0480022240.01 | 0.819980 | 8.733533e-53 | 6.823467e-50 |
MsG0280011073.01 | MsG0480022240.01 | 0.834031 | 3.792138e-56 | 4.445509e-53 |
MsG0280011110.01 | MsG0480022240.01 | -0.807005 | 6.244060e-50 | 3.438879e-47 |
MsG0280011180.01 | MsG0480022240.01 | 0.845654 | 3.549131e-59 | 5.956552e-56 |
MsG0280011218.01 | MsG0480022240.01 | 0.854759 | 9.939070e-62 | 2.243371e-58 |
MsG0280011362.01 | MsG0480022240.01 | 0.818737 | 1.677146e-52 | 1.265779e-49 |
MsG0380012868.01 | MsG0480022240.01 | 0.882761 | 7.942107e-71 | 4.900002e-67 |
MsG0380014179.01 | MsG0480022240.01 | 0.825153 | 5.475946e-54 | 4.951266e-51 |
MsG0480019812.01 | MsG0480022240.01 | 0.868962 | 4.421232e-66 | 1.630108e-62 |
MsG0480020473.01 | MsG0480022240.01 | 0.876923 | 9.485041e-69 | 4.681967e-65 |
MsG0480020596.01 | MsG0480022240.01 | 0.842052 | 3.271998e-58 | 4.900918e-55 |
MsG0480020797.01 | MsG0480022240.01 | -0.843866 | 1.076297e-58 | 1.706856e-55 |
MsG0480021091.01 | MsG0480022240.01 | -0.810117 | 1.352097e-50 | 8.082008e-48 |
MsG0480021101.01 | MsG0480022240.01 | 0.806235 | 9.079588e-50 | 4.902911e-47 |
MsG0480021213.01 | MsG0480022240.01 | 0.824371 | 8.368835e-54 | 7.398287e-51 |
MsG0480021377.01 | MsG0480022240.01 | 0.847151 | 1.385929e-59 | 2.441046e-56 |
MsG0480021817.01 | MsG0480022240.01 | 0.812564 | 3.979360e-51 | 2.538566e-48 |
MsG0480022154.01 | MsG0480022240.01 | 0.830406 | 2.989758e-55 | 3.147017e-52 |
MsG0480022155.01 | MsG0480022240.01 | 0.836710 | 7.976860e-57 | 1.013520e-53 |
MsG0480022162.01 | MsG0480022240.01 | 0.862273 | 5.696285e-64 | 1.658525e-60 |
MsG0480022226.01 | MsG0480022240.01 | 0.866208 | 3.372362e-65 | 1.127334e-61 |
MsG0480022239.01 | MsG0480022240.01 | 0.913223 | 7.896079e-84 | 1.847966e-79 |
MsG0480022240.01 | MsG0480022243.01 | 0.828745 | 7.580252e-55 | 7.601222e-52 |
MsG0480022240.01 | MsG0480022245.01 | 0.817742 | 2.816045e-52 | 2.068032e-49 |
MsG0480022240.01 | MsG0480022918.01 | 0.819127 | 1.367030e-52 | 1.042915e-49 |
MsG0480022240.01 | MsG0480023001.01 | -0.808309 | 3.300095e-50 | 1.880555e-47 |
MsG0480022240.01 | MsG0480023169.01 | 0.815490 | 8.999421e-52 | 6.213973e-49 |
MsG0480022240.01 | MsG0480023406.01 | 0.862779 | 3.978566e-64 | 1.179255e-60 |
MsG0480022240.01 | MsG0480023466.01 | 0.839579 | 1.455916e-57 | 2.019246e-54 |
MsG0480022240.01 | MsG0580024471.01 | 0.860976 | 1.418673e-63 | 3.950263e-60 |
MsG0480022240.01 | MsG0580024535.01 | -0.829043 | 6.417436e-55 | 6.491713e-52 |
MsG0480022240.01 | MsG0580024597.01 | 0.872010 | 4.416336e-67 | 1.818337e-63 |
MsG0480022240.01 | MsG0580024598.01 | 0.903147 | 4.682801e-79 | 6.842109e-75 |
MsG0480022240.01 | MsG0580024601.01 | 0.891489 | 3.791129e-74 | 3.331025e-70 |
MsG0480022240.01 | MsG0580024764.01 | 0.803389 | 3.569162e-49 | 1.791267e-46 |
MsG0480022240.01 | MsG0580024872.01 | 0.818903 | 1.537178e-52 | 1.165606e-49 |
MsG0480022240.01 | MsG0580025252.01 | 0.805599 | 1.234925e-49 | 6.560374e-47 |
MsG0480022240.01 | MsG0580025558.01 | -0.822493 | 2.299608e-53 | 1.927823e-50 |
MsG0480022240.01 | MsG0580025670.01 | -0.809508 | 1.827913e-50 | 1.075209e-47 |
MsG0480022240.01 | MsG0580027183.01 | 0.831248 | 1.859263e-55 | 2.006062e-52 |
MsG0480022240.01 | MsG0580027803.01 | 0.810303 | 1.232906e-50 | 7.404942e-48 |
MsG0480022240.01 | MsG0580027899.01 | 0.842497 | 2.493635e-58 | 3.788004e-55 |
MsG0480022240.01 | MsG0580028024.01 | 0.815568 | 8.647095e-52 | 5.983191e-49 |
MsG0480022240.01 | MsG0580028306.01 | 0.804982 | 1.662846e-49 | 8.695086e-47 |
MsG0480022240.01 | MsG0580028419.01 | 0.804572 | 2.025524e-49 | 1.047974e-46 |
MsG0480022240.01 | MsG0580028495.01 | 0.836728 | 7.892342e-57 | 1.003332e-53 |
MsG0480022240.01 | MsG0580029682.01 | 0.821003 | 5.087349e-53 | 4.089540e-50 |
MsG0480022240.01 | MsG0580029700.01 | 0.801087 | 1.062438e-48 | 5.029407e-46 |
MsG0480022240.01 | MsG0580029912.01 | 0.831485 | 1.625796e-55 | 1.766750e-52 |
MsG0480022240.01 | MsG0580029914.01 | 0.827705 | 1.349615e-54 | 1.313044e-51 |
MsG0480022240.01 | MsG0580030063.01 | 0.816865 | 4.437276e-52 | 3.181146e-49 |
MsG0480022240.01 | MsG0680030464.01 | 0.809091 | 2.245360e-50 | 1.306182e-47 |
MsG0480022240.01 | MsG0680030680.01 | 0.817513 | 3.171937e-52 | 2.314799e-49 |
MsG0480022240.01 | MsG0680032413.01 | 0.827608 | 1.424087e-54 | 1.381491e-51 |
MsG0480022240.01 | MsG0680032516.01 | 0.807032 | 6.160858e-50 | 3.395504e-47 |
MsG0480022240.01 | MsG0680032850.01 | 0.850651 | 1.479434e-60 | 2.918300e-57 |
MsG0480022240.01 | MsG0680033852.01 | 0.836998 | 6.736847e-57 | 8.634385e-54 |
MsG0480022240.01 | MsG0680034725.01 | 0.805441 | 1.333067e-49 | 7.053111e-47 |
MsG0480022240.01 | MsG0680035618.01 | 0.811344 | 7.339590e-51 | 4.531687e-48 |
MsG0480022240.01 | MsG0680035664.01 | 0.837777 | 4.254567e-57 | 5.585314e-54 |
MsG0480022240.01 | MsG0680035665.01 | 0.846223 | 2.485578e-59 | 4.248126e-56 |
MsG0480022240.01 | MsG0780035960.01 | 0.808947 | 2.410565e-50 | 1.396827e-47 |
MsG0480022240.01 | MsG0780035965.01 | 0.817030 | 4.074535e-52 | 2.934377e-49 |
MsG0480022240.01 | MsG0780036008.01 | 0.854946 | 8.773076e-62 | 1.992450e-58 |
MsG0480022240.01 | MsG0780036260.01 | -0.801661 | 8.102605e-49 | 3.891287e-46 |
MsG0480022240.01 | MsG0780037052.01 | -0.862329 | 5.475143e-64 | 1.597278e-60 |
MsG0480022240.01 | MsG0780037363.01 | 0.839098 | 1.941798e-57 | 2.653720e-54 |
MsG0480022240.01 | MsG0780037662.01 | 0.839958 | 1.160158e-57 | 1.628272e-54 |
MsG0480022240.01 | MsG0780039161.01 | 0.824378 | 8.336113e-54 | 7.371009e-51 |
MsG0480022240.01 | MsG0780039686.01 | -0.822741 | 2.013749e-53 | 1.700218e-50 |
MsG0480022240.01 | MsG0780039805.01 | 0.815450 | 9.190111e-52 | 6.338303e-49 |
MsG0480022240.01 | MsG0780040278.01 | 0.804046 | 2.606597e-49 | 1.330532e-46 |
MsG0480022240.01 | MsG0780040343.01 | 0.818636 | 1.767940e-52 | 1.330548e-49 |
MsG0480022240.01 | MsG0780040684.01 | 0.852698 | 3.892507e-61 | 8.202017e-58 |
MsG0480022240.01 | MsG0780040700.01 | 0.800077 | 1.707197e-48 | 7.876605e-46 |
MsG0480022240.01 | MsG0780040825.01 | -0.804288 | 2.321017e-49 | 1.192124e-46 |
MsG0480022240.01 | MsG0780041004.01 | 0.818189 | 2.232100e-52 | 1.659367e-49 |
MsG0480022240.01 | MsG0780041331.01 | 0.837097 | 6.355837e-57 | 8.169726e-54 |
MsG0480022240.01 | MsG0780041385.01 | 0.840015 | 1.121279e-57 | 1.576592e-54 |
MsG0480022240.01 | MsG0880041847.01 | 0.800727 | 1.258155e-48 | 5.901377e-46 |
MsG0480022240.01 | MsG0880042086.01 | 0.872324 | 3.470576e-67 | 1.445972e-63 |
MsG0480022240.01 | MsG0880042256.01 | 0.813707 | 2.233536e-51 | 1.469299e-48 |
MsG0480022240.01 | MsG0880042415.01 | 0.881047 | 3.321089e-70 | 1.916090e-66 |
MsG0480022240.01 | MsG0880042416.01 | 0.826968 | 2.027533e-54 | 1.930762e-51 |
MsG0480022240.01 | MsG0880042417.01 | 0.808981 | 2.371221e-50 | 1.375278e-47 |
MsG0480022240.01 | MsG0880043107.01 | 0.879905 | 8.503152e-70 | 4.694165e-66 |
MsG0480022240.01 | MsG0880043621.01 | 0.822509 | 2.280496e-53 | 1.912703e-50 |
MsG0480022240.01 | MsG0880043648.01 | 0.806359 | 8.549448e-50 | 4.630903e-47 |
MsG0480022240.01 | MsG0880043650.01 | 0.807989 | 3.859971e-50 | 2.181099e-47 |
MsG0480022240.01 | MsG0880043829.01 | 0.856759 | 2.588690e-62 | 6.243237e-59 |
MsG0480022240.01 | MsG0880044105.01 | 0.820598 | 6.301360e-53 | 5.007736e-50 |
MsG0480022240.01 | MsG0880044524.01 | 0.821440 | 4.032726e-53 | 3.280992e-50 |
MsG0480022240.01 | MsG0880044564.01 | 0.820637 | 6.172697e-53 | 4.910785e-50 |
MsG0480022240.01 | MsG0880044834.01 | 0.825754 | 3.945703e-54 | 3.629001e-51 |
MsG0480022240.01 | MsG0880044901.01 | -0.805509 | 1.289936e-49 | 6.836608e-47 |
MsG0480022240.01 | MsG0880045031.01 | 0.813932 | 1.992618e-51 | 1.318757e-48 |
MsG0480022240.01 | MsG0880045190.01 | 0.811199 | 7.887614e-51 | 4.851851e-48 |
MsG0480022240.01 | MsG0880046124.01 | 0.834534 | 2.835006e-56 | 3.374316e-53 |
MsG0480022240.01 | MsG0880046324.01 | 0.843286 | 1.538396e-58 | 2.395609e-55 |
MsG0480022240.01 | MsG0880046334.01 | -0.809561 | 1.780617e-50 | 1.048891e-47 |
MsG0480022240.01 | MsG0880046408.01 | 0.843004 | 1.828882e-58 | 2.822158e-55 |
MsG0480022240.01 | MsG0880046434.01 | -0.839780 | 1.290932e-57 | 1.801535e-54 |
MsG0480022240.01 | MsG0880047275.01 | 0.834216 | 3.406630e-56 | 4.015662e-53 |
MsG0480022240.01 | MsG0880047312.01 | -0.854538 | 1.151464e-61 | 2.580185e-58 |
MsG0480022240.01 | MsG0880047451.01 | 0.808868 | 2.506685e-50 | 1.449480e-47 |
MsG0480022240.01 | MsG0880047656.01 | 0.815815 | 7.620877e-52 | 5.308743e-49 |
MsG0380015438.01 | MsG0480022240.01 | 0.827536 | 1.482001e-54 | 1.434724e-51 |
MsG0380015847.01 | MsG0480022240.01 | -0.806217 | 9.156640e-50 | 4.942268e-47 |
MsG0380016057.01 | MsG0480022240.01 | 0.823632 | 1.247428e-53 | 1.080048e-50 |
MsG0380016194.01 | MsG0480022240.01 | 0.812067 | 5.107245e-51 | 3.214832e-48 |
MsG0380017427.01 | MsG0480022240.01 | 0.835181 | 1.948157e-56 | 2.363994e-53 |
MsG0380017620.01 | MsG0480022240.01 | 0.832343 | 9.979994e-56 | 1.112234e-52 |
MsG0480018337.01 | MsG0480022240.01 | 0.853267 | 2.675284e-61 | 5.747750e-58 |
MsG0480018338.01 | MsG0480022240.01 | 0.807555 | 4.773579e-50 | 2.666864e-47 |
MsG0480018345.01 | MsG0480022240.01 | 0.819540 | 1.101033e-52 | 8.497055e-50 |
MsG0480018426.01 | MsG0480022240.01 | 0.800489 | 1.407316e-48 | 6.561243e-46 |
MsG0280007513.01 | MsG0480022240.01 | -0.829544 | 4.849825e-55 | 4.978827e-52 |
MsG0280007867.01 | MsG0480022240.01 | 0.813857 | 2.070386e-51 | 1.367450e-48 |
MsG0280008072.01 | MsG0480022240.01 | 0.806016 | 1.009186e-49 | 5.419189e-47 |
MsG0280008098.01 | MsG0480022240.01 | 0.851215 | 1.026196e-60 | 2.062158e-57 |
MsG0280008343.01 | MsG0480022240.01 | 0.806306 | 8.771725e-50 | 4.745019e-47 |
MsG0280008419.01 | MsG0480022240.01 | 0.814727 | 1.329454e-51 | 8.990523e-49 |
MsG0280008928.01 | MsG0480022240.01 | 0.825691 | 4.084089e-54 | 3.749552e-51 |
MsG0280008929.01 | MsG0480022240.01 | 0.811237 | 7.739835e-51 | 4.765640e-48 |
MsG0280009435.01 | MsG0480022240.01 | 0.819807 | 9.565933e-53 | 7.437948e-50 |
MsG0280009436.01 | MsG0480022240.01 | 0.817685 | 2.901451e-52 | 2.127326e-49 |
MsG0280009445.01 | MsG0480022240.01 | 0.810652 | 1.036495e-50 | 6.283620e-48 |
MsG0280009699.01 | MsG0480022240.01 | 0.821442 | 4.028027e-53 | 3.277421e-50 |
MsG0280009756.01 | MsG0480022240.01 | 0.802597 | 5.202303e-49 | 2.558700e-46 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0480022240.01.T01 | MTR_4g082900 | 89.474 | 57 | 5 | 1 | 1 | 56 | 1 | 57 | 4.10e-21 | 78.6 |
MsG0480022240.01.T01 | MTR_4g082883 | 68.519 | 54 | 14 | 2 | 8 | 58 | 26 | 79 | 1.17e-14 | 62.8 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Find 15 sgRNAs with CRISPR-Local
Find 19 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
GGCTGGACCTAACGATATTT+TGG | 0.245207 | 4:-70038499 | MsG0480022240.01.T01:CDS |
AAAACCAAAGGTGCGGTTAA+TGG | 0.283737 | 4:-70038317 | None:intergenic |
AGCACCATTAACCGCACCTT+TGG | 0.426753 | 4:+70038313 | None:intergenic |
GCACTTGCCAAAATATCGTT+AGG | 0.455143 | 4:+70038492 | None:intergenic |
TAAAACCAAACCAGATCCTA+TGG | 0.485210 | 4:-70038341 | MsG0480022240.01.T01:CDS |
TAAACAACAAAATCGATGGC+TGG | 0.548436 | 4:-70038516 | None:intergenic |
GCAGGTGTTCATAAGACTGT+AGG | 0.564597 | 4:-70038393 | MsG0480022240.01.T01:CDS |
ACTGTAGGAAATGCTGCAGC+TGG | 0.565617 | 4:-70038441 | MsG0480022240.01.T01:CDS |
GCTTCAGCACAGAAAACTGT+AGG | 0.594928 | 4:-70038456 | MsG0480022240.01.T01:CDS |
AAAACTGTGGGAAATGCTGC+AGG | 0.601750 | 4:-70038411 | MsG0480022240.01.T01:CDS |
AGATCCTATGGCAAAACCAA+AGG | 0.621329 | 4:-70038329 | MsG0480022240.01.T01:CDS |
AGCTGGTGCCCAGAAAACTG+TGG | 0.654418 | 4:-70038424 | MsG0480022240.01.T01:CDS |
TGTAGGAGACTATGCTACCA+TGG | 0.655972 | 4:-70038376 | MsG0480022240.01.T01:CDS |
CTATGGCAAAACCAAAGGTG+CGG | 0.678266 | 4:-70038324 | MsG0480022240.01.T01:CDS |
GCTGGTGCCCAGAAAACTGT+GGG | 0.683027 | 4:-70038423 | MsG0480022240.01.T01:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
TAAAACCAAACCAGATCCTA+TGG | - | Chr4:70038480-70038499 | MsG0480022240.01.T01:CDS | 35.0% | |
! | TTTTACATAATCAGCAGCCA+TGG | + | Chr4:70038465-70038484 | None:intergenic | 35.0% |
AGATCCTATGGCAAAACCAA+AGG | - | Chr4:70038492-70038511 | MsG0480022240.01.T01:CDS | 40.0% | |
GCACTTGCCAAAATATCGTT+AGG | + | Chr4:70038332-70038351 | None:intergenic | 40.0% | |
! | AGCATTTCCCACAGTTTTCT+GGG | + | Chr4:70038408-70038427 | None:intergenic | 40.0% |
! | TTTTGCCATAGGATCTGGTT+TGG | + | Chr4:70038488-70038507 | None:intergenic | 40.0% |
!!! | CGATATTTTGGCAAGTGCAA+AGG | - | Chr4:70038334-70038353 | MsG0480022240.01.T01:CDS | 40.0% |
!!! | TTTGGTTTTGCCATAGGATC+TGG | + | Chr4:70038493-70038512 | None:intergenic | 40.0% |
AAAACTGTGGGAAATGCTGC+AGG | - | Chr4:70038410-70038429 | MsG0480022240.01.T01:CDS | 45.0% | |
CTATGGCAAAACCAAAGGTG+CGG | - | Chr4:70038497-70038516 | MsG0480022240.01.T01:CDS | 45.0% | |
GCAGGTGTTCATAAGACTGT+AGG | - | Chr4:70038428-70038447 | MsG0480022240.01.T01:CDS | 45.0% | |
GCTTCAGCACAGAAAACTGT+AGG | - | Chr4:70038365-70038384 | MsG0480022240.01.T01:CDS | 45.0% | |
TGTAGGAGACTATGCTACCA+TGG | - | Chr4:70038445-70038464 | MsG0480022240.01.T01:CDS | 45.0% | |
! | CAGCATTTCCCACAGTTTTC+TGG | + | Chr4:70038409-70038428 | None:intergenic | 45.0% |
! | GGCTGGACCTAACGATATTT+TGG | - | Chr4:70038322-70038341 | MsG0480022240.01.T01:CDS | 45.0% |
ACTGTAGGAAATGCTGCAGC+TGG | - | Chr4:70038380-70038399 | MsG0480022240.01.T01:CDS | 50.0% | |
!!! | CGCACCTTTGGTTTTGCCAT+AGG | + | Chr4:70038499-70038518 | None:intergenic | 50.0% |
AGCTGGTGCCCAGAAAACTG+TGG | - | Chr4:70038397-70038416 | MsG0480022240.01.T01:CDS | 55.0% | |
GCTGGTGCCCAGAAAACTGT+GGG | - | Chr4:70038398-70038417 | MsG0480022240.01.T01:CDS | 55.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr4 | gene | 70038320 | 70038523 | 70038320 | ID=MsG0480022240.01;Name=MsG0480022240.01 |
Chr4 | mRNA | 70038320 | 70038523 | 70038320 | ID=MsG0480022240.01.T01;Parent=MsG0480022240.01;Name=MsG0480022240.01.T01;_AED=0.50;_eAED=0.50;_QI=0|-1|0|1|-1|1|1|0|67 |
Chr4 | exon | 70038320 | 70038523 | 70038320 | ID=MsG0480022240.01.T01:exon:11098;Parent=MsG0480022240.01.T01 |
Chr4 | CDS | 70038320 | 70038523 | 70038320 | ID=MsG0480022240.01.T01:cds;Parent=MsG0480022240.01.T01 |
Gene Sequence |
Protein sequence |