Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0111510 | XP_004497758.1 | 90.323 | 93 | 7 | 1 | 1 | 91 | 110 | 202 | 3.35e-51 | 169 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0111510 | sp|F6HS55|ITPA_VITVI | 78.261 | 92 | 18 | 1 | 1 | 90 | 110 | 201 | 1.70e-46 | 150 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0111510 | A0A1S2Y197 | 90.323 | 93 | 7 | 1 | 1 | 91 | 110 | 202 | 1.60e-51 | 169 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| Msa0014330 | Msa0111510 | 0.800419 | 1.454206e-48 | -8.615850e-47 |
| Msa0015750 | Msa0111510 | 0.810589 | 1.069412e-50 | -8.615850e-47 |
| Msa0016570 | Msa0111510 | 0.827829 | 1.260437e-54 | -8.615850e-47 |
| Msa0016580 | Msa0111510 | 0.816342 | 5.810382e-52 | -8.615850e-47 |
| Msa0102070 | Msa0111510 | 0.812275 | 4.601560e-51 | -8.615850e-47 |
| Msa0107580 | Msa0111510 | 0.807052 | 6.101843e-50 | -8.615850e-47 |
| Msa0111510 | Msa0123810 | 0.809348 | 1.978575e-50 | -8.615850e-47 |
| Msa0111510 | Msa0142220 | 0.826965 | 2.030513e-54 | -8.615850e-47 |
| Msa0111510 | Msa0145750 | 0.820906 | 5.354681e-53 | -8.615850e-47 |
| Msa0111510 | Msa0153910 | 0.853644 | 2.085827e-61 | -8.615850e-47 |
| Msa0111510 | Msa0192970 | 0.817267 | 3.603841e-52 | -8.615850e-47 |
| Msa0111510 | Msa0227480 | 0.816284 | 5.985205e-52 | -8.615850e-47 |
| Msa0111510 | Msa0232850 | 0.822190 | 2.704856e-53 | -8.615850e-47 |
| Msa0111510 | Msa0235140 | 0.828031 | 1.127126e-54 | -8.615850e-47 |
| Msa0111510 | Msa0267000 | 0.842187 | 3.014341e-58 | -8.615850e-47 |
| Msa0111510 | Msa0267010 | 0.847433 | 1.160311e-59 | -8.615850e-47 |
| Msa0111510 | Msa0270520 | 0.829534 | 4.877530e-55 | -8.615850e-47 |
| Msa0111510 | Msa0304170 | 0.820826 | 5.586564e-53 | -8.615850e-47 |
| Msa0111510 | Msa0306460 | 0.812330 | 4.475915e-51 | -8.615850e-47 |
| Msa0111510 | Msa0309020 | 0.813684 | 2.259583e-51 | -8.615850e-47 |
| Msa0111510 | Msa0313760 | 0.831183 | 1.928950e-55 | -8.615850e-47 |
| Msa0111510 | Msa0342240 | 0.833407 | 5.429196e-56 | -8.615850e-47 |
| Msa0111510 | Msa0355220 | 0.802944 | 4.411043e-49 | -8.615850e-47 |
| Msa0111510 | Msa0360510 | 0.819113 | 1.377204e-52 | -8.615850e-47 |
| Msa0111510 | Msa0365500 | 0.818876 | 1.558883e-52 | -8.615850e-47 |
| Msa0111510 | Msa0371730 | 0.800253 | 1.571504e-48 | -8.615850e-47 |
| Msa0111510 | Msa0384800 | 0.844570 | 6.965414e-59 | -8.615850e-47 |
| Msa0111510 | Msa0394970 | 0.807109 | 5.934861e-50 | -8.615850e-47 |
| Msa0111510 | Msa0402290 | 0.810837 | 9.450007e-51 | -8.615850e-47 |
| Msa0111510 | Msa0406120 | 0.809163 | 2.166967e-50 | -8.615850e-47 |
| Msa0111510 | Msa0414410 | 0.821698 | 3.516857e-53 | -8.615850e-47 |
| Msa0111510 | Msa0414420 | 0.847510 | 1.104775e-59 | -8.615850e-47 |
| Msa0111510 | Msa0436780 | 0.800239 | 1.582273e-48 | -8.615850e-47 |
| Msa0111510 | Msa0438620 | 0.800953 | 1.131671e-48 | -8.615850e-47 |
| Msa0111510 | Msa0444130 | 0.807450 | 5.025280e-50 | -8.615850e-47 |
| Msa0111510 | Msa0450000 | 0.802893 | 4.519317e-49 | -8.615850e-47 |
| Msa0111510 | Msa0452900 | 0.860036 | 2.731700e-63 | -8.615850e-47 |
| Msa0111510 | Msa0453120 | 0.812362 | 4.404300e-51 | -8.615850e-47 |
| Msa0111510 | Msa0454910 | 0.826986 | 2.007370e-54 | -8.615850e-47 |
| Msa0111510 | Msa0459170 | 0.820007 | 8.610086e-53 | -8.615850e-47 |
| Msa0111510 | Msa0491590 | 0.814787 | 1.289448e-51 | -8.615850e-47 |
| Msa0111510 | Msa0502760 | 0.811215 | 7.825169e-51 | -8.615850e-47 |
| Msa0111510 | Msa0506270 | 0.800110 | 1.680338e-48 | -8.615850e-47 |
| Msa0111510 | Msa0564890 | 0.859650 | 3.572069e-63 | -8.615850e-47 |
| Msa0111510 | Msa0589780 | 0.800090 | 1.696375e-48 | -8.615850e-47 |
| Msa0111510 | Msa0596150 | 0.827939 | 1.186009e-54 | -8.615850e-47 |
| Msa0111510 | Msa0598780 | 0.824723 | 6.914345e-54 | -8.615850e-47 |
| Msa0111510 | Msa0636170 | 0.807559 | 4.765450e-50 | -8.615850e-47 |
| Msa0111510 | Msa0678930 | 0.834390 | 3.081558e-56 | -8.615850e-47 |
| Msa0111510 | Msa0694370 | 0.849361 | 3.397875e-60 | -8.615850e-47 |
| Msa0111510 | Msa0726140 | 0.866153 | 3.511136e-65 | -8.615850e-47 |
| Msa0111510 | Msa0729800 | 0.806664 | 7.371082e-50 | -8.615850e-47 |
| Msa0111510 | Msa0731550 | 0.816082 | 6.641685e-52 | -8.615850e-47 |
| Msa0111510 | Msa0733290 | 0.806429 | 8.261868e-50 | -8.615850e-47 |
| Msa0111510 | Msa0736000 | 0.801736 | 7.821973e-49 | -8.615850e-47 |
| Msa0111510 | Msa0741990 | 0.826732 | 2.308565e-54 | -8.615850e-47 |
| Msa0111510 | Msa0743810 | 0.850926 | 1.238125e-60 | -8.615850e-47 |
| Msa0111510 | Msa0745060 | 0.863733 | 2.016557e-64 | -8.615850e-47 |
| Msa0111510 | Msa0766630 | 0.824873 | 6.375915e-54 | -8.615850e-47 |
| Msa0111510 | Msa0767720 | 0.838519 | 2.739886e-57 | -8.615850e-47 |
| Msa0111510 | Msa0783160 | 0.845947 | 2.954501e-59 | -8.615850e-47 |
| Msa0111510 | Msa0787600 | 0.826123 | 3.224013e-54 | -8.615850e-47 |
| Msa0111510 | Msa0789250 | 0.815268 | 1.008299e-51 | -8.615850e-47 |
| Msa0111510 | Msa0811080 | 0.833710 | 4.561290e-56 | -8.615850e-47 |
| Msa0111510 | Msa0811270 | 0.801676 | 8.045205e-49 | -8.615850e-47 |
| Msa0111510 | Msa0825860 | 0.858490 | 7.948159e-63 | -8.615850e-47 |
| Msa0111510 | Msa0833290 | 0.807041 | 6.135155e-50 | -8.615850e-47 |
| Msa0111510 | Msa0846330 | 0.819987 | 8.700478e-53 | -8.615850e-47 |
| Msa0111510 | Msa0846350 | 0.832618 | 8.529064e-56 | -8.615850e-47 |
| Msa0111510 | Msa0848060 | 0.801739 | 7.811844e-49 | -8.615850e-47 |
| Msa0111510 | Msa0865320 | 0.837608 | 4.702883e-57 | -8.615850e-47 |
| Msa0111510 | Msa0885280 | 0.826379 | 2.801648e-54 | -8.615850e-47 |
| Msa0111510 | Msa0885290 | 0.847525 | 1.094510e-59 | -8.615850e-47 |
| Msa0111510 | Msa0907260 | 0.850010 | 2.237938e-60 | -8.615850e-47 |
| Msa0111510 | Msa0954910 | 0.846510 | 2.075632e-59 | -8.615850e-47 |
| Msa0111510 | Msa0956270 | 0.853570 | 2.189210e-61 | -8.615850e-47 |
| Msa0111510 | Msa0957860 | 0.806229 | 9.102688e-50 | -8.615850e-47 |
| Msa0111510 | Msa0957960 | 0.806325 | 8.690957e-50 | -8.615850e-47 |
| Msa0111510 | Msa0981370 | 0.813166 | 2.936795e-51 | -8.615850e-47 |
| Msa0111510 | Msa0983090 | 0.805665 | 1.196469e-49 | -8.615850e-47 |
| Msa0111510 | Msa0989060 | 0.821772 | 3.380617e-53 | -8.615850e-47 |
| Msa0111510 | Msa0998690 | 0.814130 | 1.802371e-51 | -8.615850e-47 |
| Msa0111510 | Msa1014540 | 0.811487 | 6.831863e-51 | -8.615850e-47 |
| Msa0111510 | Msa1016280 | 0.865416 | 6.001373e-65 | -8.615850e-47 |
| Msa0111510 | Msa1024240 | 0.823499 | 1.340052e-53 | -8.615850e-47 |
| Msa0111510 | Msa1025360 | 0.839686 | 1.365803e-57 | -8.615850e-47 |
| Msa0111510 | Msa1025370 | 0.830370 | 3.050573e-55 | -8.615850e-47 |
| Msa0111510 | Msa1044830 | 0.833502 | 5.140259e-56 | -8.615850e-47 |
| Msa0111510 | Msa1044840 | 0.841675 | 4.114519e-58 | -8.615850e-47 |
| Msa0111510 | Msa1060840 | 0.816898 | 4.360141e-52 | -8.615850e-47 |
| Msa0111510 | Msa1065570 | 0.800347 | 1.503830e-48 | -8.615850e-47 |
| Msa0111510 | Msa1092990 | 0.837547 | 4.873183e-57 | -8.615850e-47 |
| Msa0111510 | Msa1100980 | 0.840948 | 6.394217e-58 | -8.615850e-47 |
| Msa0111510 | Msa1109440 | 0.848833 | 4.764669e-60 | -8.615850e-47 |
| Msa0111510 | Msa1111150 | 0.826584 | 2.503761e-54 | -8.615850e-47 |
| Msa0111510 | Msa1121200 | 0.816547 | 5.228262e-52 | -8.615850e-47 |
| Msa0111510 | Msa1135740 | 0.828557 | 8.415653e-55 | -8.615850e-47 |
| Msa0111510 | Msa1136090 | 0.848662 | 5.314836e-60 | -8.615850e-47 |
| Msa0111510 | Msa1146110 | 0.823111 | 1.651017e-53 | -8.615850e-47 |
| Msa0111510 | Msa1150370 | 0.820284 | 7.439990e-53 | -8.615850e-47 |
| Msa0111510 | Msa1160670 | 0.821590 | 3.723280e-53 | -8.615850e-47 |
| Msa0111510 | Msa1182090 | 0.804699 | 1.905271e-49 | -8.615850e-47 |
| Msa0111510 | Msa1187940 | 0.831145 | 1.970801e-55 | -8.615850e-47 |
| Msa0111510 | Msa1187950 | 0.827089 | 1.896195e-54 | -8.615850e-47 |
| Msa0111510 | Msa1192640 | 0.845740 | 3.363892e-59 | -8.615850e-47 |
| Msa0111510 | Msa1246880 | 0.804882 | 1.744964e-49 | -8.615850e-47 |
| Msa0111510 | Msa1269670 | 0.857922 | 1.173294e-62 | -8.615850e-47 |
| Msa0111510 | Msa1270230 | 0.842512 | 2.471965e-58 | -8.615850e-47 |
| Msa0111510 | Msa1270240 | 0.834004 | 3.851058e-56 | -8.615850e-47 |
| Msa0111510 | Msa1270270 | 0.824579 | 7.477067e-54 | -8.615850e-47 |
| Msa0111510 | Msa1273230 | 0.818198 | 2.221998e-52 | -8.615850e-47 |
| Msa0111510 | Msa1283330 | 0.835018 | 2.141719e-56 | -8.615850e-47 |
| Msa0111510 | Msa1285930 | 0.864402 | 1.247863e-64 | -8.615850e-47 |
| Msa0111510 | Msa1287800 | 0.845199 | 4.712068e-59 | -8.615850e-47 |
| Msa0111510 | Msa1287810 | 0.848770 | 4.960319e-60 | -8.615850e-47 |
| Msa0111510 | Msa1287830 | 0.800961 | 1.127076e-48 | -8.615850e-47 |
| Msa0111510 | Msa1289430 | 0.811044 | 8.522337e-51 | -8.615850e-47 |
| Msa0111510 | Msa1297210 | 0.833485 | 5.191752e-56 | -8.615850e-47 |
| Msa0111510 | Msa1307890 | 0.822316 | 2.528076e-53 | -8.615850e-47 |
| Msa0111510 | Msa1320300 | 0.802926 | 4.449082e-49 | -8.615850e-47 |
| Msa0111510 | Msa1340590 | 0.800930 | 1.143862e-48 | -8.615850e-47 |
| Msa0111510 | Msa1342200 | 0.803535 | 3.328735e-49 | -8.615850e-47 |
| Msa0111510 | Msa1386330 | 0.806316 | 8.727687e-50 | -8.615850e-47 |
| Msa0111510 | Msa1397860 | 0.809415 | 1.914021e-50 | -8.615850e-47 |
| Msa0111510 | Msa1404000 | 0.843836 | 1.096392e-58 | -8.615850e-47 |
| Msa0111510 | Msa1415310 | 0.809757 | 1.615778e-50 | -8.615850e-47 |
| Msa0111510 | Msa1422180 | 0.865131 | 7.374202e-65 | -8.615850e-47 |
| Msa0111510 | Msa1433120 | 0.831554 | 1.562847e-55 | -8.615850e-47 |
| Msa0111510 | Msa1451570 | 0.816675 | 4.893254e-52 | -8.615850e-47 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0111510 | MtrunA17_Chr1g0169741 | 88.172 | 93 | 9 | 1 | 1 | 91 | 110 | 202 | 9.09e-55 | 168 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0111510 | AT4G13720.2 | 75.000 | 92 | 21 | 1 | 1 | 90 | 122 | 213 | 1.06e-44 | 143 |
| Msa0111510 | AT4G13720.1 | 75.000 | 92 | 21 | 1 | 1 | 90 | 109 | 200 | 1.59e-44 | 142 |
Find 10 sgRNAs with CRISPR-Local
Find 37 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| GCAAGAGGACCCAATGATTT+TGG | 0.178011 | 1_3:+25345278 | Msa0111510:CDS |
| AAATCATTGGGTCCTCTTGC+AGG | 0.318605 | 1_3:-25345275 | None:intergenic |
| GGGATCCCATCCAAAATCAT+TGG | 0.403416 | 1_3:-25345288 | None:intergenic |
| ATCTTTAGTTCATAGCCATC+AGG | 0.438044 | 1_3:-25345320 | None:intergenic |
| AGGTCTCAACAATCTGTTGA+TGG | 0.476377 | 1_3:+25344844 | None:intergenic |
| GGATCCCATCCAAAATCATT+GGG | 0.509802 | 1_3:-25345287 | None:intergenic |
| ACGCATCTTTCAGATTTGAA+AGG | 0.571486 | 1_3:-25345490 | None:intergenic |
| GGGAAGATTGTTCCTGCAAG+AGG | 0.597623 | 1_3:+25345263 | Msa0111510:CDS |
| ACTGTCTGAACCAATTGCAA+AGG | 0.625537 | 1_3:-25344906 | None:intergenic |
| CAAGTGCAAGAGATTTGCAG+CGG | 0.688996 | 1_3:-25345437 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !!! | TATGCATACATAATTGTTTT+TGG | - | chr1_3:25344990-25345009 | None:intergenic | 20.0% |
| !! | ATTTACATGTTAATATTGTG+AGG | + | chr1_3:25345021-25345040 | Msa0111510:intron | 20.0% |
| !!! | TCAATGAGTAAATTTTATGA+CGG | + | chr1_3:25345049-25345068 | Msa0111510:intron | 20.0% |
| !! | TAAAAGTCAGGTTAAATATA+AGG | - | chr1_3:25345203-25345222 | None:intergenic | 20.0% |
| !!! | AATTTTGTTCTTTTCTTCTT+TGG | - | chr1_3:25345412-25345431 | None:intergenic | 20.0% |
| ! | AACAGAACTCAGATTAAAAA+CGG | - | chr1_3:25344965-25344984 | None:intergenic | 25.0% |
| !! | AGAATAACACGTTTTTACAA+GGG | - | chr1_3:25345098-25345117 | None:intergenic | 25.0% |
| !! | AAGAATAACACGTTTTTACA+AGG | - | chr1_3:25345099-25345118 | None:intergenic | 25.0% |
| !! | TAACTCATTTTATGCTTGTA+TGG | + | chr1_3:25345237-25345256 | Msa0111510:intron | 25.0% |
| ! | TGTGTATTTTCCTTTGCAAT+TGG | + | chr1_3:25344896-25344915 | Msa0111510:CDS | 30.0% |
| ! | GTTTTTCCTGAAAATGTGAT+AGG | - | chr1_3:25344935-25344954 | None:intergenic | 30.0% |
| TGCGTTAAAGATGAAATAGT+TGG | + | chr1_3:25345136-25345155 | Msa0111510:intron | 30.0% | |
| ! | TCATTTTATGCTTGTATGGT+AGG | + | chr1_3:25345241-25345260 | Msa0111510:intron | 30.0% |
| ! | CATTTTATGCTTGTATGGTA+GGG | + | chr1_3:25345242-25345261 | Msa0111510:intron | 30.0% |
| ! | ATTTTATGCTTGTATGGTAG+GGG | + | chr1_3:25345243-25345262 | Msa0111510:intron | 30.0% |
| TTAGCTCATGCAAATAACTA+TGG | - | chr1_3:25345350-25345369 | None:intergenic | 30.0% | |
| ACAATTGTAGTTATGCATAG+AGG | + | chr1_3:25345385-25345404 | Msa0111510:intron | 30.0% | |
| ! | AGTGAACCTATCACATTTTC+AGG | + | chr1_3:25344926-25344945 | Msa0111510:CDS | 35.0% |
| !! | CACATTTTCAGGAAAAACAC+TGG | + | chr1_3:25344937-25344956 | Msa0111510:CDS | 35.0% |
| TCATCTTTAACGCACTAGTT+TGG | - | chr1_3:25345130-25345149 | None:intergenic | 35.0% | |
| CATCACTCATCATAAAAGTC+AGG | - | chr1_3:25345215-25345234 | None:intergenic | 35.0% | |
| !! | TAGCCATCAGGTTGAAAAAT+GGG | - | chr1_3:25345311-25345330 | None:intergenic | 35.0% |
| !! | ATAGCCATCAGGTTGAAAAA+TGG | - | chr1_3:25345312-25345331 | None:intergenic | 35.0% |
| ! | ATCTTTAGTTCATAGCCATC+AGG | - | chr1_3:25345323-25345342 | None:intergenic | 35.0% |
| ! | AAATCACATTTTGCTGAAGC+TGG | + | chr1_3:25345462-25345481 | Msa0111510:CDS | 35.0% |
| ACTGTCTGAACCAATTGCAA+AGG | - | chr1_3:25344909-25344928 | None:intergenic | 40.0% | |
| ! | TTTAACGCACTAGTTTGGTC+AGG | - | chr1_3:25345125-25345144 | None:intergenic | 40.0% |
| TGGCACGTCTGTAAAACAAT+AGG | + | chr1_3:25345156-25345175 | Msa0111510:intron | 40.0% | |
| ! | AGGACCCAATGATTTTGGAT+GGG | + | chr1_3:25345283-25345302 | Msa0111510:CDS | 40.0% |
| GGATCCCATCCAAAATCATT+GGG | - | chr1_3:25345290-25345309 | None:intergenic | 40.0% | |
| !! | GATCCCATTTTTCAACCTGA+TGG | + | chr1_3:25345305-25345324 | Msa0111510:CDS | 40.0% |
| AAATCATTGGGTCCTCTTGC+AGG | - | chr1_3:25345278-25345297 | None:intergenic | 45.0% | |
| ! | GCAAGAGGACCCAATGATTT+TGG | + | chr1_3:25345278-25345297 | Msa0111510:CDS | 45.0% |
| ! | GAGGACCCAATGATTTTGGA+TGG | + | chr1_3:25345282-25345301 | Msa0111510:CDS | 45.0% |
| GGGATCCCATCCAAAATCAT+TGG | - | chr1_3:25345291-25345310 | None:intergenic | 45.0% | |
| CAAGTGCAAGAGATTTGCAG+CGG | - | chr1_3:25345440-25345459 | None:intergenic | 45.0% | |
| GGGAAGATTGTTCCTGCAAG+AGG | + | chr1_3:25345263-25345282 | Msa0111510:CDS | 50.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| chr1_3 | gene | 25344846 | 25345500 | 25344846 | ID=Msa0111510;Name=Msa0111510 |
| chr1_3 | mRNA | 25344846 | 25345500 | 25344846 | ID=Msa0111510-mRNA-1;Parent=Msa0111510;Name=Msa0111510-mRNA-1;_AED=0.16;_eAED=0.21;_QI=17|0|0|1|0.5|0.33|3|0|91 |
| chr1_3 | exon | 25344846 | 25344958 | 25344846 | ID=Msa0111510-mRNA-1:exon:8683;Parent=Msa0111510-mRNA-1 |
| chr1_3 | exon | 25345263 | 25345343 | 25345263 | ID=Msa0111510-mRNA-1:exon:8684;Parent=Msa0111510-mRNA-1 |
| chr1_3 | exon | 25345405 | 25345500 | 25345405 | ID=Msa0111510-mRNA-1:exon:8685;Parent=Msa0111510-mRNA-1 |
| chr1_3 | five_prime_UTR | 25344846 | 25344862 | 25344846 | ID=Msa0111510-mRNA-1:five_prime_utr;Parent=Msa0111510-mRNA-1 |
| chr1_3 | CDS | 25344863 | 25344958 | 25344863 | ID=Msa0111510-mRNA-1:cds;Parent=Msa0111510-mRNA-1 |
| chr1_3 | CDS | 25345263 | 25345343 | 25345263 | ID=Msa0111510-mRNA-1:cds;Parent=Msa0111510-mRNA-1 |
| chr1_3 | CDS | 25345405 | 25345500 | 25345405 | ID=Msa0111510-mRNA-1:cds;Parent=Msa0111510-mRNA-1 |
| Gene Sequence |
| Protein sequence |
