Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0780037124.01.T01 | XP_024625689.1 | 100 | 51 | 0 | 0 | 1 | 51 | 1 | 51 | 5.00E-28 | 105 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0780037124.01.T01 | A0A396GV77 | 100.000 | 51 | 0 | 0 | 1 | 51 | 1 | 51 | 2.39e-28 | 105 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080047791.01 | MsG0780037124.01 | 0.826135 | 3.202032e-54 | 2.977174e-51 |
MsG0080048383.01 | MsG0780037124.01 | 0.808225 | 3.437958e-50 | 1.954859e-47 |
MsG0180000205.01 | MsG0780037124.01 | 0.815259 | 1.013255e-51 | 6.951379e-49 |
MsG0180000209.01 | MsG0780037124.01 | 0.800697 | 1.276100e-48 | 5.980884e-46 |
MsG0180000568.01 | MsG0780037124.01 | 0.816084 | 6.634899e-52 | 4.656340e-49 |
MsG0180000777.01 | MsG0780037124.01 | 0.833886 | 4.121508e-56 | 4.810938e-53 |
MsG0180000806.01 | MsG0780037124.01 | 0.805603 | 1.232498e-49 | 6.548158e-47 |
MsG0180000982.01 | MsG0780037124.01 | 0.846397 | 2.228414e-59 | 3.830696e-56 |
MsG0180001599.01 | MsG0780037124.01 | 0.808295 | 3.322833e-50 | 1.892831e-47 |
MsG0180001886.01 | MsG0780037124.01 | 0.867747 | 1.089210e-65 | 3.844864e-62 |
MsG0180002547.01 | MsG0780037124.01 | 0.838096 | 3.523593e-57 | 4.670112e-54 |
MsG0180002794.01 | MsG0780037124.01 | 0.836792 | 7.602864e-57 | 9.684117e-54 |
MsG0180003510.01 | MsG0780037124.01 | 0.806523 | 7.892769e-50 | 4.293247e-47 |
MsG0180003572.01 | MsG0780037124.01 | 0.801304 | 9.593114e-49 | 4.565862e-46 |
MsG0180004050.01 | MsG0780037124.01 | 0.802268 | 6.080549e-49 | 2.965712e-46 |
MsG0180004389.01 | MsG0780037124.01 | 0.803328 | 3.674220e-49 | 1.841096e-46 |
MsG0180004481.01 | MsG0780037124.01 | 0.834080 | 3.684785e-56 | 4.325903e-53 |
MsG0180004482.01 | MsG0780037124.01 | 0.815683 | 8.154305e-52 | 5.659992e-49 |
MsG0180004509.01 | MsG0780037124.01 | 0.807499 | 4.907401e-50 | 2.737756e-47 |
MsG0180004854.01 | MsG0780037124.01 | 0.805215 | 1.486800e-49 | 7.820856e-47 |
MsG0180004861.01 | MsG0780037124.01 | 0.821427 | 4.061967e-53 | 3.303703e-50 |
MsG0180004928.01 | MsG0780037124.01 | 0.806659 | 7.388151e-50 | 4.032555e-47 |
MsG0180005668.01 | MsG0780037124.01 | 0.810948 | 8.940124e-51 | 5.463498e-48 |
MsG0180005990.01 | MsG0780037124.01 | 0.832204 | 1.080413e-55 | 1.199185e-52 |
MsG0180006013.01 | MsG0780037124.01 | 0.802615 | 5.156892e-49 | 2.537571e-46 |
MsG0180006096.01 | MsG0780037124.01 | 0.800043 | 1.733912e-48 | 7.993011e-46 |
MsG0280010595.01 | MsG0780037124.01 | 0.811476 | 6.869765e-51 | 4.256785e-48 |
MsG0280010776.01 | MsG0780037124.01 | 0.801161 | 1.025837e-48 | 4.865092e-46 |
MsG0280010980.01 | MsG0780037124.01 | 0.801449 | 8.956261e-49 | 4.278434e-46 |
MsG0280011141.01 | MsG0780037124.01 | 0.800521 | 1.386459e-48 | 6.469235e-46 |
MsG0380011581.01 | MsG0780037124.01 | 0.804311 | 2.295763e-49 | 1.179838e-46 |
MsG0380012570.01 | MsG0780037124.01 | 0.804816 | 1.801427e-49 | 9.379892e-47 |
MsG0380013085.01 | MsG0780037124.01 | 0.824969 | 6.052093e-54 | 5.443467e-51 |
MsG0380014225.01 | MsG0780037124.01 | -0.810913 | 9.099007e-51 | 5.555071e-48 |
MsG0380014248.01 | MsG0780037124.01 | 0.807338 | 5.306880e-50 | 2.948227e-47 |
MsG0380014296.01 | MsG0780037124.01 | 0.820789 | 5.695695e-53 | 4.550849e-50 |
MsG0680031000.01 | MsG0780037124.01 | 0.806135 | 9.530645e-50 | 5.133149e-47 |
MsG0680031621.01 | MsG0780037124.01 | 0.800944 | 1.136374e-48 | 5.359814e-46 |
MsG0680031628.01 | MsG0780037124.01 | 0.808442 | 3.090555e-50 | 1.767388e-47 |
MsG0680031708.01 | MsG0780037124.01 | 0.805532 | 1.275546e-49 | 6.764465e-47 |
MsG0680031964.01 | MsG0780037124.01 | 0.813995 | 1.929908e-51 | 1.279454e-48 |
MsG0680034671.01 | MsG0780037124.01 | 0.815576 | 8.615438e-52 | 5.962446e-49 |
MsG0680034913.01 | MsG0780037124.01 | 0.812327 | 4.483940e-51 | 2.842527e-48 |
MsG0480020447.01 | MsG0780037124.01 | 0.807546 | 4.794328e-50 | 2.677846e-47 |
MsG0480021041.01 | MsG0780037124.01 | 0.838596 | 2.617238e-57 | 3.522743e-54 |
MsG0480021464.01 | MsG0780037124.01 | 0.809308 | 2.017692e-50 | 1.180532e-47 |
MsG0480021465.01 | MsG0780037124.01 | 0.816664 | 4.920310e-52 | 3.508155e-49 |
MsG0480021706.01 | MsG0780037124.01 | 0.818535 | 1.863833e-52 | 1.398899e-49 |
MsG0480021750.01 | MsG0780037124.01 | 0.823928 | 1.063749e-53 | 9.286956e-51 |
MsG0480021994.01 | MsG0780037124.01 | 0.819346 | 1.218926e-52 | 9.354821e-50 |
MsG0480022054.01 | MsG0780037124.01 | 0.801950 | 7.070282e-49 | 3.420488e-46 |
MsG0480022207.01 | MsG0780037124.01 | 0.808212 | 3.460058e-50 | 1.966738e-47 |
MsG0480022223.01 | MsG0780037124.01 | 0.857026 | 2.160643e-62 | 5.258684e-59 |
MsG0480022292.01 | MsG0780037124.01 | 0.816620 | 5.033739e-52 | 3.584683e-49 |
MsG0480022672.01 | MsG0780037124.01 | 0.806061 | 9.874968e-50 | 5.308743e-47 |
MsG0480022696.01 | MsG0780037124.01 | 0.856863 | 2.412983e-62 | 5.839949e-59 |
MsG0480022711.01 | MsG0780037124.01 | 0.829127 | 6.126189e-55 | 6.212978e-52 |
MsG0480022916.01 | MsG0780037124.01 | 0.807732 | 4.378089e-50 | 2.457280e-47 |
MsG0480022960.01 | MsG0780037124.01 | 0.805309 | 1.420469e-49 | 7.490125e-47 |
MsG0480023055.01 | MsG0780037124.01 | 0.813489 | 2.493985e-51 | 1.631017e-48 |
MsG0480023221.01 | MsG0780037124.01 | 0.821940 | 3.090835e-53 | 2.550460e-50 |
MsG0480023356.01 | MsG0780037124.01 | 0.829049 | 6.395731e-55 | 6.470913e-52 |
MsG0480023357.01 | MsG0780037124.01 | 0.823667 | 1.224564e-53 | 1.061319e-50 |
MsG0480023994.01 | MsG0780037124.01 | 0.846662 | 1.886557e-59 | 3.271051e-56 |
MsG0580024051.01 | MsG0780037124.01 | 0.816834 | 4.508624e-52 | 3.229525e-49 |
MsG0580024185.01 | MsG0780037124.01 | 0.813885 | 2.041062e-51 | 1.349140e-48 |
MsG0580024197.01 | MsG0780037124.01 | 0.810415 | 1.166134e-50 | 7.024716e-48 |
MsG0580024339.01 | MsG0780037124.01 | 0.819835 | 9.424100e-53 | 7.333211e-50 |
MsG0580024619.01 | MsG0780037124.01 | 0.810134 | 1.340199e-50 | 8.014381e-48 |
MsG0580024727.01 | MsG0780037124.01 | 0.826411 | 2.753392e-54 | 2.580345e-51 |
MsG0580025268.01 | MsG0780037124.01 | 0.822826 | 1.924230e-53 | 1.628548e-50 |
MsG0580025587.01 | MsG0780037124.01 | 0.821437 | 4.039444e-53 | 3.286227e-50 |
MsG0580025756.01 | MsG0780037124.01 | 0.851326 | 9.546859e-61 | 1.925549e-57 |
MsG0380015027.01 | MsG0780037124.01 | 0.802243 | 6.153716e-49 | 2.999489e-46 |
MsG0380015818.01 | MsG0780037124.01 | 0.800571 | 1.354000e-48 | 6.325848e-46 |
MsG0380016067.01 | MsG0780037124.01 | 0.828482 | 8.774876e-55 | 8.733120e-52 |
MsG0380016133.01 | MsG0780037124.01 | 0.876467 | 1.364815e-68 | 6.625338e-65 |
MsG0380016290.01 | MsG0780037124.01 | 0.800651 | 1.304393e-48 | 6.106542e-46 |
MsG0380016559.01 | MsG0780037124.01 | 0.827009 | 1.981971e-54 | 1.889483e-51 |
MsG0380016560.01 | MsG0780037124.01 | 0.842450 | 2.566771e-58 | 3.893682e-55 |
MsG0380016860.01 | MsG0780037124.01 | 0.818623 | 1.779811e-52 | 1.338989e-49 |
MsG0380016970.01 | MsG0780037124.01 | 0.804209 | 2.411069e-49 | 1.235820e-46 |
MsG0380017540.01 | MsG0780037124.01 | 0.803201 | 3.903662e-49 | 1.949740e-46 |
MsG0380018033.01 | MsG0780037124.01 | 0.848488 | 5.937563e-60 | 1.091520e-56 |
MsG0380018044.01 | MsG0780037124.01 | 0.829337 | 5.446352e-55 | 5.558595e-52 |
MsG0480018110.01 | MsG0780037124.01 | 0.824696 | 7.017625e-54 | 6.263086e-51 |
MsG0580026137.01 | MsG0780037124.01 | 0.815725 | 7.978699e-52 | 5.544760e-49 |
MsG0580026225.01 | MsG0780037124.01 | 0.808614 | 2.840096e-50 | 1.631293e-47 |
MsG0580026301.01 | MsG0780037124.01 | 0.804599 | 1.999648e-49 | 1.035292e-46 |
MsG0580026340.01 | MsG0780037124.01 | 0.801235 | 9.906544e-49 | 4.707009e-46 |
MsG0580026439.01 | MsG0780037124.01 | 0.854811 | 9.596828e-62 | 2.170179e-58 |
MsG0580026485.01 | MsG0780037124.01 | 0.846593 | 1.970889e-59 | 3.409368e-56 |
MsG0580026718.01 | MsG0780037124.01 | 0.821320 | 4.298242e-53 | 3.485373e-50 |
MsG0580028094.01 | MsG0780037124.01 | 0.814453 | 1.528600e-51 | 1.026116e-48 |
MsG0580028582.01 | MsG0780037124.01 | 0.836449 | 9.298871e-57 | 1.172276e-53 |
MsG0580028918.01 | MsG0780037124.01 | 0.814466 | 1.518526e-51 | 1.019744e-48 |
MsG0580029736.01 | MsG0780037124.01 | 0.801637 | 8.196083e-49 | 3.933804e-46 |
MsG0680030413.01 | MsG0780037124.01 | 0.824657 | 7.168149e-54 | 6.390170e-51 |
MsG0680030415.01 | MsG0780037124.01 | 0.809444 | 1.886327e-50 | 1.107695e-47 |
MsG0280006461.01 | MsG0780037124.01 | 0.822111 | 2.821743e-53 | 2.339759e-50 |
MsG0280006593.01 | MsG0780037124.01 | 0.836979 | 6.812299e-57 | 8.725858e-54 |
MsG0280006678.01 | MsG0780037124.01 | 0.806590 | 7.640413e-50 | 4.163053e-47 |
MsG0280007153.01 | MsG0780037124.01 | 0.821696 | 3.519640e-53 | 2.884333e-50 |
MsG0280007161.01 | MsG0780037124.01 | 0.800637 | 1.312926e-48 | 6.144228e-46 |
MsG0280007527.01 | MsG0780037124.01 | 0.806714 | 7.193663e-50 | 3.932175e-47 |
MsG0280007575.01 | MsG0780037124.01 | 0.806532 | 7.856883e-50 | 4.274818e-47 |
MsG0280007847.01 | MsG0780037124.01 | 0.827100 | 1.885180e-54 | 1.802024e-51 |
MsG0280008429.01 | MsG0780037124.01 | 0.811182 | 7.956993e-51 | 4.892261e-48 |
MsG0280009575.01 | MsG0780037124.01 | 0.819533 | 1.105085e-52 | 8.526849e-50 |
MsG0280009578.01 | MsG0780037124.01 | 0.819373 | 1.201443e-52 | 9.227979e-50 |
MsG0280010013.01 | MsG0780037124.01 | 0.811562 | 6.578874e-51 | 4.085739e-48 |
MsG0280010233.01 | MsG0780037124.01 | 0.828155 | 1.052120e-54 | 1.037218e-51 |
MsG0280010434.01 | MsG0780037124.01 | 0.836121 | 1.126719e-56 | 1.406459e-53 |
MsG0680035888.01 | MsG0780037124.01 | 0.819475 | 1.139294e-52 | 8.776570e-50 |
MsG0780036288.01 | MsG0780037124.01 | 0.809664 | 1.692239e-50 | 9.995896e-48 |
MsG0780037124.01 | MsG0780037141.01 | 0.806601 | 7.601257e-50 | 4.142894e-47 |
MsG0780037124.01 | MsG0780039144.01 | 0.803467 | 3.438177e-49 | 1.729038e-46 |
MsG0780037124.01 | MsG0780039170.01 | 0.803183 | 3.936662e-49 | 1.965346e-46 |
MsG0780037124.01 | MsG0780040545.01 | 0.839829 | 1.253542e-57 | 1.752091e-54 |
MsG0780037124.01 | MsG0780041268.01 | 0.817457 | 3.265393e-52 | 2.379402e-49 |
MsG0780037124.01 | MsG0780041392.01 | 0.815053 | 1.125681e-51 | 7.679405e-49 |
MsG0780037124.01 | MsG0780041435.01 | 0.808305 | 3.306408e-50 | 1.883940e-47 |
MsG0780037124.01 | MsG0780041796.01 | 0.800772 | 1.232234e-48 | 5.786192e-46 |
MsG0780037124.01 | MsG0880042033.01 | 0.800965 | 1.125299e-48 | 5.310475e-46 |
MsG0780037124.01 | MsG0880042108.01 | 0.826204 | 3.084169e-54 | 2.873262e-51 |
MsG0780037124.01 | MsG0880042324.01 | 0.815141 | 1.076030e-51 | 7.358154e-49 |
MsG0780037124.01 | MsG0880042519.01 | 0.824499 | 7.808160e-54 | 6.928239e-51 |
MsG0780037124.01 | MsG0880043454.01 | 0.805029 | 1.625809e-49 | 8.511258e-47 |
MsG0780037124.01 | MsG0880043477.01 | 0.803212 | 3.882593e-49 | 1.939778e-46 |
MsG0780037124.01 | MsG0880043749.01 | 0.809972 | 1.452890e-50 | 8.651657e-48 |
MsG0780037124.01 | MsG0880044394.01 | 0.808634 | 2.812386e-50 | 1.616225e-47 |
MsG0780037124.01 | MsG0880044728.01 | 0.809028 | 2.316761e-50 | 1.345397e-47 |
MsG0780037124.01 | MsG0880044975.01 | 0.851105 | 1.101770e-60 | 2.205991e-57 |
MsG0780037124.01 | MsG0880045017.01 | 0.831179 | 1.932634e-55 | 2.081082e-52 |
MsG0780037124.01 | MsG0880045145.01 | 0.815475 | 9.073183e-52 | 6.262309e-49 |
MsG0780037124.01 | MsG0880045613.01 | 0.831414 | 1.692231e-55 | 1.834973e-52 |
MsG0780037124.01 | MsG0880045656.01 | 0.829544 | 4.850496e-55 | 4.979479e-52 |
MsG0780037124.01 | MsG0880045736.01 | 0.804090 | 2.552066e-49 | 1.304183e-46 |
MsG0780037124.01 | MsG0880045765.01 | 0.808498 | 3.007700e-50 | 1.722440e-47 |
MsG0780037124.01 | MsG0880045951.01 | 0.805666 | 1.195484e-49 | 6.362042e-47 |
MsG0780037124.01 | MsG0880045965.01 | 0.826402 | 2.766765e-54 | 2.592131e-51 |
MsG0780037124.01 | MsG0880047045.01 | 0.801783 | 7.651669e-49 | 3.686068e-46 |
MsG0780037124.01 | MsG0880047052.01 | 0.812438 | 4.238757e-51 | 2.695313e-48 |
MsG0780037124.01 | MsG0880047212.01 | 0.811372 | 7.235927e-51 | 4.471236e-48 |
MsG0780037124.01 | MsG0880047473.01 | 0.804327 | 2.277813e-49 | 1.171104e-46 |
MsG0780037124.01 | MsG0880047764.01 | 0.831300 | 1.804921e-55 | 1.950542e-52 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0780037124.01.T01 | MTR_7g028755 | 100.000 | 51 | 0 | 0 | 1 | 51 | 103 | 153 | 1.64e-30 | 104 |
MsG0780037124.01.T01 | MTR_3g007670 | 86.000 | 50 | 7 | 0 | 1 | 50 | 1 | 50 | 1.69e-26 | 91.3 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0780037124.01.T01 | AT5G14105 | 78.571 | 42 | 9 | 0 | 1 | 42 | 1 | 42 | 6.20e-20 | 74.7 |
Find 8 sgRNAs with CRISPR-Local
Find 8 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TTTGACGTTGCGTTTGAAAA+TGG | 0.285769 | 7:+20211508 | None:intergenic |
GCGCTGTGGTTCTTCTTCTA+AGG | 0.305710 | 7:-20211553 | MsG0780037124.01.T01:CDS |
AATTTCATAATAACGGTTGC+CGG | 0.449593 | 7:-20211581 | MsG0780037124.01.T01:CDS |
ACGTCAAACAAATTCGTCAT+TGG | 0.463772 | 7:-20211493 | MsG0780037124.01.T01:CDS |
TTTGACGAATTTCATAATAA+CGG | 0.495140 | 7:-20211588 | MsG0780037124.01.T01:CDS |
AAGAACCACAGCGCTAACAC+CGG | 0.602416 | 7:+20211562 | None:intergenic |
GGTTGCCGGTGTTAGCGCTG+TGG | 0.613708 | 7:-20211567 | MsG0780037124.01.T01:CDS |
GACGTTGCGTTTGAAAATGG+AGG | 0.631098 | 7:+20211511 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!! | TTTGACGAATTTCATAATAA+CGG | - | Chr7:20211465-20211484 | MsG0780037124.01.T01:CDS | 20.0% |
AATTTCATAATAACGGTTGC+CGG | - | Chr7:20211472-20211491 | MsG0780037124.01.T01:CDS | 30.0% | |
ACGTCAAACAAATTCGTCAT+TGG | - | Chr7:20211560-20211579 | MsG0780037124.01.T01:CDS | 35.0% | |
TTTGACGTTGCGTTTGAAAA+TGG | + | Chr7:20211548-20211567 | None:intergenic | 35.0% | |
GACGTTGCGTTTGAAAATGG+AGG | + | Chr7:20211545-20211564 | None:intergenic | 45.0% | |
AAGAACCACAGCGCTAACAC+CGG | + | Chr7:20211494-20211513 | None:intergenic | 50.0% | |
GCGCTGTGGTTCTTCTTCTA+AGG | - | Chr7:20211500-20211519 | MsG0780037124.01.T01:CDS | 50.0% | |
! | GGTTGCCGGTGTTAGCGCTG+TGG | - | Chr7:20211486-20211505 | MsG0780037124.01.T01:CDS | 65.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr7 | gene | 20211460 | 20211615 | 20211460 | ID=MsG0780037124.01;Name=MsG0780037124.01 |
Chr7 | mRNA | 20211460 | 20211615 | 20211460 | ID=MsG0780037124.01.T01;Parent=MsG0780037124.01;Name=MsG0780037124.01.T01;_AED=0.49;_eAED=0.49;_QI=0|-1|0|1|-1|0|1|0|51 |
Chr7 | exon | 20211460 | 20211615 | 20211460 | ID=MsG0780037124.01.T01:exon:4967;Parent=MsG0780037124.01.T01 |
Chr7 | CDS | 20211460 | 20211615 | 20211460 | ID=MsG0780037124.01.T01:cds;Parent=MsG0780037124.01.T01 |
Gene Sequence |
Protein sequence |