Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049070.01.T01 | XP_003631130.1 | 96.471 | 85 | 3 | 0 | 2 | 86 | 90 | 174 | 3.48E-52 | 171 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049070.01.T01 | G7LE74 | 96.471 | 85 | 3 | 0 | 2 | 86 | 90 | 174 | 1.66e-52 | 171 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080048528.01 | MsG0080049070.01 | 0.803529 | 3.337793e-49 | 1.681334e-46 |
MsG0080048727.01 | MsG0080049070.01 | 0.811048 | 8.505147e-51 | 5.211086e-48 |
MsG0080048748.01 | MsG0080049070.01 | 0.833326 | 5.687198e-56 | 6.528178e-53 |
MsG0080048849.01 | MsG0080049070.01 | 0.804787 | 1.826372e-49 | 9.502474e-47 |
MsG0080048993.01 | MsG0080049070.01 | 0.834057 | 3.735321e-56 | 4.382266e-53 |
MsG0080049029.01 | MsG0080049070.01 | 0.800681 | 1.285868e-48 | 6.024278e-46 |
MsG0080049068.01 | MsG0080049070.01 | 0.810646 | 1.039214e-50 | 6.299223e-48 |
MsG0080049069.01 | MsG0080049070.01 | 0.903937 | 2.067449e-79 | 3.124533e-75 |
MsG0080049070.01 | MsG0180000017.01 | 0.813024 | 3.156133e-51 | 2.037970e-48 |
MsG0080049070.01 | MsG0180000040.01 | 0.838704 | 2.455560e-57 | 3.315910e-54 |
MsG0080049070.01 | MsG0180000113.01 | 0.815662 | 8.241241e-52 | 5.717037e-49 |
MsG0080049070.01 | MsG0180000489.01 | 0.848833 | 4.762183e-60 | 8.852469e-57 |
MsG0080049070.01 | MsG0180000491.01 | 0.834188 | 3.463545e-56 | 4.079061e-53 |
MsG0080049070.01 | MsG0180000549.01 | 0.874996 | 4.361140e-68 | 2.004112e-64 |
MsG0080049070.01 | MsG0180000599.01 | 0.811917 | 5.507986e-51 | 3.452840e-48 |
MsG0080049070.01 | MsG0180000833.01 | 0.818191 | 2.229434e-52 | 1.657457e-49 |
MsG0080049070.01 | MsG0180000834.01 | 0.820438 | 6.859161e-53 | 5.427372e-50 |
MsG0080049070.01 | MsG0180000843.01 | 0.812372 | 4.381732e-51 | 2.781068e-48 |
MsG0080049070.01 | MsG0180000942.01 | 0.866498 | 2.727840e-65 | 9.213657e-62 |
MsG0080049070.01 | MsG0180000976.01 | 0.851129 | 1.085082e-60 | 2.174390e-57 |
MsG0080049070.01 | MsG0180001270.01 | 0.804053 | 2.597491e-49 | 1.326158e-46 |
MsG0080049070.01 | MsG0180001548.01 | 0.922410 | 1.019981e-88 | 3.852283e-84 |
MsG0080049070.01 | MsG0180001664.01 | 0.803006 | 4.283777e-49 | 2.128815e-46 |
MsG0080049070.01 | MsG0180001704.01 | 0.830293 | 3.186037e-55 | 3.342586e-52 |
MsG0080049070.01 | MsG0180001864.01 | 0.801579 | 8.425711e-49 | 4.038064e-46 |
MsG0080049070.01 | MsG0180002700.01 | 0.875165 | 3.819835e-68 | 1.765985e-64 |
MsG0080049070.01 | MsG0180003196.01 | 0.894555 | 2.208779e-75 | 2.206369e-71 |
MsG0080049070.01 | MsG0180003547.01 | 0.809592 | 1.753860e-50 | 1.034000e-47 |
MsG0080049070.01 | MsG0180003748.01 | 0.822934 | 1.816288e-53 | 1.541857e-50 |
MsG0080049070.01 | MsG0180004006.01 | 0.804388 | 2.212860e-49 | 1.139471e-46 |
MsG0080049070.01 | MsG0180004025.01 | 0.808048 | 3.750637e-50 | 2.122572e-47 |
MsG0080049070.01 | MsG0180004448.01 | 0.812251 | 4.657134e-51 | 2.946334e-48 |
MsG0080049070.01 | MsG0180004518.01 | 0.806524 | 7.891150e-50 | 4.292438e-47 |
MsG0080049070.01 | MsG0180004545.01 | 0.804192 | 2.430314e-49 | 1.245158e-46 |
MsG0080049070.01 | MsG0180004687.01 | 0.801447 | 8.967501e-49 | 4.283482e-46 |
MsG0080049070.01 | MsG0180004714.01 | 0.804778 | 1.834734e-49 | 9.543570e-47 |
MsG0080049070.01 | MsG0180004736.01 | 0.806015 | 1.009783e-49 | 5.422270e-47 |
MsG0080049070.01 | MsG0180004792.01 | 0.863144 | 3.070606e-64 | 9.213736e-61 |
MsG0080049070.01 | MsG0180004934.01 | 0.807657 | 4.541567e-50 | 2.543939e-47 |
MsG0080049070.01 | MsG0180005184.01 | 0.848274 | 6.801702e-60 | 1.241655e-56 |
MsG0080049070.01 | MsG0180005339.01 | 0.870573 | 1.317673e-66 | 5.150616e-63 |
MsG0080049070.01 | MsG0180005416.01 | 0.805947 | 1.043866e-49 | 5.595328e-47 |
MsG0080049070.01 | MsG0180005612.01 | 0.805117 | 1.558158e-49 | 8.175924e-47 |
MsG0080049070.01 | MsG0180005636.01 | -0.812257 | 4.644551e-51 | 2.938778e-48 |
MsG0080049070.01 | MsG0180005666.01 | 0.816740 | 4.731698e-52 | 3.380578e-49 |
MsG0080049070.01 | MsG0180005898.01 | 0.813074 | 3.076859e-51 | 1.989408e-48 |
MsG0080049070.01 | MsG0180005964.01 | 0.824190 | 9.230904e-54 | 8.118848e-51 |
MsG0080049070.01 | MsG0180006028.01 | 0.852134 | 5.633094e-61 | 1.165731e-57 |
MsG0080049070.01 | MsG0180006136.01 | 0.825184 | 5.384252e-54 | 4.872648e-51 |
MsG0080049070.01 | MsG0180006176.01 | 0.827360 | 1.633339e-54 | 1.573484e-51 |
MsG0080049070.01 | MsG0180006217.01 | 0.865363 | 6.236869e-65 | 2.023642e-61 |
MsG0080049070.01 | MsG0280006400.01 | 0.824199 | 9.187726e-54 | 8.082683e-51 |
MsG0080049070.01 | MsG0280006571.01 | 0.810537 | 1.097078e-50 | 6.630356e-48 |
MsG0080049070.01 | MsG0280006718.01 | 0.814065 | 1.862279e-51 | 1.237041e-48 |
MsG0080049070.01 | MsG0280006914.01 | 0.805227 | 1.477685e-49 | 7.775331e-47 |
MsG0080049070.01 | MsG0280007406.01 | 0.854637 | 1.078173e-61 | 2.423775e-58 |
MsG0080049070.01 | MsG0280007511.01 | 0.803170 | 3.960560e-49 | 1.976659e-46 |
MsG0080049070.01 | MsG0280007561.01 | 0.827616 | 1.418212e-54 | 1.376059e-51 |
MsG0080049070.01 | MsG0280007647.01 | 0.806851 | 6.729695e-50 | 3.691685e-47 |
MsG0080049070.01 | MsG0280007852.01 | 0.875130 | 3.926311e-68 | 1.813103e-64 |
MsG0080049070.01 | MsG0280007853.01 | 0.883429 | 4.522433e-71 | 2.865809e-67 |
MsG0080049070.01 | MsG0280007867.01 | 0.807398 | 5.155393e-50 | 2.868557e-47 |
MsG0080049070.01 | MsG0280008072.01 | 0.810844 | 9.416734e-51 | 5.738355e-48 |
MsG0080049070.01 | MsG0280008098.01 | 0.806030 | 1.002568e-49 | 5.385405e-47 |
MsG0080049070.01 | MsG0280008223.01 | 0.842706 | 2.194597e-58 | 3.355337e-55 |
MsG0080049070.01 | MsG0280008343.01 | 0.861052 | 1.345092e-63 | 3.755160e-60 |
MsG0080049070.01 | MsG0280008419.01 | 0.808591 | 2.872330e-50 | 1.648865e-47 |
MsG0080049070.01 | MsG0280008928.01 | 0.822486 | 2.308941e-53 | 1.935246e-50 |
MsG0080049070.01 | MsG0280008929.01 | 0.802324 | 5.920504e-49 | 2.891934e-46 |
MsG0080049070.01 | MsG0280009431.01 | 0.815837 | 7.532839e-52 | 5.250455e-49 |
MsG0080049070.01 | MsG0280009435.01 | 0.821613 | 3.678358e-53 | 3.007178e-50 |
MsG0080049070.01 | MsG0280009436.01 | 0.824484 | 7.874526e-54 | 6.983981e-51 |
MsG0080049070.01 | MsG0280009699.01 | 0.800291 | 1.544285e-48 | 7.163963e-46 |
MsG0080049070.01 | MsG0280009756.01 | 0.832493 | 9.159625e-56 | 1.025493e-52 |
MsG0080049070.01 | MsG0280010353.01 | 0.820955 | 5.216538e-53 | 4.187760e-50 |
MsG0080049070.01 | MsG0280010728.01 | 0.821830 | 3.277832e-53 | 2.696441e-50 |
MsG0080049070.01 | MsG0280011110.01 | -0.831250 | 1.856396e-55 | 2.003122e-52 |
MsG0080049070.01 | MsG0280011180.01 | 0.844496 | 7.292108e-59 | 1.179446e-55 |
MsG0080049070.01 | MsG0280011218.01 | 0.852623 | 4.087336e-61 | 8.591590e-58 |
MsG0080049070.01 | MsG0280011362.01 | 0.808323 | 3.276624e-50 | 1.867953e-47 |
MsG0080049070.01 | MsG0380011632.01 | 0.809211 | 2.116195e-50 | 1.235032e-47 |
MsG0080049070.01 | MsG0380012782.01 | 0.825192 | 5.358476e-54 | 4.850323e-51 |
MsG0080049070.01 | MsG0380012868.01 | 0.891452 | 3.920251e-74 | 3.439320e-70 |
MsG0080049070.01 | MsG0380014588.01 | 0.813952 | 1.972239e-51 | 1.306012e-48 |
MsG0080049070.01 | MsG0380014909.01 | 0.825425 | 4.721706e-54 | 4.301913e-51 |
MsG0080049070.01 | MsG0380015024.01 | 0.807026 | 6.179990e-50 | 3.405461e-47 |
MsG0080049070.01 | MsG0380016057.01 | 0.862708 | 4.184940e-64 | 1.237182e-60 |
MsG0080049070.01 | MsG0380016058.01 | 0.800309 | 1.531020e-48 | 7.105901e-46 |
MsG0080049070.01 | MsG0380016167.01 | 0.803835 | 2.884374e-49 | 1.464335e-46 |
MsG0080049070.01 | MsG0380016172.01 | 0.840445 | 8.656043e-58 | 1.233292e-54 |
MsG0080049070.01 | MsG0380016188.01 | -0.827692 | 1.359223e-54 | 1.321849e-51 |
MsG0080049070.01 | MsG0380016542.01 | 0.838135 | 3.442930e-57 | 4.568581e-54 |
MsG0080049070.01 | MsG0380016545.01 | 0.853903 | 1.756810e-61 | 3.855046e-58 |
MsG0080049070.01 | MsG0380016568.01 | 0.800249 | 1.574831e-48 | 7.297658e-46 |
MsG0080049070.01 | MsG0380016997.01 | 0.810898 | 9.169379e-51 | 5.595647e-48 |
MsG0080049070.01 | MsG0380017162.01 | 0.834831 | 2.387278e-56 | 2.866595e-53 |
MsG0080049070.01 | MsG0380017427.01 | 0.889623 | 2.052681e-73 | 1.669121e-69 |
MsG0080049070.01 | MsG0380017793.01 | 0.862974 | 3.465494e-64 | 1.033877e-60 |
MsG0080049070.01 | MsG0480018107.01 | 0.845549 | 3.789390e-59 | 6.337424e-56 |
MsG0080049070.01 | MsG0480018337.01 | 0.917493 | 4.963362e-86 | 1.436637e-81 |
MsG0080049070.01 | MsG0480018338.01 | 0.904134 | 1.685772e-79 | 2.571197e-75 |
MsG0080049070.01 | MsG0480018592.01 | 0.819363 | 1.207970e-52 | 9.275521e-50 |
MsG0080049070.01 | MsG0480018644.01 | 0.810443 | 1.149918e-50 | 6.932252e-48 |
MsG0080049070.01 | MsG0480018673.01 | 0.822153 | 2.758742e-53 | 2.290277e-50 |
MsG0080049070.01 | MsG0480018676.01 | 0.833330 | 5.674528e-56 | 6.514470e-53 |
MsG0080049070.01 | MsG0480018997.01 | 0.803212 | 3.881985e-49 | 1.939479e-46 |
MsG0080049070.01 | MsG0480019384.01 | 0.828558 | 8.410876e-55 | 8.389360e-52 |
MsG0080049070.01 | MsG0480019501.01 | 0.822356 | 2.475116e-53 | 2.066926e-50 |
MsG0080049070.01 | MsG0480019644.01 | 0.810508 | 1.113292e-50 | 6.723179e-48 |
MsG0080049070.01 | MsG0480019812.01 | 0.885245 | 9.601173e-72 | 6.541139e-68 |
MsG0080049070.01 | MsG0480020473.01 | 0.901591 | 2.294852e-78 | 3.121518e-74 |
MsG0080049070.01 | MsG0480020596.01 | 0.859788 | 3.246225e-63 | 8.677307e-60 |
MsG0080049070.01 | MsG0480021038.01 | 0.887916 | 9.366604e-73 | 7.102104e-69 |
MsG0080049070.01 | MsG0480021101.01 | 0.834225 | 3.389650e-56 | 3.996700e-53 |
MsG0080049070.01 | MsG0480021124.01 | 0.826876 | 2.132953e-54 | 2.025547e-51 |
MsG0080049070.01 | MsG0480021154.01 | -0.804464 | 2.133094e-49 | 1.100548e-46 |
MsG0080049070.01 | MsG0480021168.01 | 0.820638 | 6.170188e-53 | 4.908870e-50 |
MsG0080049070.01 | MsG0480021207.01 | 0.806717 | 7.181327e-50 | 3.925776e-47 |
MsG0080049070.01 | MsG0480021213.01 | 0.885341 | 8.838942e-72 | 6.044862e-68 |
MsG0080049070.01 | MsG0480021248.01 | 0.836064 | 1.164690e-56 | 1.451349e-53 |
MsG0080049070.01 | MsG0480021377.01 | 0.824932 | 6.174857e-54 | 5.548028e-51 |
MsG0080049070.01 | MsG0480021406.01 | 0.807250 | 5.541480e-50 | 3.071493e-47 |
MsG0080049070.01 | MsG0480021497.01 | 0.802013 | 6.862604e-49 | 3.325374e-46 |
MsG0080049070.01 | MsG0480021783.01 | 0.802782 | 4.765059e-49 | 2.354795e-46 |
MsG0080049070.01 | MsG0480021817.01 | 0.805814 | 1.113039e-49 | 5.945856e-47 |
MsG0080049070.01 | MsG0480021830.01 | 0.810107 | 1.358789e-50 | 8.120032e-48 |
MsG0080049070.01 | MsG0480021967.01 | 0.839978 | 1.146237e-57 | 1.609808e-54 |
MsG0080049070.01 | MsG0480022113.01 | 0.851815 | 6.941352e-61 | 1.421906e-57 |
MsG0080049070.01 | MsG0480022154.01 | 0.836516 | 8.938740e-57 | 1.129032e-53 |
MsG0080049070.01 | MsG0480022162.01 | 0.919393 | 4.760543e-87 | 1.526579e-82 |
MsG0080049070.01 | MsG0480022240.01 | 0.840350 | 9.170362e-58 | 1.302645e-54 |
MsG0080049070.01 | MsG0480022664.01 | 0.811301 | 7.498528e-51 | 4.624650e-48 |
MsG0080049070.01 | MsG0480022918.01 | 0.800828 | 1.199830e-48 | 5.642316e-46 |
MsG0080049070.01 | MsG0480023169.01 | 0.835573 | 1.551445e-56 | 1.904763e-53 |
MsG0080049070.01 | MsG0480023190.01 | 0.810430 | 1.157062e-50 | 6.972981e-48 |
MsG0080049070.01 | MsG0480023326.01 | 0.830586 | 2.701244e-55 | 2.858206e-52 |
MsG0080049070.01 | MsG0480023406.01 | 0.831161 | 1.952464e-55 | 2.101369e-52 |
MsG0080049070.01 | MsG0480023454.01 | -0.805595 | 1.237247e-49 | 6.572097e-47 |
MsG0080049070.01 | MsG0480023466.01 | 0.858297 | 9.074267e-63 | 2.305240e-59 |
MsG0080049070.01 | MsG0480023704.01 | 0.803508 | 3.370886e-49 | 1.697077e-46 |
MsG0080049070.01 | MsG0580024285.01 | 0.829458 | 5.089747e-55 | 5.212231e-52 |
MsG0080049070.01 | MsG0580024340.01 | 0.831437 | 1.670650e-55 | 1.812832e-52 |
MsG0080049070.01 | MsG0580024598.01 | 0.819041 | 1.430064e-52 | 1.088500e-49 |
MsG0080049070.01 | MsG0580024872.01 | 0.827069 | 1.917558e-54 | 1.831341e-51 |
MsG0080049070.01 | MsG0580025252.01 | 0.808184 | 3.508690e-50 | 1.992907e-47 |
MsG0080049070.01 | MsG0580025366.01 | 0.822331 | 2.507766e-53 | 2.092701e-50 |
MsG0080049070.01 | MsG0580025610.01 | 0.836496 | 9.044684e-57 | 1.141752e-53 |
MsG0080049070.01 | MsG0580025627.01 | 0.827622 | 1.412920e-54 | 1.371192e-51 |
MsG0080049070.01 | MsG0580026498.01 | 0.816440 | 5.523017e-52 | 3.913525e-49 |
MsG0080049070.01 | MsG0580027183.01 | 0.851916 | 6.497070e-61 | 1.335068e-57 |
MsG0080049070.01 | MsG0580027189.01 | 0.845629 | 3.605754e-59 | 6.045822e-56 |
MsG0080049070.01 | MsG0580027394.01 | 0.805838 | 1.100251e-49 | 5.881195e-47 |
MsG0080049070.01 | MsG0580027979.01 | 0.824933 | 6.170174e-54 | 5.544040e-51 |
MsG0080049070.01 | MsG0580028065.01 | -0.809608 | 1.739713e-50 | 1.026128e-47 |
MsG0080049070.01 | MsG0580028306.01 | 0.806761 | 7.030879e-50 | 3.847792e-47 |
MsG0080049070.01 | MsG0580028419.01 | 0.843814 | 1.111842e-58 | 1.760174e-55 |
MsG0080049070.01 | MsG0580028422.01 | 0.817441 | 3.292573e-52 | 2.398097e-49 |
MsG0080049070.01 | MsG0580028495.01 | 0.840107 | 1.061366e-57 | 1.496511e-54 |
MsG0080049070.01 | MsG0580029511.01 | 0.818281 | 2.127785e-52 | 1.585779e-49 |
MsG0080049070.01 | MsG0580029734.01 | 0.819824 | 9.480634e-53 | 7.374796e-50 |
MsG0080049070.01 | MsG0580029862.01 | 0.821726 | 3.463623e-53 | 2.840740e-50 |
MsG0080049070.01 | MsG0580029967.01 | 0.800279 | 1.552681e-48 | 7.200719e-46 |
MsG0080049070.01 | MsG0580030063.01 | 0.811840 | 5.725536e-51 | 3.581924e-48 |
MsG0080049070.01 | MsG0680030464.01 | 0.825677 | 4.113737e-54 | 3.775238e-51 |
MsG0080049070.01 | MsG0680030858.01 | 0.815332 | 9.758864e-52 | 6.708884e-49 |
MsG0080049070.01 | MsG0680030907.01 | 0.839575 | 1.459966e-57 | 2.024566e-54 |
MsG0080049070.01 | MsG0680031826.01 | 0.874776 | 5.184175e-68 | 2.363080e-64 |
MsG0080049070.01 | MsG0680032006.01 | 0.808346 | 3.240355e-50 | 1.848348e-47 |
MsG0080049070.01 | MsG0680032160.01 | 0.803770 | 2.975354e-49 | 1.507984e-46 |
MsG0080049070.01 | MsG0680032254.01 | 0.805596 | 1.236995e-49 | 6.570822e-47 |
MsG0080049070.01 | MsG0680032413.01 | 0.825451 | 4.655323e-54 | 4.244469e-51 |
MsG0080049070.01 | MsG0680032769.01 | 0.801852 | 7.404258e-49 | 3.573333e-46 |
MsG0080049070.01 | MsG0680032850.01 | 0.887127 | 1.874249e-72 | 1.376227e-68 |
MsG0080049070.01 | MsG0680034759.01 | -0.815515 | 8.888059e-52 | 6.141015e-49 |
MsG0080049070.01 | MsG0680035532.01 | 0.818214 | 2.203255e-52 | 1.638990e-49 |
MsG0080049070.01 | MsG0680035664.01 | 0.851521 | 8.405791e-61 | 1.705929e-57 |
MsG0080049070.01 | MsG0680035665.01 | 0.817687 | 2.897374e-52 | 2.124481e-49 |
MsG0080049070.01 | MsG0780035960.01 | 0.810520 | 1.106399e-50 | 6.683738e-48 |
MsG0080049070.01 | MsG0780035965.01 | 0.866395 | 2.942825e-65 | 9.903241e-62 |
MsG0080049070.01 | MsG0780036008.01 | 0.848777 | 4.937157e-60 | 9.161022e-57 |
MsG0080049070.01 | MsG0780036620.01 | 0.848653 | 5.342580e-60 | 9.873019e-57 |
MsG0080049070.01 | MsG0780036792.01 | 0.848552 | 5.700700e-60 | 1.050013e-56 |
MsG0080049070.01 | MsG0780037052.01 | -0.823229 | 1.549985e-53 | 1.326704e-50 |
MsG0080049070.01 | MsG0780037351.01 | 0.840923 | 6.491105e-58 | 9.386229e-55 |
MsG0080049070.01 | MsG0780037363.01 | 0.872580 | 2.851357e-67 | 1.199502e-63 |
MsG0080049070.01 | MsG0780037507.01 | 0.820822 | 5.598014e-53 | 4.476959e-50 |
MsG0080049070.01 | MsG0780037662.01 | 0.814658 | 1.377057e-51 | 9.294829e-49 |
MsG0080049070.01 | MsG0780038056.01 | 0.847074 | 1.455112e-59 | 2.556533e-56 |
MsG0080049070.01 | MsG0780039161.01 | 0.859481 | 4.015058e-63 | 1.061944e-59 |
MsG0080049070.01 | MsG0780039795.01 | 0.802486 | 5.484628e-49 | 2.689851e-46 |
MsG0080049070.01 | MsG0780039805.01 | 0.811351 | 7.312223e-51 | 4.515623e-48 |
MsG0080049070.01 | MsG0780040343.01 | 0.810394 | 1.178020e-50 | 7.092476e-48 |
MsG0080049070.01 | MsG0780040684.01 | 0.855829 | 4.850021e-62 | 1.134392e-58 |
MsG0080049070.01 | MsG0780040965.01 | 0.880362 | 5.845115e-70 | 3.283862e-66 |
MsG0080049070.01 | MsG0780041129.01 | 0.842383 | 2.674548e-58 | 4.048475e-55 |
MsG0080049070.01 | MsG0780041174.01 | 0.810040 | 1.404589e-50 | 8.379117e-48 |
MsG0080049070.01 | MsG0780041331.01 | 0.906770 | 1.040071e-80 | 1.788147e-76 |
MsG0080049070.01 | MsG0780041361.01 | 0.840291 | 9.500804e-58 | 1.347113e-54 |
MsG0080049070.01 | MsG0780041385.01 | 0.847966 | 8.275708e-60 | 1.495774e-56 |
MsG0080049070.01 | MsG0780041442.01 | 0.820765 | 5.768539e-53 | 4.606064e-50 |
MsG0080049070.01 | MsG0780041474.01 | 0.804518 | 2.078347e-49 | 1.073762e-46 |
MsG0080049070.01 | MsG0780041778.01 | 0.809449 | 1.881664e-50 | 1.105089e-47 |
MsG0080049070.01 | MsG0780041828.01 | 0.811791 | 5.868245e-51 | 3.666423e-48 |
MsG0080049070.01 | MsG0880041847.01 | 0.834145 | 3.550645e-56 | 4.176083e-53 |
MsG0080049070.01 | MsG0880042044.01 | 0.810706 | 1.008697e-50 | 6.124084e-48 |
MsG0080049070.01 | MsG0880042086.01 | 0.891004 | 5.899004e-74 | 5.080259e-70 |
MsG0080049070.01 | MsG0880042415.01 | 0.913462 | 5.983716e-84 | 1.416447e-79 |
MsG0080049070.01 | MsG0880042416.01 | 0.831086 | 2.037235e-55 | 2.187802e-52 |
MsG0080049070.01 | MsG0880042512.01 | 0.813160 | 2.946204e-51 | 1.909341e-48 |
MsG0080049070.01 | MsG0880043024.01 | 0.819200 | 1.315908e-52 | 1.005912e-49 |
MsG0080049070.01 | MsG0880043092.01 | 0.815079 | 1.110819e-51 | 7.583425e-49 |
MsG0080049070.01 | MsG0880043107.01 | 0.878959 | 1.841287e-69 | 9.803483e-66 |
MsG0080049070.01 | MsG0880043278.01 | 0.817898 | 2.597357e-52 | 1.915480e-49 |
MsG0080049070.01 | MsG0880043476.01 | 0.822392 | 2.428287e-53 | 2.029942e-50 |
MsG0080049070.01 | MsG0880043622.01 | 0.841940 | 3.503325e-58 | 5.228964e-55 |
MsG0080049070.01 | MsG0880043829.01 | 0.801518 | 8.670304e-49 | 4.149018e-46 |
MsG0080049070.01 | MsG0880044620.01 | 0.803205 | 3.895920e-49 | 1.946093e-46 |
MsG0080049070.01 | MsG0880044626.01 | 0.809950 | 1.468392e-50 | 8.739056e-48 |
MsG0080049070.01 | MsG0880044629.01 | 0.801729 | 7.846534e-49 | 3.774804e-46 |
MsG0080049070.01 | MsG0880044834.01 | 0.818490 | 1.908076e-52 | 1.430319e-49 |
MsG0080049070.01 | MsG0880044901.01 | -0.804828 | 1.790812e-49 | 9.327482e-47 |
MsG0080049070.01 | MsG0880045031.01 | 0.834555 | 2.801460e-56 | 3.336422e-53 |
MsG0080049070.01 | MsG0880045285.01 | 0.813113 | 3.016778e-51 | 1.952554e-48 |
MsG0080049070.01 | MsG0880045312.01 | 0.820702 | 5.964037e-53 | 4.753622e-50 |
MsG0080049070.01 | MsG0880045402.01 | 0.800756 | 1.241079e-48 | 5.825486e-46 |
MsG0080049070.01 | MsG0880045423.01 | 0.802271 | 6.071535e-49 | 2.961551e-46 |
MsG0080049070.01 | MsG0880045648.01 | 0.825992 | 3.463813e-54 | 3.207548e-51 |
MsG0080049070.01 | MsG0880045927.01 | 0.812809 | 3.517561e-51 | 2.258281e-48 |
MsG0080049070.01 | MsG0880046051.01 | 0.806312 | 8.745108e-50 | 4.731325e-47 |
MsG0080049070.01 | MsG0880046124.01 | 0.841230 | 5.388882e-58 | 7.866319e-55 |
MsG0080049070.01 | MsG0880046200.01 | 0.802132 | 6.484452e-49 | 3.151764e-46 |
MsG0080049070.01 | MsG0880046324.01 | 0.829247 | 5.728081e-55 | 5.830374e-52 |
MsG0080049070.01 | MsG0880046408.01 | 0.809726 | 1.640880e-50 | 9.708468e-48 |
MsG0080049070.01 | MsG0880046434.01 | -0.815220 | 1.033371e-51 | 7.081736e-49 |
MsG0080049070.01 | MsG0880046533.01 | 0.819461 | 1.147627e-52 | 8.837328e-50 |
MsG0080049070.01 | MsG0880046765.01 | 0.827970 | 1.165929e-54 | 1.143213e-51 |
MsG0080049070.01 | MsG0880047312.01 | -0.825275 | 5.124153e-54 | 4.648979e-51 |
MsG0080049070.01 | MsG0880047451.01 | 0.808394 | 3.165003e-50 | 1.807640e-47 |
MsG0080049070.01 | MsG0880047481.01 | -0.813024 | 3.156133e-51 | 2.037970e-48 |
MsG0080049070.01 | MsG0880047656.01 | 0.810535 | 1.098314e-50 | 6.637419e-48 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049070.01.T01 | MTR_8g107430 | 96.471 | 85 | 3 | 0 | 2 | 86 | 90 | 174 | 4.22e-56 | 171 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049070.01.T01 | AT3G17930 | 80.723 | 83 | 16 | 0 | 4 | 86 | 84 | 166 | 4.06e-46 | 146 |
Find 18 sgRNAs with CRISPR-Local
Find 27 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TGTTCAACTTGTGCTGGTTT+TGG | 0.236008 | contig647end:-11368 | MsG0080049070.01.T01:CDS |
AGGAAAGATGTCATATTAAT+CGG | 0.384907 | contig647end:-11595 | MsG0080049070.01.T01:CDS |
CTTGGCATTGCCTTAAAATC+CGG | 0.397706 | contig647end:-11556 | MsG0080049070.01.T01:CDS |
TTACAGACTAAGGCACCATT+TGG | 0.404439 | contig647end:-11625 | None:intergenic |
GGACTTGGAGTTACTTTCCT+TGG | 0.438033 | contig647end:-11574 | MsG0080049070.01.T01:CDS |
AAATGTTGTTCAACTTGTGC+TGG | 0.438263 | contig647end:-11374 | MsG0080049070.01.T01:CDS |
AGGCACCATTTGGATATTCA+AGG | 0.473273 | contig647end:-11615 | MsG0080049070.01.T01:CDS |
AGCTTGTAGTGGATCAAATC+CGG | 0.498185 | contig647end:+11399 | None:intergenic |
TCTTTCCTTGAATATCCAAA+TGG | 0.501246 | contig647end:+11610 | None:intergenic |
GATGTCATATTAATCGGACT+TGG | 0.523993 | contig647end:-11589 | MsG0080049070.01.T01:CDS |
GAGTTGAGATACCTCAAGTC+CGG | 0.544969 | contig647end:+11537 | None:intergenic |
TGCCTTAAAATCCGGACTTG+AGG | 0.557648 | contig647end:-11548 | MsG0080049070.01.T01:intron |
ACAACATTTCCAGCTTGTAG+TGG | 0.569187 | contig647end:+11388 | None:intergenic |
GGATTTGATCCACTACAAGC+TGG | 0.576522 | contig647end:-11397 | MsG0080049070.01.T01:CDS |
TGACTACGAAAGTAAAGTCA+TGG | 0.582776 | contig647end:-11269 | MsG0080049070.01.T01:CDS |
TATCTTCAGAGTCTCAAACA+AGG | 0.652304 | contig647end:-11317 | MsG0080049070.01.T01:CDS |
TTGAGATCCATCCAACAGTG+AGG | 0.728057 | contig647end:+11344 | None:intergenic |
CTACGAAAGTAAAGTCATGG+AGG | 0.745272 | contig647end:-11266 | MsG0080049070.01.T01:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
! | AGGAAAGATGTCATATTAAT+CGG | - | contig647end:11282-11301 | MsG0080049070.01.T01:CDS | 25.0% |
!! | ATATATATTTTGCAGTTTGC+CGG | - | contig647end:11459-11478 | MsG0080049070.01.T01:intron | 25.0% |
ATCATGCAACTATTCTTTCT+TGG | - | contig647end:11430-11449 | MsG0080049070.01.T01:intron | 30.0% | |
TCTTTCCTTGAATATCCAAA+TGG | + | contig647end:11270-11289 | None:intergenic | 30.0% | |
AAATGTTGTTCAACTTGTGC+TGG | - | contig647end:11503-11522 | MsG0080049070.01.T01:intron | 35.0% | |
GATGTCATATTAATCGGACT+TGG | - | contig647end:11288-11307 | MsG0080049070.01.T01:CDS | 35.0% | |
TATCTTCAGAGTCTCAAACA+AGG | - | contig647end:11560-11579 | MsG0080049070.01.T01:CDS | 35.0% | |
TGACTACGAAAGTAAAGTCA+TGG | - | contig647end:11608-11627 | MsG0080049070.01.T01:CDS | 35.0% | |
! | ATTTTCCAATTACCACACAC+AGG | - | contig647end:11378-11397 | MsG0080049070.01.T01:CDS | 35.0% |
ACAACATTTCCAGCTTGTAG+TGG | + | contig647end:11492-11511 | None:intergenic | 40.0% | |
AGGCACCATTTGGATATTCA+AGG | - | contig647end:11262-11281 | MsG0080049070.01.T01:CDS | 40.0% | |
CTACGAAAGTAAAGTCATGG+AGG | - | contig647end:11611-11630 | MsG0080049070.01.T01:CDS | 40.0% | |
CTTGGCATTGCCTTAAAATC+CGG | - | contig647end:11321-11340 | MsG0080049070.01.T01:CDS | 40.0% | |
! | TACCTCAAGTCCGGATTTTA+AGG | + | contig647end:11334-11353 | None:intergenic | 40.0% |
!! | AGCTTGTAGTGGATCAAATC+CGG | + | contig647end:11481-11500 | None:intergenic | 40.0% |
!!! | GTTCAACTTGTGCTGGTTTT+GGG | - | contig647end:11510-11529 | MsG0080049070.01.T01:intron | 40.0% |
!!! | TGTTCAACTTGTGCTGGTTT+TGG | - | contig647end:11509-11528 | MsG0080049070.01.T01:intron | 40.0% |
AAGTGCCTGTGTGTGGTAAT+TGG | + | contig647end:11386-11405 | None:intergenic | 45.0% | |
CAAACATAAGTGCCTGTGTG+TGG | + | contig647end:11393-11412 | None:intergenic | 45.0% | |
GAGTTGAGATACCTCAAGTC+CGG | + | contig647end:11343-11362 | None:intergenic | 45.0% | |
GGATTTGATCCACTACAAGC+TGG | - | contig647end:11480-11499 | MsG0080049070.01.T01:intron | 45.0% | |
TGCCTTAAAATCCGGACTTG+AGG | - | contig647end:11329-11348 | MsG0080049070.01.T01:CDS | 45.0% | |
TTGAGATCCATCCAACAGTG+AGG | + | contig647end:11536-11555 | None:intergenic | 45.0% | |
! | GGACTTGGAGTTACTTTCCT+TGG | - | contig647end:11303-11322 | MsG0080049070.01.T01:CDS | 45.0% |
!!! | CGGATTTTAAGGCAATGCCA+AGG | + | contig647end:11323-11342 | None:intergenic | 45.0% |
! | TTTTGGGCCTCACTGTTGGA+TGG | - | contig647end:11526-11545 | MsG0080049070.01.T01:intron | 50.0% |
!!! | CTGGTTTTGGGCCTCACTGT+TGG | - | contig647end:11522-11541 | MsG0080049070.01.T01:intron | 55.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
contig647end | gene | 11258 | 11641 | 11258 | ID=MsG0080049070.01;Name=MsG0080049070.01 |
contig647end | mRNA | 11258 | 11641 | 11258 | ID=MsG0080049070.01.T01;Parent=MsG0080049070.01;Name=MsG0080049070.01.T01;_AED=0.50;_eAED=0.50;_QI=0|0|0|1|1|1|2|0|86 |
contig647end | exon | 11549 | 11641 | 11549 | ID=MsG0080049070.01.T01:exon:8337;Parent=MsG0080049070.01.T01 |
contig647end | exon | 11258 | 11425 | 11258 | ID=MsG0080049070.01.T01:exon:8338;Parent=MsG0080049070.01.T01 |
contig647end | CDS | 11549 | 11641 | 11549 | ID=MsG0080049070.01.T01:cds;Parent=MsG0080049070.01.T01 |
contig647end | CDS | 11258 | 11425 | 11258 | ID=MsG0080049070.01.T01:cds;Parent=MsG0080049070.01.T01 |
Gene Sequence |
Protein sequence |