Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0180002089.01.T01 | AES64392.1 | 92.157 | 51 | 4 | 0 | 1 | 51 | 27 | 77 | 1.63E-24 | 97.1 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0180002089.01.T01 | G7ILN7 | 92.157 | 51 | 4 | 0 | 1 | 51 | 27 | 77 | 7.78e-25 | 97.1 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080047869.01 | MsG0180002089.01 | 0.837108 | 6.312756e-57 | 8.117548e-54 |
MsG0080048856.01 | MsG0180002089.01 | 0.800284 | 1.549101e-48 | 7.185084e-46 |
MsG0080048874.01 | MsG0180002089.01 | 0.809194 | 2.134119e-50 | 1.244924e-47 |
MsG0180000065.01 | MsG0180002089.01 | 0.804998 | 1.650009e-49 | 8.631368e-47 |
MsG0180000145.01 | MsG0180002089.01 | 0.804554 | 2.042719e-49 | 1.056378e-46 |
MsG0180000335.01 | MsG0180002089.01 | 0.801221 | 9.974987e-49 | 4.737635e-46 |
MsG0180000470.01 | MsG0180002089.01 | 0.864287 | 1.355607e-64 | 4.233797e-61 |
MsG0180000650.01 | MsG0180002089.01 | 0.810282 | 1.245723e-50 | 7.477859e-48 |
MsG0180000828.01 | MsG0180002089.01 | 0.819688 | 1.018234e-52 | 7.890392e-50 |
MsG0180001342.01 | MsG0180002089.01 | 0.810334 | 1.213504e-50 | 7.294651e-48 |
MsG0180001410.01 | MsG0180002089.01 | 0.830231 | 3.298699e-55 | 3.454929e-52 |
MsG0180001892.01 | MsG0180002089.01 | 0.820002 | 8.632320e-53 | 6.748437e-50 |
MsG0180002089.01 | MsG0180002195.01 | 0.801617 | 8.273835e-49 | 3.969043e-46 |
MsG0180002089.01 | MsG0180002282.01 | 0.801552 | 8.531252e-49 | 4.085891e-46 |
MsG0180002089.01 | MsG0180003438.01 | 0.805860 | 1.088332e-49 | 5.820951e-47 |
MsG0180002089.01 | MsG0180003669.01 | 0.837596 | 4.734045e-57 | 6.179763e-54 |
MsG0180002089.01 | MsG0180004264.01 | 0.848949 | 4.421927e-60 | 8.250985e-57 |
MsG0180002089.01 | MsG0180004426.01 | 0.807548 | 4.790038e-50 | 2.675542e-47 |
MsG0180002089.01 | MsG0180004765.01 | 0.817026 | 4.081904e-52 | 2.939394e-49 |
MsG0180002089.01 | MsG0180005974.01 | 0.820466 | 6.756885e-53 | 5.350699e-50 |
MsG0180002089.01 | MsG0280006324.01 | 0.828788 | 7.399115e-55 | 7.429381e-52 |
MsG0180002089.01 | MsG0280006325.01 | 0.816635 | 4.996319e-52 | 3.559373e-49 |
MsG0180002089.01 | MsG0280006456.01 | 0.831840 | 1.328936e-55 | 1.459583e-52 |
MsG0180002089.01 | MsG0280006491.01 | 0.811729 | 6.053495e-51 | 3.776092e-48 |
MsG0180002089.01 | MsG0280007064.01 | 0.819676 | 1.025014e-52 | 7.940107e-50 |
MsG0180002089.01 | MsG0280007164.01 | 0.807678 | 4.495767e-50 | 2.519686e-47 |
MsG0180002089.01 | MsG0280007547.01 | 0.826430 | 2.724292e-54 | 2.554423e-51 |
MsG0180002089.01 | MsG0280007955.01 | 0.820389 | 7.039117e-53 | 5.562539e-50 |
MsG0180002089.01 | MsG0280008182.01 | 0.849072 | 4.087538e-60 | 7.658403e-57 |
MsG0180002089.01 | MsG0280008615.01 | 0.822657 | 2.106548e-53 | 1.774305e-50 |
MsG0180002089.01 | MsG0280008733.01 | 0.810666 | 1.029293e-50 | 6.242478e-48 |
MsG0180002089.01 | MsG0280009646.01 | 0.833655 | 4.707924e-56 | 5.456901e-53 |
MsG0180002089.01 | MsG0280010443.01 | 0.853205 | 2.786830e-61 | 5.974882e-58 |
MsG0180002089.01 | MsG0280010796.01 | 0.806363 | 8.530132e-50 | 4.620975e-47 |
MsG0180002089.01 | MsG0280011032.01 | 0.834446 | 2.982542e-56 | 3.540528e-53 |
MsG0180002089.01 | MsG0280011156.01 | 0.823732 | 1.182418e-53 | 1.026756e-50 |
MsG0180002089.01 | MsG0380011609.01 | 0.815104 | 1.096697e-51 | 7.491819e-49 |
MsG0180002089.01 | MsG0380011870.01 | 0.821465 | 3.978955e-53 | 3.239475e-50 |
MsG0180002089.01 | MsG0380012702.01 | 0.808607 | 2.849498e-50 | 1.636415e-47 |
MsG0180002089.01 | MsG0380013475.01 | 0.805832 | 1.103618e-49 | 5.898227e-47 |
MsG0180002089.01 | MsG0380014251.01 | 0.831718 | 1.424128e-55 | 1.558556e-52 |
MsG0180002089.01 | MsG0380014468.01 | 0.803155 | 3.990275e-49 | 1.990692e-46 |
MsG0180002089.01 | MsG0380014573.01 | 0.822491 | 2.302605e-53 | 1.930218e-50 |
MsG0180002089.01 | MsG0380014894.01 | 0.809846 | 1.546014e-50 | 9.175964e-48 |
MsG0180002089.01 | MsG0380015566.01 | 0.826303 | 2.921249e-54 | 2.729083e-51 |
MsG0180002089.01 | MsG0380015720.01 | 0.831872 | 1.304600e-55 | 1.434264e-52 |
MsG0180002089.01 | MsG0380016004.01 | 0.800769 | 1.233602e-48 | 5.792270e-46 |
MsG0180002089.01 | MsG0380016064.01 | 0.817339 | 3.470371e-52 | 2.520489e-49 |
MsG0180002089.01 | MsG0380016160.01 | -0.817560 | 3.095282e-52 | 2.261677e-49 |
MsG0180002089.01 | MsG0380016475.01 | 0.825375 | 4.850270e-54 | 4.412920e-51 |
MsG0180002089.01 | MsG0380016517.01 | 0.802613 | 5.163348e-49 | 2.540541e-46 |
MsG0180002089.01 | MsG0380016910.01 | 0.834195 | 3.449672e-56 | 4.063573e-53 |
MsG0180002089.01 | MsG0380017266.01 | -0.801994 | 6.924451e-49 | 3.353687e-46 |
MsG0180002089.01 | MsG0380017326.01 | 0.813041 | 3.128400e-51 | 2.021023e-48 |
MsG0180002089.01 | MsG0380017461.01 | 0.808044 | 3.756968e-50 | 2.125937e-47 |
MsG0180002089.01 | MsG0380017848.01 | 0.809908 | 1.499683e-50 | 8.915296e-48 |
MsG0180002089.01 | MsG0480018163.01 | 0.820475 | 6.724579e-53 | 5.326307e-50 |
MsG0180002089.01 | MsG0480018778.01 | 0.808794 | 2.599921e-50 | 1.500402e-47 |
MsG0180002089.01 | MsG0480018883.01 | 0.812729 | 3.661828e-51 | 2.346215e-48 |
MsG0180002089.01 | MsG0480018964.01 | 0.809951 | 1.467653e-50 | 8.734874e-48 |
MsG0180002089.01 | MsG0480019337.01 | 0.818212 | 2.205353e-52 | 1.640489e-49 |
MsG0180002089.01 | MsG0480019730.01 | 0.825161 | 5.451993e-54 | 4.930618e-51 |
MsG0180002089.01 | MsG0480019873.01 | 0.803369 | 3.602730e-49 | 1.807176e-46 |
MsG0180002089.01 | MsG0480021274.01 | 0.819380 | 1.197229e-52 | 9.197503e-50 |
MsG0180002089.01 | MsG0480021536.01 | 0.814590 | 1.426007e-51 | 9.607904e-49 |
MsG0180002089.01 | MsG0480021558.01 | 0.810786 | 9.691951e-51 | 5.896906e-48 |
MsG0180002089.01 | MsG0480021853.01 | 0.825400 | 4.786250e-54 | 4.357804e-51 |
MsG0180002089.01 | MsG0480021925.01 | 0.804142 | 2.489913e-49 | 1.274080e-46 |
MsG0180002089.01 | MsG0480022213.01 | -0.810465 | 1.137565e-50 | 6.861886e-48 |
MsG0180002089.01 | MsG0480022259.01 | 0.831089 | 2.033330e-55 | 2.183836e-52 |
MsG0180002089.01 | MsG0480022262.01 | 0.810649 | 1.037866e-50 | 6.291489e-48 |
MsG0180002089.01 | MsG0480022615.01 | -0.805924 | 1.055230e-49 | 5.652982e-47 |
MsG0180002089.01 | MsG0480023015.01 | 0.809174 | 2.155677e-50 | 1.256804e-47 |
MsG0180002089.01 | MsG0480023163.01 | 0.810289 | 1.241448e-50 | 7.453584e-48 |
MsG0180002089.01 | MsG0480023654.01 | 0.808437 | 3.098000e-50 | 1.771414e-47 |
MsG0180002089.01 | MsG0480024003.01 | 0.803141 | 4.016704e-49 | 2.003113e-46 |
MsG0180002089.01 | MsG0480024005.01 | 0.817822 | 2.702178e-52 | 1.988710e-49 |
MsG0180002089.01 | MsG0580024038.01 | 0.819339 | 1.223604e-52 | 9.389009e-50 |
MsG0180002089.01 | MsG0580024552.01 | 0.807879 | 4.074920e-50 | 2.295740e-47 |
MsG0180002089.01 | MsG0580024621.01 | 0.816835 | 4.504712e-52 | 3.226892e-49 |
MsG0180002089.01 | MsG0580024905.01 | 0.808590 | 2.873419e-50 | 1.649460e-47 |
MsG0180002089.01 | MsG0580025022.01 | 0.803298 | 3.726997e-49 | 1.866102e-46 |
MsG0180002089.01 | MsG0580025135.01 | 0.809568 | 1.774333e-50 | 1.045406e-47 |
MsG0180002089.01 | MsG0580025448.01 | 0.811343 | 7.342966e-51 | 4.533611e-48 |
MsG0180002089.01 | MsG0580025638.01 | 0.819769 | 9.759811e-53 | 7.580651e-50 |
MsG0180002089.01 | MsG0580025758.01 | 0.806646 | 7.435818e-50 | 4.057171e-47 |
MsG0180002089.01 | MsG0580026002.01 | 0.807330 | 5.329147e-50 | 2.959969e-47 |
MsG0180002089.01 | MsG0580026165.01 | 0.800177 | 1.628711e-48 | 7.533380e-46 |
MsG0180002089.01 | MsG0580026342.01 | 0.823568 | 1.291345e-53 | 1.115967e-50 |
MsG0180002089.01 | MsG0580027018.01 | 0.831520 | 1.593018e-55 | 1.732994e-52 |
MsG0180002089.01 | MsG0580027650.01 | 0.800491 | 1.405834e-48 | 6.554762e-46 |
MsG0180002089.01 | MsG0580027679.01 | 0.816776 | 4.644228e-52 | 3.321450e-49 |
MsG0180002089.01 | MsG0580027687.01 | 0.836524 | 8.899362e-57 | 1.124313e-53 |
MsG0180002089.01 | MsG0580027688.01 | 0.840806 | 6.965037e-58 | 1.003576e-54 |
MsG0180002089.01 | MsG0580027745.01 | 0.803245 | 3.821296e-49 | 1.910798e-46 |
MsG0180002089.01 | MsG0580027766.01 | 0.801652 | 8.139082e-49 | 3.907878e-46 |
MsG0180002089.01 | MsG0580027833.01 | 0.801587 | 8.393289e-49 | 4.023240e-46 |
MsG0180002089.01 | MsG0580027922.01 | 0.851381 | 9.209777e-61 | 1.860802e-57 |
MsG0180002089.01 | MsG0580027947.01 | 0.803357 | 3.622618e-49 | 1.816605e-46 |
MsG0180002089.01 | MsG0580028527.01 | 0.822219 | 2.663256e-53 | 2.215176e-50 |
MsG0180002089.01 | MsG0580028634.01 | 0.804769 | 1.842803e-49 | 9.583358e-47 |
MsG0180002089.01 | MsG0580028990.01 | 0.837709 | 4.430368e-57 | 5.803708e-54 |
MsG0180002089.01 | MsG0580029204.01 | 0.824237 | 8.997396e-54 | 7.923834e-51 |
MsG0180002089.01 | MsG0580029500.01 | -0.811997 | 5.289928e-51 | 3.323524e-48 |
MsG0180002089.01 | MsG0580029554.01 | 0.833319 | 5.709642e-56 | 6.552448e-53 |
MsG0180002089.01 | MsG0680030316.01 | 0.807840 | 4.152677e-50 | 2.337260e-47 |
MsG0180002089.01 | MsG0680030366.01 | 0.834481 | 2.923886e-56 | 3.474405e-53 |
MsG0180002089.01 | MsG0680030667.01 | 0.841315 | 5.120933e-58 | 7.494803e-55 |
MsG0180002089.01 | MsG0680030882.01 | 0.825600 | 4.291095e-54 | 3.929451e-51 |
MsG0180002089.01 | MsG0680031210.01 | 0.808743 | 2.665992e-50 | 1.536473e-47 |
MsG0180002089.01 | MsG0680031379.01 | 0.811760 | 5.957785e-51 | 3.719407e-48 |
MsG0180002089.01 | MsG0680031505.01 | 0.807545 | 4.797017e-50 | 2.679278e-47 |
MsG0180002089.01 | MsG0680032158.01 | 0.810614 | 1.056202e-50 | 6.396603e-48 |
MsG0180002089.01 | MsG0680032801.01 | 0.848875 | 4.636276e-60 | 8.630455e-57 |
MsG0180002089.01 | MsG0680032844.01 | 0.836366 | 9.762533e-57 | 1.227671e-53 |
MsG0180002089.01 | MsG0680032996.01 | 0.803252 | 3.809728e-49 | 1.905325e-46 |
MsG0180002089.01 | MsG0680033228.01 | 0.818181 | 2.241011e-52 | 1.665647e-49 |
MsG0180002089.01 | MsG0680033379.01 | 0.843718 | 1.179076e-58 | 1.861057e-55 |
MsG0180002089.01 | MsG0680033412.01 | 0.807045 | 6.123354e-50 | 3.375894e-47 |
MsG0180002089.01 | MsG0680033792.01 | 0.832458 | 9.343512e-56 | 1.044958e-52 |
MsG0180002089.01 | MsG0680034464.01 | 0.830719 | 2.506304e-55 | 2.662631e-52 |
MsG0180002089.01 | MsG0680034466.01 | 0.809050 | 2.291648e-50 | 1.331616e-47 |
MsG0180002089.01 | MsG0680034565.01 | 0.811689 | 6.175172e-51 | 3.847693e-48 |
MsG0180002089.01 | MsG0680035444.01 | 0.841538 | 4.472858e-58 | 6.592787e-55 |
MsG0180002089.01 | MsG0680035455.01 | 0.801605 | 8.320486e-49 | 3.990186e-46 |
MsG0180002089.01 | MsG0680035475.01 | 0.810590 | 1.068919e-50 | 6.469414e-48 |
MsG0180002089.01 | MsG0680035573.01 | 0.806021 | 1.006727e-49 | 5.406732e-47 |
MsG0180002089.01 | MsG0680035692.01 | 0.829917 | 3.935598e-55 | 4.084794e-52 |
MsG0180002089.01 | MsG0680035828.01 | 0.806264 | 8.952327e-50 | 4.837712e-47 |
MsG0180002089.01 | MsG0780035948.01 | 0.823477 | 1.356352e-53 | 1.169131e-50 |
MsG0180002089.01 | MsG0780036477.01 | 0.817240 | 3.654389e-52 | 2.646844e-49 |
MsG0180002089.01 | MsG0780036498.01 | 0.829428 | 5.177098e-55 | 5.297104e-52 |
MsG0180002089.01 | MsG0780037054.01 | 0.818887 | 1.550244e-52 | 1.174962e-49 |
MsG0180002089.01 | MsG0780037457.01 | 0.826385 | 2.793547e-54 | 2.615958e-51 |
MsG0180002089.01 | MsG0780038401.01 | 0.812634 | 3.841649e-51 | 2.455275e-48 |
MsG0180002089.01 | MsG0780038827.01 | 0.802737 | 4.867377e-49 | 2.402594e-46 |
MsG0180002089.01 | MsG0780039829.01 | 0.803754 | 2.997597e-49 | 1.518666e-46 |
MsG0180002089.01 | MsG0780039867.01 | -0.819298 | 1.249948e-52 | 9.580565e-50 |
MsG0180002089.01 | MsG0780040057.01 | 0.813603 | 2.354508e-51 | 1.544522e-48 |
MsG0180002089.01 | MsG0780040576.01 | -0.819822 | 9.488727e-53 | 7.380821e-50 |
MsG0180002089.01 | MsG0780040596.01 | 0.841143 | 5.679783e-58 | 8.269206e-55 |
MsG0180002089.01 | MsG0780040704.01 | 0.823175 | 1.595362e-53 | 1.363512e-50 |
MsG0180002089.01 | MsG0880041836.01 | 0.826194 | 3.100335e-54 | 2.887507e-51 |
MsG0180002089.01 | MsG0880042161.01 | 0.818230 | 2.184324e-52 | 1.625615e-49 |
MsG0180002089.01 | MsG0880042232.01 | 0.813811 | 2.119228e-51 | 1.398037e-48 |
MsG0180002089.01 | MsG0880042294.01 | 0.806168 | 9.378887e-50 | 5.055808e-47 |
MsG0180002089.01 | MsG0880042404.01 | 0.801010 | 1.101621e-48 | 5.204826e-46 |
MsG0180002089.01 | MsG0880042454.01 | 0.823065 | 1.692942e-53 | 1.442476e-50 |
MsG0180002089.01 | MsG0880042800.01 | 0.858405 | 8.426449e-63 | 2.148245e-59 |
MsG0180002089.01 | MsG0880042886.01 | 0.822858 | 1.891617e-53 | 1.602329e-50 |
MsG0180002089.01 | MsG0880042966.01 | 0.843115 | 1.708481e-58 | 2.645742e-55 |
MsG0180002089.01 | MsG0880044323.01 | 0.824530 | 7.679748e-54 | 6.820663e-51 |
MsG0180002089.01 | MsG0880044415.01 | 0.825695 | 4.075028e-54 | 3.741642e-51 |
MsG0180002089.01 | MsG0880044416.01 | 0.821308 | 4.325343e-53 | 3.506274e-50 |
MsG0180002089.01 | MsG0880044542.01 | 0.814269 | 1.679191e-51 | 1.121590e-48 |
MsG0180002089.01 | MsG0880044554.01 | 0.814714 | 1.338620e-51 | 9.049242e-49 |
MsG0180002089.01 | MsG0880044574.01 | 0.848830 | 4.772980e-60 | 8.871618e-57 |
MsG0180002089.01 | MsG0880045362.01 | 0.804556 | 2.041205e-49 | 1.055640e-46 |
MsG0180002089.01 | MsG0880045765.01 | 0.804340 | 2.264564e-49 | 1.164668e-46 |
MsG0180002089.01 | MsG0880046457.01 | 0.802832 | 4.652632e-49 | 2.302230e-46 |
MsG0180002089.01 | MsG0880046581.01 | 0.838442 | 2.868930e-57 | 3.843242e-54 |
MsG0180002089.01 | MsG0880046620.01 | 0.800549 | 1.367903e-48 | 6.387247e-46 |
MsG0180002089.01 | MsG0880046645.01 | 0.803293 | 3.735260e-49 | 1.870044e-46 |
MsG0180002089.01 | MsG0880046803.01 | 0.810295 | 1.237273e-50 | 7.429795e-48 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0180002089.01.T01 | MTR_2g021870 | 92.157 | 51 | 4 | 0 | 1 | 51 | 27 | 77 | 1.97e-28 | 97.1 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Find 10 sgRNAs with CRISPR-Local
Find 14 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
AATAATGAAGATAATGAAAA+TGG | 0.293353 | 1:-32659363 | MsG0180002089.01.T01:CDS |
TCATTATCTTCATTATTGAT+TGG | 0.384406 | 1:+32659369 | None:intergenic |
CTTCATTATTGATTGGACTA+GGG | 0.456427 | 1:+32659376 | None:intergenic |
TCTTCATTATTGATTGGACT+AGG | 0.459814 | 1:+32659375 | None:intergenic |
GATAATACAAGCTGCTAGAC+AGG | 0.497499 | 1:-32659640 | MsG0180002089.01.T01:intron |
TTCATTATTGATTGGACTAG+GGG | 0.510352 | 1:+32659377 | None:intergenic |
TTGGACTAGGGGAATTCAAA+GGG | 0.520133 | 1:+32659388 | None:intergenic |
ATTGGACTAGGGGAATTCAA+AGG | 0.524515 | 1:+32659387 | None:intergenic |
CTAGGGGAATTCAAAGGGTT+AGG | 0.527124 | 1:+32659393 | None:intergenic |
GATAGAGTTAAGACTATGGA+GGG | 0.632932 | 1:-32659723 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!! | AATAATGAAGATAATGAAAA+TGG | - | Chr1:32659659-32659678 | MsG0180002089.01.T01:CDS | 15.0% |
!! | TCATTATCTTCATTATTGAT+TGG | + | Chr1:32659656-32659675 | None:intergenic | 20.0% |
!!! | TTTTTGATTTTCTGTGATAT+AGG | - | Chr1:32659586-32659605 | MsG0180002089.01.T01:intron | 20.0% |
!!! | AAATCAAGAGTATTGCTAAA+TGG | + | Chr1:32659545-32659564 | None:intergenic | 25.0% |
!!! | TTCATTGATTTAAGAGAACA+TGG | - | Chr1:32659447-32659466 | MsG0180002089.01.T01:intron | 25.0% |
! | CTTCATTATTGATTGGACTA+GGG | + | Chr1:32659649-32659668 | None:intergenic | 30.0% |
! | TCTTCATTATTGATTGGACT+AGG | + | Chr1:32659650-32659669 | None:intergenic | 30.0% |
! | TTCATTATTGATTGGACTAG+GGG | + | Chr1:32659648-32659667 | None:intergenic | 30.0% |
!! | TTGATTCAAAGTCGATTTTC+TGG | - | Chr1:32659344-32659363 | MsG0180002089.01.T01:CDS | 30.0% |
GATAATACAAGCTGCTAGAC+AGG | - | Chr1:32659382-32659401 | MsG0180002089.01.T01:CDS | 40.0% | |
GTTTGAGTCACACAATTCGT+TGG | - | Chr1:32659513-32659532 | MsG0180002089.01.T01:intron | 40.0% | |
! | ATTGGACTAGGGGAATTCAA+AGG | + | Chr1:32659638-32659657 | None:intergenic | 40.0% |
! | TTGGACTAGGGGAATTCAAA+GGG | + | Chr1:32659637-32659656 | None:intergenic | 40.0% |
CTAGGGGAATTCAAAGGGTT+AGG | + | Chr1:32659632-32659651 | None:intergenic | 45.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr1 | gene | 32659314 | 32659730 | 32659314 | ID=MsG0180002089.01;Name=MsG0180002089.01 |
Chr1 | mRNA | 32659314 | 32659730 | 32659314 | ID=MsG0180002089.01.T01;Parent=MsG0180002089.01;Name=MsG0180002089.01.T01;_AED=0.50;_eAED=0.61;_QI=0|0|0|1|1|0.5|2|0|70 |
Chr1 | exon | 32659641 | 32659730 | 32659641 | ID=MsG0180002089.01.T01:exon:36603;Parent=MsG0180002089.01.T01 |
Chr1 | exon | 32659314 | 32659436 | 32659314 | ID=MsG0180002089.01.T01:exon:36604;Parent=MsG0180002089.01.T01 |
Chr1 | CDS | 32659641 | 32659730 | 32659641 | ID=MsG0180002089.01.T01:cds;Parent=MsG0180002089.01.T01 |
Chr1 | CDS | 32659314 | 32659436 | 32659314 | ID=MsG0180002089.01.T01:cds;Parent=MsG0180002089.01.T01 |
Gene Sequence |
Protein sequence |