Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080047869.01.T01 | XP_003606271.2 | 66.2 | 429 | 53 | 8 | 1 | 363 | 218 | 620 | 3.10E-178 | 519 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080047869.01.T01 | Q7DMA9 | 41.725 | 429 | 156 | 9 | 1 | 363 | 215 | 615 | 6.39E-94 | 296 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080047869.01.T01 | G7JM35 | 66.200 | 429 | 53 | 8 | 1 | 363 | 218 | 620 | 1.48e-178 | 519 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080047869.01 | MsG0080047944.01 | 0.832460 | 9.333715e-56 | 1.043938e-52 |
MsG0080047869.01 | MsG0080047957.01 | 0.828561 | 8.393825e-55 | 8.373213e-52 |
MsG0080047869.01 | MsG0080047959.01 | 0.839560 | 1.472563e-57 | 2.041048e-54 |
MsG0080047869.01 | MsG0080047962.01 | 0.816624 | 5.025448e-52 | 3.579052e-49 |
MsG0080047869.01 | MsG0080048113.01 | 0.810303 | 1.232895e-50 | 7.404882e-48 |
MsG0080047869.01 | MsG0080048404.01 | 0.816361 | 5.752978e-52 | 4.068001e-49 |
MsG0080047869.01 | MsG0080048431.01 | 0.801669 | 8.074869e-49 | 3.878750e-46 |
MsG0080047869.01 | MsG0080048461.01 | 0.836668 | 8.178258e-57 | 1.037697e-53 |
MsG0080047869.01 | MsG0080048462.01 | 0.840973 | 6.296448e-58 | 9.118738e-55 |
MsG0080047869.01 | MsG0080048618.01 | 0.838682 | 2.487466e-57 | 3.356632e-54 |
MsG0080047869.01 | MsG0080048764.01 | 0.825083 | 5.687417e-54 | 5.132181e-51 |
MsG0080047869.01 | MsG0080048804.01 | 0.826382 | 2.796763e-54 | 2.618811e-51 |
MsG0080047869.01 | MsG0080048856.01 | 0.834103 | 3.636515e-56 | 4.272415e-53 |
MsG0080047869.01 | MsG0080048874.01 | 0.852674 | 3.953368e-61 | 8.323759e-58 |
MsG0080047869.01 | MsG0080048964.01 | 0.833351 | 5.605568e-56 | 6.439166e-53 |
MsG0080047869.01 | MsG0080049032.01 | 0.804588 | 2.009860e-49 | 1.040305e-46 |
MsG0080047869.01 | MsG0080049058.01 | 0.807140 | 5.846152e-50 | 3.230973e-47 |
MsG0080047869.01 | MsG0180000065.01 | 0.849486 | 3.135734e-60 | 5.953501e-57 |
MsG0080047869.01 | MsG0180000139.01 | 0.805707 | 1.172413e-49 | 6.246133e-47 |
MsG0080047869.01 | MsG0180000145.01 | 0.835398 | 1.717667e-56 | 2.098071e-53 |
MsG0080047869.01 | MsG0180000154.01 | 0.802245 | 6.147921e-49 | 2.996834e-46 |
MsG0080047869.01 | MsG0180000178.01 | 0.817277 | 3.584704e-52 | 2.598966e-49 |
MsG0080047869.01 | MsG0180000195.01 | 0.820380 | 7.070986e-53 | 5.586391e-50 |
MsG0080047869.01 | MsG0180000209.01 | 0.803518 | 3.354965e-49 | 1.689473e-46 |
MsG0080047869.01 | MsG0180000334.01 | 0.817749 | 2.806022e-52 | 2.061081e-49 |
MsG0080047869.01 | MsG0180000335.01 | 0.838825 | 2.284080e-57 | 3.095648e-54 |
MsG0080047869.01 | MsG0180000470.01 | 0.875768 | 2.374603e-68 | 1.122529e-64 |
MsG0080047869.01 | MsG0180000503.01 | 0.809116 | 2.218138e-50 | 1.291226e-47 |
MsG0080047869.01 | MsG0180000550.01 | 0.849980 | 2.281699e-60 | 4.402832e-57 |
MsG0080047869.01 | MsG0180000607.01 | 0.805166 | 1.522276e-49 | 7.997492e-47 |
MsG0080047869.01 | MsG0180000679.01 | 0.819846 | 9.370003e-53 | 7.293236e-50 |
MsG0080047869.01 | MsG0180000702.01 | 0.804024 | 2.633898e-49 | 1.343727e-46 |
MsG0080047869.01 | MsG0180000703.01 | 0.808660 | 2.776462e-50 | 1.596687e-47 |
MsG0080047869.01 | MsG0180000822.01 | 0.809725 | 1.641955e-50 | 9.714495e-48 |
MsG0080047869.01 | MsG0180000828.01 | 0.835374 | 1.741217e-56 | 2.125290e-53 |
MsG0080047869.01 | MsG0180001006.01 | 0.808676 | 2.755428e-50 | 1.585236e-47 |
MsG0080047869.01 | MsG0180001023.01 | 0.807817 | 4.199391e-50 | 2.362168e-47 |
MsG0080047869.01 | MsG0180001063.01 | 0.847291 | 1.268864e-59 | 2.244512e-56 |
MsG0080047869.01 | MsG0180001141.01 | 0.830496 | 2.842329e-55 | 2.999538e-52 |
MsG0080047869.01 | MsG0180001471.01 | 0.803384 | 3.576748e-49 | 1.794866e-46 |
MsG0080047869.01 | MsG0180001663.01 | 0.826950 | 2.047357e-54 | 1.948581e-51 |
MsG0080047869.01 | MsG0180001884.01 | 0.805985 | 1.024675e-49 | 5.498027e-47 |
MsG0080047869.01 | MsG0180001892.01 | 0.806873 | 6.656550e-50 | 3.653627e-47 |
MsG0080047869.01 | MsG0180001971.01 | 0.808195 | 3.488836e-50 | 1.982224e-47 |
MsG0080047869.01 | MsG0180002071.01 | 0.800608 | 1.330958e-48 | 6.224003e-46 |
MsG0080047869.01 | MsG0180002089.01 | 0.837108 | 6.312756e-57 | 8.117548e-54 |
MsG0080047869.01 | MsG0180002195.01 | 0.820689 | 6.005683e-53 | 4.784959e-50 |
MsG0080047869.01 | MsG0180002282.01 | 0.849277 | 3.584365e-60 | 6.760243e-57 |
MsG0080047869.01 | MsG0180002459.01 | 0.814175 | 1.761286e-51 | 1.173392e-48 |
MsG0080047869.01 | MsG0180002482.01 | 0.836031 | 1.187616e-56 | 1.478358e-53 |
MsG0080047869.01 | MsG0180002563.01 | 0.807720 | 4.402943e-50 | 2.470462e-47 |
MsG0080047869.01 | MsG0180002842.01 | 0.814022 | 1.903803e-51 | 1.263102e-48 |
MsG0080047869.01 | MsG0180002895.01 | 0.808065 | 3.718986e-50 | 2.105631e-47 |
MsG0080047869.01 | MsG0180002952.01 | 0.828056 | 1.111187e-54 | 1.092294e-51 |
MsG0080047869.01 | MsG0180003188.01 | 0.804162 | 2.465810e-49 | 1.262397e-46 |
MsG0080047869.01 | MsG0180003455.01 | 0.809569 | 1.773805e-50 | 1.045107e-47 |
MsG0080047869.01 | MsG0180003573.01 | 0.821473 | 3.963271e-53 | 3.227408e-50 |
MsG0080047869.01 | MsG0180003669.01 | 0.875565 | 2.786908e-68 | 1.307525e-64 |
MsG0080047869.01 | MsG0180003671.01 | 0.823712 | 1.194809e-53 | 1.036942e-50 |
MsG0080047869.01 | MsG0180003673.01 | 0.846885 | 1.639548e-59 | 2.862709e-56 |
MsG0080047869.01 | MsG0180003686.01 | 0.846613 | 1.945785e-59 | 3.368177e-56 |
MsG0080047869.01 | MsG0180003773.01 | 0.808790 | 2.604149e-50 | 1.502699e-47 |
MsG0080047869.01 | MsG0180003810.01 | 0.800460 | 1.426264e-48 | 6.644651e-46 |
MsG0080047869.01 | MsG0180003854.01 | 0.810167 | 1.319034e-50 | 7.894402e-48 |
MsG0080047869.01 | MsG0180003864.01 | 0.824215 | 9.107997e-54 | 8.016223e-51 |
MsG0080047869.01 | MsG0180003952.01 | 0.848828 | 4.779543e-60 | 8.883063e-57 |
MsG0080047869.01 | MsG0180004157.01 | 0.816538 | 5.253154e-52 | 3.732369e-49 |
MsG0080047869.01 | MsG0180004264.01 | 0.879511 | 1.174166e-69 | 6.382678e-66 |
MsG0080047869.01 | MsG0180004275.01 | 0.805968 | 1.033121e-49 | 5.540829e-47 |
MsG0080047869.01 | MsG0180004295.01 | 0.832347 | 9.955615e-56 | 1.109670e-52 |
MsG0080047869.01 | MsG0180004320.01 | 0.807702 | 4.443435e-50 | 2.491911e-47 |
MsG0080047869.01 | MsG0180004331.01 | 0.811155 | 8.066129e-51 | 4.955718e-48 |
MsG0080047869.01 | MsG0180004388.01 | 0.848079 | 7.702872e-60 | 1.397055e-56 |
MsG0080047869.01 | MsG0180004389.01 | 0.838711 | 2.444573e-57 | 3.301983e-54 |
MsG0080047869.01 | MsG0180004426.01 | 0.867709 | 1.120294e-65 | 3.948807e-62 |
MsG0080047869.01 | MsG0180004463.01 | 0.847823 | 9.063973e-60 | 1.630919e-56 |
MsG0080047869.01 | MsG0180004465.01 | 0.815771 | 7.795016e-52 | 5.423908e-49 |
MsG0080047869.01 | MsG0180004765.01 | 0.809868 | 1.529777e-50 | 9.084611e-48 |
MsG0080047869.01 | MsG0180004779.01 | 0.807719 | 4.406759e-50 | 2.472485e-47 |
MsG0080047869.01 | MsG0180004789.01 | 0.803353 | 3.629783e-49 | 1.819985e-46 |
MsG0080047869.01 | MsG0180004802.01 | 0.806333 | 8.656033e-50 | 4.685672e-47 |
MsG0080047869.01 | MsG0180004926.01 | 0.809456 | 1.875433e-50 | 1.101642e-47 |
MsG0080047869.01 | MsG0180004996.01 | 0.807284 | 5.450572e-50 | 3.023800e-47 |
MsG0080047869.01 | MsG0180005050.01 | 0.851435 | 8.892590e-61 | 1.799824e-57 |
MsG0080047869.01 | MsG0180005185.01 | 0.818412 | 1.987185e-52 | 1.486543e-49 |
MsG0080047869.01 | MsG0180005250.01 | 0.835565 | 1.557990e-56 | 1.912377e-53 |
MsG0080047869.01 | MsG0180005371.01 | 0.824009 | 1.017960e-53 | 8.906824e-51 |
MsG0080047869.01 | MsG0180005393.01 | 0.808852 | 2.526763e-50 | 1.460431e-47 |
MsG0080047869.01 | MsG0180005664.01 | 0.835664 | 1.471371e-56 | 1.811426e-53 |
MsG0080047869.01 | MsG0180005705.01 | 0.812881 | 3.391004e-51 | 2.181349e-48 |
MsG0080047869.01 | MsG0180005708.01 | 0.811601 | 6.452491e-51 | 4.011157e-48 |
MsG0080047869.01 | MsG0180005842.01 | 0.851026 | 1.159960e-60 | 2.316545e-57 |
MsG0080047869.01 | MsG0180005860.01 | 0.860082 | 2.645813e-63 | 7.145623e-60 |
MsG0080047869.01 | MsG0180005872.01 | 0.818384 | 2.016117e-52 | 1.507013e-49 |
MsG0080047869.01 | MsG0180005954.01 | 0.832164 | 1.105012e-55 | 1.225022e-52 |
MsG0080047869.01 | MsG0180005993.01 | 0.834798 | 2.433853e-56 | 2.919304e-53 |
MsG0080047869.01 | MsG0180006016.01 | 0.820006 | 8.613634e-53 | 6.734712e-50 |
MsG0080047869.01 | MsG0180006257.01 | 0.830588 | 2.698019e-55 | 2.855051e-52 |
MsG0080047869.01 | MsG0180006261.01 | 0.841453 | 4.707358e-58 | 6.920650e-55 |
MsG0080047869.01 | MsG0280006299.01 | 0.871682 | 5.674335e-67 | 2.309341e-63 |
MsG0080047869.01 | MsG0280006321.01 | 0.823644 | 1.239951e-53 | 1.073912e-50 |
MsG0080047869.01 | MsG0280006324.01 | 0.843644 | 1.234477e-58 | 1.944195e-55 |
MsG0080047869.01 | MsG0280006325.01 | 0.809281 | 2.044702e-50 | 1.195515e-47 |
MsG0080047869.01 | MsG0280006356.01 | 0.800514 | 1.390478e-48 | 6.486983e-46 |
MsG0080047869.01 | MsG0280006375.01 | 0.853545 | 2.226056e-61 | 4.827191e-58 |
MsG0080047869.01 | MsG0280006407.01 | 0.821293 | 4.359880e-53 | 3.532728e-50 |
MsG0080047869.01 | MsG0280006456.01 | 0.812582 | 3.942602e-51 | 2.516349e-48 |
MsG0080047869.01 | MsG0280006491.01 | 0.813593 | 2.366126e-51 | 1.551754e-48 |
MsG0080047869.01 | MsG0280006712.01 | 0.801164 | 1.024296e-48 | 4.858133e-46 |
MsG0080047869.01 | MsG0280006770.01 | 0.803860 | 2.850035e-49 | 1.447846e-46 |
MsG0080047869.01 | MsG0280006933.01 | 0.804704 | 1.900898e-49 | 9.868822e-47 |
MsG0080047869.01 | MsG0280007023.01 | 0.803741 | 3.015674e-49 | 1.527329e-46 |
MsG0080047869.01 | MsG0280007058.01 | -0.804757 | 1.853272e-49 | 9.634964e-47 |
MsG0080047869.01 | MsG0280007064.01 | 0.823731 | 1.182840e-53 | 1.027099e-50 |
MsG0080047869.01 | MsG0280007066.01 | 0.805326 | 1.409266e-49 | 7.434241e-47 |
MsG0080047869.01 | MsG0280007072.01 | 0.800113 | 1.678128e-48 | 7.749544e-46 |
MsG0080047869.01 | MsG0280007088.01 | 0.857377 | 1.701198e-62 | 4.190187e-59 |
MsG0080047869.01 | MsG0280007164.01 | 0.829832 | 4.129021e-55 | 4.275555e-52 |
MsG0080047869.01 | MsG0280007335.01 | 0.803824 | 2.899251e-49 | 1.471471e-46 |
MsG0080047869.01 | MsG0280007529.01 | 0.837457 | 5.140674e-57 | 6.681640e-54 |
MsG0080047869.01 | MsG0280007547.01 | 0.830084 | 3.583881e-55 | 3.737192e-52 |
MsG0080047869.01 | MsG0280007564.01 | 0.810299 | 1.234864e-50 | 7.416108e-48 |
MsG0080047869.01 | MsG0280007609.01 | 0.811316 | 7.442065e-51 | 4.591656e-48 |
MsG0080047869.01 | MsG0280007727.01 | 0.823435 | 1.387180e-53 | 1.194254e-50 |
MsG0080047869.01 | MsG0280007815.01 | 0.836293 | 1.018873e-56 | 1.278601e-53 |
MsG0080047869.01 | MsG0280007955.01 | 0.826763 | 2.269086e-54 | 2.147777e-51 |
MsG0080047869.01 | MsG0280008112.01 | 0.806321 | 8.705422e-50 | 4.711008e-47 |
MsG0080047869.01 | MsG0280008130.01 | 0.823256 | 1.527802e-53 | 1.308702e-50 |
MsG0080047869.01 | MsG0280008378.01 | 0.818892 | 1.545928e-52 | 1.171868e-49 |
MsG0080047869.01 | MsG0280008556.01 | 0.808987 | 2.363921e-50 | 1.371255e-47 |
MsG0080047869.01 | MsG0280008615.01 | 0.868690 | 5.412844e-66 | 1.976167e-62 |
MsG0080047869.01 | MsG0280008894.01 | 0.818883 | 1.553771e-52 | 1.177492e-49 |
MsG0080047869.01 | MsG0280008970.01 | 0.808921 | 2.442216e-50 | 1.414159e-47 |
MsG0080047869.01 | MsG0280008971.01 | 0.839822 | 1.259173e-57 | 1.759581e-54 |
MsG0080047869.01 | MsG0280009024.01 | 0.849364 | 3.391464e-60 | 6.414542e-57 |
MsG0080047869.01 | MsG0280009109.01 | 0.812614 | 3.879499e-51 | 2.478170e-48 |
MsG0080047869.01 | MsG0280009140.01 | 0.821464 | 3.981893e-53 | 3.241746e-50 |
MsG0080047869.01 | MsG0280009514.01 | 0.814265 | 1.682530e-51 | 1.123681e-48 |
MsG0080047869.01 | MsG0280009646.01 | 0.820295 | 7.397114e-53 | 5.829752e-50 |
MsG0080047869.01 | MsG0280009748.01 | 0.841818 | 3.772481e-58 | 5.609085e-55 |
MsG0080047869.01 | MsG0280009794.01 | 0.806251 | 9.008777e-50 | 4.866629e-47 |
MsG0080047869.01 | MsG0280009986.01 | 0.805453 | 1.324951e-49 | 7.012606e-47 |
MsG0080047869.01 | MsG0280010389.01 | 0.845339 | 4.319656e-59 | 7.176212e-56 |
MsG0080047869.01 | MsG0280010443.01 | 0.877426 | 6.344672e-69 | 3.189236e-65 |
MsG0080047869.01 | MsG0280010447.01 | 0.800570 | 1.354778e-48 | 6.329251e-46 |
MsG0080047869.01 | MsG0280010491.01 | 0.844412 | 7.681007e-59 | 1.238993e-55 |
MsG0080047869.01 | MsG0280010551.01 | 0.806894 | 6.590777e-50 | 3.619393e-47 |
MsG0080047869.01 | MsG0280010614.01 | 0.827076 | 1.909766e-54 | 1.824375e-51 |
MsG0080047869.01 | MsG0280010698.01 | 0.859209 | 4.846898e-63 | 1.270020e-59 |
MsG0080047869.01 | MsG0280010722.01 | 0.834355 | 3.144531e-56 | 3.722552e-53 |
MsG0080047869.01 | MsG0280010778.01 | 0.811968 | 5.369828e-51 | 3.370975e-48 |
MsG0080047869.01 | MsG0280010980.01 | 0.821652 | 3.602355e-53 | 2.948408e-50 |
MsG0080047869.01 | MsG0280011003.01 | 0.804793 | 1.821556e-49 | 9.478746e-47 |
MsG0080047869.01 | MsG0280011013.01 | 0.802354 | 5.836774e-49 | 2.853192e-46 |
MsG0080047869.01 | MsG0280011014.01 | 0.806583 | 7.667862e-50 | 4.177219e-47 |
MsG0080047869.01 | MsG0280011032.01 | 0.859339 | 4.430604e-63 | 1.166203e-59 |
MsG0080047869.01 | MsG0280011052.01 | 0.809567 | 1.775687e-50 | 1.046165e-47 |
MsG0080047869.01 | MsG0280011070.01 | 0.821732 | 3.452317e-53 | 2.831962e-50 |
MsG0080047869.01 | MsG0280011086.01 | 0.862888 | 3.682617e-64 | 1.095624e-60 |
MsG0080047869.01 | MsG0280011141.01 | 0.801887 | 7.284665e-49 | 3.518769e-46 |
MsG0080047869.01 | MsG0280011156.01 | 0.866473 | 2.778832e-65 | 9.376900e-62 |
MsG0080047869.01 | MsG0280011175.01 | 0.814893 | 1.221411e-51 | 8.296459e-49 |
MsG0080047869.01 | MsG0280011282.01 | 0.814002 | 1.923001e-51 | 1.275135e-48 |
MsG0080047869.01 | MsG0280011446.01 | 0.873378 | 1.540575e-67 | 6.671074e-64 |
MsG0080047869.01 | MsG0280011472.01 | 0.826847 | 2.167386e-54 | 2.056496e-51 |
MsG0080047869.01 | MsG0380011494.01 | 0.854863 | 9.272946e-62 | 2.100389e-58 |
MsG0080047869.01 | MsG0380011609.01 | 0.863122 | 3.118214e-64 | 9.350152e-61 |
MsG0080047869.01 | MsG0380011617.01 | 0.801183 | 1.015627e-48 | 4.819145e-46 |
MsG0080047869.01 | MsG0380011755.01 | 0.816263 | 6.051805e-52 | 4.267967e-49 |
MsG0080047869.01 | MsG0380011985.01 | 0.834253 | 3.335999e-56 | 3.937128e-53 |
MsG0080047869.01 | MsG0380012009.01 | 0.824485 | 7.867552e-54 | 6.978105e-51 |
MsG0080047869.01 | MsG0380012330.01 | 0.822868 | 1.881572e-53 | 1.594285e-50 |
MsG0080047869.01 | MsG0380012403.01 | 0.815911 | 7.251552e-52 | 5.064542e-49 |
MsG0080047869.01 | MsG0380012460.01 | 0.833229 | 6.012588e-56 | 6.881132e-53 |
MsG0080047869.01 | MsG0380012471.01 | 0.844147 | 9.049876e-59 | 1.447831e-55 |
MsG0080047869.01 | MsG0380012702.01 | 0.800357 | 1.496996e-48 | 6.956258e-46 |
MsG0080047869.01 | MsG0380013178.01 | 0.812760 | 3.604177e-51 | 2.311093e-48 |
MsG0080047869.01 | MsG0380013363.01 | 0.818268 | 2.142098e-52 | 1.595851e-49 |
MsG0080047869.01 | MsG0380013404.01 | 0.800572 | 1.353197e-48 | 6.322341e-46 |
MsG0080047869.01 | MsG0380013475.01 | 0.830287 | 3.197324e-55 | 3.353879e-52 |
MsG0080047869.01 | MsG0380013549.01 | 0.815719 | 8.002213e-52 | 5.560146e-49 |
MsG0080047869.01 | MsG0380013834.01 | 0.850114 | 2.092695e-60 | 4.055773e-57 |
MsG0080047869.01 | MsG0380014118.01 | 0.803340 | 3.653306e-49 | 1.831181e-46 |
MsG0080047869.01 | MsG0380014135.01 | 0.808910 | 2.454992e-50 | 1.421153e-47 |
MsG0080047869.01 | MsG0380014139.01 | 0.847959 | 8.310145e-60 | 1.501743e-56 |
MsG0080047869.01 | MsG0380014173.01 | 0.848669 | 5.288773e-60 | 9.778944e-57 |
MsG0080047869.01 | MsG0380014251.01 | 0.848670 | 5.286745e-60 | 9.775354e-57 |
MsG0080047869.01 | MsG0380014365.01 | 0.804377 | 2.224752e-49 | 1.145291e-46 |
MsG0080047869.01 | MsG0380014537.01 | 0.858343 | 8.793665e-63 | 2.237056e-59 |
MsG0080047869.01 | MsG0380014573.01 | 0.865773 | 4.630179e-65 | 1.524520e-61 |
MsG0080047869.01 | MsG0380014647.01 | 0.818736 | 1.677911e-52 | 1.266330e-49 |
MsG0080047869.01 | MsG0380014701.01 | 0.814015 | 1.909902e-51 | 1.266933e-48 |
MsG0080047869.01 | MsG0380014703.01 | 0.832902 | 7.253101e-56 | 8.219863e-53 |
MsG0080047869.01 | MsG0380014770.01 | 0.829027 | 6.477230e-55 | 6.549061e-52 |
MsG0080047869.01 | MsG0380014894.01 | 0.812435 | 4.246056e-51 | 2.699689e-48 |
MsG0080047869.01 | MsG0380014930.01 | 0.826012 | 3.426670e-54 | 3.174934e-51 |
MsG0080047869.01 | MsG0380014981.01 | 0.814510 | 1.485276e-51 | 9.986077e-49 |
MsG0080047869.01 | MsG0380015164.01 | 0.850365 | 1.780079e-60 | 3.478482e-57 |
MsG0080047869.01 | MsG0380015332.01 | 0.810337 | 1.211901e-50 | 7.285501e-48 |
MsG0080047869.01 | MsG0380015555.01 | 0.840504 | 8.357225e-58 | 1.192907e-54 |
MsG0080047869.01 | MsG0380015566.01 | 0.901894 | 1.687844e-78 | 2.329455e-74 |
MsG0080047869.01 | MsG0380015631.01 | 0.802867 | 4.575548e-49 | 2.265987e-46 |
MsG0080047869.01 | MsG0380015677.01 | 0.858917 | 5.926482e-63 | 1.537452e-59 |
MsG0080047869.01 | MsG0380015720.01 | 0.850925 | 1.238856e-60 | 2.465879e-57 |
MsG0080047869.01 | MsG0380015779.01 | 0.830268 | 3.231647e-55 | 3.388095e-52 |
MsG0080047869.01 | MsG0380015830.01 | 0.811658 | 6.271966e-51 | 3.904719e-48 |
MsG0080047869.01 | MsG0380016064.01 | 0.812639 | 3.830889e-51 | 2.448732e-48 |
MsG0080047869.01 | MsG0380016285.01 | 0.806474 | 8.084634e-50 | 4.392206e-47 |
MsG0080047869.01 | MsG0380016475.01 | 0.881352 | 2.578663e-70 | 1.505691e-66 |
MsG0080047869.01 | MsG0380016517.01 | 0.821320 | 4.299058e-53 | 3.486009e-50 |
MsG0080047869.01 | MsG0380016553.01 | 0.840457 | 8.597574e-58 | 1.225383e-54 |
MsG0080047869.01 | MsG0380016581.01 | 0.856627 | 2.830219e-62 | 6.796953e-59 |
MsG0080047869.01 | MsG0380016603.01 | 0.806287 | 8.850246e-50 | 4.785286e-47 |
MsG0080047869.01 | MsG0380016624.01 | 0.839023 | 2.029598e-57 | 2.767352e-54 |
MsG0080047869.01 | MsG0380016695.01 | 0.804430 | 2.168339e-49 | 1.117734e-46 |
MsG0080047869.01 | MsG0380016765.01 | 0.801480 | 8.826082e-49 | 4.219556e-46 |
MsG0080047869.01 | MsG0380016859.01 | 0.819229 | 1.295900e-52 | 9.914340e-50 |
MsG0080047869.01 | MsG0380016910.01 | 0.868044 | 8.742989e-66 | 3.118068e-62 |
MsG0080047869.01 | MsG0380016970.01 | 0.800157 | 1.644328e-48 | 7.601643e-46 |
MsG0080047869.01 | MsG0380017040.01 | 0.821147 | 4.711156e-53 | 3.801990e-50 |
MsG0080047869.01 | MsG0380017060.01 | 0.819086 | 1.396672e-52 | 1.064342e-49 |
MsG0080047869.01 | MsG0380017140.01 | 0.847127 | 1.407653e-59 | 2.477460e-56 |
MsG0080047869.01 | MsG0380017233.01 | 0.814265 | 1.682146e-51 | 1.123437e-48 |
MsG0080047869.01 | MsG0380017266.01 | -0.819283 | 1.260028e-52 | 9.653905e-50 |
MsG0080047869.01 | MsG0380017323.01 | 0.802826 | 4.665982e-49 | 2.308537e-46 |
MsG0080047869.01 | MsG0380017326.01 | 0.842314 | 2.789431e-58 | 4.213041e-55 |
MsG0080047869.01 | MsG0380017403.01 | 0.802684 | 4.990530e-49 | 2.459977e-46 |
MsG0080047869.01 | MsG0380017461.01 | 0.825444 | 4.672545e-54 | 4.259366e-51 |
MsG0080047869.01 | MsG0380017495.01 | 0.800202 | 1.609776e-48 | 7.450619e-46 |
MsG0080047869.01 | MsG0380017543.01 | 0.839773 | 1.296805e-57 | 1.809316e-54 |
MsG0080047869.01 | MsG0380017551.01 | -0.800012 | 1.759168e-48 | 8.103043e-46 |
MsG0080047869.01 | MsG0380017680.01 | 0.853481 | 2.322650e-61 | 5.025627e-58 |
MsG0080047869.01 | MsG0380017746.01 | 0.803404 | 3.543217e-49 | 1.779014e-46 |
MsG0080047869.01 | MsG0380018009.01 | 0.849066 | 4.104638e-60 | 7.688725e-57 |
MsG0080047869.01 | MsG0480018163.01 | 0.877981 | 4.060742e-69 | 2.083931e-65 |
MsG0080047869.01 | MsG0480018183.01 | 0.802048 | 6.747554e-49 | 3.272648e-46 |
MsG0080047869.01 | MsG0480018206.01 | 0.839401 | 1.620221e-57 | 2.235087e-54 |
MsG0080047869.01 | MsG0480018236.01 | 0.804816 | 1.801789e-49 | 9.381628e-47 |
MsG0080047869.01 | MsG0480018347.01 | 0.818954 | 1.496597e-52 | 1.136449e-49 |
MsG0080047869.01 | MsG0480018425.01 | 0.824807 | 6.606034e-54 | 5.914517e-51 |
MsG0080047869.01 | MsG0480018465.01 | 0.818409 | 1.990452e-52 | 1.488852e-49 |
MsG0080047869.01 | MsG0480018576.01 | 0.812430 | 4.255724e-51 | 2.705497e-48 |
MsG0080047869.01 | MsG0480018603.01 | 0.811333 | 7.378963e-51 | 4.554690e-48 |
MsG0080047869.01 | MsG0480018637.01 | 0.801752 | 7.763455e-49 | 3.736939e-46 |
MsG0080047869.01 | MsG0480018659.01 | 0.841729 | 3.981661e-58 | 5.903370e-55 |
MsG0080047869.01 | MsG0480018660.01 | 0.846402 | 2.221605e-59 | 3.819572e-56 |
MsG0080047869.01 | MsG0480018778.01 | 0.809247 | 2.079305e-50 | 1.214670e-47 |
MsG0080047869.01 | MsG0480018883.01 | 0.814500 | 1.492802e-51 | 1.003397e-48 |
MsG0080047869.01 | MsG0480018894.01 | 0.802903 | 4.498087e-49 | 2.229694e-46 |
MsG0080047869.01 | MsG0480018964.01 | 0.834020 | 3.816073e-56 | 4.471964e-53 |
MsG0080047869.01 | MsG0480018970.01 | 0.845368 | 4.242497e-59 | 7.053768e-56 |
MsG0080047869.01 | MsG0480019137.01 | 0.802209 | 6.253464e-49 | 3.045345e-46 |
MsG0080047869.01 | MsG0480019297.01 | 0.819033 | 1.436164e-52 | 1.092901e-49 |
MsG0080047869.01 | MsG0480019337.01 | 0.823348 | 1.453534e-53 | 1.248285e-50 |
MsG0080047869.01 | MsG0480019795.01 | 0.802150 | 6.431319e-49 | 3.127329e-46 |
MsG0080047869.01 | MsG0480019970.01 | 0.801411 | 9.118786e-49 | 4.351798e-46 |
MsG0080047869.01 | MsG0480020002.01 | 0.821891 | 3.172270e-53 | 2.614139e-50 |
MsG0080047869.01 | MsG0480020090.01 | 0.818446 | 1.951597e-52 | 1.461358e-49 |
MsG0080047869.01 | MsG0480020136.01 | 0.818020 | 2.437353e-52 | 1.803515e-49 |
MsG0080047869.01 | MsG0480020445.01 | 0.806216 | 9.159331e-50 | 4.943674e-47 |
MsG0080047869.01 | MsG0480020521.01 | 0.801759 | 7.738127e-49 | 3.725362e-46 |
MsG0080047869.01 | MsG0480020634.01 | 0.814903 | 1.215632e-51 | 8.259244e-49 |
MsG0080047869.01 | MsG0480020739.01 | 0.814561 | 1.447018e-51 | 9.741987e-49 |
MsG0080047869.01 | MsG0480020836.01 | 0.804598 | 2.000760e-49 | 1.035837e-46 |
MsG0080047869.01 | MsG0480020839.01 | 0.828555 | 8.422458e-55 | 8.400370e-52 |
MsG0080047869.01 | MsG0480020874.01 | 0.836772 | 7.692737e-57 | 9.792850e-54 |
MsG0080047869.01 | MsG0480020886.01 | 0.808192 | 3.495309e-50 | 1.985708e-47 |
MsG0080047869.01 | MsG0480021164.01 | 0.849129 | 3.942448e-60 | 7.400758e-57 |
MsG0080047869.01 | MsG0480021215.01 | 0.848341 | 6.517777e-60 | 1.192379e-56 |
MsG0080047869.01 | MsG0480021274.01 | 0.865450 | 5.855916e-65 | 1.906068e-61 |
MsG0080047869.01 | MsG0480021276.01 | 0.829161 | 6.008606e-55 | 6.100154e-52 |
MsG0080047869.01 | MsG0480021451.01 | 0.802022 | 6.831342e-49 | 3.311054e-46 |
MsG0080047869.01 | MsG0480021464.01 | 0.814030 | 1.895903e-51 | 1.258160e-48 |
MsG0080047869.01 | MsG0480021465.01 | 0.825641 | 4.195613e-54 | 3.846430e-51 |
MsG0080047869.01 | MsG0480021491.01 | 0.812927 | 3.314307e-51 | 2.134500e-48 |
MsG0080047869.01 | MsG0480021536.01 | 0.865879 | 4.285370e-65 | 1.416127e-61 |
MsG0080047869.01 | MsG0480021558.01 | 0.875423 | 3.117872e-68 | 1.454790e-64 |
MsG0080047869.01 | MsG0480021853.01 | 0.849785 | 2.587298e-60 | 4.960381e-57 |
MsG0080047869.01 | MsG0480021925.01 | 0.832980 | 6.936238e-56 | 7.879496e-53 |
MsG0080047869.01 | MsG0480021953.01 | 0.831901 | 1.283556e-55 | 1.412309e-52 |
MsG0080047869.01 | MsG0480022052.01 | -0.822680 | 2.080806e-53 | 1.753722e-50 |
MsG0080047869.01 | MsG0480022060.01 | 0.827107 | 1.877899e-54 | 1.795407e-51 |
MsG0080047869.01 | MsG0480022068.01 | 0.813142 | 2.973162e-51 | 1.925883e-48 |
MsG0080047869.01 | MsG0480022146.01 | 0.800121 | 1.672201e-48 | 7.723758e-46 |
MsG0080047869.01 | MsG0480022164.01 | 0.835411 | 1.704500e-56 | 2.082703e-53 |
MsG0080047869.01 | MsG0480022213.01 | -0.853732 | 1.967666e-61 | 4.293290e-58 |
MsG0080047869.01 | MsG0480022222.01 | 0.850634 | 1.495888e-60 | 2.949020e-57 |
MsG0080047869.01 | MsG0480022252.01 | 0.812352 | 4.426471e-51 | 2.808035e-48 |
MsG0080047869.01 | MsG0480022259.01 | 0.858751 | 6.642292e-63 | 1.713211e-59 |
MsG0080047869.01 | MsG0480022262.01 | 0.849830 | 2.513917e-60 | 4.826881e-57 |
MsG0080047869.01 | MsG0480022467.01 | 0.830187 | 3.381492e-55 | 3.537126e-52 |
MsG0080047869.01 | MsG0480022480.01 | 0.829437 | 5.151375e-55 | 5.272015e-52 |
MsG0080047869.01 | MsG0480022482.01 | 0.830145 | 3.463432e-55 | 3.618377e-52 |
MsG0080047869.01 | MsG0480022533.01 | 0.823025 | 1.729775e-53 | 1.472214e-50 |
MsG0080047869.01 | MsG0480022551.01 | 0.834337 | 3.176732e-56 | 3.758714e-53 |
MsG0080047869.01 | MsG0480022615.01 | -0.828799 | 7.355035e-55 | 7.387281e-52 |
MsG0080047869.01 | MsG0480022707.01 | 0.836060 | 1.167610e-56 | 1.454812e-53 |
MsG0080047869.01 | MsG0480022768.01 | 0.824173 | 9.318246e-54 | 8.191608e-51 |
MsG0080047869.01 | MsG0480022795.01 | 0.863218 | 2.911989e-64 | 8.761607e-61 |
MsG0080047869.01 | MsG0480022836.01 | 0.803335 | 3.661536e-49 | 1.835093e-46 |
MsG0080047869.01 | MsG0480022985.01 | 0.851577 | 8.106999e-61 | 1.648220e-57 |
MsG0080047869.01 | MsG0480023014.01 | 0.822168 | 2.737216e-53 | 2.273331e-50 |
MsG0080047869.01 | MsG0480023015.01 | 0.801278 | 9.710934e-49 | 4.618960e-46 |
MsG0080047869.01 | MsG0480023088.01 | 0.808367 | 3.206513e-50 | 1.830103e-47 |
MsG0080047869.01 | MsG0480023163.01 | 0.812182 | 4.821971e-51 | 3.044820e-48 |
MsG0080047869.01 | MsG0480023248.01 | 0.823222 | 1.555991e-53 | 1.331607e-50 |
MsG0080047869.01 | MsG0480023427.01 | 0.825899 | 3.643458e-54 | 3.365142e-51 |
MsG0080047869.01 | MsG0480023463.01 | 0.811561 | 6.583979e-51 | 4.088749e-48 |
MsG0080047869.01 | MsG0480023600.01 | 0.833907 | 4.072932e-56 | 4.757479e-53 |
MsG0080047869.01 | MsG0480023636.01 | 0.845464 | 3.996577e-59 | 6.665955e-56 |
MsG0080047869.01 | MsG0480023654.01 | 0.863588 | 2.236673e-64 | 6.815746e-61 |
MsG0080047869.01 | MsG0480023707.01 | 0.888477 | 5.702295e-73 | 4.424811e-69 |
MsG0080047869.01 | MsG0480023814.01 | 0.807220 | 5.622706e-50 | 3.114087e-47 |
MsG0080047869.01 | MsG0480023832.01 | 0.803157 | 3.984979e-49 | 1.988191e-46 |
MsG0080047869.01 | MsG0480023835.01 | 0.801885 | 7.289005e-49 | 3.520786e-46 |
MsG0080047869.01 | MsG0480023873.01 | 0.823619 | 1.256375e-53 | 1.087372e-50 |
MsG0080047869.01 | MsG0480024003.01 | 0.822762 | 1.991462e-53 | 1.682412e-50 |
MsG0080047869.01 | MsG0480024005.01 | 0.834874 | 2.328896e-56 | 2.799983e-53 |
MsG0080047869.01 | MsG0480024014.01 | 0.803592 | 3.238979e-49 | 1.634187e-46 |
MsG0080047869.01 | MsG0480024015.01 | 0.822521 | 2.265657e-53 | 1.900982e-50 |
MsG0080047869.01 | MsG0580024038.01 | 0.801210 | 1.002751e-48 | 4.761299e-46 |
MsG0080047869.01 | MsG0580024073.01 | 0.816026 | 6.837746e-52 | 4.790902e-49 |
MsG0080047869.01 | MsG0580024114.01 | 0.833380 | 5.513125e-56 | 6.338366e-53 |
MsG0080047869.01 | MsG0580024166.01 | 0.805050 | 1.609189e-49 | 8.429158e-47 |
MsG0080047869.01 | MsG0580024305.01 | 0.801987 | 6.945965e-49 | 3.363546e-46 |
MsG0080047869.01 | MsG0580024363.01 | -0.801853 | 7.400559e-49 | 3.571647e-46 |
MsG0080047869.01 | MsG0580024390.01 | 0.805525 | 1.279783e-49 | 6.785752e-47 |
MsG0080047869.01 | MsG0580024402.01 | 0.800659 | 1.299458e-48 | 6.084706e-46 |
MsG0080047869.01 | MsG0580024418.01 | 0.826093 | 3.278286e-54 | 3.044235e-51 |
MsG0080047869.01 | MsG0580024552.01 | 0.821139 | 4.733581e-53 | 3.819226e-50 |
MsG0080047869.01 | MsG0580024733.01 | 0.800476 | 1.415768e-48 | 6.598431e-46 |
MsG0080047869.01 | MsG0580024781.01 | 0.830506 | 2.826395e-55 | 2.983580e-52 |
MsG0080047869.01 | MsG0580025022.01 | 0.856267 | 3.610124e-62 | 8.567494e-59 |
MsG0080047869.01 | MsG0580025135.01 | 0.852645 | 4.030655e-61 | 8.478318e-58 |
MsG0080047869.01 | MsG0580025154.01 | 0.808964 | 2.390680e-50 | 1.385927e-47 |
MsG0080047869.01 | MsG0580025201.01 | 0.817337 | 3.474151e-52 | 2.523108e-49 |
MsG0080047869.01 | MsG0580025448.01 | 0.853492 | 2.306252e-61 | 4.992131e-58 |
MsG0080047869.01 | MsG0580025638.01 | 0.840830 | 6.865374e-58 | 9.899279e-55 |
MsG0080047869.01 | MsG0580025758.01 | 0.842576 | 2.377237e-58 | 3.620021e-55 |
MsG0080047869.01 | MsG0580026002.01 | 0.815868 | 7.415374e-52 | 5.172919e-49 |
MsG0080047869.01 | MsG0580026023.01 | 0.802282 | 6.041383e-49 | 2.947721e-46 |
MsG0080047869.01 | MsG0580026086.01 | 0.810879 | 9.255343e-51 | 5.645341e-48 |
MsG0080047869.01 | MsG0580026165.01 | 0.805170 | 1.519449e-49 | 7.983486e-47 |
MsG0080047869.01 | MsG0580026342.01 | 0.801792 | 7.616771e-49 | 3.670210e-46 |
MsG0080047869.01 | MsG0580026709.01 | 0.824938 | 6.154696e-54 | 5.530783e-51 |
MsG0080047869.01 | MsG0580027018.01 | 0.802233 | 6.182619e-49 | 3.012769e-46 |
MsG0080047869.01 | MsG0580027031.01 | 0.859741 | 3.352580e-63 | 8.947173e-60 |
MsG0080047869.01 | MsG0580027129.01 | 0.801345 | 9.406522e-49 | 4.481760e-46 |
MsG0080047869.01 | MsG0580027152.01 | 0.821993 | 3.005011e-53 | 2.483339e-50 |
MsG0080047869.01 | MsG0580027169.01 | 0.801951 | 7.066143e-49 | 3.418578e-46 |
MsG0080047869.01 | MsG0580027211.01 | 0.802392 | 5.734377e-49 | 2.805806e-46 |
MsG0080047869.01 | MsG0580027228.01 | 0.827596 | 1.433542e-54 | 1.390171e-51 |
MsG0080047869.01 | MsG0580027344.01 | 0.810058 | 1.391875e-50 | 8.307100e-48 |
MsG0080047869.01 | MsG0580027650.01 | 0.827874 | 1.229351e-54 | 1.201984e-51 |
MsG0080047869.01 | MsG0580027679.01 | 0.810473 | 1.132877e-50 | 6.835244e-48 |
MsG0080047869.01 | MsG0580027745.01 | 0.821749 | 3.422189e-53 | 2.808482e-50 |
MsG0080047869.01 | MsG0580027766.01 | 0.828584 | 8.288608e-55 | 8.273511e-52 |
MsG0080047869.01 | MsG0580027767.01 | 0.818747 | 1.668222e-52 | 1.259414e-49 |
MsG0080047869.01 | MsG0580027833.01 | 0.860526 | 1.943248e-63 | 5.327747e-60 |
MsG0080047869.01 | MsG0580027922.01 | 0.821542 | 3.820236e-53 | 3.117051e-50 |
MsG0080047869.01 | MsG0580027926.01 | 0.817591 | 3.045749e-52 | 2.227337e-49 |
MsG0080047869.01 | MsG0580027937.01 | 0.811331 | 7.384619e-51 | 4.558008e-48 |
MsG0080047869.01 | MsG0580028394.01 | 0.847431 | 1.161330e-59 | 2.063820e-56 |
MsG0080047869.01 | MsG0580028527.01 | 0.827185 | 1.798755e-54 | 1.723834e-51 |
MsG0080047869.01 | MsG0580028592.01 | 0.800163 | 1.639189e-48 | 7.579147e-46 |
MsG0080047869.01 | MsG0580028634.01 | 0.814736 | 1.323365e-51 | 8.951416e-49 |
MsG0080047869.01 | MsG0580028990.01 | 0.860866 | 1.531926e-63 | 4.249688e-60 |
MsG0080047869.01 | MsG0580029008.01 | 0.809395 | 1.932516e-50 | 1.133381e-47 |
MsG0080047869.01 | MsG0580029015.01 | 0.800248 | 1.575469e-48 | 7.300507e-46 |
MsG0080047869.01 | MsG0580029189.01 | 0.806002 | 1.016147e-49 | 5.454697e-47 |
MsG0080047869.01 | MsG0580029554.01 | 0.840898 | 6.589654e-58 | 9.521400e-55 |
MsG0080047869.01 | MsG0580029640.01 | 0.821791 | 3.345637e-53 | 2.749129e-50 |
MsG0080047869.01 | MsG0580029826.01 | 0.807159 | 5.792376e-50 | 3.202881e-47 |
MsG0080047869.01 | MsG0580029999.01 | -0.807543 | 4.801938e-50 | 2.681885e-47 |
MsG0080047869.01 | MsG0580030235.01 | 0.808612 | 2.842822e-50 | 1.632776e-47 |
MsG0080047869.01 | MsG0680030316.01 | 0.864662 | 1.034743e-64 | 3.274952e-61 |
MsG0080047869.01 | MsG0680030366.01 | 0.827874 | 1.229515e-54 | 1.202131e-51 |
MsG0080047869.01 | MsG0680030413.01 | 0.807745 | 4.349973e-50 | 2.442356e-47 |
MsG0080047869.01 | MsG0680030447.01 | 0.803780 | 2.961177e-49 | 1.501179e-46 |
MsG0080047869.01 | MsG0680030560.01 | 0.805965 | 1.034408e-49 | 5.547330e-47 |
MsG0080047869.01 | MsG0680030561.01 | 0.809308 | 2.018100e-50 | 1.180766e-47 |
MsG0080047869.01 | MsG0680030633.01 | 0.814155 | 1.779550e-51 | 1.184916e-48 |
MsG0080047869.01 | MsG0680030667.01 | 0.820517 | 6.577744e-53 | 5.215778e-50 |
MsG0080047869.01 | MsG0680030880.01 | 0.810826 | 9.503118e-51 | 5.788152e-48 |
MsG0080047869.01 | MsG0680030881.01 | 0.809741 | 1.629180e-50 | 9.643078e-48 |
MsG0080047869.01 | MsG0680030882.01 | 0.845536 | 3.820596e-59 | 6.386975e-56 |
MsG0080047869.01 | MsG0680030886.01 | 0.808396 | 3.161899e-50 | 1.805965e-47 |
MsG0080047869.01 | MsG0680031087.01 | 0.832076 | 1.161719e-55 | 1.284682e-52 |
MsG0080047869.01 | MsG0680031114.01 | 0.818407 | 1.991761e-52 | 1.489765e-49 |
MsG0080047869.01 | MsG0680031214.01 | 0.820846 | 5.527101e-53 | 4.423307e-50 |
MsG0080047869.01 | MsG0680031262.01 | 0.814648 | 1.384024e-51 | 9.339654e-49 |
MsG0080047869.01 | MsG0680031355.01 | 0.828285 | 9.788521e-55 | 9.685804e-52 |
MsG0080047869.01 | MsG0680031379.01 | 0.835331 | 1.785770e-56 | 2.176990e-53 |
MsG0080047869.01 | MsG0680031506.01 | 0.808639 | 2.806081e-50 | 1.612807e-47 |
MsG0080047869.01 | MsG0680031617.01 | 0.827785 | 1.291033e-54 | 1.258951e-51 |
MsG0080047869.01 | MsG0680031646.01 | 0.800923 | 1.147535e-48 | 5.409579e-46 |
MsG0080047869.01 | MsG0680031651.01 | 0.820679 | 6.037075e-53 | 4.808623e-50 |
MsG0080047869.01 | MsG0680031946.01 | 0.805533 | 1.274989e-49 | 6.761644e-47 |
MsG0080047869.01 | MsG0680032157.01 | 0.817645 | 2.961302e-52 | 2.168801e-49 |
MsG0080047869.01 | MsG0680032204.01 | 0.812355 | 4.420742e-51 | 2.804643e-48 |
MsG0080047869.01 | MsG0680032355.01 | 0.807159 | 5.792220e-50 | 3.202799e-47 |
MsG0080047869.01 | MsG0680032771.01 | 0.806426 | 8.272528e-50 | 4.488761e-47 |
MsG0080047869.01 | MsG0680032801.01 | 0.821066 | 4.918210e-53 | 3.960459e-50 |
MsG0080047869.01 | MsG0680032844.01 | 0.807635 | 4.590461e-50 | 2.569912e-47 |
MsG0080047869.01 | MsG0680032996.01 | 0.829483 | 5.019910e-55 | 5.144324e-52 |
MsG0080047869.01 | MsG0680033228.01 | 0.862062 | 6.610767e-64 | 1.910539e-60 |
MsG0080047869.01 | MsG0680033412.01 | 0.837566 | 4.818347e-57 | 6.283776e-54 |
MsG0080047869.01 | MsG0680033792.01 | 0.808840 | 2.540823e-50 | 1.468090e-47 |
MsG0080047869.01 | MsG0680034464.01 | 0.828169 | 1.043787e-54 | 1.029413e-51 |
MsG0080047869.01 | MsG0680034565.01 | 0.804085 | 2.559018e-49 | 1.307524e-46 |
MsG0080047869.01 | MsG0680035040.01 | 0.806080 | 9.788045e-50 | 5.264343e-47 |
MsG0080047869.01 | MsG0680035115.01 | 0.816897 | 4.364189e-52 | 3.131437e-49 |
MsG0080047869.01 | MsG0680035346.01 | 0.823908 | 1.074839e-53 | 9.378991e-51 |
MsG0080047869.01 | MsG0680035347.01 | 0.806213 | 9.175805e-50 | 4.952074e-47 |
MsG0080047869.01 | MsG0680035444.01 | 0.842643 | 2.281499e-58 | 3.481117e-55 |
MsG0080047869.01 | MsG0680035455.01 | 0.808651 | 2.789272e-50 | 1.603658e-47 |
MsG0080047869.01 | MsG0680035467.01 | 0.814258 | 1.688751e-51 | 1.127617e-48 |
MsG0080047869.01 | MsG0680035475.01 | 0.839164 | 1.866691e-57 | 2.556138e-54 |
MsG0080047869.01 | MsG0680035573.01 | 0.868377 | 6.830351e-66 | 2.465297e-62 |
MsG0080047869.01 | MsG0680035692.01 | 0.861343 | 1.096886e-63 | 3.094035e-60 |
MsG0080047869.01 | MsG0680035694.01 | 0.847481 | 1.125691e-59 | 2.003581e-56 |
MsG0080047869.01 | MsG0680035704.01 | 0.817659 | 2.940980e-52 | 2.154779e-49 |
MsG0080047869.01 | MsG0680035828.01 | 0.827892 | 1.217322e-54 | 1.190839e-51 |
MsG0080047869.01 | MsG0680035909.01 | 0.841658 | 4.157545e-58 | 6.150594e-55 |
MsG0080047869.01 | MsG0780035948.01 | 0.854336 | 1.317349e-61 | 2.932046e-58 |
MsG0080047869.01 | MsG0780036018.01 | 0.801513 | 8.690263e-49 | 4.158001e-46 |
MsG0080047869.01 | MsG0780036080.01 | 0.821497 | 3.912245e-53 | 3.188026e-50 |
MsG0080047869.01 | MsG0780036477.01 | 0.849694 | 2.742588e-60 | 5.242903e-57 |
MsG0080047869.01 | MsG0780036498.01 | 0.804368 | 2.234253e-49 | 1.149928e-46 |
MsG0080047869.01 | MsG0780036663.01 | 0.803726 | 3.037907e-49 | 1.537950e-46 |
MsG0080047869.01 | MsG0780036719.01 | 0.840101 | 1.065183e-57 | 1.501653e-54 |
MsG0080047869.01 | MsG0780036810.01 | 0.823611 | 1.261930e-53 | 1.091898e-50 |
MsG0080047869.01 | MsG0780036815.01 | 0.810239 | 1.272268e-50 | 7.629054e-48 |
MsG0080047869.01 | MsG0780037054.01 | 0.822782 | 1.970496e-53 | 1.665540e-50 |
MsG0080047869.01 | MsG0780037141.01 | 0.820813 | 5.625009e-53 | 4.497411e-50 |
MsG0080047869.01 | MsG0780037457.01 | 0.800048 | 1.730155e-48 | 7.976637e-46 |
MsG0080047869.01 | MsG0780037512.01 | 0.822470 | 2.328830e-53 | 1.951019e-50 |
MsG0080047869.01 | MsG0780037604.01 | 0.832599 | 8.624698e-56 | 9.686181e-53 |
MsG0080047869.01 | MsG0780037845.01 | 0.806190 | 9.277561e-50 | 5.004043e-47 |
MsG0080047869.01 | MsG0780037918.01 | 0.852477 | 4.501060e-61 | 9.416401e-58 |
MsG0080047869.01 | MsG0780037919.01 | 0.813584 | 2.377360e-51 | 1.558657e-48 |
MsG0080047869.01 | MsG0780037942.01 | 0.849854 | 2.475491e-60 | 4.756891e-57 |
MsG0080047869.01 | MsG0780038276.01 | 0.805258 | 1.456263e-49 | 7.668398e-47 |
MsG0080047869.01 | MsG0780038386.01 | 0.824946 | 6.127100e-54 | 5.507339e-51 |
MsG0080047869.01 | MsG0780038391.01 | 0.834401 | 3.062088e-56 | 3.629961e-53 |
MsG0080047869.01 | MsG0780038401.01 | 0.845825 | 3.190198e-59 | 5.383750e-56 |
MsG0080047869.01 | MsG0780038424.01 | 0.811395 | 7.151342e-51 | 4.421839e-48 |
MsG0080047869.01 | MsG0780038439.01 | 0.829050 | 6.393296e-55 | 6.468536e-52 |
MsG0080047869.01 | MsG0780038495.01 | 0.851461 | 8.744307e-61 | 1.771130e-57 |
MsG0080047869.01 | MsG0780038602.01 | 0.815851 | 7.478983e-52 | 5.214809e-49 |
MsG0080047869.01 | MsG0780038654.01 | 0.820525 | 6.550815e-53 | 5.195649e-50 |
MsG0080047869.01 | MsG0780038906.01 | 0.816604 | 5.076582e-52 | 3.613546e-49 |
MsG0080047869.01 | MsG0780039059.01 | 0.815996 | 6.942890e-52 | 4.860541e-49 |
MsG0080047869.01 | MsG0780039137.01 | 0.824821 | 6.558538e-54 | 5.874081e-51 |
MsG0080047869.01 | MsG0780039144.01 | 0.832891 | 7.295259e-56 | 8.265009e-53 |
MsG0080047869.01 | MsG0780039243.01 | 0.819650 | 1.038748e-52 | 8.040960e-50 |
MsG0080047869.01 | MsG0780039252.01 | 0.856307 | 3.515719e-62 | 8.353836e-59 |
MsG0080047869.01 | MsG0780039423.01 | 0.805605 | 1.231501e-49 | 6.543160e-47 |
MsG0080047869.01 | MsG0780039866.01 | 0.832619 | 8.525997e-56 | 9.581221e-53 |
MsG0080047869.01 | MsG0780039867.01 | -0.808767 | 2.635008e-50 | 1.519549e-47 |
MsG0080047869.01 | MsG0780040057.01 | 0.854420 | 1.245773e-61 | 2.780449e-58 |
MsG0080047869.01 | MsG0780040262.01 | 0.806671 | 7.343940e-50 | 4.009766e-47 |
MsG0080047869.01 | MsG0780040442.01 | 0.837619 | 4.671240e-57 | 6.102184e-54 |
MsG0080047869.01 | MsG0780040445.01 | 0.808641 | 2.803400e-50 | 1.611351e-47 |
MsG0080047869.01 | MsG0780040488.01 | 0.808479 | 3.035658e-50 | 1.737611e-47 |
MsG0080047869.01 | MsG0780040576.01 | -0.809536 | 1.802592e-50 | 1.061129e-47 |
MsG0080047869.01 | MsG0780040596.01 | 0.851420 | 8.979177e-61 | 1.816553e-57 |
MsG0080047869.01 | MsG0780040604.01 | 0.866153 | 3.511553e-65 | 1.171731e-61 |
MsG0080047869.01 | MsG0780040669.01 | 0.802828 | 4.661302e-49 | 2.306350e-46 |
MsG0080047869.01 | MsG0780040704.01 | 0.858290 | 9.116259e-63 | 2.315267e-59 |
MsG0080047869.01 | MsG0780040726.01 | 0.810584 | 1.071657e-50 | 6.485147e-48 |
MsG0080047869.01 | MsG0780040841.01 | 0.821285 | 4.380186e-53 | 3.548256e-50 |
MsG0080047869.01 | MsG0780040858.01 | 0.818548 | 1.850392e-52 | 1.389343e-49 |
MsG0080047869.01 | MsG0780040861.01 | 0.810109 | 1.357558e-50 | 8.113039e-48 |
MsG0080047869.01 | MsG0780041065.01 | 0.818157 | 2.269685e-52 | 1.685793e-49 |
MsG0080047869.01 | MsG0780041149.01 | -0.804939 | 1.697700e-49 | 8.867948e-47 |
MsG0080047869.01 | MsG0780041402.01 | 0.843352 | 1.477338e-58 | 2.305334e-55 |
MsG0080047869.01 | MsG0780041456.01 | 0.884854 | 1.342987e-71 | 9.004474e-68 |
MsG0080047869.01 | MsG0780041507.01 | 0.812832 | 3.477159e-51 | 2.233676e-48 |
MsG0080047869.01 | MsG0780041535.01 | 0.815227 | 1.029956e-51 | 7.059755e-49 |
MsG0080047869.01 | MsG0780041559.01 | 0.816536 | 5.258275e-52 | 3.735828e-49 |
MsG0080047869.01 | MsG0780041674.01 | 0.819980 | 8.732642e-53 | 6.822802e-50 |
MsG0080047869.01 | MsG0880041836.01 | 0.882659 | 8.655134e-71 | 5.315217e-67 |
MsG0080047869.01 | MsG0880042129.01 | 0.803577 | 3.262050e-49 | 1.645224e-46 |
MsG0080047869.01 | MsG0880042158.01 | 0.839757 | 1.309140e-57 | 1.825563e-54 |
MsG0080047869.01 | MsG0880042203.01 | 0.802382 | 5.760104e-49 | 2.817751e-46 |
MsG0080047869.01 | MsG0880042232.01 | 0.876077 | 1.858888e-68 | 8.890508e-65 |
MsG0080047869.01 | MsG0880042294.01 | 0.871640 | 5.859818e-67 | 2.381364e-63 |
MsG0080047869.01 | MsG0880042301.01 | 0.827657 | 1.386291e-54 | 1.346797e-51 |
MsG0080047869.01 | MsG0880042314.01 | 0.848286 | 6.751391e-60 | 1.232987e-56 |
MsG0080047869.01 | MsG0880042404.01 | 0.840596 | 7.907639e-58 | 1.131840e-54 |
MsG0080047869.01 | MsG0880042518.01 | 0.835669 | 1.467056e-56 | 1.806359e-53 |
MsG0080047869.01 | MsG0880042543.01 | 0.827314 | 1.675452e-54 | 1.611747e-51 |
MsG0080047869.01 | MsG0880042611.01 | 0.816212 | 6.212613e-52 | 4.375220e-49 |
MsG0080047869.01 | MsG0880042698.01 | 0.852805 | 3.626244e-61 | 7.670090e-58 |
MsG0080047869.01 | MsG0880042779.01 | 0.805554 | 1.262406e-49 | 6.698439e-47 |
MsG0080047869.01 | MsG0880042800.01 | 0.840815 | 6.927285e-58 | 9.983907e-55 |
MsG0080047869.01 | MsG0880042966.01 | 0.847834 | 8.996603e-60 | 1.619358e-56 |
MsG0080047869.01 | MsG0880043002.01 | 0.801268 | 9.757058e-49 | 4.639672e-46 |
MsG0080047869.01 | MsG0880043172.01 | 0.815305 | 9.895085e-52 | 6.797241e-49 |
MsG0080047869.01 | MsG0880043292.01 | 0.855567 | 5.785560e-62 | 1.341381e-58 |
MsG0080047869.01 | MsG0880043303.01 | 0.822280 | 2.577559e-53 | 2.147792e-50 |
MsG0080047869.01 | MsG0880043479.01 | 0.827378 | 1.617238e-54 | 1.558792e-51 |
MsG0080047869.01 | MsG0880043491.01 | 0.825544 | 4.425163e-54 | 4.045485e-51 |
MsG0080047869.01 | MsG0880043897.01 | 0.801297 | 9.625031e-49 | 4.580280e-46 |
MsG0080047869.01 | MsG0880043941.01 | 0.806938 | 6.450776e-50 | 3.546573e-47 |
MsG0080047869.01 | MsG0880044079.01 | 0.829577 | 4.761580e-55 | 4.893038e-52 |
MsG0080047869.01 | MsG0880044080.01 | 0.802651 | 5.070253e-49 | 2.497113e-46 |
MsG0080047869.01 | MsG0880044085.01 | 0.813494 | 2.487594e-51 | 1.627083e-48 |
MsG0080047869.01 | MsG0880044237.01 | 0.819692 | 1.016075e-52 | 7.874588e-50 |
MsG0080047869.01 | MsG0880044323.01 | 0.806687 | 7.287299e-50 | 3.980535e-47 |
MsG0080047869.01 | MsG0880044415.01 | 0.841410 | 4.833028e-58 | 7.095694e-55 |
MsG0080047869.01 | MsG0880044416.01 | 0.840803 | 6.977239e-58 | 1.005222e-54 |
MsG0080047869.01 | MsG0880044455.01 | -0.831784 | 1.371902e-55 | 1.504344e-52 |
MsG0080047869.01 | MsG0880044486.01 | 0.802080 | 6.647783e-49 | 3.226795e-46 |
MsG0080047869.01 | MsG0880044510.01 | 0.831009 | 2.127982e-55 | 2.280069e-52 |
MsG0080047869.01 | MsG0880044542.01 | 0.839699 | 1.355601e-57 | 1.886942e-54 |
MsG0080047869.01 | MsG0880044554.01 | 0.840908 | 6.550537e-58 | 9.467757e-55 |
MsG0080047869.01 | MsG0880044573.01 | 0.807932 | 3.969777e-50 | 2.239679e-47 |
MsG0080047869.01 | MsG0880044574.01 | 0.856137 | 3.942490e-62 | 9.315806e-59 |
MsG0080047869.01 | MsG0880044728.01 | 0.800947 | 1.134708e-48 | 5.352421e-46 |
MsG0080047869.01 | MsG0880044821.01 | 0.805330 | 1.406433e-49 | 7.420105e-47 |
MsG0080047869.01 | MsG0880044996.01 | 0.809586 | 1.758649e-50 | 1.036679e-47 |
MsG0080047869.01 | MsG0880045111.01 | 0.822422 | 2.389226e-53 | 1.998997e-50 |
MsG0080047869.01 | MsG0880045371.01 | 0.805452 | 1.325755e-49 | 7.016619e-47 |
MsG0080047869.01 | MsG0880045372.01 | 0.824891 | 6.314409e-54 | 5.666928e-51 |
MsG0080047869.01 | MsG0880045555.01 | -0.840933 | 6.449675e-58 | 9.329197e-55 |
MsG0080047869.01 | MsG0880045653.01 | 0.833115 | 6.418612e-56 | 7.321563e-53 |
MsG0080047869.01 | MsG0880045691.01 | 0.827716 | 1.341927e-54 | 1.306002e-51 |
MsG0080047869.01 | MsG0880045736.01 | 0.874115 | 8.687948e-68 | 3.863310e-64 |
MsG0080047869.01 | MsG0880045848.01 | 0.815024 | 1.142363e-51 | 7.787495e-49 |
MsG0080047869.01 | MsG0880045895.01 | 0.820251 | 7.568821e-53 | 5.957913e-50 |
MsG0080047869.01 | MsG0880045896.01 | 0.831918 | 1.271208e-55 | 1.399390e-52 |
MsG0080047869.01 | MsG0880045937.01 | 0.868623 | 5.689332e-66 | 2.071980e-62 |
MsG0080047869.01 | MsG0880045965.01 | 0.805370 | 1.379190e-49 | 7.283963e-47 |
MsG0080047869.01 | MsG0880046012.01 | 0.880561 | 4.961868e-70 | 2.810684e-66 |
MsG0080047869.01 | MsG0880046020.01 | 0.838745 | 2.395972e-57 | 3.239303e-54 |
MsG0080047869.01 | MsG0880046073.01 | 0.801579 | 8.425239e-49 | 4.037843e-46 |
MsG0080047869.01 | MsG0880046114.01 | 0.808314 | 3.292271e-50 | 1.876358e-47 |
MsG0080047869.01 | MsG0880046122.01 | 0.808112 | 3.634016e-50 | 2.060105e-47 |
MsG0080047869.01 | MsG0880046285.01 | 0.816013 | 6.883506e-52 | 4.821250e-49 |
MsG0080047869.01 | MsG0880046425.01 | 0.815379 | 9.528762e-52 | 6.558990e-49 |
MsG0080047869.01 | MsG0880046479.01 | 0.854070 | 1.572346e-61 | 3.469924e-58 |
MsG0080047869.01 | MsG0880046531.01 | 0.804205 | 2.415211e-49 | 1.237828e-46 |
MsG0080047869.01 | MsG0880046620.01 | 0.816637 | 4.989827e-52 | 3.554975e-49 |
MsG0080047869.01 | MsG0880046645.01 | 0.814000 | 1.924677e-51 | 1.276194e-48 |
MsG0080047869.01 | MsG0880046669.01 | 0.808030 | 3.782827e-50 | 2.139806e-47 |
MsG0080047869.01 | MsG0880046803.01 | 0.804126 | 2.508813e-49 | 1.283229e-46 |
MsG0080047869.01 | MsG0880046973.01 | 0.823724 | 1.187495e-53 | 1.030921e-50 |
MsG0080047869.01 | MsG0880047010.01 | 0.830895 | 2.269541e-55 | 2.423632e-52 |
MsG0080047869.01 | MsG0880047144.01 | 0.801666 | 8.086488e-49 | 3.883975e-46 |
MsG0080047869.01 | MsG0880047191.01 | 0.840000 | 1.131300e-57 | 1.589930e-54 |
MsG0080047869.01 | MsG0880047427.01 | 0.804936 | 1.700325e-49 | 8.880916e-47 |
MsG0080047869.01 | MsG0880047473.01 | 0.839789 | 1.284427e-57 | 1.793000e-54 |
MsG0080047869.01 | MsG0880047647.01 | 0.821026 | 5.025454e-53 | 4.042298e-50 |
MsG0080047869.01 | MsG0880047712.01 | 0.818513 | 1.884776e-52 | 1.413768e-49 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080047869.01.T01 | MTR_4g055500 | 66.200 | 429 | 53 | 8 | 1 | 363 | 218 | 620 | 0.0 | 519 |
MsG0080047869.01.T01 | MTR_4g019860 | 50.538 | 93 | 22 | 1 | 200 | 292 | 34 | 102 | 1.36e-20 | 86.7 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080047869.01.T01 | AT3G54010 | 41.725 | 429 | 156 | 9 | 1 | 363 | 125 | 525 | 9.00e-96 | 296 |
MsG0080047869.01.T01 | AT3G54010 | 41.725 | 429 | 156 | 9 | 1 | 363 | 215 | 615 | 6.52e-95 | 296 |
Find 98 sgRNAs with CRISPR-Local
Find 636 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
CCTGTACCTCACCATCTTTC+TGG | 0.127073 | contig129end:-8402 | MsG0080047869.01.T01:intergenic |
TCCATTTGAAAATTGTATTA+TGG | 0.221259 | contig129end:-8585 | MsG0080047869.01.T01:intergenic |
GATGGATTTGGATCCTCTTA+TGG | 0.228401 | contig129end:+8857 | MsG0080047869.01.T01:three_prime_UTR |
AAAGCTCGAAAACAATTTAA+AGG | 0.252297 | contig129end:+8304 | MsG0080047869.01.T01:CDS |
AATAAAGTTGTATGCATAAT+AGG | 0.255882 | contig129end:+8720 | MsG0080047869.01.T01:three_prime_UTR |
CTGTTCTCAATGAAGAAAAT+AGG | 0.258621 | contig129end:+3243 | MsG0080047869.01.T01:CDS |
TTTCCAAATGTGAAGAAGTA+TGG | 0.269003 | contig129end:-337 | MsG0080047869.01.T01:intergenic |
AGGGTTGGTTTGCTCACTTT+TGG | 0.308176 | contig129end:+8488 | MsG0080047869.01.T01:CDS |
GAACCATACTTCTTCACATT+TGG | 0.309966 | contig129end:+334 | MsG0080047869.01.T01:five_prime_UTR |
GTTTAAGTTGAATTATAGTA+TGG | 0.331521 | contig129end:-8556 | MsG0080047869.01.T01:intergenic |
ATGGATTTGGATCCTCTTAT+GGG | 0.343533 | contig129end:+8858 | MsG0080047869.01.T01:three_prime_UTR |
ATCCCCATTTCAAGACCTTT+AGG | 0.352401 | contig129end:-672 | MsG0080047869.01.T01:intergenic |
ACTGAACACAAATTTATTCC+TGG | 0.353292 | contig129end:-8659 | MsG0080047869.01.T01:intergenic |
AGCAAATCCTGCGCACGTTA+AGG | 0.369791 | contig129end:+7810 | MsG0080047869.01.T01:CDS |
CTCATCAGATGGAACGAATT+CGG | 0.389272 | contig129end:+8429 | MsG0080047869.01.T01:CDS |
TGAACAAGCTCCACTTCAAC+TGG | 0.396073 | contig129end:-788 | MsG0080047869.01.T01:intergenic |
CCAGAAAGATGGTGAGGTAC+AGG | 0.404100 | contig129end:+8402 | MsG0080047869.01.T01:CDS |
AGCAAGGGCTGATTTCAAAA+TGG | 0.405604 | contig129end:+7882 | MsG0080047869.01.T01:CDS |
GTGAGGGACGTGCTTGGAGA+TGG | 0.416863 | contig129end:+2774 | MsG0080047869.01.T01:CDS |
TGTTCTCAATGAAGAAAATA+GGG | 0.417407 | contig129end:+3244 | MsG0080047869.01.T01:CDS |
GTACCTAAAGGTCTTGAAAT+GGG | 0.422391 | contig129end:+669 | MsG0080047869.01.T01:exon |
ACTTCAGAATCTTCTATAAC+AGG | 0.425096 | contig129end:-765 | MsG0080047869.01.T01:intergenic |
GCAAATCCTGCGCACGTTAA+GGG | 0.429054 | contig129end:+7811 | MsG0080047869.01.T01:CDS |
TGCACCTGACGCAGATCAAA+AGG | 0.429264 | contig129end:+8468 | MsG0080047869.01.T01:CDS |
AAGCTCGAAAACAATTTAAA+GGG | 0.447801 | contig129end:+8305 | MsG0080047869.01.T01:CDS |
GGTACCTAAAGGTCTTGAAA+TGG | 0.448036 | contig129end:+668 | MsG0080047869.01.T01:intron |
CCAAAATTAAATCCCATAAG+AGG | 0.448332 | contig129end:-8870 | MsG0080047869.01.T01:intergenic |
TTAACTTCTGCAATTTCTCC+AGG | 0.461518 | contig129end:-8343 | MsG0080047869.01.T01:intergenic |
GGGCTATTTGACAAGAAGCC+TGG | 0.462556 | contig129end:+8325 | MsG0080047869.01.T01:CDS |
ACGTCGATTCGTGATGGAAA+AGG | 0.463088 | contig129end:+2809 | MsG0080047869.01.T01:CDS |
CCGAGGGTGCTCATATTCAA+TGG | 0.464333 | contig129end:+3764 | MsG0080047869.01.T01:CDS |
TTTCAGATCACTTTGCTACC+AGG | 0.465663 | contig129end:+8612 | MsG0080047869.01.T01:three_prime_UTR |
TCGTCGTGGAATGGCCTACA+TGG | 0.476188 | contig129end:+7840 | MsG0080047869.01.T01:CDS |
GCACCCTCGGGAACATTTGA+AGG | 0.480687 | contig129end:-3751 | MsG0080047869.01.T01:intergenic |
GAGAGTTCAGGCATGTTACC+AGG | 0.491128 | contig129end:+8641 | MsG0080047869.01.T01:three_prime_UTR |
TGATAACGATGGCCAACCAT+TGG | 0.493123 | contig129end:+3286 | MsG0080047869.01.T01:CDS |
TATAATTCAACTTAAACCAT+TGG | 0.495869 | contig129end:+8562 | MsG0080047869.01.T01:exon |
CCATTGAATATGAGCACCCT+CGG | 0.504418 | contig129end:-3764 | MsG0080047869.01.T01:intergenic |
TGCAAAGGCAAAGTATGAAA+AGG | 0.505520 | contig129end:+5702 | MsG0080047869.01.T01:CDS |
CGAGGGTGCTCATATTCAAT+GGG | 0.507803 | contig129end:+3765 | MsG0080047869.01.T01:CDS |
GTGACAAGAGCCATCTCTCC+AGG | 0.518680 | contig129end:-3556 | MsG0080047869.01.T01:intergenic |
ATTGGATTTCTGTTCTGAGA+AGG | 0.520231 | contig129end:+3304 | MsG0080047869.01.T01:CDS |
CATGAAGTAGACTGTCATGA+AGG | 0.520378 | contig129end:-3205 | MsG0080047869.01.T01:intergenic |
TCTACTTCATGTTCATTACA+AGG | 0.522997 | contig129end:+3217 | MsG0080047869.01.T01:CDS |
GAAAATTGTATTATGGCCAA+TGG | 0.524771 | contig129end:-8578 | MsG0080047869.01.T01:intergenic |
TGAGGGACGTGCTTGGAGAT+GGG | 0.527732 | contig129end:+2775 | MsG0080047869.01.T01:CDS |
TGTGTTCGTCTGATGCTACC+TGG | 0.529722 | contig129end:+3538 | MsG0080047869.01.T01:CDS |
TTCAGATCACTTTGCTACCA+GGG | 0.529792 | contig129end:+8613 | MsG0080047869.01.T01:three_prime_UTR |
TAACAGGTGAGGGACGTGCT+TGG | 0.530806 | contig129end:+2768 | MsG0080047869.01.T01:intron |
GAGGGGCAAAACAAAAGAGC+AGG | 0.538032 | contig129end:+2106 | MsG0080047869.01.T01:CDS |
GGGTCTTTATCGTCGTGGAA+TGG | 0.540148 | contig129end:+7831 | MsG0080047869.01.T01:CDS |
ATTCTGAAGTCCAGTTGAAG+TGG | 0.540387 | contig129end:+778 | MsG0080047869.01.T01:CDS |
GCCTGAACTCTCTAAAACCC+TGG | 0.554867 | contig129end:-8630 | MsG0080047869.01.T01:intergenic |
AACACACATTCAAATCCCTC+TGG | 0.572024 | contig129end:-3521 | MsG0080047869.01.T01:intergenic |
CAGAAAGATGGTGAGGTACA+GGG | 0.572472 | contig129end:+8403 | MsG0080047869.01.T01:CDS |
CAGAACAGAAATCCAATGGT+TGG | 0.573852 | contig129end:-3298 | MsG0080047869.01.T01:intergenic |
GATAAAACGTCGATTCGTGA+TGG | 0.574008 | contig129end:+2803 | MsG0080047869.01.T01:CDS |
AAAATCTCCATTGCCCATGT+AGG | 0.574139 | contig129end:-7854 | MsG0080047869.01.T01:intergenic |
ATGAAGTAGACTGTCATGAA+GGG | 0.577080 | contig129end:-3204 | MsG0080047869.01.T01:intergenic |
TGATACACTCAGGTACCTAA+AGG | 0.577159 | contig129end:+657 | MsG0080047869.01.T01:intron |
CATTGAATATGAGCACCCTC+GGG | 0.577690 | contig129end:-3763 | MsG0080047869.01.T01:intergenic |
AACAGGCATCAGAGGAGACT+CGG | 0.581482 | contig129end:-748 | MsG0080047869.01.T01:intergenic |
ACAAGTGAGATCCAGAAAGA+TGG | 0.581569 | contig129end:+8391 | MsG0080047869.01.T01:CDS |
AAAACTGAAGCAGAAAGAGC+AGG | 0.583103 | contig129end:+8038 | MsG0080047869.01.T01:CDS |
TCCCTATTACAGGACTGGAC+AGG | 0.583776 | contig129end:+4256 | MsG0080047869.01.T01:intron |
ATTACAGGACTGGACAGGAA+TGG | 0.584353 | contig129end:+4261 | MsG0080047869.01.T01:intron |
GGAATGGCCTACATGGGCAA+TGG | 0.584398 | contig129end:+7847 | MsG0080047869.01.T01:CDS |
AGGAAAATATGAACTTGCAA+AGG | 0.584639 | contig129end:+5687 | MsG0080047869.01.T01:CDS |
CTTCACATTTGGAAAATCAG+AGG | 0.586334 | contig129end:+345 | MsG0080047869.01.T01:five_prime_UTR |
GAGACAAGAGGAAGACGTAA+AGG | 0.587093 | contig129end:+2155 | MsG0080047869.01.T01:CDS |
TAAAGACCCTTAACGTGCGC+AGG | 0.589178 | contig129end:-7817 | MsG0080047869.01.T01:intergenic |
TTCTCAGAACAGAAATCCAA+TGG | 0.590369 | contig129end:-3302 | MsG0080047869.01.T01:intergenic |
AAAGAGCAGGACACTGCAGA+TGG | 0.592358 | contig129end:+2119 | MsG0080047869.01.T01:CDS |
TCTGATGCTACCTGGAGAGA+TGG | 0.593692 | contig129end:+3546 | MsG0080047869.01.T01:CDS |
GCACCTGACGCAGATCAAAA+GGG | 0.595622 | contig129end:+8469 | MsG0080047869.01.T01:CDS |
AAAGGTCTTGAAATGGGGAT+CGG | 0.596604 | contig129end:+675 | MsG0080047869.01.T01:exon |
TCTTCTATAACAGGCATCAG+AGG | 0.600715 | contig129end:-756 | MsG0080047869.01.T01:intergenic |
CTGACGCAGATCAAAAGGGT+TGG | 0.603196 | contig129end:+8473 | MsG0080047869.01.T01:CDS |
CAGGCCTTCAAATGTTCCCG+AGG | 0.604437 | contig129end:+3747 | MsG0080047869.01.T01:intron |
TACCTAAAGGTCTTGAAATG+GGG | 0.605676 | contig129end:+670 | MsG0080047869.01.T01:exon |
CTAGCACAGGACACTGCAGA+GGG | 0.609450 | contig129end:+2088 | MsG0080047869.01.T01:intron |
TGAAATGGGGATCGGAACAA+TGG | 0.613883 | contig129end:+683 | MsG0080047869.01.T01:exon |
CGTCGTGGAATGGCCTACAT+GGG | 0.615183 | contig129end:+7841 | MsG0080047869.01.T01:CDS |
CTACTTCATGTTCATTACAA+GGG | 0.619652 | contig129end:+3218 | MsG0080047869.01.T01:CDS |
TTGATCATGTCACACACAGA+AGG | 0.620413 | contig129end:+310 | None:intergenic |
GTACAGGGAGACTCATCAGA+TGG | 0.621413 | contig129end:+8418 | MsG0080047869.01.T01:CDS |
GGGTAACAGGTTGTTCAAAG+AGG | 0.629670 | contig129end:+5667 | MsG0080047869.01.T01:intron |
AGGCCTTCAAATGTTCCCGA+GGG | 0.633156 | contig129end:+3748 | MsG0080047869.01.T01:intron |
GTTAAGGGTCTTTATCGTCG+TGG | 0.634075 | contig129end:+7826 | MsG0080047869.01.T01:CDS |
TGAAGTAGACTGTCATGAAG+GGG | 0.639682 | contig129end:-3203 | MsG0080047869.01.T01:intergenic |
ACGTACTTAACTGAGACAAG+AGG | 0.654014 | contig129end:+2143 | MsG0080047869.01.T01:CDS |
TCTAGCACAGGACACTGCAG+AGG | 0.663093 | contig129end:+2087 | MsG0080047869.01.T01:intron |
TGAGATCCAGAAAGATGGTG+AGG | 0.665711 | contig129end:+8396 | MsG0080047869.01.T01:CDS |
AGCTGAAAATATCAGAAACA+CGG | 0.668935 | contig129end:+4306 | MsG0080047869.01.T01:CDS |
GAAGTAGACTGTCATGAAGG+GGG | 0.694116 | contig129end:-3202 | MsG0080047869.01.T01:intergenic |
ATCAGATGGAACGAATTCGG+AGG | 0.697245 | contig129end:+8432 | MsG0080047869.01.T01:CDS |
GACACGAGAGTTGATAACGA+TGG | 0.709689 | contig129end:+3275 | MsG0080047869.01.T01:CDS |
TAGCACAGGACACTGCAGAG+GGG | 0.798321 | contig129end:+2089 | MsG0080047869.01.T01:intron |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!! | AATAAATAATAAGTGTAAAA+TGG | - | contig129end:3370-3389 | MsG0080047869.01.T01:intergenic | 10.0% |
!! | ATATCTAATTACTTAATTAT+TGG | + | contig129end:7678-7697 | MsG0080047869.01.T01:intron | 10.0% |
!! | TTAAATAAATTTGTATAGAT+TGG | + | contig129end:4652-4671 | MsG0080047869.01.T01:intron | 10.0% |
!!! | AATAAAGTTATTTATTTTCT+AGG | + | contig129end:554-573 | MsG0080047869.01.T01:intron | 10.0% |
!!! | AGCATTTATTTATTTTTTAA+TGG | - | contig129end:8210-8229 | MsG0080047869.01.T01:intergenic | 10.0% |
!!! | ATTCTTTTTATTTTGTAAAA+TGG | + | contig129end:3041-3060 | MsG0080047869.01.T01:intron | 10.0% |
!!! | CTAATTTTTTATTTTTTATC+AGG | + | contig129end:3728-3747 | MsG0080047869.01.T01:intron | 10.0% |
!!! | GCATTTATTTATTTTTTAAT+GGG | - | contig129end:8209-8228 | MsG0080047869.01.T01:intergenic | 10.0% |
!!! | TATGTTTTATTTTGTATATA+TGG | - | contig129end:7661-7680 | MsG0080047869.01.T01:intergenic | 10.0% |
!!! | TGGTTTTTTTTTTTTTTTTT+TGG | + | contig129end:4672-4691 | MsG0080047869.01.T01:intron | 10.0% |
!!! | TTCCTTTTTATTTATTTATT+TGG | - | contig129end:2913-2932 | MsG0080047869.01.T01:intergenic | 10.0% |
!!! | TTTATTTTATAATGCTATAA+TGG | + | contig129end:391-410 | MsG0080047869.01.T01:intron | 10.0% |
!! | AATAAAATTAATGAACAGAA+TGG | + | contig129end:7416-7435 | MsG0080047869.01.T01:intron | 15.0% |
!! | AGCCAAATAAATAAATAAAA+AGG | + | contig129end:2908-2927 | MsG0080047869.01.T01:intron | 15.0% |
!! | ATAATACTATAGAAAATGTT+CGG | - | contig129end:5462-5481 | MsG0080047869.01.T01:intergenic | 15.0% |
!! | ATATCTAAACTTATATTGAA+AGG | + | contig129end:6932-6951 | MsG0080047869.01.T01:intron | 15.0% |
!! | TATATAAGAAAATAACTGAT+TGG | - | contig129end:8078-8097 | MsG0080047869.01.T01:intergenic | 15.0% |
!! | TATTCCAATGAAATAAATAA+AGG | - | contig129end:7400-7419 | MsG0080047869.01.T01:intergenic | 15.0% |
!! | TCCAAAAAATAATCAAATAT+CGG | + | contig129end:5494-5513 | MsG0080047869.01.T01:intron | 15.0% |
!!! | AATATCCTTGAAAATTTTAA+TGG | + | contig129end:4612-4631 | MsG0080047869.01.T01:intron | 15.0% |
!!! | AATATTTTTCAAATTACCTT+TGG | - | contig129end:3817-3836 | MsG0080047869.01.T01:intergenic | 15.0% |
!!! | AATTTTTAAAACTTTTTCGA+GGG | + | contig129end:5415-5434 | MsG0080047869.01.T01:intron | 15.0% |
!!! | ACTTTTATTTCATAGATTAA+AGG | - | contig129end:1620-1639 | MsG0080047869.01.T01:intergenic | 15.0% |
!!! | ATTAAGATTATTTTGTGTTT+TGG | + | contig129end:4001-4020 | MsG0080047869.01.T01:intron | 15.0% |
!!! | ATTGTCATTTGTATTTATTT+TGG | - | contig129end:537-556 | MsG0080047869.01.T01:intergenic | 15.0% |
!!! | GATAAAAAATTACTTTTTCT+TGG | + | contig129end:894-913 | MsG0080047869.01.T01:intron | 15.0% |
!!! | GTTTTAGAAATTATGTAATA+GGG | - | contig129end:6720-6739 | MsG0080047869.01.T01:intergenic | 15.0% |
!!! | TGTTTTAGAAATTATGTAAT+AGG | - | contig129end:6721-6740 | MsG0080047869.01.T01:intergenic | 15.0% |
!!! | TTGTCATTTGTATTTATTTT+GGG | - | contig129end:536-555 | MsG0080047869.01.T01:intergenic | 15.0% |
!!! | TTTTAAAAATTGAGTCAATT+TGG | - | contig129end:5406-5425 | MsG0080047869.01.T01:intergenic | 15.0% |
!!! | TTTTATTTTGTATATATGGT+AGG | - | contig129end:7657-7676 | MsG0080047869.01.T01:intergenic | 15.0% |
!! | AAAAAATAGTGTTACCAAAT+GGG | - | contig129end:1152-1171 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | AAATCAGGTAAAAGTAAAAA+CGG | - | contig129end:984-1003 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | AATAAAGTTGTATGCATAAT+AGG | + | contig129end:8720-8739 | MsG0080047869.01.T01:three_prime_UTR | 20.0% |
!! | AATCAGGAAATAAAAAAGTT+TGG | - | contig129end:494-513 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | ACATTTCATGTACAAAATAT+TGG | - | contig129end:2563-2582 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | AGAAATAGAAAATAATGTTG+TGG | + | contig129end:2933-2952 | MsG0080047869.01.T01:intron | 20.0% |
!! | ATAAAGAACATATTCAATCA+GGG | - | contig129end:3656-3675 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | ATACAAAAAACAGAGATTAT+GGG | + | contig129end:2865-2884 | MsG0080047869.01.T01:intron | 20.0% |
!! | ATAGATAAAGAAGTGATTAT+TGG | + | contig129end:4804-4823 | MsG0080047869.01.T01:intron | 20.0% |
!! | ATCAGGAAATAAAAAAGTTT+GGG | - | contig129end:493-512 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | ATGTAAAATAGAAACCAAAA+TGG | - | contig129end:4190-4209 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | ATTTGTAGAAGATGATTTAT+TGG | + | contig129end:7470-7489 | MsG0080047869.01.T01:intron | 20.0% |
!! | GACTTATATAAAGACTAATT+TGG | - | contig129end:6090-6109 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | GTATTTATCTGTTGAAATTT+GGG | - | contig129end:1598-1617 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | TAAAAAATAGTGTTACCAAA+TGG | - | contig129end:1153-1172 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | TAAACTTATATTGAAAGGAT+TGG | + | contig129end:6937-6956 | MsG0080047869.01.T01:intron | 20.0% |
!! | TAAGCATAAGGATAAAAAAT+TGG | - | contig129end:3084-3103 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | TAATACTATAGAAAATGTTC+GGG | - | contig129end:5461-5480 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | TATAATTCAACTTAAACCAT+TGG | + | contig129end:8562-8581 | MsG0080047869.01.T01:exon | 20.0% |
!! | TATTTATCTGTTGAAATTTG+GGG | - | contig129end:1597-1616 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | TCCATTTGAAAATTGTATTA+TGG | - | contig129end:8588-8607 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | TGAATACAGCATAAATTATA+GGG | + | contig129end:1730-1749 | MsG0080047869.01.T01:intron | 20.0% |
!! | TGTAAAATAGAAACCAAAAT+GGG | - | contig129end:4189-4208 | MsG0080047869.01.T01:intergenic | 20.0% |
!! | TGTATTTGTTTGTAAACAAT+AGG | + | contig129end:3161-3180 | MsG0080047869.01.T01:intron | 20.0% |
!! | TTGAATACAGCATAAATTAT+AGG | + | contig129end:1729-1748 | MsG0080047869.01.T01:intron | 20.0% |
!!! | AATATTTTGTACATGAAATG+TGG | + | contig129end:2562-2581 | MsG0080047869.01.T01:intron | 20.0% |
!!! | AATTATACACTGATTTCATT+TGG | + | contig129end:5612-5631 | MsG0080047869.01.T01:intron | 20.0% |
!!! | ACCGATATTTGATTATTTTT+TGG | - | contig129end:5498-5517 | MsG0080047869.01.T01:intergenic | 20.0% |
!!! | ACTGACTTACTTTTTTATTT+GGG | - | contig129end:6399-6418 | MsG0080047869.01.T01:intergenic | 20.0% |
!!! | ATAATACAATTTTCAAATGG+AGG | + | contig129end:8587-8606 | MsG0080047869.01.T01:three_prime_UTR | 20.0% |
!!! | ATTAGTCTTTATATAAGTCT+CGG | + | contig129end:6091-6110 | MsG0080047869.01.T01:intron | 20.0% |
!!! | ATTCTAGTTATTTACTATAG+TGG | + | contig129end:3844-3863 | MsG0080047869.01.T01:intron | 20.0% |
!!! | ATTTTATAATGCTATAATGG+TGG | + | contig129end:394-413 | MsG0080047869.01.T01:intron | 20.0% |
!!! | CAATTTTTAAAACTTTTTCG+AGG | + | contig129end:5414-5433 | MsG0080047869.01.T01:intron | 20.0% |
!!! | GTAATATTGTTTTTGAACTA+TGG | + | contig129end:5114-5133 | MsG0080047869.01.T01:intron | 20.0% |
!!! | GTTTAAGTTGAATTATAGTA+TGG | - | contig129end:8559-8578 | MsG0080047869.01.T01:intergenic | 20.0% |
!!! | TATTTTTTAAAACTCAGACA+TGG | + | contig129end:1164-1183 | MsG0080047869.01.T01:intron | 20.0% |
!!! | TATTTTTTAATGGGAAATGT+TGG | - | contig129end:8200-8219 | MsG0080047869.01.T01:intergenic | 20.0% |
!!! | TCAACTTTCTTTAGAATATA+AGG | + | contig129end:7918-7937 | MsG0080047869.01.T01:intron | 20.0% |
!!! | TGTCATTTGTATTTATTTTG+GGG | - | contig129end:535-554 | MsG0080047869.01.T01:intergenic | 20.0% |
!!! | TTGATAACATGAATCATAAA+GGG | - | contig129end:7622-7641 | MsG0080047869.01.T01:intergenic | 20.0% |
!!! | TTGTAATAAGGTATGTTTTA+TGG | + | contig129end:7357-7376 | MsG0080047869.01.T01:intron | 20.0% |
!!! | TTGTATGAAATTTCATTTTC+TGG | + | contig129end:5090-5109 | MsG0080047869.01.T01:intron | 20.0% |
! | AAACTTGAAAACTATCTCAT+AGG | - | contig129end:4055-4074 | MsG0080047869.01.T01:intergenic | 25.0% |
! | AAAGAATGAAAACTGAGAAA+AGG | - | contig129end:3028-3047 | MsG0080047869.01.T01:intergenic | 25.0% |
! | AAAGCTCGAAAACAATTTAA+AGG | + | contig129end:8304-8323 | MsG0080047869.01.T01:CDS | 25.0% |
! | AAATTATGTAATAGGGTAAC+TGG | - | contig129end:6713-6732 | MsG0080047869.01.T01:intergenic | 25.0% |
! | AAGCTCGAAAACAATTTAAA+GGG | + | contig129end:8305-8324 | MsG0080047869.01.T01:CDS | 25.0% |
! | AAGTGAAATCACTAAATTCA+AGG | - | contig129end:1111-1130 | MsG0080047869.01.T01:intergenic | 25.0% |
! | AATGAAAGGAAATAAAAGCA+AGG | - | contig129end:4908-4927 | MsG0080047869.01.T01:intergenic | 25.0% |
! | AATTATGTAATAGGGTAACT+GGG | - | contig129end:6712-6731 | MsG0080047869.01.T01:intergenic | 25.0% |
! | ACTATGACTTTATTCTTACA+CGG | + | contig129end:8251-8270 | MsG0080047869.01.T01:intron | 25.0% |
! | ACTTTGTAAATGTAAGCATA+AGG | - | contig129end:3096-3115 | MsG0080047869.01.T01:intergenic | 25.0% |
! | AGATGAAAAAATTCTACTAC+CGG | - | contig129end:8518-8537 | MsG0080047869.01.T01:intergenic | 25.0% |
! | AGGATATTATCCTAAAAGAA+AGG | - | contig129end:4600-4619 | MsG0080047869.01.T01:intergenic | 25.0% |
! | ATAAGTGTAAAATGGAACAT+TGG | - | contig129end:3362-3381 | MsG0080047869.01.T01:intergenic | 25.0% |
! | ATAATACAAGGATAAAATCC+AGG | - | contig129end:2658-2677 | MsG0080047869.01.T01:intergenic | 25.0% |
! | ATATATGAATAGGTGTCTTT+AGG | + | contig129end:5062-5081 | MsG0080047869.01.T01:intron | 25.0% |
! | ATATGATGCATGAACAAATA+TGG | - | contig129end:6029-6048 | MsG0080047869.01.T01:intergenic | 25.0% |
! | ATCCAAGTATTTACTAACTA+CGG | + | contig129end:4959-4978 | MsG0080047869.01.T01:intron | 25.0% |
! | ATCTGTATATAAACACTGAA+AGG | + | contig129end:1056-1075 | MsG0080047869.01.T01:intron | 25.0% |
! | ATGAAAGGAAATAAAAGCAA+GGG | - | contig129end:4907-4926 | MsG0080047869.01.T01:intergenic | 25.0% |
! | ATTAAAATAGTAGTCAATCC+CGG | - | contig129end:5579-5598 | MsG0080047869.01.T01:intergenic | 25.0% |
! | ATTTAGTGATTTCACTTTCT+AGG | + | contig129end:1114-1133 | MsG0080047869.01.T01:intron | 25.0% |
! | CAACAGTTAAAAAATTAGCA+AGG | - | contig129end:838-857 | MsG0080047869.01.T01:intergenic | 25.0% |
! | CATAAAGAACATATTCAATC+AGG | - | contig129end:3657-3676 | MsG0080047869.01.T01:intergenic | 25.0% |
! | CATAATGTTAATAAGATCGA+TGG | - | contig129end:7046-7065 | MsG0080047869.01.T01:intergenic | 25.0% |
! | CATACAAAAAACAGAGATTA+TGG | + | contig129end:2864-2883 | MsG0080047869.01.T01:intron | 25.0% |
! | CATAGTAATTGAATTGTACT+TGG | + | contig129end:6193-6212 | MsG0080047869.01.T01:intron | 25.0% |
! | CATTTATATGTGGCAATTAT+AGG | + | contig129end:3872-3891 | MsG0080047869.01.T01:intron | 25.0% |
! | CTAGTAAAGTATATAACGAT+TGG | - | contig129end:926-945 | MsG0080047869.01.T01:intergenic | 25.0% |
! | CTTTATGATTCATGTTATCA+AGG | + | contig129end:7621-7640 | MsG0080047869.01.T01:intron | 25.0% |
! | GGATATTATCCTAAAAGAAA+GGG | - | contig129end:4599-4618 | MsG0080047869.01.T01:intergenic | 25.0% |
! | GGTATTTATCTGTTGAAATT+TGG | - | contig129end:1599-1618 | MsG0080047869.01.T01:intergenic | 25.0% |
! | TACACATAGTACCATATTTA+AGG | + | contig129end:6537-6556 | MsG0080047869.01.T01:intron | 25.0% |
! | TACTTATGACTCCTTAAATA+TGG | - | contig129end:6551-6570 | MsG0080047869.01.T01:intergenic | 25.0% |
! | TATGATGCATGAACAAATAT+GGG | - | contig129end:6028-6047 | MsG0080047869.01.T01:intergenic | 25.0% |
! | TATTAACATTATGTGGTAGT+TGG | + | contig129end:7053-7072 | MsG0080047869.01.T01:intron | 25.0% |
! | TCGATCTTATTAACATTATG+TGG | + | contig129end:7046-7065 | MsG0080047869.01.T01:intron | 25.0% |
! | TCTTTATCCTGATTGAAAAA+TGG | - | contig129end:2339-2358 | MsG0080047869.01.T01:intergenic | 25.0% |
! | TGTTCTCAATGAAGAAAATA+GGG | + | contig129end:3244-3263 | MsG0080047869.01.T01:CDS | 25.0% |
! | TTAATAAGATCGATGGTAAA+GGG | - | contig129end:7039-7058 | MsG0080047869.01.T01:intergenic | 25.0% |
! | TTACATACATGTTAGAAATC+AGG | - | contig129end:999-1018 | MsG0080047869.01.T01:intergenic | 25.0% |
! | TTTCTAACATGTATGTAATG+TGG | + | contig129end:1001-1020 | MsG0080047869.01.T01:intron | 25.0% |
!! | AAAGGTGATATCTTTAAGTT+AGG | - | contig129end:4532-4551 | MsG0080047869.01.T01:intergenic | 25.0% |
!! | AATTCATTGATTGATCAGAA+AGG | - | contig129end:4550-4569 | MsG0080047869.01.T01:intergenic | 25.0% |
!! | ATATAAACACTGAAAGGTTT+TGG | + | contig129end:1062-1081 | MsG0080047869.01.T01:intron | 25.0% |
!! | ATATATGTTTGAGACATCAT+GGG | + | contig129end:8093-8112 | MsG0080047869.01.T01:intron | 25.0% |
!! | ATTTTGTAAAATGGTATGCA+GGG | + | contig129end:3050-3069 | MsG0080047869.01.T01:intron | 25.0% |
!! | CTTGATAACATGAATCATAA+AGG | - | contig129end:7623-7642 | MsG0080047869.01.T01:intergenic | 25.0% |
!! | GAATAACAACAATAACCTTT+TGG | + | contig129end:2273-2292 | MsG0080047869.01.T01:intron | 25.0% |
!! | GCCATAATACAATTTTCAAA+TGG | + | contig129end:8584-8603 | MsG0080047869.01.T01:three_prime_UTR | 25.0% |
!! | GGATGGTTTTTATGTATTTA+CGG | - | contig129end:6691-6710 | MsG0080047869.01.T01:intergenic | 25.0% |
!! | GGGTAACTTTATTTCATATA+GGG | - | contig129end:1780-1799 | MsG0080047869.01.T01:intergenic | 25.0% |
!! | GTAGCCTTTATTTATTTCAT+TGG | + | contig129end:7393-7412 | MsG0080047869.01.T01:intron | 25.0% |
!! | TAAAGGGTATACATAATGAA+AGG | - | contig129end:4922-4941 | MsG0080047869.01.T01:intergenic | 25.0% |
!! | TATATATGTTTGAGACATCA+TGG | + | contig129end:8092-8111 | MsG0080047869.01.T01:intron | 25.0% |
!! | TATTGATTATTTCCCAATGT+TGG | + | contig129end:5142-5161 | MsG0080047869.01.T01:intron | 25.0% |
!! | TATTTTGTAAAATGGTATGC+AGG | + | contig129end:3049-3068 | MsG0080047869.01.T01:intron | 25.0% |
!! | TGCTTTTAATAAACTATGCA+AGG | + | contig129end:2497-2516 | MsG0080047869.01.T01:intron | 25.0% |
!! | TGGGTAACTTTATTTCATAT+AGG | - | contig129end:1781-1800 | MsG0080047869.01.T01:intergenic | 25.0% |
!! | TTAGTCTTTATATAAGTCTC+GGG | + | contig129end:6092-6111 | MsG0080047869.01.T01:intron | 25.0% |
!! | TTTTAACAACTACTTCACTT+TGG | - | contig129end:8762-8781 | MsG0080047869.01.T01:intergenic | 25.0% |
!! | TTTTAATAAACTATGCAAGG+AGG | + | contig129end:2500-2519 | MsG0080047869.01.T01:intron | 25.0% |
!! | TTTTCTTCTAACAAGATGTT+TGG | + | contig129end:2717-2736 | MsG0080047869.01.T01:intron | 25.0% |
!! | TTTTGGTACAATGTATAGAT+TGG | + | contig129end:4689-4708 | MsG0080047869.01.T01:intron | 25.0% |
!!! | AAAGAGAGTAAGTTTTAGTA+TGG | - | contig129end:7258-7277 | MsG0080047869.01.T01:intergenic | 25.0% |
!!! | AAGATTATTTTGTGTTTTGG+TGG | + | contig129end:4004-4023 | MsG0080047869.01.T01:intron | 25.0% |
!!! | AATGAATTAGTTTTCTGACT+TGG | + | contig129end:4562-4581 | MsG0080047869.01.T01:intron | 25.0% |
!!! | AGTAGAATTTTTTCATCTCT+TGG | + | contig129end:8520-8539 | MsG0080047869.01.T01:CDS | 25.0% |
!!! | ATACTTTACTAGTTTTACTG+TGG | + | contig129end:934-953 | MsG0080047869.01.T01:intron | 25.0% |
!!! | CATTTTGGTACAGAAAAATA+AGG | + | contig129end:1811-1830 | MsG0080047869.01.T01:intron | 25.0% |
!!! | GACTGACTTACTTTTTTATT+TGG | - | contig129end:6400-6419 | MsG0080047869.01.T01:intergenic | 25.0% |
!!! | GTCATTTGTATTTATTTTGG+GGG | - | contig129end:534-553 | MsG0080047869.01.T01:intergenic | 25.0% |
!!! | TATTATTTTGACTTGATGTG+AGG | + | contig129end:8805-8824 | MsG0080047869.01.T01:three_prime_UTR | 25.0% |
!!! | TCTCTTTTGTTTTTCTTTTC+AGG | + | contig129end:3496-3515 | MsG0080047869.01.T01:intron | 25.0% |
!!! | TGAAGTAAATGTTTTTGAGA+AGG | - | contig129end:6628-6647 | MsG0080047869.01.T01:intergenic | 25.0% |
!!! | TTCTATTACTAGTGTTTTGA+TGG | + | contig129end:4370-4389 | MsG0080047869.01.T01:intron | 25.0% |
AAAGAAAGCTAAAGACTTAG+AGG | + | contig129end:2213-2232 | MsG0080047869.01.T01:intron | 30.0% | |
AAATACTTGGATAGTTAGAG+AGG | - | contig129end:4951-4970 | MsG0080047869.01.T01:intergenic | 30.0% | |
AAATCCAAGTGATCATTAAG+AGG | - | contig129end:6997-7016 | MsG0080047869.01.T01:intergenic | 30.0% | |
AAATCCTAGCACAGAAAATT+TGG | - | contig129end:6870-6889 | MsG0080047869.01.T01:intergenic | 30.0% | |
AAATGAACTACTACCAACAT+TGG | - | contig129end:5158-5177 | MsG0080047869.01.T01:intergenic | 30.0% | |
AAGAAAGCTAAAGACTTAGA+GGG | + | contig129end:2214-2233 | MsG0080047869.01.T01:intron | 30.0% | |
AAGGATATATTCTGTACATC+CGG | + | contig129end:7719-7738 | MsG0080047869.01.T01:intron | 30.0% | |
AATACTTGGATAGTTAGAGA+GGG | - | contig129end:4950-4969 | MsG0080047869.01.T01:intergenic | 30.0% | |
AATGAACTACTACCAACATT+GGG | - | contig129end:5157-5176 | MsG0080047869.01.T01:intergenic | 30.0% | |
ACTGAACACAAATTTATTCC+TGG | - | contig129end:8662-8681 | MsG0080047869.01.T01:intergenic | 30.0% | |
ACTGAACATAAATGATCAAC+TGG | - | contig129end:3126-3145 | MsG0080047869.01.T01:intergenic | 30.0% | |
ACTGATAAGATTTGCATCTA+AGG | + | contig129end:6168-6187 | MsG0080047869.01.T01:intron | 30.0% | |
ACTTCAGAATCTTCTATAAC+AGG | - | contig129end:768-787 | MsG0080047869.01.T01:intergenic | 30.0% | |
AGAAATTCTATTACACCCTA+GGG | + | contig129end:4828-4847 | MsG0080047869.01.T01:intron | 30.0% | |
AGATGCAAATCTTATCAGTT+GGG | - | contig129end:6167-6186 | MsG0080047869.01.T01:intergenic | 30.0% | |
AGCTGAAAATATCAGAAACA+CGG | + | contig129end:4306-4325 | MsG0080047869.01.T01:CDS | 30.0% | |
AGGAAAATATGAACTTGCAA+AGG | + | contig129end:5687-5706 | MsG0080047869.01.T01:CDS | 30.0% | |
ATAAAGGGAAGTAGTTTAAG+TGG | - | contig129end:7607-7626 | MsG0080047869.01.T01:intergenic | 30.0% | |
ATCATAGAACAAAATGACAG+TGG | - | contig129end:3686-3705 | MsG0080047869.01.T01:intergenic | 30.0% | |
ATGAAAACTGAGAAAAGGAA+AGG | - | contig129end:3023-3042 | MsG0080047869.01.T01:intergenic | 30.0% | |
ATGAAGTGCATGAAAATGAA+AGG | - | contig129end:3450-3469 | MsG0080047869.01.T01:intergenic | 30.0% | |
ATGTAAAAATGATAACCCTG+AGG | - | contig129end:6286-6305 | MsG0080047869.01.T01:intergenic | 30.0% | |
ATTAGATACATTCTCAGAGT+AGG | + | contig129end:2249-2268 | MsG0080047869.01.T01:intron | 30.0% | |
ATTATCCTAAAAGAAAGGGA+CGG | - | contig129end:4595-4614 | MsG0080047869.01.T01:intergenic | 30.0% | |
CAATCTATCAGTCATAAGTT+AGG | - | contig129end:7227-7246 | MsG0080047869.01.T01:intergenic | 30.0% | |
CAGACACAACTAATAATACA+AGG | - | contig129end:2670-2689 | MsG0080047869.01.T01:intergenic | 30.0% | |
CAGATCATAGCTGAAATATT+TGG | - | contig129end:459-478 | MsG0080047869.01.T01:intergenic | 30.0% | |
CATCCTTCCAAACAATAATT+AGG | - | contig129end:6479-6498 | MsG0080047869.01.T01:intergenic | 30.0% | |
CTAAAACCTCTGCAATAAAT+AGG | - | contig129end:5761-5780 | MsG0080047869.01.T01:intergenic | 30.0% | |
CTAAAGAAAGTTGAGTATGA+AGG | - | contig129end:7912-7931 | MsG0080047869.01.T01:intergenic | 30.0% | |
CTACTTCATGTTCATTACAA+GGG | + | contig129end:3218-3237 | MsG0080047869.01.T01:CDS | 30.0% | |
CTATTCATATATTCCAGAGA+GGG | - | contig129end:5054-5073 | MsG0080047869.01.T01:intergenic | 30.0% | |
CTCATAGGAGAATATTTGTA+TGG | - | contig129end:4040-4059 | MsG0080047869.01.T01:intergenic | 30.0% | |
CTGTTCTCAATGAAGAAAAT+AGG | + | contig129end:3243-3262 | MsG0080047869.01.T01:CDS | 30.0% | |
CTTGCTGGAATTATATTAAC+AGG | + | contig129end:2752-2771 | MsG0080047869.01.T01:intron | 30.0% | |
GAAAATTGTATTATGGCCAA+TGG | - | contig129end:8581-8600 | MsG0080047869.01.T01:intergenic | 30.0% | |
GAATGGCATATAGCAATAAT+TGG | + | contig129end:7433-7452 | MsG0080047869.01.T01:intron | 30.0% | |
GATTATATCTCTAGTCTATG+TGG | - | contig129end:5846-5865 | MsG0080047869.01.T01:intergenic | 30.0% | |
GGAATTATATTAACAGGTGA+GGG | + | contig129end:2758-2777 | MsG0080047869.01.T01:intron | 30.0% | |
GGTGTCTCAATATATCATTT+GGG | - | contig129end:2311-2330 | MsG0080047869.01.T01:intergenic | 30.0% | |
GTTAATAAGATCGATGGTAA+AGG | - | contig129end:7040-7059 | MsG0080047869.01.T01:intergenic | 30.0% | |
GTTTAGTGCAATGAAAAAGA+TGG | + | contig129end:8839-8858 | MsG0080047869.01.T01:three_prime_UTR | 30.0% | |
TAAAGGGAAGTAGTTTAAGT+GGG | - | contig129end:7606-7625 | MsG0080047869.01.T01:intergenic | 30.0% | |
TAATCAGTTCGTAACAGAAT+TGG | - | contig129end:5010-5029 | MsG0080047869.01.T01:intergenic | 30.0% | |
TAGATGCAAATCTTATCAGT+TGG | - | contig129end:6168-6187 | MsG0080047869.01.T01:intergenic | 30.0% | |
TAGGAACATTGCAATATGAA+GGG | - | contig129end:1355-1374 | MsG0080047869.01.T01:intergenic | 30.0% | |
TATTCATATATTCCAGAGAG+GGG | - | contig129end:5053-5072 | MsG0080047869.01.T01:intergenic | 30.0% | |
TCTACTTCATGTTCATTACA+AGG | + | contig129end:3217-3236 | MsG0080047869.01.T01:CDS | 30.0% | |
TCTGAGAAGAGTTTATAAAG+AGG | + | contig129end:1526-1545 | MsG0080047869.01.T01:intron | 30.0% | |
TGACCTAATTATTGTTTGGA+AGG | + | contig129end:6473-6492 | MsG0080047869.01.T01:intron | 30.0% | |
TGGAATTATATTAACAGGTG+AGG | + | contig129end:2757-2776 | MsG0080047869.01.T01:intron | 30.0% | |
TGTATATATGGTAGGAATCA+TGG | - | contig129end:7649-7668 | MsG0080047869.01.T01:intergenic | 30.0% | |
TGTTCATGCATCATATATGA+GGG | + | contig129end:6033-6052 | MsG0080047869.01.T01:intron | 30.0% | |
TTAATATGCCTGATGCATTA+CGG | + | contig129end:4227-4246 | MsG0080047869.01.T01:intron | 30.0% | |
TTATGTATTTACGGTGATTC+CGG | - | contig129end:6682-6701 | MsG0080047869.01.T01:intergenic | 30.0% | |
TTCTGTGTTTAAGTAGTCAA+TGG | + | contig129end:5232-5251 | MsG0080047869.01.T01:intron | 30.0% | |
TTGTTCATGCATCATATATG+AGG | + | contig129end:6032-6051 | MsG0080047869.01.T01:intron | 30.0% | |
TTTAAATAAGCGATCATGCA+TGG | - | contig129end:3420-3439 | MsG0080047869.01.T01:intergenic | 30.0% | |
TTTAACTGTTGTGACATGTA+TGG | + | contig129end:847-866 | MsG0080047869.01.T01:intron | 30.0% | |
TTTAGATGCTCCAACTTATA+CGG | - | contig129end:6756-6775 | MsG0080047869.01.T01:intergenic | 30.0% | |
TTTATTTCATATAGGGCCTT+AGG | - | contig129end:1773-1792 | MsG0080047869.01.T01:intergenic | 30.0% | |
TTTCCAAATGTGAAGAAGTA+TGG | - | contig129end:340-359 | MsG0080047869.01.T01:intergenic | 30.0% | |
! | AAATAAAAGCAAGGGCTTTT+CGG | - | contig129end:4899-4918 | MsG0080047869.01.T01:intergenic | 30.0% |
! | AACAATAGGTGATTTTCCAA+TGG | + | contig129end:3175-3194 | MsG0080047869.01.T01:intron | 30.0% |
! | AACCTTAGATTTAAAGCTTC+CGG | + | contig129end:6660-6679 | MsG0080047869.01.T01:intron | 30.0% |
! | ACATATTGAGCTAGGTTTTA+GGG | + | contig129end:5898-5917 | MsG0080047869.01.T01:intron | 30.0% |
! | ACGGATACGATTAATTTTGT+AGG | + | contig129end:8270-8289 | MsG0080047869.01.T01:intron | 30.0% |
! | AGATTAGTTGACAATGTGAT+AGG | + | contig129end:4768-4787 | MsG0080047869.01.T01:intron | 30.0% |
! | CGTCTCCATTAAAATTTTCA+AGG | - | contig129end:4620-4639 | MsG0080047869.01.T01:intergenic | 30.0% |
! | CTATGTGGATTTAAAACACA+TGG | - | contig129end:5831-5850 | MsG0080047869.01.T01:intergenic | 30.0% |
! | CTTTCTGATAGTTTGAAACT+GGG | + | contig129end:6792-6811 | MsG0080047869.01.T01:intron | 30.0% |
! | CTTTTAGATAGTGCAGTTTT+AGG | + | contig129end:5783-5802 | MsG0080047869.01.T01:intron | 30.0% |
! | TATATGTTTGAGACATCATG+GGG | + | contig129end:8094-8113 | MsG0080047869.01.T01:intron | 30.0% |
! | TCTTTCTGATAGTTTGAAAC+TGG | + | contig129end:6791-6810 | MsG0080047869.01.T01:intron | 30.0% |
! | TGCAATGAAAAAGATGGATT+TGG | + | contig129end:8845-8864 | MsG0080047869.01.T01:three_prime_UTR | 30.0% |
! | TTTCTGATAGTTTGAAACTG+GGG | + | contig129end:6793-6812 | MsG0080047869.01.T01:intron | 30.0% |
!! | GCATTTTGGTACAGAAAATA+AGG | + | contig129end:1655-1674 | MsG0080047869.01.T01:intron | 30.0% |
!! | TCAGGGTTATCATTTTTACA+TGG | + | contig129end:6285-6304 | MsG0080047869.01.T01:intron | 30.0% |
!!! | GACATCTTTTAGCTAGTTTT+AGG | + | contig129end:6122-6141 | MsG0080047869.01.T01:intron | 30.0% |
!!! | GGTAGTAGTTCATTTTTTGT+AGG | + | contig129end:5163-5182 | MsG0080047869.01.T01:intron | 30.0% |
!!! | TCTATCTTTTGAAATGCCAA+AGG | + | contig129end:3798-3817 | MsG0080047869.01.T01:CDS | 30.0% |
AAAACCTAGCTCAATATGTG+AGG | - | contig129end:5897-5916 | MsG0080047868.01.T01:intergenic | 35.0% | |
AAAGAAAAGAGGGTAGGAAT+GGG | - | contig129end:2007-2026 | MsG0080047869.01.T01:intergenic | 35.0% | |
AAATCAAATAGCAGCCAAAG+CGG | - | contig129end:5370-5389 | MsG0080047869.01.T01:intergenic | 35.0% | |
AAGAAAAGTTAACATCGCCA+CGG | - | contig129end:2439-2458 | MsG0080047869.01.T01:intergenic | 35.0% | |
AATCTTATCAGTTGGGCATT+AGG | - | contig129end:6160-6179 | MsG0080047869.01.T01:intergenic | 35.0% | |
AATGCATTCAGTGTAACCAT+AGG | - | contig129end:4736-4755 | MsG0080047869.01.T01:intergenic | 35.0% | |
AATTCCTCACATATTGAGCT+AGG | + | contig129end:5890-5909 | MsG0080047869.01.T01:intron | 35.0% | |
ACCAATAACATATCGAGAGT+AGG | - | contig129end:5948-5967 | MsG0080047869.01.T01:intergenic | 35.0% | |
ACCCATTAAGGTGAATAAGT+GGG | + | contig129end:1306-1325 | MsG0080047869.01.T01:intron | 35.0% | |
ACTTGTCATAAGCATAGTCT+CGG | - | contig129end:3586-3605 | MsG0080047869.01.T01:intergenic | 35.0% | |
AGATTACTGCACCATGTTTA+AGG | - | contig129end:1040-1059 | MsG0080047869.01.T01:intergenic | 35.0% | |
AGCCGTAGTTAGTAAATACT+TGG | - | contig129end:4964-4983 | MsG0080047869.01.T01:intergenic | 35.0% | |
AGGAACATTGCAATATGAAG+GGG | - | contig129end:1354-1373 | MsG0080047869.01.T01:intergenic | 35.0% | |
AGTGGATGCACATTTATATG+TGG | + | contig129end:3862-3881 | MsG0080047869.01.T01:intron | 35.0% | |
ATAAAGTTACCCAAGTTACG+AGG | + | contig129end:1788-1807 | MsG0080047869.01.T01:intron | 35.0% | |
ATAATGTTGTGGAAAATGCC+TGG | + | contig129end:2944-2963 | MsG0080047869.01.T01:intron | 35.0% | |
ATAGACAGCTAAGTTACCTA+TGG | + | contig129end:4717-4736 | MsG0080047869.01.T01:intron | 35.0% | |
ATCTATAGTCGTGTTGGATT+TGG | - | contig129end:6063-6082 | MsG0080047869.01.T01:intergenic | 35.0% | |
ATGAAGTAGACTGTCATGAA+GGG | - | contig129end:3207-3226 | MsG0080047869.01.T01:intergenic | 35.0% | |
ATGATGCTTCATGACACTAT+AGG | + | contig129end:3701-3720 | MsG0080047869.01.T01:intron | 35.0% | |
ATGCAAGGAGGATGAATAAT+CGG | + | contig129end:2512-2531 | MsG0080047869.01.T01:intron | 35.0% | |
ATGCTTATGACAAGTTTCCA+AGG | + | contig129end:3591-3610 | MsG0080047869.01.T01:intron | 35.0% | |
ATGGATTTGGATCCTCTTAT+GGG | + | contig129end:8858-8877 | MsG0080047869.01.T01:three_prime_UTR | 35.0% | |
ATTTCACTTTCTAGGCTTGA+TGG | + | contig129end:1122-1141 | MsG0080047869.01.T01:intron | 35.0% | |
CAGAAATTCTATTACACCCT+AGG | + | contig129end:4827-4846 | MsG0080047869.01.T01:intron | 35.0% | |
CCATATGTAGAAAATCGTGT+AGG | - | contig129end:4344-4363 | MsG0080047869.01.T01:intergenic | 35.0% | |
CCTATTCATATATTCCAGAG+AGG | - | contig129end:5055-5074 | MsG0080047869.01.T01:intergenic | 35.0% | |
CCTGATTGAAAAATGGTGTT+CGG | - | contig129end:2332-2351 | MsG0080047869.01.T01:intergenic | 35.0% | |
CGGTGTCTCAATATATCATT+TGG | - | contig129end:2312-2331 | MsG0080047869.01.T01:intergenic | 35.0% | |
CTAAAAGTTCATCAACACCT+TGG | - | contig129end:3611-3630 | MsG0080047869.01.T01:intergenic | 35.0% | |
CTAACTCATCCTTACAAAAC+CGG | - | contig129end:1573-1592 | MsG0080047869.01.T01:intergenic | 35.0% | |
CTATGTGTAATTCTGACCTA+CGG | - | contig129end:6526-6545 | MsG0080047869.01.T01:intergenic | 35.0% | |
CTATTGTATGAAAGAACAGC+AGG | + | contig129end:4088-4107 | MsG0080047869.01.T01:intron | 35.0% | |
CTCATGCTGTAGTTATTACA+GGG | + | contig129end:5647-5666 | MsG0080047869.01.T01:intron | 35.0% | |
CTTCACATTTGGAAAATCAG+AGG | + | contig129end:345-364 | MsG0080047869.01.T01:five_prime_UTR | 35.0% | |
GAAAAAATTCTACTACCGGT+AGG | - | contig129end:8514-8533 | MsG0080047869.01.T01:intergenic | 35.0% | |
GAACCATACTTCTTCACATT+TGG | + | contig129end:334-353 | MsG0080047869.01.T01:five_prime_UTR | 35.0% | |
GAATATATCCTTGTCTCGAT+TGG | - | contig129end:7711-7730 | MsG0080047869.01.T01:intergenic | 35.0% | |
GAGAAGAGTTTATAAAGAGG+AGG | + | contig129end:1529-1548 | MsG0080047869.01.T01:intron | 35.0% | |
GCAGTGACCTAATTATTGTT+TGG | + | contig129end:6469-6488 | MsG0080047869.01.T01:intron | 35.0% | |
GTACCTAAAGGTCTTGAAAT+GGG | + | contig129end:669-688 | MsG0080047869.01.T01:exon | 35.0% | |
GTAGGAACATTGCAATATGA+AGG | - | contig129end:1356-1375 | MsG0080047869.01.T01:intergenic | 35.0% | |
GTCAAACATGCTTATGTACA+TGG | + | contig129end:4407-4426 | MsG0080047869.01.T01:intron | 35.0% | |
GTGTAAAATGGAACATTGGT+TGG | - | contig129end:3358-3377 | MsG0080047869.01.T01:intergenic | 35.0% | |
GTTCATGCATCATATATGAG+GGG | + | contig129end:6034-6053 | MsG0080047869.01.T01:intron | 35.0% | |
TAAAAGTTACCCAAGTTACG+AGG | + | contig129end:1633-1652 | MsG0080047869.01.T01:intron | 35.0% | |
TAAAGTCATAGTGTTTCCTG+CGG | - | contig129end:8243-8262 | MsG0080047869.01.T01:intergenic | 35.0% | |
TAATCAAATCAGTCCATACG+AGG | + | contig129end:5861-5880 | MsG0080047869.01.T01:intron | 35.0% | |
TACCTAAAGGTCTTGAAATG+GGG | + | contig129end:670-689 | MsG0080047869.01.T01:exon | 35.0% | |
TACCTTATTACAAGTCTCGA+TGG | - | contig129end:7350-7369 | MsG0080047869.01.T01:intergenic | 35.0% | |
TCACTGCTATTCTTTAACCT+CGG | - | contig129end:6456-6475 | MsG0080047869.01.T01:intergenic | 35.0% | |
TCCACAAATGAGAAAACGAA+AGG | + | contig129end:1707-1726 | MsG0080047869.01.T01:intron | 35.0% | |
TCTCATGCTGTAGTTATTAC+AGG | + | contig129end:5646-5665 | MsG0080047869.01.T01:intron | 35.0% | |
TGAAGATGAGATACATGTGA+TGG | + | contig129end:6497-6516 | MsG0080047869.01.T01:intron | 35.0% | |
TGCAAAGGCAAAGTATGAAA+AGG | + | contig129end:5702-5721 | MsG0080047869.01.T01:CDS | 35.0% | |
TGGCTAAAGAGAAATCATGA+AGG | - | contig129end:2893-2912 | MsG0080047869.01.T01:intergenic | 35.0% | |
TGTACCTCTTAATGATCACT+TGG | + | contig129end:6990-7009 | MsG0080047869.01.T01:intron | 35.0% | |
TGTAGTTATTACAGGGTAAC+AGG | + | contig129end:5654-5673 | MsG0080047869.01.T01:intron | 35.0% | |
TGTGTTCCTATTTATTGCAG+AGG | + | contig129end:5752-5771 | MsG0080047869.01.T01:intron | 35.0% | |
TGTGTTTAAGTAGTCAATGG+CGG | + | contig129end:5235-5254 | MsG0080047869.01.T01:intron | 35.0% | |
TTAAAACTCAGACATGGCTA+GGG | + | contig129end:1170-1189 | MsG0080047869.01.T01:intron | 35.0% | |
TTAACTTCTGCAATTTCTCC+AGG | - | contig129end:8346-8365 | MsG0080047869.01.T01:intergenic | 35.0% | |
TTAGATGCTCCAACTTATAC+GGG | - | contig129end:6755-6774 | MsG0080047869.01.T01:intergenic | 35.0% | |
TTCTCAGAACAGAAATCCAA+TGG | - | contig129end:3305-3324 | MsG0080047869.01.T01:intergenic | 35.0% | |
TTCTTAACTCCCGTATAAGT+TGG | + | contig129end:6743-6762 | MsG0080047869.01.T01:intron | 35.0% | |
! | AACCTTCGTTTTCTCATTTG+TGG | - | contig129end:1711-1730 | MsG0080047869.01.T01:intergenic | 35.0% |
! | AAGTGGGTTTGAAATAATGC+AGG | - | contig129end:7590-7609 | MsG0080047869.01.T01:intergenic | 35.0% |
! | ACCTTTCGTTTTCTCATTTG+TGG | - | contig129end:1867-1886 | MsG0080047869.01.T01:intergenic | 35.0% |
! | ATATGTTTGAGACATCATGG+GGG | + | contig129end:8095-8114 | MsG0080047869.01.T01:intron | 35.0% |
! | CACACAATTGACTTCAGAAA+CGG | - | contig129end:7956-7975 | MsG0080047869.01.T01:intergenic | 35.0% |
! | CACATATTGAGCTAGGTTTT+AGG | + | contig129end:5897-5916 | MsG0080047869.01.T01:intron | 35.0% |
! | CACGATTTTCTACATATGGT+TGG | + | contig129end:4345-4364 | MsG0080047869.01.T01:intron | 35.0% |
! | CCTACACGATTTTCTACATA+TGG | + | contig129end:4341-4360 | MsG0080047869.01.T01:intron | 35.0% |
! | GCTTTTGCATTCCTTAAACA+TGG | + | contig129end:1026-1045 | MsG0080047869.01.T01:intron | 35.0% |
! | TAATAACCCTCAACCCATTT+TGG | + | contig129end:4173-4192 | MsG0080047869.01.T01:intron | 35.0% |
! | TCAATACCACAGCATTTTGT+TGG | - | contig129end:3899-3918 | MsG0080047869.01.T01:intergenic | 35.0% |
! | TCTTCCAAATTTTCTGTGCT+AGG | + | contig129end:6863-6882 | MsG0080047869.01.T01:intron | 35.0% |
! | TTGGTAATTACTCCTTCGTT+CGG | - | contig129end:8181-8200 | MsG0080047869.01.T01:intergenic | 35.0% |
! | TTTAAAACTCAGACATGGCT+AGG | + | contig129end:1169-1188 | MsG0080047869.01.T01:intron | 35.0% |
!! | ACACTGAAAGGTTTTGGTAT+TGG | + | contig129end:1068-1087 | MsG0080047869.01.T01:intron | 35.0% |
!! | ACTGAAAGGTTTTGGTATTG+GGG | + | contig129end:1070-1089 | MsG0080047869.01.T01:intron | 35.0% |
!! | ATAGAAACCAAAATGGGTTG+AGG | - | contig129end:4183-4202 | MsG0080047869.01.T01:intergenic | 35.0% |
!! | ATGGAGATTTTGAAGAAGCA+AGG | + | contig129end:7866-7885 | MsG0080047869.01.T01:CDS | 35.0% |
!! | ATTCGGTGAGTGAGTTTTAT+AGG | - | contig129end:1938-1957 | MsG0080047869.01.T01:intergenic | 35.0% |
!! | ATTGGATTTCTGTTCTGAGA+AGG | + | contig129end:3304-3323 | MsG0080047869.01.T01:CDS | 35.0% |
!! | ATTTGCTTCTAAAACCTGCA+TGG | - | contig129end:7797-7816 | MsG0080047869.01.T01:intergenic | 35.0% |
!! | CACCTTAATGGGTGAAATTT+TGG | - | contig129end:1299-1318 | MsG0080047869.01.T01:intergenic | 35.0% |
!! | CACTGAAAGGTTTTGGTATT+GGG | + | contig129end:1069-1088 | MsG0080047869.01.T01:intron | 35.0% |
!! | CCTCTCTGGAATATATGAAT+AGG | + | contig129end:5052-5071 | MsG0080047869.01.T01:intron | 35.0% |
!! | CTTAATTGTTCTGGCTTTGA+CGG | + | contig129end:1471-1490 | MsG0080047869.01.T01:intron | 35.0% |
!! | GGCTGCTATTTGATTTTAGT+TGG | + | contig129end:5374-5393 | MsG0080047869.01.T01:intron | 35.0% |
!! | TAGAAACCAAAATGGGTTGA+GGG | - | contig129end:4182-4201 | MsG0080047869.01.T01:intergenic | 35.0% |
!! | TGGAGATTTTGAAGAAGCAA+GGG | + | contig129end:7867-7886 | MsG0080047869.01.T01:CDS | 35.0% |
!! | TGGATTTTTGTTTGCACTCA+AGG | + | contig129end:7010-7029 | MsG0080047869.01.T01:intron | 35.0% |
!! | TTAATTGTTCTGGCTTTGAC+GGG | + | contig129end:1472-1491 | MsG0080047869.01.T01:intron | 35.0% |
!! | TTCCGGAAGCTTTAAATCTA+AGG | - | contig129end:6665-6684 | MsG0080047869.01.T01:intergenic | 35.0% |
!! | TTCGGTGAGTGAGTTTTATA+GGG | - | contig129end:1937-1956 | MsG0080047869.01.T01:intergenic | 35.0% |
!! | TTTTCTAGGCATTGTTGTGT+TGG | + | contig129end:568-587 | MsG0080047869.01.T01:intron | 35.0% |
!! | TTTTTGAGAAGGAAGAGATG+AGG | - | contig129end:6617-6636 | MsG0080047869.01.T01:intergenic | 35.0% |
!!! | AACTTTTTCGAGGGCATTTT+TGG | + | contig129end:5424-5443 | MsG0080047869.01.T01:intron | 35.0% |
!!! | ACTTTTTCGAGGGCATTTTT+GGG | + | contig129end:5425-5444 | MsG0080047869.01.T01:intron | 35.0% |
!!! | CAAGGTGTTGATGAACTTTT+AGG | + | contig129end:3609-3628 | MsG0080047869.01.T01:intron | 35.0% |
!!! | CTCTGTTTTTTGTATGCTAC+TGG | - | contig129end:2860-2879 | MsG0080047869.01.T01:intergenic | 35.0% |
!!! | CTGCAAACTTGTTTTTGCTA+CGG | - | contig129end:3941-3960 | MsG0080047869.01.T01:intergenic | 35.0% |
!!! | TTTTCTTTTCAGGTACCAGA+GGG | + | contig129end:3506-3525 | MsG0080047869.01.T01:intron | 35.0% |
!!! | TTTTGTGTTTTGGTGGAGTT+AGG | + | contig129end:4011-4030 | MsG0080047869.01.T01:intron | 35.0% |
!!! | TTTTTCTTTTCAGGTACCAG+AGG | + | contig129end:3505-3524 | MsG0080047869.01.T01:intron | 35.0% |
!!! | TTTTTTGTGAAGTAGCCTAG+TGG | + | contig129end:1273-1292 | MsG0080047869.01.T01:intron | 35.0% |
AAAACTGAAGCAGAAAGAGC+AGG | + | contig129end:8038-8057 | MsG0080047869.01.T01:CDS | 40.0% | |
AAAATCTCCATTGCCCATGT+AGG | - | contig129end:7857-7876 | MsG0080047869.01.T01:intergenic | 40.0% | |
AAAGGTCTTGAAATGGGGAT+CGG | + | contig129end:675-694 | MsG0080047869.01.T01:exon | 40.0% | |
AACACACATTCAAATCCCTC+TGG | - | contig129end:3524-3543 | MsG0080047869.01.T01:intergenic | 40.0% | |
AAGATGGAACTCTCAGAATC+CGG | - | contig129end:7741-7760 | MsG0080047869.01.T01:intergenic | 40.0% | |
AATTGTACTTGGCTAAACCG+TGG | + | contig129end:6204-6223 | MsG0080047869.01.T01:intron | 40.0% | |
ACAAGTGAGATCCAGAAAGA+TGG | + | contig129end:8391-8410 | MsG0080047869.01.T01:CDS | 40.0% | |
ACAGTTAGAAAGAGTGGTGA+AGG | - | contig129end:1983-2002 | MsG0080047869.01.T01:intergenic | 40.0% | |
ACCAAAATGCCTCGTAACTT+GGG | - | contig129end:1645-1664 | MsG0080047869.01.T01:intergenic | 40.0% | |
ACCATGCCAACAAAGAAAAG+AGG | - | contig129end:2018-2037 | MsG0080047869.01.T01:intergenic | 40.0% | |
ACCTGGAGAGTCAACAAATA+TGG | - | contig129end:5975-5994 | MsG0080047869.01.T01:intergenic | 40.0% | |
ACGGACATAATCCCTATTAC+AGG | + | contig129end:4246-4265 | MsG0080047869.01.T01:intron | 40.0% | |
ACGTACTTAACTGAGACAAG+AGG | + | contig129end:2143-2162 | MsG0080047869.01.T01:CDS | 40.0% | |
ACTAGGTATCTCAAATCCCT+AGG | - | contig129end:4847-4866 | MsG0080047869.01.T01:intergenic | 40.0% | |
ACTAGTTAGAGTGAAATCCG+AGG | + | contig129end:6436-6455 | MsG0080047869.01.T01:intron | 40.0% | |
AGAATCCTATCTATCCGATG+TGG | - | contig129end:1509-1528 | MsG0080047869.01.T01:intergenic | 40.0% | |
AGCCAGAACAATTAAGGTGT+TGG | - | contig129end:1467-1486 | MsG0080047869.01.T01:intergenic | 40.0% | |
AGGAAGACGTAAAGGTGATT+GGG | + | contig129end:2163-2182 | MsG0080047869.01.T01:intron | 40.0% | |
AGGGTAATCACCAAATGCAA+GGG | - | contig129end:635-654 | MsG0080047869.01.T01:intergenic | 40.0% | |
AGTTGACAATGTGATAGGAC+TGG | + | contig129end:4773-4792 | MsG0080047869.01.T01:intron | 40.0% | |
ATAGGACCAACAAAATGCTG+TGG | + | contig129end:3890-3909 | MsG0080047869.01.T01:intron | 40.0% | |
ATCCCCATTTCAAGACCTTT+AGG | - | contig129end:675-694 | MsG0080047869.01.T01:intergenic | 40.0% | |
ATGGGAACAGTTAGAAAGAG+TGG | - | contig129end:1989-2008 | MsG0080047869.01.T01:intergenic | 40.0% | |
ATGGGGACGAAAGATAATGT+TGG | + | contig129end:1392-1411 | MsG0080047869.01.T01:intron | 40.0% | |
ATGTAATAGGGTAACTGGGA+TGG | - | contig129end:6708-6727 | MsG0080047869.01.T01:intergenic | 40.0% | |
ATTATGTGGTAGTTGGCAAC+AGG | + | contig129end:7060-7079 | MsG0080047869.01.T01:intron | 40.0% | |
ATTTAGGGAGGAAAGGAACT+AGG | - | contig129end:4864-4883 | MsG0080047869.01.T01:intergenic | 40.0% | |
CAAAGAAAAGAGGGTAGGAA+TGG | - | contig129end:2008-2027 | MsG0080047869.01.T01:intergenic | 40.0% | |
CACCCATTAAGGTGAATAAG+TGG | + | contig129end:1305-1324 | MsG0080047869.01.T01:intron | 40.0% | |
CAGAACAGAAATCCAATGGT+TGG | - | contig129end:3301-3320 | MsG0080047869.01.T01:intergenic | 40.0% | |
CAGTTAGAAAGAGTGGTGAA+GGG | - | contig129end:1982-2001 | MsG0080047869.01.T01:intergenic | 40.0% | |
CATAATCCCTATTACAGGAC+TGG | + | contig129end:4251-4270 | MsG0080047869.01.T01:intron | 40.0% | |
CATGAAGTAGACTGTCATGA+AGG | - | contig129end:3208-3227 | MsG0080047869.01.T01:intergenic | 40.0% | |
CCATGCCAACAAAGAAAAGA+GGG | - | contig129end:2017-2036 | MsG0080047869.01.T01:intergenic | 40.0% | |
CCCATTAAGGTGAATAAGTG+GGG | + | contig129end:1307-1326 | MsG0080047869.01.T01:intron | 40.0% | |
CCCCACTTATTCACCTTAAT+GGG | - | contig129end:1310-1329 | MsG0080047869.01.T01:intergenic | 40.0% | |
CCTGGAGAGTCAACAAATAT+GGG | - | contig129end:5974-5993 | MsG0080047869.01.T01:intergenic | 40.0% | |
CGTCAAAGCCAGAACAATTA+AGG | - | contig129end:1473-1492 | MsG0080047869.01.T01:intergenic | 40.0% | |
CTAGGTATCTCAAATCCCTA+GGG | - | contig129end:4846-4865 | MsG0080047869.01.T01:intergenic | 40.0% | |
CTAGTTTGAGCTAAGGGTTA+AGG | + | contig129end:8132-8151 | MsG0080047869.01.T01:intron | 40.0% | |
CTCATCAGATGGAACGAATT+CGG | + | contig129end:8429-8448 | MsG0080047869.01.T01:CDS | 40.0% | |
CTCCAACACCTTAATTGTTC+TGG | + | contig129end:1462-1481 | MsG0080047869.01.T01:intron | 40.0% | |
CTCCACAAATGAGAAAACGA+AGG | + | contig129end:1706-1725 | MsG0080047869.01.T01:intron | 40.0% | |
GAATCCTATCTATCCGATGT+GGG | - | contig129end:1508-1527 | MsG0080047869.01.T01:intergenic | 40.0% | |
GACGACAGGCAAAATTAAGA+TGG | - | contig129end:7757-7776 | MsG0080047869.01.T01:intergenic | 40.0% | |
GATTATGTCCGTAATGCATC+AGG | - | contig129end:4238-4257 | MsG0080047869.01.T01:intergenic | 40.0% | |
GCCTACTCTCGATATGTTAT+TGG | + | contig129end:5944-5963 | MsG0080047869.01.T01:intron | 40.0% | |
GGCCAAAATTTCACCCATTA+AGG | + | contig129end:1294-1313 | MsG0080047869.01.T01:intron | 40.0% | |
GGGTTATACTCGATTCCAAA+AGG | - | contig129end:2291-2310 | MsG0080047869.01.T01:intergenic | 40.0% | |
GGTACCTAAAGGTCTTGAAA+TGG | + | contig129end:668-687 | MsG0080047869.01.T01:intron | 40.0% | |
GGTCATATCTATAGTCGTGT+TGG | - | contig129end:6069-6088 | MsG0080047869.01.T01:intergenic | 40.0% | |
GTCCATCGAGACTTGTAATA+AGG | + | contig129end:7345-7364 | MsG0080047869.01.T01:intron | 40.0% | |
TAAAATGGTATGCAGGGAGA+CGG | + | contig129end:3056-3075 | MsG0080047869.01.T01:intron | 40.0% | |
TAAAGGCTACATGATAGCTG+AGG | - | contig129end:7383-7402 | MsG0080047869.01.T01:intergenic | 40.0% | |
TAATGCAGGCTTCAGCAATA+AGG | - | contig129end:7576-7595 | MsG0080047869.01.T01:intergenic | 40.0% | |
TACCAAAATGCCTCGTAACT+TGG | - | contig129end:1646-1665 | MsG0080047869.01.T01:intergenic | 40.0% | |
TCCCCACTTATTCACCTTAA+TGG | - | contig129end:1311-1330 | MsG0080047869.01.T01:intergenic | 40.0% | |
TCTTCTATAACAGGCATCAG+AGG | - | contig129end:759-778 | MsG0080047869.01.T01:intergenic | 40.0% | |
TGAAGTAGACTGTCATGAAG+GGG | - | contig129end:3206-3225 | MsG0080047869.01.T01:intergenic | 40.0% | |
TGATACACTCAGGTACCTAA+AGG | + | contig129end:657-676 | MsG0080047869.01.T01:intron | 40.0% | |
TGGAAATTCCGCCTTAATTG+CGG | + | contig129end:1412-1431 | MsG0080047869.01.T01:intron | 40.0% | |
TGGTAATTACTCCTTCGTTC+GGG | - | contig129end:8180-8199 | MsG0080047869.01.T01:intergenic | 40.0% | |
TTCAGATCACTTTGCTACCA+GGG | + | contig129end:8613-8632 | MsG0080047869.01.T01:three_prime_UTR | 40.0% | |
TTCATAGTCATTCAGAGACC+TGG | + | contig129end:2637-2656 | MsG0080047869.01.T01:intron | 40.0% | |
TTGGATAGTTAGAGAGGGAA+CGG | - | contig129end:4945-4964 | MsG0080047869.01.T01:intergenic | 40.0% | |
TTTCAGATCACTTTGCTACC+AGG | + | contig129end:8612-8631 | MsG0080047869.01.T01:three_prime_UTR | 40.0% | |
TTTGTGCAAAGCATGGAACA+AGG | + | contig129end:4441-4460 | MsG0080047869.01.T01:intron | 40.0% | |
! | AGCAAGGGCTGATTTCAAAA+TGG | + | contig129end:7882-7901 | MsG0080047869.01.T01:CDS | 40.0% |
! | AGCTCAACTAGTTTGAGCTA+AGG | + | contig129end:8125-8144 | MsG0080047869.01.T01:intron | 40.0% |
! | AGTAAGTCAGTCTGTTTCTC+AGG | + | contig129end:6408-6427 | MsG0080047869.01.T01:intron | 40.0% |
! | ATACATGTGATGGAATCCGT+AGG | + | contig129end:6507-6526 | MsG0080047869.01.T01:intron | 40.0% |
! | GATGGATTTGGATCCTCTTA+TGG | + | contig129end:8857-8876 | MsG0080047869.01.T01:three_prime_UTR | 40.0% |
! | GCTCAACTAGTTTGAGCTAA+GGG | + | contig129end:8126-8145 | MsG0080047869.01.T01:intron | 40.0% |
! | TATGTTTGAGACATCATGGG+GGG | + | contig129end:8096-8115 | MsG0080047869.01.T01:intron | 40.0% |
! | TCACGAATCGACGTTTTATC+AGG | - | contig129end:2803-2822 | MsG0080047869.01.T01:intergenic | 40.0% |
! | TCCTACCCTCTTTTCTTTGT+TGG | + | contig129end:2009-2028 | MsG0080047869.01.T01:intron | 40.0% |
! | TCTGTGTTTTGTGCAAAGCA+TGG | + | contig129end:4434-4453 | MsG0080047869.01.T01:intron | 40.0% |
! | TGGCATGTGAATTTTCTTGC+TGG | + | contig129end:2737-2756 | MsG0080047869.01.T01:intron | 40.0% |
! | TTTTATAGGGCCTTAGGACA+AGG | - | contig129end:1924-1943 | MsG0080047869.01.T01:intergenic | 40.0% |
!! | AGTGAGTTTTATAGGGCCTT+AGG | - | contig129end:1930-1949 | MsG0080047869.01.T01:intergenic | 40.0% |
!! | ATTCTGAAGTCCAGTTGAAG+TGG | + | contig129end:778-797 | MsG0080047869.01.T01:CDS | 40.0% |
!! | CAGAACAATTAAGGTGTTGG+AGG | - | contig129end:1464-1483 | MsG0080047869.01.T01:intergenic | 40.0% |
!! | CCGAACACCATTTTTCAATC+AGG | + | contig129end:2329-2348 | MsG0080047869.01.T01:intron | 40.0% |
!! | CGGTTTTGTAAGGATGAGTT+AGG | + | contig129end:1571-1590 | MsG0080047869.01.T01:intron | 40.0% |
!! | GATAAAACGTCGATTCGTGA+TGG | + | contig129end:2803-2822 | MsG0080047869.01.T01:CDS | 40.0% |
!! | TAATTGTTCTGGCTTTGACG+GGG | + | contig129end:1473-1492 | MsG0080047869.01.T01:intron | 40.0% |
!! | TTTTGGGGAGAAATTTAGGG+AGG | - | contig129end:4876-4895 | MsG0080047869.01.T01:intergenic | 40.0% |
!!! | CGGTTTTGGGGAGAAATTTA+GGG | - | contig129end:4879-4898 | MsG0080047869.01.T01:intergenic | 40.0% |
!!! | CTAGGTTTTAGGGTTGAGTT+AGG | + | contig129end:5908-5927 | MsG0080047869.01.T01:intron | 40.0% |
!!! | CTAGTTTTAGGAGTTGTGTC+AGG | + | contig129end:6134-6153 | MsG0080047869.01.T01:intron | 40.0% |
!!! | TCGGTTTTGGGGAGAAATTT+AGG | - | contig129end:4880-4899 | MsG0080047869.01.T01:intergenic | 40.0% |
AAGAGATGAGGCACATGTGA+TGG | - | contig129end:6605-6624 | MsG0080047869.01.T01:intergenic | 45.0% | |
AAGGTAGGGAACAGGACATT+CGG | - | contig129end:1955-1974 | MsG0080047869.01.T01:intergenic | 45.0% | |
AAGGTGATTGGGATAGACTC+AGG | + | contig129end:2174-2193 | MsG0080047869.01.T01:intron | 45.0% | |
AATATTTGGCACGCAAGGAG+TGG | - | contig129end:445-464 | MsG0080047869.01.T01:intergenic | 45.0% | |
AATGATAACCCTGAGGACCT+TGG | - | contig129end:6279-6298 | MsG0080047869.01.T01:intergenic | 45.0% | |
AATGGCACACATCTGTGTCA+GGG | + | contig129end:6230-6249 | MsG0080047869.01.T01:intron | 45.0% | |
ACATTGCAATATGAAGGGGC+TGG | - | contig129end:1350-1369 | MsG0080047869.01.T01:intergenic | 45.0% | |
ACCAACTGAGCTATGCTCAT+GGG | + | contig129end:1374-1393 | MsG0080047869.01.T01:intron | 45.0% | |
AGCTTTCTACCCCTTGCATT+TGG | + | contig129end:622-641 | MsG0080047869.01.T01:intron | 45.0% | |
AGGAATTCTCAAGCCTCGTA+TGG | - | contig129end:5877-5896 | MsG0080047869.01.T01:intergenic | 45.0% | |
AGGTGATTGGGATAGACTCA+GGG | + | contig129end:2175-2194 | MsG0080047869.01.T01:intron | 45.0% | |
AGTTAGAGAGGGAACGGTAA+AGG | - | contig129end:4939-4958 | MsG0080047869.01.T01:intergenic | 45.0% | |
ATCAGATGGAACGAATTCGG+AGG | + | contig129end:8432-8451 | MsG0080047869.01.T01:CDS | 45.0% | |
ATGAGCATAGCTCAGTTGGT+AGG | - | contig129end:1374-1393 | MsG0080047869.01.T01:intergenic | 45.0% | |
ATGCTAACCTCCTTGTCCTA+AGG | + | contig129end:1754-1773 | MsG0080047869.01.T01:intron | 45.0% | |
ATTACAGGACTGGACAGGAA+TGG | + | contig129end:4261-4280 | MsG0080047869.01.T01:intron | 45.0% | |
ATTACCCTGCTGATACACTC+AGG | + | contig129end:647-666 | MsG0080047869.01.T01:intron | 45.0% | |
ATTGAAGAACACACGACGAC+AGG | - | contig129end:7771-7790 | MsG0080047869.01.T01:intergenic | 45.0% | |
CAGAAAGATGGTGAGGTACA+GGG | + | contig129end:8403-8422 | MsG0080047869.01.T01:CDS | 45.0% | |
CAGATACACGTGTACGTAAC+TGG | + | contig129end:7139-7158 | MsG0080047869.01.T01:intron | 45.0% | |
CAGGGTAATCACCAAATGCA+AGG | - | contig129end:636-655 | MsG0080047869.01.T01:intergenic | 45.0% | |
CATTGAATATGAGCACCCTC+GGG | - | contig129end:3766-3785 | MsG0080047869.01.T01:intergenic | 45.0% | |
CCATTGAATATGAGCACCCT+CGG | - | contig129end:3767-3786 | MsG0080047869.01.T01:intergenic | 45.0% | |
GAACGAATTGCGGGATCTTT+GGG | - | contig129end:2376-2395 | MsG0080047869.01.T01:intergenic | 45.0% | |
GAAGTAGACTGTCATGAAGG+GGG | - | contig129end:3205-3224 | MsG0080047869.01.T01:intergenic | 45.0% | |
GACAGCAGGATAGCATATGA+CGG | - | contig129end:5523-5542 | MsG0080047869.01.T01:intergenic | 45.0% | |
GAGACAAGAGGAAGACGTAA+AGG | + | contig129end:2155-2174 | MsG0080047869.01.T01:CDS | 45.0% | |
GAGGAAGACGTAAAGGTGAT+TGG | + | contig129end:2162-2181 | MsG0080047869.01.T01:intron | 45.0% | |
GATAGCATGCAGCAACATTC+AGG | - | contig129end:7303-7322 | MsG0080047869.01.T01:intergenic | 45.0% | |
GATTCAGTCCAATCGAGACA+AGG | + | contig129end:7700-7719 | MsG0080047869.01.T01:intron | 45.0% | |
GCCAACAAAGAAAAGAGGGT+AGG | - | contig129end:2013-2032 | MsG0080047869.01.T01:intergenic | 45.0% | |
GCTGAAATATTTGGCACGCA+AGG | - | contig129end:450-469 | MsG0080047869.01.T01:intergenic | 45.0% | |
GGAACGGGAAAAGAGAACTA+TGG | - | contig129end:6584-6603 | MsG0080047869.01.T01:intergenic | 45.0% | |
GGCTTGATGGAAAACCCATT+TGG | + | contig129end:1135-1154 | MsG0080047869.01.T01:intron | 45.0% | |
GGGAGAAATTTAGGGAGGAA+AGG | - | contig129end:4871-4890 | MsG0080047869.01.T01:intergenic | 45.0% | |
GGGATCTTTGGGCATTTGTT+TGG | - | contig129end:2365-2384 | MsG0080047869.01.T01:intergenic | 45.0% | |
GGGTAACAGGTTGTTCAAAG+AGG | + | contig129end:5667-5686 | MsG0080047869.01.T01:intron | 45.0% | |
GGGTAATCACCAAATGCAAG+GGG | - | contig129end:634-653 | MsG0080047869.01.T01:intergenic | 45.0% | |
GTATAACTCAAGCATGAGCC+AGG | - | contig129end:2965-2984 | MsG0080047869.01.T01:intergenic | 45.0% | |
GTGAATAAGTGGGGAATCCA+GGG | + | contig129end:1316-1335 | MsG0080047869.01.T01:intron | 45.0% | |
GTTAAGGAGTTGGAGGTCTT+GGG | + | contig129end:8148-8167 | MsG0080047869.01.T01:intron | 45.0% | |
GTTAAGGGTCTTTATCGTCG+TGG | + | contig129end:7826-7845 | MsG0080047869.01.T01:CDS | 45.0% | |
GTTAGAGAGGGAACGGTAAA+GGG | - | contig129end:4938-4957 | MsG0080047869.01.T01:intergenic | 45.0% | |
TAATGGCACACATCTGTGTC+AGG | + | contig129end:6229-6248 | MsG0080047869.01.T01:intron | 45.0% | |
TACCAACTGAGCTATGCTCA+TGG | + | contig129end:1373-1392 | MsG0080047869.01.T01:intron | 45.0% | |
TAGTAGTCAATCCCGGATAG+CGG | - | contig129end:5572-5591 | MsG0080047869.01.T01:intergenic | 45.0% | |
TAGTCCCACATCGGATAGAT+AGG | + | contig129end:1501-1520 | MsG0080047869.01.T01:intron | 45.0% | |
TCATATAGGGCCTTAGGACA+AGG | - | contig129end:1767-1786 | MsG0080047869.01.T01:intergenic | 45.0% | |
TCCTGTCCAGTCCTGTAATA+GGG | - | contig129end:4260-4279 | MsG0080047869.01.T01:intergenic | 45.0% | |
TGAAATGGGGATCGGAACAA+TGG | + | contig129end:683-702 | MsG0080047869.01.T01:exon | 45.0% | |
TGAACAAGCTCCACTTCAAC+TGG | - | contig129end:791-810 | MsG0080047869.01.T01:intergenic | 45.0% | |
TGAACGAATTGCGGGATCTT+TGG | - | contig129end:2377-2396 | MsG0080047869.01.T01:intergenic | 45.0% | |
TGAGATCCAGAAAGATGGTG+AGG | + | contig129end:8396-8415 | MsG0080047869.01.T01:CDS | 45.0% | |
TGAGCTAAGGGTTAAGGAGT+TGG | + | contig129end:8138-8157 | MsG0080047869.01.T01:intron | 45.0% | |
TGTCGTCGTGTGTTCTTCAA+TGG | + | contig129end:7770-7789 | MsG0080047869.01.T01:intron | 45.0% | |
TGTTAATCCACAAGACGACG+AGG | + | contig129end:7102-7121 | MsG0080047869.01.T01:intron | 45.0% | |
TGTTCTTCAATGGACCATGC+AGG | + | contig129end:7780-7799 | MsG0080047869.01.T01:intron | 45.0% | |
TTAGAAAGAGTGGTGAAGGG+AGG | - | contig129end:1979-1998 | MsG0080047869.01.T01:intergenic | 45.0% | |
TTCCTGTCCAGTCCTGTAAT+AGG | - | contig129end:4261-4280 | MsG0080047869.01.T01:intergenic | 45.0% | |
TTGGCTAAACCGTGGTGTAA+TGG | + | contig129end:6212-6231 | MsG0080047869.01.T01:intron | 45.0% | |
TTGGGTTAAAACCCGAACGA+AGG | + | contig129end:8166-8185 | MsG0080047869.01.T01:intron | 45.0% | |
TTGTAGGCGTTTCACAACTC+AGG | + | contig129end:5179-5198 | MsG0080047869.01.T01:intron | 45.0% | |
! | AAGCAAGGGCTTTTCGGTTT+TGG | - | contig129end:4893-4912 | MsG0080047869.01.T01:intergenic | 45.0% |
! | AGATGTGTGCCATTACACCA+CGG | - | contig129end:6224-6243 | MsG0080047869.01.T01:intergenic | 45.0% |
! | AGCAAGGGCTTTTCGGTTTT+GGG | - | contig129end:4892-4911 | MsG0080047869.01.T01:intergenic | 45.0% |
! | ATGAGGCACATGTGATGGAA+CGG | - | contig129end:6600-6619 | MsG0080047869.01.T01:intergenic | 45.0% |
! | ATGCGAGTTGAACGAATTGC+GGG | - | contig129end:2385-2404 | MsG0080047869.01.T01:intergenic | 45.0% |
! | CATGCGAGTTGAACGAATTG+CGG | - | contig129end:2386-2405 | MsG0080047869.01.T01:intergenic | 45.0% |
! | CCCTCTTTTCTTTGTTGGCA+TGG | + | contig129end:2014-2033 | MsG0080047869.01.T01:intron | 45.0% |
! | GATTCGTGATGGAAAAGGTG+TGG | + | contig129end:2814-2833 | MsG0080047869.01.T01:intron | 45.0% |
! | GCTGCATGCTATCTGAAGTT+GGG | + | contig129end:7310-7329 | MsG0080047869.01.T01:intron | 45.0% |
! | GGTGGAATAACTTGCACTGA+TGG | + | contig129end:412-431 | MsG0080047869.01.T01:intron | 45.0% |
! | GTAGTCCGTCCCTTTCTTTT+AGG | + | contig129end:4587-4606 | MsG0080047869.01.T01:intron | 45.0% |
! | TAACTTGCACTGATGGTAGC+TGG | + | contig129end:419-438 | MsG0080047869.01.T01:intron | 45.0% |
! | TGATAACGATGGCCAACCAT+TGG | + | contig129end:3286-3305 | MsG0080047869.01.T01:CDS | 45.0% |
! | TGCTGCATGCTATCTGAAGT+TGG | + | contig129end:7309-7328 | MsG0080047869.01.T01:intron | 45.0% |
!! | AAGGTTTTGGTATTGGGGCT+TGG | + | contig129end:1075-1094 | MsG0080047869.01.T01:intron | 45.0% |
!! | ACCCAAGTTACGAGGCATTT+TGG | + | contig129end:1641-1660 | MsG0080047869.01.T01:intron | 45.0% |
!! | ACGTCGATTCGTGATGGAAA+AGG | + | contig129end:2809-2828 | MsG0080047869.01.T01:CDS | 45.0% |
!! | CCCATATTTGTTGACTCTCC+AGG | + | contig129end:5971-5990 | MsG0080047869.01.T01:intron | 45.0% |
!! | CCTTACAAAACCGGCTTGTA+AGG | - | contig129end:1564-1583 | MsG0080047869.01.T01:intergenic | 45.0% |
!! | CCTTACAAGCCGGTTTTGTA+AGG | + | contig129end:1561-1580 | MsG0080047869.01.T01:intron | 45.0% |
!! | CGAGGGTGCTCATATTCAAT+GGG | + | contig129end:3765-3784 | MsG0080047869.01.T01:CDS | 45.0% |
!! | GACACGAGAGTTGATAACGA+TGG | + | contig129end:3275-3294 | MsG0080047869.01.T01:CDS | 45.0% |
!! | GTTTTAGGTGCTTCTGCATC+TGG | + | contig129end:5798-5817 | MsG0080047869.01.T01:intron | 45.0% |
!! | TATCCTGCTGTCCCACTTTT+GGG | + | contig129end:5531-5550 | MsG0080047869.01.T01:intron | 45.0% |
!! | TGGGTGAAATTTTGGCCACT+AGG | - | contig129end:1291-1310 | MsG0080047869.01.T01:intergenic | 45.0% |
!! | TTTGCTCACTTTTGGCCTAC+CGG | + | contig129end:8496-8515 | MsG0080047869.01.T01:CDS | 45.0% |
!!! | ACCAGGGTTTTAGAGAGTTC+AGG | + | contig129end:8629-8648 | MsG0080047869.01.T01:three_prime_UTR | 45.0% |
!!! | AGGGTTGGTTTGCTCACTTT+TGG | + | contig129end:8488-8507 | MsG0080047869.01.T01:CDS | 45.0% |
!! | CTTATTATTTATTTAATTAA+AGG | + | contig129end:3377-3396 | MsG0080047869.01.T01:intron | 5.0% |
!! | TTATTAATAATATATTTACA+AGG | + | contig129end:7191-7210 | MsG0080047869.01.T01:intron | 5.0% |
AAAGAGCAGGACACTGCAGA+TGG | + | contig129end:2119-2138 | MsG0080047869.01.T01:CDS | 50.0% | |
AACACGGACACACGAGTAAG+GGG | - | contig129end:2066-2085 | MsG0080047869.01.T01:intergenic | 50.0% | |
AACAGGCATCAGAGGAGACT+CGG | - | contig129end:751-770 | MsG0080047869.01.T01:intergenic | 50.0% | |
AAGAGTGGTGAAGGGAGGAA+AGG | - | contig129end:1974-1993 | MsG0080047869.01.T01:intergenic | 50.0% | |
AATCCACAAGACGACGAGGA+AGG | + | contig129end:7106-7125 | MsG0080047869.01.T01:intron | 50.0% | |
AATGCTCAAGACATCACCGC+AGG | + | contig129end:8224-8243 | MsG0080047869.01.T01:intron | 50.0% | |
ACAACACGGACACACGAGTA+AGG | - | contig129end:2068-2087 | MsG0080047869.01.T01:intergenic | 50.0% | |
AGCAAATCCTGCGCACGTTA+AGG | + | contig129end:7810-7829 | MsG0080047869.01.T01:CDS | 50.0% | |
AGGCCTTCAAATGTTCCCGA+GGG | + | contig129end:3748-3767 | MsG0080047869.01.T01:intron | 50.0% | |
AGGTACCTGAGTGTATCAGC+AGG | - | contig129end:655-674 | MsG0080047869.01.T01:intergenic | 50.0% | |
ATGCTCCAGCTGTGCTAAAG+CGG | + | contig129end:5336-5355 | MsG0080047869.01.T01:intron | 50.0% | |
CAACACGGACACACGAGTAA+GGG | - | contig129end:2067-2086 | MsG0080047869.01.T01:intergenic | 50.0% | |
CACTACGACGATTACCGTAG+CGG | - | contig129end:5297-5316 | MsG0080047869.01.T01:intergenic | 50.0% | |
CCAACTGAGCTATGCTCATG+GGG | + | contig129end:1375-1394 | MsG0080047869.01.T01:intron | 50.0% | |
CCAGAAAGATGGTGAGGTAC+AGG | + | contig129end:8402-8421 | MsG0080047869.01.T01:CDS | 50.0% | |
CCTGTACCTCACCATCTTTC+TGG | - | contig129end:8405-8424 | MsG0080047869.01.T01:intergenic | 50.0% | |
CTGACGCAGATCAAAAGGGT+TGG | + | contig129end:8473-8492 | MsG0080047869.01.T01:CDS | 50.0% | |
CTGTGTCAGGGTGTAAACTG+CGG | + | contig129end:6242-6261 | MsG0080047869.01.T01:intron | 50.0% | |
GAGAGTTCAGGCATGTTACC+AGG | + | contig129end:8641-8660 | MsG0080047869.01.T01:three_prime_UTR | 50.0% | |
GAGGGGCAAAACAAAAGAGC+AGG | + | contig129end:2106-2125 | MsG0080047869.01.T01:CDS | 50.0% | |
GCAAATCCTGCGCACGTTAA+GGG | + | contig129end:7811-7830 | MsG0080047869.01.T01:CDS | 50.0% | |
GCACCTGACGCAGATCAAAA+GGG | + | contig129end:8469-8488 | MsG0080047869.01.T01:CDS | 50.0% | |
GCAGAAAGAGCAGGTGAGAT+TGG | + | contig129end:8047-8066 | MsG0080047869.01.T01:intron | 50.0% | |
GCTAAGGGTTAAGGAGTTGG+AGG | + | contig129end:8141-8160 | MsG0080047869.01.T01:intron | 50.0% | |
GCTGCTTCACATGTGGAATC+AGG | - | contig129end:510-529 | MsG0080047869.01.T01:intergenic | 50.0% | |
GGGCTATTTGACAAGAAGCC+TGG | + | contig129end:8325-8344 | MsG0080047869.01.T01:CDS | 50.0% | |
GGGTCTTTATCGTCGTGGAA+TGG | + | contig129end:7831-7850 | MsG0080047869.01.T01:CDS | 50.0% | |
GGTACCTGAGTGTATCAGCA+GGG | - | contig129end:654-673 | MsG0080047869.01.T01:intergenic | 50.0% | |
GGTGAATAAGTGGGGAATCC+AGG | + | contig129end:1315-1334 | MsG0080047869.01.T01:intron | 50.0% | |
GGTTAAGGAGTTGGAGGTCT+TGG | + | contig129end:8147-8166 | MsG0080047869.01.T01:intron | 50.0% | |
GTACAGGGAGACTCATCAGA+TGG | + | contig129end:8418-8437 | MsG0080047869.01.T01:CDS | 50.0% | |
GTAGCAGCAATGAACCGCTA+CGG | + | contig129end:5280-5299 | MsG0080047869.01.T01:intron | 50.0% | |
GTGTCCTGTGCTAGACAACA+CGG | - | contig129end:2082-2101 | MsG0080047869.01.T01:intergenic | 50.0% | |
TAAAGACCCTTAACGTGCGC+AGG | - | contig129end:7820-7839 | MsG0080047869.01.T01:intergenic | 50.0% | |
TATAGGGCCTTAGGACAAGG+AGG | - | contig129end:1764-1783 | MsG0080047869.01.T01:intergenic | 50.0% | |
TCATGAAGGGGGCAATCCAT+TGG | - | contig129end:3194-3213 | MsG0080047869.01.T01:intergenic | 50.0% | |
TCCCTATTACAGGACTGGAC+AGG | + | contig129end:4256-4275 | MsG0080047869.01.T01:intron | 50.0% | |
TCTGATGCTACCTGGAGAGA+TGG | + | contig129end:3546-3565 | MsG0080047869.01.T01:CDS | 50.0% | |
TGCACCTGACGCAGATCAAA+AGG | + | contig129end:8468-8487 | MsG0080047869.01.T01:CDS | 50.0% | |
TGGTGAAGGGAGGAAAGGTA+GGG | - | contig129end:1969-1988 | MsG0080047869.01.T01:intergenic | 50.0% | |
TGTGTTCGTCTGATGCTACC+TGG | + | contig129end:3538-3557 | MsG0080047869.01.T01:CDS | 50.0% | |
TTGAGACATCATGGGGGGTT+GGG | + | contig129end:8101-8120 | MsG0080047869.01.T01:intron | 50.0% | |
TTTCCTTCCTCGTCGTCTTG+TGG | - | contig129end:7112-7131 | MsG0080047869.01.T01:intergenic | 50.0% | |
! | AATCGCGTTTCTGAGTACCG+TGG | + | contig129end:2419-2438 | MsG0080047869.01.T01:intron | 50.0% |
! | ACACGAGTAAGGGGCATAAG+AGG | - | contig129end:2057-2076 | MsG0080047869.01.T01:intergenic | 50.0% |
! | CAACCCTTTTGATCTGCGTC+AGG | - | contig129end:8475-8494 | MsG0080047869.01.T01:intergenic | 50.0% |
! | CACGAGTAAGGGGCATAAGA+GGG | - | contig129end:2056-2075 | MsG0080047869.01.T01:intergenic | 50.0% |
! | CTATCCTGCTGTCCCACTTT+TGG | + | contig129end:5530-5549 | MsG0080047869.01.T01:intron | 50.0% |
! | GCAAGGGCTTTTCGGTTTTG+GGG | - | contig129end:4891-4910 | MsG0080047869.01.T01:intergenic | 50.0% |
! | TGAGGCACATGTGATGGAAC+GGG | - | contig129end:6599-6618 | MsG0080047869.01.T01:intergenic | 50.0% |
! | TTTGAGACATCATGGGGGGT+TGG | + | contig129end:8100-8119 | MsG0080047869.01.T01:intron | 50.0% |
!! | ATCCTGCTGTCCCACTTTTG+GGG | + | contig129end:5532-5551 | MsG0080047869.01.T01:intron | 50.0% |
!! | CAAAACCGGCTTGTAAGGTG+AGG | - | contig129end:1559-1578 | MsG0080047869.01.T01:intergenic | 50.0% |
!! | CCGAGGGTGCTCATATTCAA+TGG | + | contig129end:3764-3783 | MsG0080047869.01.T01:CDS | 50.0% |
!! | GCCTGAACTCTCTAAAACCC+TGG | - | contig129end:8633-8652 | MsG0080047869.01.T01:intergenic | 50.0% |
AACCCTGAGGACCTTGGCAA+GGG | - | contig129end:6273-6292 | MsG0080047869.01.T01:intergenic | 55.0% | |
ACTCTCCAGGTGTTAGTCCC+GGG | + | contig129end:5984-6003 | MsG0080047869.01.T01:intron | 55.0% | |
AGGCTGCAATGAAGGCGACT+AGG | - | contig129end:1444-1463 | MsG0080047869.01.T01:intergenic | 55.0% | |
AGGGAGGAAAGGTAGGGAAC+AGG | - | contig129end:1963-1982 | MsG0080047869.01.T01:intergenic | 55.0% | |
AGTCAATGGCGGCGCTATAG+CGG | + | contig129end:5246-5265 | MsG0080047869.01.T01:intron | 55.0% | |
ATAGCGGCTGACCCCAAAAG+TGG | - | contig129end:5546-5565 | MsG0080047869.01.T01:intergenic | 55.0% | |
CAGGCCTTCAAATGTTCCCG+AGG | + | contig129end:3747-3766 | MsG0080047869.01.T01:intron | 55.0% | |
CCCCATGAGCATAGCTCAGT+TGG | - | contig129end:1378-1397 | MsG0080047869.01.T01:intergenic | 55.0% | |
CGCTACGGTAATCGTCGTAG+TGG | + | contig129end:5295-5314 | MsG0080047869.01.T01:intron | 55.0% | |
CGTCGTGGAATGGCCTACAT+GGG | + | contig129end:7841-7860 | MsG0080047869.01.T01:CDS | 55.0% | |
CTAGCACAGGACACTGCAGA+GGG | + | contig129end:2088-2107 | MsG0080047869.01.T01:intron | 55.0% | |
GACTCTCCAGGTGTTAGTCC+CGG | + | contig129end:5983-6002 | MsG0080047869.01.T01:intron | 55.0% | |
GCACCCTCGGGAACATTTGA+AGG | - | contig129end:3754-3773 | MsG0080047869.01.T01:intergenic | 55.0% | |
GCACTCCTCACCTTACAAGC+CGG | + | contig129end:1551-1570 | MsG0080047869.01.T01:intron | 55.0% | |
GCTGCAATGAAGGCGACTAG+GGG | - | contig129end:1442-1461 | MsG0080047869.01.T01:intergenic | 55.0% | |
GGAATGGCCTACATGGGCAA+TGG | + | contig129end:7847-7866 | MsG0080047869.01.T01:CDS | 55.0% | |
GGCTGCAATGAAGGCGACTA+GGG | - | contig129end:1443-1462 | MsG0080047869.01.T01:intergenic | 55.0% | |
GGTTCATTGCTGCTACGCCA+CGG | - | contig129end:5276-5295 | MsG0080047869.01.T01:intergenic | 55.0% | |
GTGACAAGAGCCATCTCTCC+AGG | - | contig129end:3559-3578 | MsG0080047869.01.T01:intergenic | 55.0% | |
GTGGTGAAGGGAGGAAAGGT+AGG | - | contig129end:1970-1989 | MsG0080047869.01.T01:intergenic | 55.0% | |
GTGTCCGTGTTGTCTAGCAC+AGG | + | contig129end:2075-2094 | MsG0080047869.01.T01:intron | 55.0% | |
GTTCATTGCTGCTACGCCAC+GGG | - | contig129end:5275-5294 | MsG0080047869.01.T01:intergenic | 55.0% | |
TAACAGGTGAGGGACGTGCT+TGG | + | contig129end:2768-2787 | MsG0080047869.01.T01:intron | 55.0% | |
TAACCCTGAGGACCTTGGCA+AGG | - | contig129end:6274-6293 | MsG0080047869.01.T01:intergenic | 55.0% | |
TAGAGCTCAATGCCCCTCTC+TGG | + | contig129end:5038-5057 | MsG0080047869.01.T01:intron | 55.0% | |
TAGCACAGGACACTGCAGAG+GGG | + | contig129end:2089-2108 | MsG0080047869.01.T01:intron | 55.0% | |
TAGCGGCTGACCCCAAAAGT+GGG | - | contig129end:5545-5564 | MsG0080047869.01.T01:intergenic | 55.0% | |
TCGTCGTGGAATGGCCTACA+TGG | + | contig129end:7840-7859 | MsG0080047869.01.T01:CDS | 55.0% | |
TCTAGCACAGGACACTGCAG+AGG | + | contig129end:2087-2106 | MsG0080047869.01.T01:intron | 55.0% | |
TGAGGGACGTGCTTGGAGAT+GGG | + | contig129end:2775-2794 | MsG0080047869.01.T01:CDS | 55.0% | |
! | GGTGTTGGAGGCTGCAATGA+AGG | - | contig129end:1452-1471 | MsG0080047869.01.T01:intergenic | 55.0% |
!! | AGAGGGGCATTGAGCTCTAC+AGG | - | contig129end:5037-5056 | MsG0080047869.01.T01:intergenic | 55.0% |
!! | GAGGGGCATTGAGCTCTACA+GGG | - | contig129end:5036-5055 | MsG0080047869.01.T01:intergenic | 55.0% |
!! | GGGGTGGATTAGTCCCACAT+CGG | + | contig129end:1492-1511 | MsG0080047869.01.T01:intron | 55.0% |
!! | TTGTTCTGGCTTTGACGGGG+TGG | + | contig129end:1476-1495 | MsG0080047869.01.T01:intron | 55.0% |
AGCCGCTATGCACCGCTATC+CGG | + | contig129end:5557-5576 | MsG0080047869.01.T01:intron | 60.0% | |
CTAGGGGCGGACCGCAATTA+AGG | - | contig129end:1426-1445 | MsG0080047869.01.T01:intergenic | 60.0% | |
CTCCAGCTGTGCTAAAGCGG+CGG | + | contig129end:5339-5358 | MsG0080047869.01.T01:intron | 60.0% | |
CTCCCTTGCCAAGGTCCTCA+GGG | + | contig129end:6268-6287 | MsG0080047869.01.T01:intron | 60.0% | |
GACCCCAAAAGTGGGACAGC+AGG | - | contig129end:5537-5556 | MsG0080047869.01.T01:intergenic | 60.0% | |
GCAATGAAGGCGACTAGGGG+CGG | - | contig129end:1439-1458 | MsG0080047869.01.T01:intergenic | 60.0% | |
GTGAGGGACGTGCTTGGAGA+TGG | + | contig129end:2774-2793 | MsG0080047869.01.T01:CDS | 60.0% | |
TGGGGGAGCTGCTTCACATG+TGG | - | contig129end:517-536 | MsG0080047869.01.T01:intergenic | 60.0% | |
! | TCCCGGATAGCGGTGCATAG+CGG | - | contig129end:5562-5581 | MsG0080047869.01.T01:intergenic | 60.0% |
AGGGGCTGGAGTTCGAACCC+TGG | - | contig129end:1336-1355 | MsG0080047869.01.T01:intergenic | 65.0% | |
AGGTGTTAGTCCCGGGCGTG+CGG | + | contig129end:5991-6010 | MsG0080047869.01.T01:intron | 65.0% | |
CATTGCTGCTACGCCACGGG+CGG | - | contig129end:5272-5291 | MsG0080047869.01.T01:intergenic | 65.0% | |
GCCGCTATGCACCGCTATCC+GGG | + | contig129end:5558-5577 | MsG0080047869.01.T01:intron | 65.0% | |
GCTCCCTTGCCAAGGTCCTC+AGG | + | contig129end:6267-6286 | MsG0080047869.01.T01:intron | 65.0% | |
GGGGCGGACCGCAATTAAGG+CGG | - | contig129end:1423-1442 | MsG0080047869.01.T01:intergenic | 65.0% | |
TAGCCCAATACCCGCACGCC+CGG | - | contig129end:6005-6024 | MsG0080047869.01.T01:intergenic | 65.0% | |
! | CTCCGCCGCTTTAGCACAGC+TGG | - | contig129end:5344-5363 | MsG0080047869.01.T01:intergenic | 65.0% |
AAGCGGCGGAGCAGCCGCTT+TGG | + | contig129end:5353-5372 | MsG0080047869.01.T01:intron | 70.0% | |
AGCCCAATACCCGCACGCCC+GGG | - | contig129end:6004-6023 | MsG0080047869.01.T01:intergenic | 70.0% | |
AGTCCCGGGCGTGCGGGTAT+TGG | + | contig129end:5998-6017 | MsG0080047869.01.T01:intron | 70.0% | |
CTGCGGCTGCTCCCTTGCCA+AGG | + | contig129end:6259-6278 | MsG0080047869.01.T01:intron | 70.0% | |
GCACGCCCGGGACTAACACC+TGG | - | contig129end:5992-6011 | MsG0080047869.01.T01:intergenic | 70.0% | |
GGTGTTAGTCCCGGGCGTGC+GGG | + | contig129end:5992-6011 | MsG0080047869.01.T01:intron | 70.0% | |
GTCCCGGGCGTGCGGGTATT+GGG | + | contig129end:5999-6018 | MsG0080047869.01.T01:intron | 70.0% | |
! | GGCGCTATAGCGGCCGCCCG+TGG | + | contig129end:5256-5275 | MsG0080047869.01.T01:intron | 80.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
contig129end | gene | 319 | 8882 | 319 | ID=MsG0080047869.01;Name=MsG0080047869.01 |
contig129end | mRNA | 319 | 8882 | 319 | ID=MsG0080047869.01.T01;Parent=MsG0080047869.01;Name=MsG0080047869.01.T01;_AED=0.41;_eAED=0.41;_QI=66|0.54|0.75|0.91|0.90|0.91|12|306|372 |
contig129end | exon | 319 | 366 | 319 | ID=MsG0080047869.01.T01:exon:57180;Parent=MsG0080047869.01.T01 |
contig129end | exon | 669 | 820 | 669 | ID=MsG0080047869.01.T01:exon:57181;Parent=MsG0080047869.01.T01 |
contig129end | exon | 2097 | 2176 | 2097 | ID=MsG0080047869.01.T01:exon:57182;Parent=MsG0080047869.01.T01 |
contig129end | exon | 2774 | 2830 | 2774 | ID=MsG0080047869.01.T01:exon:57183;Parent=MsG0080047869.01.T01 |
contig129end | exon | 3183 | 3330 | 3183 | ID=MsG0080047869.01.T01:exon:57184;Parent=MsG0080047869.01.T01 |
contig129end | exon | 3518 | 3580 | 3518 | ID=MsG0080047869.01.T01:exon:57185;Parent=MsG0080047869.01.T01 |
contig129end | exon | 3750 | 3819 | 3750 | ID=MsG0080047869.01.T01:exon:57186;Parent=MsG0080047869.01.T01 |
contig129end | exon | 4268 | 4327 | 4268 | ID=MsG0080047869.01.T01:exon:57187;Parent=MsG0080047869.01.T01 |
contig129end | exon | 5676 | 5723 | 5676 | ID=MsG0080047869.01.T01:exon:57188;Parent=MsG0080047869.01.T01 |
contig129end | exon | 7802 | 7903 | 7802 | ID=MsG0080047869.01.T01:exon:57189;Parent=MsG0080047869.01.T01 |
contig129end | exon | 7988 | 8059 | 7988 | ID=MsG0080047869.01.T01:exon:57190;Parent=MsG0080047869.01.T01 |
contig129end | exon | 8292 | 8882 | 8292 | ID=MsG0080047869.01.T01:exon:57191;Parent=MsG0080047869.01.T01 |
contig129end | five_prime_UTR | 319 | 366 | 319 | ID=MsG0080047869.01.T01:five_prime_utr;Parent=MsG0080047869.01.T01 |
contig129end | five_prime_UTR | 669 | 686 | 669 | ID=MsG0080047869.01.T01:five_prime_utr;Parent=MsG0080047869.01.T01 |
contig129end | CDS | 687 | 820 | 687 | ID=MsG0080047869.01.T01:cds;Parent=MsG0080047869.01.T01 |
contig129end | CDS | 2097 | 2176 | 2097 | ID=MsG0080047869.01.T01:cds;Parent=MsG0080047869.01.T01 |
contig129end | CDS | 2774 | 2830 | 2774 | ID=MsG0080047869.01.T01:cds;Parent=MsG0080047869.01.T01 |
contig129end | CDS | 3183 | 3330 | 3183 | ID=MsG0080047869.01.T01:cds;Parent=MsG0080047869.01.T01 |
contig129end | CDS | 3518 | 3580 | 3518 | ID=MsG0080047869.01.T01:cds;Parent=MsG0080047869.01.T01 |
contig129end | CDS | 3750 | 3819 | 3750 | ID=MsG0080047869.01.T01:cds;Parent=MsG0080047869.01.T01 |
contig129end | CDS | 4268 | 4327 | 4268 | ID=MsG0080047869.01.T01:cds;Parent=MsG0080047869.01.T01 |
contig129end | CDS | 5676 | 5723 | 5676 | ID=MsG0080047869.01.T01:cds;Parent=MsG0080047869.01.T01 |
contig129end | CDS | 7802 | 7903 | 7802 | ID=MsG0080047869.01.T01:cds;Parent=MsG0080047869.01.T01 |
contig129end | CDS | 7988 | 8059 | 7988 | ID=MsG0080047869.01.T01:cds;Parent=MsG0080047869.01.T01 |
contig129end | CDS | 8292 | 8576 | 8292 | ID=MsG0080047869.01.T01:cds;Parent=MsG0080047869.01.T01 |
contig129end | three_prime_UTR | 8577 | 8882 | 8577 | ID=MsG0080047869.01.T01:three_prime_utr;Parent=MsG0080047869.01.T01 |
Gene Sequence |
Protein sequence |