Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0880042616.01.T01 | XP_003627161.1 | 87.963 | 108 | 9 | 1 | 1 | 108 | 1 | 104 | 1.20E-59 | 188 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0880042616.01.T01 | G7LI87 | 87.963 | 108 | 9 | 1 | 1 | 108 | 1 | 104 | 5.73e-60 | 188 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0180000114.01 | MsG0880042616.01 | 0.804324 | 2.281813e-49 | 1.173056e-46 |
MsG0180000470.01 | MsG0880042616.01 | 0.801063 | 1.074509e-48 | 5.083380e-46 |
MsG0180000702.01 | MsG0880042616.01 | 0.806486 | 8.034955e-50 | 4.366522e-47 |
MsG0180000703.01 | MsG0880042616.01 | 0.803353 | 3.630567e-49 | 1.820367e-46 |
MsG0180000777.01 | MsG0880042616.01 | 0.809289 | 2.036676e-50 | 1.191074e-47 |
MsG0180000814.01 | MsG0880042616.01 | 0.813708 | 2.231896e-51 | 1.468284e-48 |
MsG0180001149.01 | MsG0880042616.01 | 0.801260 | 9.792930e-49 | 4.655818e-46 |
MsG0180001663.01 | MsG0880042616.01 | 0.834490 | 2.909111e-56 | 3.457761e-53 |
MsG0180001904.01 | MsG0880042616.01 | 0.810719 | 1.002042e-50 | 6.085939e-48 |
MsG0180002282.01 | MsG0880042616.01 | 0.800011 | 1.760319e-48 | 8.108134e-46 |
MsG0180002955.01 | MsG0880042616.01 | 0.827863 | 1.236838e-54 | 1.208970e-51 |
MsG0180003189.01 | MsG0880042616.01 | 0.809031 | 2.313160e-50 | 1.343403e-47 |
MsG0180003357.01 | MsG0880042616.01 | 0.827250 | 1.735308e-54 | 1.666214e-51 |
MsG0180003510.01 | MsG0880042616.01 | 0.815631 | 8.373492e-52 | 5.804179e-49 |
MsG0180003673.01 | MsG0880042616.01 | 0.805377 | 1.374670e-49 | 7.261347e-47 |
MsG0180004085.01 | MsG0880042616.01 | 0.840829 | 6.869361e-58 | 9.904812e-55 |
MsG0180004465.01 | MsG0880042616.01 | 0.809029 | 2.315729e-50 | 1.344826e-47 |
MsG0180004600.01 | MsG0880042616.01 | 0.804158 | 2.470238e-49 | 1.264560e-46 |
MsG0180004765.01 | MsG0880042616.01 | 0.820871 | 5.454676e-53 | 4.368482e-50 |
MsG0180005160.01 | MsG0880042616.01 | 0.819221 | 1.301146e-52 | 9.952329e-50 |
MsG0180005185.01 | MsG0880042616.01 | 0.801330 | 9.473726e-49 | 4.512043e-46 |
MsG0180005730.01 | MsG0880042616.01 | 0.814106 | 1.824131e-51 | 1.212969e-48 |
MsG0180005732.01 | MsG0880042616.01 | 0.814832 | 1.260125e-51 | 8.545588e-49 |
MsG0180005960.01 | MsG0880042616.01 | 0.848072 | 7.738704e-60 | 1.403213e-56 |
MsG0180005990.01 | MsG0880042616.01 | 0.806696 | 7.256605e-50 | 3.964684e-47 |
MsG0180006134.01 | MsG0880042616.01 | 0.851386 | 9.177604e-61 | 1.854621e-57 |
MsG0780040788.01 | MsG0880042616.01 | 0.804409 | 2.190918e-49 | 1.128745e-46 |
MsG0780041015.01 | MsG0880042616.01 | -0.805605 | 1.231171e-49 | 6.541522e-47 |
MsG0780041080.01 | MsG0880042616.01 | 0.816888 | 4.384376e-52 | 3.145148e-49 |
MsG0780041261.01 | MsG0880042616.01 | 0.814180 | 1.756721e-51 | 1.170531e-48 |
MsG0780041387.01 | MsG0880042616.01 | 0.814551 | 1.454626e-51 | 9.790425e-49 |
MsG0780041491.01 | MsG0880042616.01 | 0.803797 | 2.936690e-49 | 1.489447e-46 |
MsG0880042161.01 | MsG0880042616.01 | 0.822607 | 2.164184e-53 | 1.820383e-50 |
MsG0880042247.01 | MsG0880042616.01 | 0.826311 | 2.908306e-54 | 2.717615e-51 |
MsG0880042560.01 | MsG0880042616.01 | 0.804216 | 2.403320e-49 | 1.232060e-46 |
MsG0880042616.01 | MsG0880042622.01 | 0.895352 | 1.040357e-75 | 1.075440e-71 |
MsG0880042616.01 | MsG0880042656.01 | 0.800310 | 1.530454e-48 | 7.103452e-46 |
MsG0880042616.01 | MsG0880042700.01 | 0.819046 | 1.426698e-52 | 1.086068e-49 |
MsG0880042616.01 | MsG0880042743.01 | 0.800187 | 1.620930e-48 | 7.499551e-46 |
MsG0880042616.01 | MsG0880043172.01 | 0.802064 | 6.697013e-49 | 3.249438e-46 |
MsG0880042616.01 | MsG0880043454.01 | 0.810349 | 1.204972e-50 | 7.246234e-48 |
MsG0880042616.01 | MsG0880043509.01 | 0.824779 | 6.708875e-54 | 6.001573e-51 |
MsG0880042616.01 | MsG0880043804.01 | 0.807810 | 4.214014e-50 | 2.369962e-47 |
MsG0880042616.01 | MsG0880043812.01 | 0.802162 | 6.395086e-49 | 3.110672e-46 |
MsG0880042616.01 | MsG0880043941.01 | 0.812628 | 3.852157e-51 | 2.461600e-48 |
MsG0880042616.01 | MsG0880044573.01 | 0.841954 | 3.472680e-58 | 5.185557e-55 |
MsG0880042616.01 | MsG0880044638.01 | 0.814162 | 1.772504e-51 | 1.180464e-48 |
MsG0880042616.01 | MsG0880045371.01 | 0.823244 | 1.537639e-53 | 1.316703e-50 |
MsG0880042616.01 | MsG0880045387.01 | 0.806732 | 7.129428e-50 | 3.898947e-47 |
MsG0880042616.01 | MsG0880045749.01 | 0.805704 | 1.173651e-49 | 6.252350e-47 |
MsG0880042616.01 | MsG0880045765.01 | 0.811390 | 7.171312e-51 | 4.433372e-48 |
MsG0880042616.01 | MsG0880045992.01 | 0.816334 | 5.833262e-52 | 4.121894e-49 |
MsG0880042616.01 | MsG0880047046.01 | 0.804809 | 1.807261e-49 | 9.408669e-47 |
MsG0880042616.01 | MsG0880047294.01 | 0.801777 | 7.672836e-49 | 3.695735e-46 |
MsG0280010598.01 | MsG0880042616.01 | 0.825944 | 3.556177e-54 | 3.288670e-51 |
MsG0280010599.01 | MsG0880042616.01 | 0.824094 | 9.720502e-54 | 8.525935e-51 |
MsG0280010722.01 | MsG0880042616.01 | 0.816694 | 4.845750e-52 | 3.457644e-49 |
MsG0280011032.01 | MsG0880042616.01 | 0.807642 | 4.575331e-50 | 2.561854e-47 |
MsG0280011163.01 | MsG0880042616.01 | 0.808700 | 2.723385e-50 | 1.567771e-47 |
MsG0280011376.01 | MsG0880042616.01 | 0.803889 | 2.810814e-49 | 1.429030e-46 |
MsG0380011537.01 | MsG0880042616.01 | 0.815001 | 1.155836e-51 | 7.874582e-49 |
MsG0380011895.01 | MsG0880042616.01 | 0.811684 | 6.190195e-51 | 3.856518e-48 |
MsG0380012005.01 | MsG0880042616.01 | 0.810930 | 9.023550e-51 | 5.511647e-48 |
MsG0380012365.01 | MsG0880042616.01 | 0.818698 | 1.711368e-52 | 1.290192e-49 |
MsG0380013176.01 | MsG0880042616.01 | 0.805498 | 1.296756e-49 | 6.870955e-47 |
MsG0380013342.01 | MsG0880042616.01 | 0.813650 | 2.298498e-51 | 1.509713e-48 |
MsG0380014727.01 | MsG0880042616.01 | 0.834841 | 2.373608e-56 | 2.850976e-53 |
MsG0380014866.01 | MsG0880042616.01 | 0.828490 | 8.736004e-55 | 8.696661e-52 |
MsG0680031334.01 | MsG0880042616.01 | 0.821667 | 3.575331e-53 | 2.927481e-50 |
MsG0680031355.01 | MsG0880042616.01 | 0.805357 | 1.388057e-49 | 7.328401e-47 |
MsG0680031377.01 | MsG0880042616.01 | -0.838240 | 3.235068e-57 | 4.306343e-54 |
MsG0680031561.01 | MsG0880042616.01 | 0.808215 | 3.454799e-50 | 1.963928e-47 |
MsG0680031815.01 | MsG0880042616.01 | 0.830390 | 3.017944e-55 | 3.175166e-52 |
MsG0680032058.01 | MsG0880042616.01 | 0.818135 | 2.295369e-52 | 1.703856e-49 |
MsG0680032157.01 | MsG0880042616.01 | 0.827402 | 1.596254e-54 | 1.539566e-51 |
MsG0680032801.01 | MsG0880042616.01 | 0.803589 | 3.243172e-49 | 1.636199e-46 |
MsG0680034235.01 | MsG0880042616.01 | 0.805480 | 1.307885e-49 | 6.926936e-47 |
MsG0680035444.01 | MsG0880042616.01 | 0.815508 | 8.919237e-52 | 6.161386e-49 |
MsG0480018473.01 | MsG0880042616.01 | 0.801822 | 7.509758e-49 | 3.621474e-46 |
MsG0480018778.01 | MsG0880042616.01 | 0.808692 | 2.733557e-50 | 1.573313e-47 |
MsG0480018883.01 | MsG0880042616.01 | 0.827644 | 1.396196e-54 | 1.355860e-51 |
MsG0480019035.01 | MsG0880042616.01 | 0.818984 | 1.473401e-52 | 1.119797e-49 |
MsG0480019335.01 | MsG0880042616.01 | 0.816753 | 4.701393e-52 | 3.360145e-49 |
MsG0480019434.01 | MsG0880042616.01 | 0.817022 | 4.089948e-52 | 2.944906e-49 |
MsG0480019435.01 | MsG0880042616.01 | 0.810943 | 8.961866e-51 | 5.476007e-48 |
MsG0480019772.01 | MsG0880042616.01 | 0.800285 | 1.548298e-48 | 7.181545e-46 |
MsG0480020322.01 | MsG0880042616.01 | 0.803719 | 3.047964e-49 | 1.542747e-46 |
MsG0480020323.01 | MsG0880042616.01 | 0.809638 | 1.713778e-50 | 1.011655e-47 |
MsG0480021917.01 | MsG0880042616.01 | 0.815835 | 7.542882e-52 | 5.257034e-49 |
MsG0480021948.01 | MsG0880042616.01 | 0.805988 | 1.023081e-49 | 5.489849e-47 |
MsG0480021959.01 | MsG0880042616.01 | 0.811938 | 5.449504e-51 | 3.418192e-48 |
MsG0480022068.01 | MsG0880042616.01 | 0.800045 | 1.732983e-48 | 7.988976e-46 |
MsG0480022169.01 | MsG0880042616.01 | 0.814750 | 1.314318e-51 | 8.893286e-49 |
MsG0480022178.01 | MsG0880042616.01 | 0.820106 | 8.172282e-53 | 6.408125e-50 |
MsG0480022259.01 | MsG0880042616.01 | 0.802218 | 6.226624e-49 | 3.033002e-46 |
MsG0480022262.01 | MsG0880042616.01 | 0.804774 | 1.838078e-49 | 9.559961e-47 |
MsG0480022933.01 | MsG0880042616.01 | 0.818343 | 2.059203e-52 | 1.537476e-49 |
MsG0480023045.01 | MsG0880042616.01 | 0.828519 | 8.595203e-55 | 8.563654e-52 |
MsG0480023248.01 | MsG0880042616.01 | 0.813697 | 2.244387e-51 | 1.476053e-48 |
MsG0480023251.01 | MsG0880042616.01 | 0.824568 | 7.520873e-54 | 6.687205e-51 |
MsG0480023488.01 | MsG0880042616.01 | 0.806696 | 7.257502e-50 | 3.965167e-47 |
MsG0480023638.01 | MsG0880042616.01 | 0.811105 | 8.268829e-51 | 5.073679e-48 |
MsG0480023670.01 | MsG0880042616.01 | 0.805605 | 1.231567e-49 | 6.543493e-47 |
MsG0480023835.01 | MsG0880042616.01 | 0.800418 | 1.455071e-48 | 6.771870e-46 |
MsG0480023937.01 | MsG0880042616.01 | 0.811880 | 5.610087e-51 | 3.513466e-48 |
MsG0480023994.01 | MsG0880042616.01 | 0.813036 | 3.136655e-51 | 2.026082e-48 |
MsG0480024014.01 | MsG0880042616.01 | 0.802239 | 6.164091e-49 | 3.004247e-46 |
MsG0580024130.01 | MsG0880042616.01 | 0.803450 | 3.465970e-49 | 1.742281e-46 |
MsG0580024160.01 | MsG0880042616.01 | 0.810855 | 9.368122e-51 | 5.710375e-48 |
MsG0580024829.01 | MsG0880042616.01 | 0.807768 | 4.301281e-50 | 2.416374e-47 |
MsG0580025666.01 | MsG0880042616.01 | 0.813386 | 2.627877e-51 | 1.713746e-48 |
MsG0580025758.01 | MsG0880042616.01 | 0.810946 | 8.948830e-51 | 5.468528e-48 |
MsG0580026032.01 | MsG0880042616.01 | 0.820578 | 6.369924e-53 | 5.059533e-50 |
MsG0380015039.01 | MsG0880042616.01 | 0.804574 | 2.023914e-49 | 1.047183e-46 |
MsG0380015497.01 | MsG0880042616.01 | 0.810644 | 1.040638e-50 | 6.307346e-48 |
MsG0380015829.01 | MsG0880042616.01 | 0.825915 | 3.612794e-54 | 3.338212e-51 |
MsG0380016182.01 | MsG0880042616.01 | 0.833643 | 4.740437e-56 | 5.492583e-53 |
MsG0380016391.01 | MsG0880042616.01 | 0.810442 | 1.150437e-50 | 6.935234e-48 |
MsG0380016566.01 | MsG0880042616.01 | 0.823912 | 1.072709e-53 | 9.361359e-51 |
MsG0380016581.01 | MsG0880042616.01 | 0.814675 | 1.365090e-51 | 9.218476e-49 |
MsG0380016624.01 | MsG0880042616.01 | 0.819400 | 1.184910e-52 | 9.108276e-50 |
MsG0380016694.01 | MsG0880042616.01 | 0.823427 | 1.393536e-53 | 1.199429e-50 |
MsG0380016923.01 | MsG0880042616.01 | 0.813403 | 2.604970e-51 | 1.699623e-48 |
MsG0380017040.01 | MsG0880042616.01 | 0.805839 | 1.099786e-49 | 5.878863e-47 |
MsG0380017048.01 | MsG0880042616.01 | 0.833086 | 6.527385e-56 | 7.438897e-53 |
MsG0380017220.01 | MsG0880042616.01 | 0.805193 | 1.502516e-49 | 7.899111e-47 |
MsG0380017322.01 | MsG0880042616.01 | 0.802632 | 5.116227e-49 | 2.518620e-46 |
MsG0380017326.01 | MsG0880042616.01 | 0.803408 | 3.535551e-49 | 1.775315e-46 |
MsG0380017528.01 | MsG0880042616.01 | 0.803947 | 2.733651e-49 | 1.391902e-46 |
MsG0380017543.01 | MsG0880042616.01 | 0.837853 | 4.067958e-57 | 5.352544e-54 |
MsG0380017551.01 | MsG0880042616.01 | -0.801183 | 1.015377e-48 | 4.818006e-46 |
MsG0480018121.01 | MsG0880042616.01 | 0.802877 | 4.553001e-49 | 2.255388e-46 |
MsG0480018236.01 | MsG0880042616.01 | 0.844880 | 5.747887e-59 | 9.408966e-56 |
MsG0480018318.01 | MsG0880042616.01 | 0.809455 | 1.875949e-50 | 1.101919e-47 |
MsG0580026086.01 | MsG0880042616.01 | 0.808852 | 2.526168e-50 | 1.460105e-47 |
MsG0580026304.01 | MsG0880042616.01 | 0.821720 | 3.475686e-53 | 2.850176e-50 |
MsG0580026340.01 | MsG0880042616.01 | 0.825885 | 3.672576e-54 | 3.390603e-51 |
MsG0580029376.01 | MsG0880042616.01 | 0.809456 | 1.875332e-50 | 1.101585e-47 |
MsG0580029599.01 | MsG0880042616.01 | 0.805428 | 1.341439e-49 | 7.095097e-47 |
MsG0580029622.01 | MsG0880042616.01 | 0.816375 | 5.712325e-52 | 4.040759e-49 |
MsG0280006491.01 | MsG0880042616.01 | 0.821922 | 3.120268e-53 | 2.573501e-50 |
MsG0280006588.01 | MsG0880042616.01 | 0.839226 | 1.798245e-57 | 2.467268e-54 |
MsG0280006589.01 | MsG0880042616.01 | 0.823630 | 1.249327e-53 | 1.081608e-50 |
MsG0280006590.01 | MsG0880042616.01 | 0.811357 | 7.290026e-51 | 4.502667e-48 |
MsG0280006669.01 | MsG0880042616.01 | 0.814123 | 1.807976e-51 | 1.202823e-48 |
MsG0280007496.01 | MsG0880042616.01 | 0.803935 | 2.748495e-49 | 1.399070e-46 |
MsG0280007547.01 | MsG0880042616.01 | 0.801159 | 1.027069e-48 | 4.870624e-46 |
MsG0280007864.01 | MsG0880042616.01 | -0.804414 | 2.185200e-49 | 1.125972e-46 |
MsG0280008112.01 | MsG0880042616.01 | 0.834614 | 2.707137e-56 | 3.229592e-53 |
MsG0280008113.01 | MsG0880042616.01 | 0.832369 | 9.833360e-56 | 1.096826e-52 |
MsG0280008894.01 | MsG0880042616.01 | 0.834437 | 2.998485e-56 | 3.558422e-53 |
MsG0280008932.01 | MsG0880042616.01 | 0.811157 | 8.057281e-51 | 4.950528e-48 |
MsG0280009024.01 | MsG0880042616.01 | 0.807942 | 3.950655e-50 | 2.229497e-47 |
MsG0280009421.01 | MsG0880042616.01 | 0.813849 | 2.077866e-51 | 1.372132e-48 |
MsG0280009646.01 | MsG0880042616.01 | 0.810534 | 1.099049e-50 | 6.641645e-48 |
MsG0280009754.01 | MsG0880042616.01 | 0.809650 | 1.703923e-50 | 1.006121e-47 |
MsG0280010216.01 | MsG0880042616.01 | 0.810455 | 1.143001e-50 | 6.892771e-48 |
MsG0280010349.01 | MsG0880042616.01 | 0.815023 | 1.143349e-51 | 7.793884e-49 |
MsG0280010517.01 | MsG0880042616.01 | 0.804221 | 2.397168e-49 | 1.229060e-46 |
MsG0680035707.01 | MsG0880042616.01 | 0.810058 | 1.391703e-50 | 8.306119e-48 |
MsG0780035957.01 | MsG0880042616.01 | 0.807881 | 4.069610e-50 | 2.292916e-47 |
MsG0780035958.01 | MsG0880042616.01 | 0.806785 | 6.947708e-50 | 3.804710e-47 |
MsG0780036117.01 | MsG0880042616.01 | 0.821029 | 5.016424e-53 | 4.035422e-50 |
MsG0780036128.01 | MsG0880042616.01 | 0.838403 | 2.935473e-57 | 3.927658e-54 |
MsG0780036978.01 | MsG0880042616.01 | 0.825933 | 3.578144e-54 | 3.307905e-51 |
MsG0780037330.01 | MsG0880042616.01 | 0.803522 | 3.349366e-49 | 1.686844e-46 |
MsG0780038092.01 | MsG0880042616.01 | 0.829150 | 6.046973e-55 | 6.136713e-52 |
MsG0780038636.01 | MsG0880042616.01 | 0.837513 | 4.971840e-57 | 6.473856e-54 |
MsG0780038644.01 | MsG0880042616.01 | 0.823523 | 1.323353e-53 | 1.142212e-50 |
MsG0780038827.01 | MsG0880042616.01 | 0.830688 | 2.551524e-55 | 2.708102e-52 |
MsG0780038833.01 | MsG0880042616.01 | 0.829658 | 4.550323e-55 | 4.687356e-52 |
MsG0780038907.01 | MsG0880042616.01 | 0.800208 | 1.605355e-48 | 7.431370e-46 |
MsG0780039143.01 | MsG0880042616.01 | 0.843818 | 1.108760e-58 | 1.755556e-55 |
MsG0780039498.01 | MsG0880042616.01 | 0.800302 | 1.536088e-48 | 7.128126e-46 |
MsG0780039573.01 | MsG0880042616.01 | 0.816255 | 6.077718e-52 | 4.285232e-49 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0880042616.01.T01 | MTR_8g018320 | 87.963 | 108 | 9 | 1 | 1 | 108 | 1 | 104 | 1.45e-63 | 188 |
MsG0880042616.01.T01 | MTR_8g018360 | 87.850 | 107 | 9 | 1 | 1 | 107 | 1 | 103 | 5.31e-61 | 184 |
MsG0880042616.01.T01 | MTR_2g099630 | 62.963 | 108 | 32 | 5 | 1 | 106 | 1 | 102 | 3.14e-35 | 117 |
MsG0880042616.01.T01 | MTR_4g125990 | 50.847 | 118 | 45 | 3 | 2 | 107 | 3 | 119 | 8.17e-28 | 98.6 |
MsG0880042616.01.T01 | MTR_3g104640 | 55.238 | 105 | 42 | 2 | 4 | 107 | 6 | 106 | 2.89e-20 | 79.0 |
MsG0880042616.01.T01 | MTR_7g109290 | 44.318 | 88 | 40 | 2 | 28 | 107 | 1 | 87 | 6.87e-17 | 69.7 |
MsG0880042616.01.T01 | MTR_1g087730 | 56.250 | 48 | 21 | 0 | 60 | 107 | 55 | 102 | 5.73e-15 | 65.5 |
MsG0880042616.01.T01 | MTR_1g015810 | 42.857 | 98 | 47 | 2 | 11 | 102 | 15 | 109 | 1.52e-12 | 59.7 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0880042616.01.T01 | AT5G11970 | 45.192 | 104 | 48 | 2 | 4 | 107 | 6 | 100 | 3.60e-20 | 78.6 |
MsG0880042616.01.T01 | AT2G19460 | 42.105 | 114 | 56 | 4 | 2 | 107 | 3 | 114 | 2.04e-19 | 77.0 |
MsG0880042616.01.T01 | AT2G19460 | 42.105 | 114 | 56 | 4 | 2 | 107 | 55 | 166 | 4.54e-19 | 77.4 |
MsG0880042616.01.T01 | AT1G72720 | 38.095 | 126 | 58 | 5 | 3 | 108 | 2 | 127 | 3.15e-14 | 63.9 |
MsG0880042616.01.T01 | AT3G13910 | 55.738 | 61 | 24 | 1 | 47 | 104 | 39 | 99 | 8.33e-14 | 62.4 |
MsG0880042616.01.T01 | AT3G13910 | 53.125 | 64 | 27 | 1 | 47 | 107 | 39 | 102 | 1.06e-13 | 62.4 |
MsG0880042616.01.T01 | AT2G47480 | 45.000 | 60 | 33 | 0 | 48 | 107 | 47 | 106 | 8.11e-12 | 57.4 |
Find 15 sgRNAs with CRISPR-Local
Find 18 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
CAATCAATCATCACCATAAT+TGG | 0.249026 | 8:+11512858 | None:intergenic |
ACTTTGATCCCTGCATGATT+TGG | 0.293039 | 8:+11513159 | None:intergenic |
CTCAGGTCTTGCATGCTTGA+TGG | 0.298734 | 8:+11513100 | None:intergenic |
AGAACACATGCAGCCAATTA+TGG | 0.342449 | 8:-11512871 | MsG0880042616.01.T01:CDS |
AATTTGTACTATAACTTCTC+AGG | 0.430942 | 8:+11513083 | None:intergenic |
CAGAGAAAGAAAAGAGTAGC+TGG | 0.442245 | 8:-11512959 | MsG0880042616.01.T01:CDS |
TTGCAGATTGAAAGCTATAG+TGG | 0.472998 | 8:-11513136 | MsG0880042616.01.T01:CDS |
CTTTCAAGAAGAGTTTAAGA+TGG | 0.490246 | 8:-11512898 | MsG0880042616.01.T01:CDS |
GATGTTGAAGGAAAAGTGAA+AGG | 0.521803 | 8:-11512923 | MsG0880042616.01.T01:CDS |
TATAAAGTATATGATGTTGA+AGG | 0.535495 | 8:-11512935 | MsG0880042616.01.T01:CDS |
AGTTATAGTACAAATTATGA+TGG | 0.547941 | 8:-11513076 | MsG0880042616.01.T01:CDS |
ATGTTGAAGGAAAAGTGAAA+GGG | 0.557577 | 8:-11512922 | MsG0880042616.01.T01:CDS |
AATTCAGATCCAAATCATGC+AGG | 0.564800 | 8:-11513168 | MsG0880042616.01.T01:CDS |
CAGATTGAAAGCTATAGTGG+TGG | 0.602253 | 8:-11513133 | MsG0880042616.01.T01:CDS |
ATTCAGATCCAAATCATGCA+GGG | 0.608352 | 8:-11513167 | MsG0880042616.01.T01:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!! | AGTTATAGTACAAATTATGA+TGG | - | Chr8:11512964-11512983 | MsG0880042616.01.T01:CDS | 20.0% |
!! | GAAAAAAGTAAGAGTAAATT+TGG | - | Chr8:11513018-11513037 | MsG0880042616.01.T01:CDS | 20.0% |
!! | TATAAAGTATATGATGTTGA+AGG | - | Chr8:11513105-11513124 | MsG0880042616.01.T01:CDS | 20.0% |
! | AATTTGTACTATAACTTCTC+AGG | + | Chr8:11512960-11512979 | None:intergenic | 25.0% |
ATGTTGAAGGAAAAGTGAAA+GGG | - | Chr8:11513118-11513137 | MsG0880042616.01.T01:CDS | 30.0% | |
CTTTCAAGAAGAGTTTAAGA+TGG | - | Chr8:11513142-11513161 | MsG0880042616.01.T01:CDS | 30.0% | |
! | TTGGCAAAGCATCAAAAATT+TGG | - | Chr8:11513037-11513056 | MsG0880042616.01.T01:CDS | 30.0% |
!! | ATCTGCTTTTGATCAAAACA+AGG | - | Chr8:11512993-11513012 | MsG0880042616.01.T01:CDS | 30.0% |
AATTCAGATCCAAATCATGC+AGG | - | Chr8:11512872-11512891 | MsG0880042616.01.T01:CDS | 35.0% | |
ATTCAGATCCAAATCATGCA+GGG | - | Chr8:11512873-11512892 | MsG0880042616.01.T01:CDS | 35.0% | |
GATGTTGAAGGAAAAGTGAA+AGG | - | Chr8:11513117-11513136 | MsG0880042616.01.T01:CDS | 35.0% | |
TTGCAGATTGAAAGCTATAG+TGG | - | Chr8:11512904-11512923 | MsG0880042616.01.T01:CDS | 35.0% | |
ACTTTGATCCCTGCATGATT+TGG | + | Chr8:11512884-11512903 | None:intergenic | 40.0% | |
AGAACACATGCAGCCAATTA+TGG | - | Chr8:11513169-11513188 | MsG0880042616.01.T01:CDS | 40.0% | |
CAGAGAAAGAAAAGAGTAGC+TGG | - | Chr8:11513081-11513100 | MsG0880042616.01.T01:CDS | 40.0% | |
CAGATTGAAAGCTATAGTGG+TGG | - | Chr8:11512907-11512926 | MsG0880042616.01.T01:CDS | 40.0% | |
! | CTTTTCTTTCTCTGCAACTC+TGG | + | Chr8:11513075-11513094 | None:intergenic | 40.0% |
CTCAGGTCTTGCATGCTTGA+TGG | + | Chr8:11512943-11512962 | None:intergenic | 50.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr8 | gene | 11512868 | 11513194 | 11512868 | ID=MsG0880042616.01;Name=MsG0880042616.01 |
Chr8 | mRNA | 11512868 | 11513194 | 11512868 | ID=MsG0880042616.01.T01;Parent=MsG0880042616.01;Name=MsG0880042616.01.T01;_AED=0.05;_eAED=0.07;_QI=0|-1|0|1|-1|1|1|0|108 |
Chr8 | exon | 11512868 | 11513194 | 11512868 | ID=MsG0880042616.01.T01:exon:3527;Parent=MsG0880042616.01.T01 |
Chr8 | CDS | 11512868 | 11513194 | 11512868 | ID=MsG0880042616.01.T01:cds;Parent=MsG0880042616.01.T01 |
Gene Sequence |
Protein sequence |