Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049029.01.T01 | XP_013464778.1 | 92.147 | 191 | 13 | 1 | 11 | 201 | 51 | 239 | 2.06E-113 | 333 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049029.01.T01 | A0A072VBL2 | 92.147 | 191 | 13 | 1 | 11 | 201 | 51 | 239 | 9.85e-114 | 333 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080047910.01 | MsG0080049029.01 | 0.822199 | 2.690906e-53 | 2.236949e-50 |
MsG0080047945.01 | MsG0080049029.01 | 0.839338 | 1.681958e-57 | 2.315722e-54 |
MsG0080047955.01 | MsG0080049029.01 | 0.829491 | 4.996760e-55 | 5.121906e-52 |
MsG0080047956.01 | MsG0080049029.01 | 0.819052 | 1.421905e-52 | 1.082576e-49 |
MsG0080048068.01 | MsG0080049029.01 | 0.804970 | 1.672974e-49 | 8.745313e-47 |
MsG0080048528.01 | MsG0080049029.01 | 0.827240 | 1.745165e-54 | 1.675164e-51 |
MsG0080048727.01 | MsG0080049029.01 | 0.835355 | 1.761351e-56 | 2.148670e-53 |
MsG0080048773.01 | MsG0080049029.01 | 0.850332 | 1.818527e-60 | 3.549726e-57 |
MsG0080048777.01 | MsG0080049029.01 | 0.818557 | 1.841981e-52 | 1.383316e-49 |
MsG0080048780.01 | MsG0080049029.01 | 0.863331 | 2.686847e-64 | 8.115881e-61 |
MsG0080048801.01 | MsG0080049029.01 | 0.849345 | 3.432024e-60 | 6.487392e-57 |
MsG0080048802.01 | MsG0080049029.01 | 0.828389 | 9.238768e-55 | 9.170076e-52 |
MsG0080048820.01 | MsG0080049029.01 | 0.821590 | 3.723363e-53 | 3.041956e-50 |
MsG0080048845.01 | MsG0080049029.01 | 0.859447 | 4.110879e-63 | 1.086075e-59 |
MsG0080048876.01 | MsG0080049029.01 | 0.864977 | 8.242644e-65 | 2.638070e-61 |
MsG0080048929.01 | MsG0080049029.01 | 0.820791 | 5.691909e-53 | 4.547995e-50 |
MsG0080049004.01 | MsG0080049029.01 | 0.853556 | 2.209535e-61 | 4.793124e-58 |
MsG0080049029.01 | MsG0080049039.01 | 0.878305 | 3.125855e-69 | 1.623942e-65 |
MsG0080049029.01 | MsG0080049040.01 | 0.905210 | 5.460910e-80 | 8.740381e-76 |
MsG0080049029.01 | MsG0080049053.01 | 0.820975 | 5.163071e-53 | 4.147095e-50 |
MsG0080049029.01 | MsG0080049054.01 | 0.851443 | 8.848165e-61 | 1.791237e-57 |
MsG0080049029.01 | MsG0080049063.01 | 0.848468 | 6.014766e-60 | 1.105020e-56 |
MsG0080049029.01 | MsG0080049068.01 | 0.895421 | 9.738364e-76 | 1.009901e-71 |
MsG0080049029.01 | MsG0080049070.01 | 0.800681 | 1.285868e-48 | 6.024278e-46 |
MsG0080049029.01 | MsG0080049072.01 | 0.838997 | 2.061556e-57 | 2.808678e-54 |
MsG0080049029.01 | MsG0080049078.01 | 0.807267 | 5.493469e-50 | 3.046310e-47 |
MsG0080049029.01 | MsG0080049129.01 | 0.816376 | 5.709374e-52 | 4.038738e-49 |
MsG0080049029.01 | MsG0080049130.01 | 0.842283 | 2.842974e-58 | 4.289640e-55 |
MsG0080049029.01 | MsG0180000113.01 | 0.834078 | 3.690353e-56 | 4.332074e-53 |
MsG0080049029.01 | MsG0180000246.01 | 0.838786 | 2.338637e-57 | 3.165703e-54 |
MsG0080049029.01 | MsG0180000352.01 | 0.827404 | 1.594491e-54 | 1.537943e-51 |
MsG0080049029.01 | MsG0180000354.01 | 0.804038 | 2.616894e-49 | 1.335510e-46 |
MsG0080049029.01 | MsG0180000549.01 | 0.819729 | 9.966050e-53 | 7.731902e-50 |
MsG0080049029.01 | MsG0180000638.01 | 0.850596 | 1.533301e-60 | 3.018950e-57 |
MsG0080049029.01 | MsG0180000670.01 | 0.859482 | 4.012305e-63 | 1.061278e-59 |
MsG0080049029.01 | MsG0180000671.01 | 0.868804 | 4.972769e-66 | 1.822970e-62 |
MsG0080049029.01 | MsG0180000677.01 | 0.863359 | 2.633237e-64 | 7.961553e-61 |
MsG0080049029.01 | MsG0180000678.01 | 0.815241 | 1.022801e-51 | 7.013180e-49 |
MsG0080049029.01 | MsG0180000708.01 | 0.814249 | 1.696571e-51 | 1.132551e-48 |
MsG0080049029.01 | MsG0180000792.01 | 0.816666 | 4.915808e-52 | 3.505117e-49 |
MsG0080049029.01 | MsG0180000793.01 | 0.816744 | 4.721212e-52 | 3.373504e-49 |
MsG0080049029.01 | MsG0180000843.01 | 0.849407 | 3.298791e-60 | 6.247187e-57 |
MsG0080049029.01 | MsG0180000878.01 | 0.824249 | 8.939040e-54 | 7.874798e-51 |
MsG0080049029.01 | MsG0180000989.01 | 0.847478 | 1.127233e-59 | 2.006195e-56 |
MsG0080049029.01 | MsG0180001085.01 | 0.877140 | 7.975747e-69 | 3.967898e-65 |
MsG0080049029.01 | MsG0180001175.01 | 0.907395 | 5.306294e-81 | 9.398830e-77 |
MsG0080049029.01 | MsG0180001270.01 | 0.895661 | 7.755650e-76 | 8.122666e-72 |
MsG0080049029.01 | MsG0180001371.01 | 0.859649 | 3.575061e-63 | 9.510528e-60 |
MsG0080049029.01 | MsG0180001609.01 | 0.820401 | 6.993582e-53 | 5.528271e-50 |
MsG0080049029.01 | MsG0180001664.01 | 0.804169 | 2.458151e-49 | 1.258674e-46 |
MsG0080049029.01 | MsG0180001772.01 | 0.854687 | 1.042479e-61 | 2.347455e-58 |
MsG0080049029.01 | MsG0180001864.01 | 0.812712 | 3.692875e-51 | 2.365008e-48 |
MsG0080049029.01 | MsG0180001929.01 | 0.882320 | 1.150041e-70 | 6.974458e-67 |
MsG0080049029.01 | MsG0180002671.01 | 0.838850 | 2.250740e-57 | 3.052647e-54 |
MsG0080049029.01 | MsG0180002700.01 | 0.859792 | 3.237509e-63 | 8.655402e-60 |
MsG0080049029.01 | MsG0180003196.01 | 0.821161 | 4.677853e-53 | 3.776526e-50 |
MsG0080049029.01 | MsG0180003316.01 | 0.812940 | 3.291414e-51 | 2.120522e-48 |
MsG0080049029.01 | MsG0180003325.01 | 0.828670 | 7.901223e-55 | 7.906556e-52 |
MsG0080049029.01 | MsG0180003353.01 | 0.820202 | 7.767181e-53 | 6.105929e-50 |
MsG0080049029.01 | MsG0180003526.01 | 0.826101 | 3.263295e-54 | 3.031121e-51 |
MsG0080049029.01 | MsG0180003531.01 | 0.905857 | 2.754616e-80 | 4.543756e-76 |
MsG0080049029.01 | MsG0180003633.01 | 0.802339 | 5.878562e-49 | 2.872471e-46 |
MsG0080049029.01 | MsG0180003933.01 | 0.818267 | 2.142525e-52 | 1.596147e-49 |
MsG0080049029.01 | MsG0180003942.01 | -0.813898 | 2.027582e-51 | 1.340726e-48 |
MsG0080049029.01 | MsG0180003986.01 | 0.822958 | 1.792504e-53 | 1.522678e-50 |
MsG0080049029.01 | MsG0180004103.01 | 0.844906 | 5.654163e-59 | 9.263486e-56 |
MsG0080049029.01 | MsG0180004115.01 | 0.801817 | 7.527842e-49 | 3.629726e-46 |
MsG0080049029.01 | MsG0180004163.01 | 0.821721 | 3.472565e-53 | 2.847723e-50 |
MsG0080049029.01 | MsG0180004192.01 | 0.836673 | 8.153865e-57 | 1.034813e-53 |
MsG0080049029.01 | MsG0180004276.01 | 0.821952 | 3.070480e-53 | 2.534552e-50 |
MsG0080049029.01 | MsG0180004448.01 | 0.891851 | 2.721497e-74 | 2.426679e-70 |
MsG0080049029.01 | MsG0180004542.01 | 0.806570 | 7.715807e-50 | 4.202036e-47 |
MsG0080049029.01 | MsG0180004554.01 | 0.866589 | 2.552703e-65 | 8.649870e-62 |
MsG0080049029.01 | MsG0180004672.01 | 0.809922 | 1.489118e-50 | 8.855898e-48 |
MsG0080049029.01 | MsG0180004733.01 | 0.901567 | 2.351907e-78 | 3.196121e-74 |
MsG0080049029.01 | MsG0180004735.01 | 0.879409 | 1.275826e-69 | 6.910265e-66 |
MsG0080049029.01 | MsG0180004739.01 | 0.888187 | 7.375421e-73 | 5.655009e-69 |
MsG0080049029.01 | MsG0180004934.01 | 0.832076 | 1.162158e-55 | 1.285142e-52 |
MsG0080049029.01 | MsG0180005039.01 | 0.820818 | 5.609502e-53 | 4.485635e-50 |
MsG0080049029.01 | MsG0180005064.01 | 0.830655 | 2.598283e-55 | 2.754992e-52 |
MsG0080049029.01 | MsG0180005087.01 | 0.812379 | 4.366730e-51 | 2.772095e-48 |
MsG0080049029.01 | MsG0180005130.01 | -0.820385 | 7.054327e-53 | 5.573858e-50 |
MsG0080049029.01 | MsG0180005135.01 | 0.835847 | 1.322182e-56 | 1.636762e-53 |
MsG0080049029.01 | MsG0180005137.01 | 0.829663 | 4.537551e-55 | 4.674880e-52 |
MsG0080049029.01 | MsG0180005143.01 | -0.817483 | 3.222112e-52 | 2.349474e-49 |
MsG0080049029.01 | MsG0180005184.01 | 0.858569 | 7.526785e-63 | 1.929354e-59 |
MsG0080049029.01 | MsG0180005269.01 | 0.835625 | 1.504673e-56 | 1.850237e-53 |
MsG0080049029.01 | MsG0180005276.01 | 0.849878 | 2.436989e-60 | 4.686813e-57 |
MsG0080049029.01 | MsG0180005349.01 | 0.897956 | 8.494807e-77 | 9.829793e-73 |
MsG0080049029.01 | MsG0180005391.01 | 0.817704 | 2.872800e-52 | 2.107421e-49 |
MsG0080049029.01 | MsG0180005395.01 | -0.827083 | 1.902863e-54 | 1.818170e-51 |
MsG0080049029.01 | MsG0180005418.01 | 0.846255 | 2.436863e-59 | 4.169322e-56 |
MsG0080049029.01 | MsG0180005463.01 | -0.816306 | 5.917939e-52 | 4.178566e-49 |
MsG0080049029.01 | MsG0180005492.01 | 0.897282 | 1.636128e-76 | 1.835242e-72 |
MsG0080049029.01 | MsG0180005612.01 | 0.820987 | 5.128776e-53 | 4.121024e-50 |
MsG0080049029.01 | MsG0180005635.01 | -0.807230 | 5.593498e-50 | 3.098759e-47 |
MsG0080049029.01 | MsG0180005750.01 | 0.838990 | 2.070621e-57 | 2.820453e-54 |
MsG0080049029.01 | MsG0180005755.01 | 0.879393 | 1.293029e-69 | 6.998422e-66 |
MsG0080049029.01 | MsG0180005803.01 | 0.806342 | 8.617776e-50 | 4.665963e-47 |
MsG0080049029.01 | MsG0180005807.01 | 0.813285 | 2.765243e-51 | 1.798274e-48 |
MsG0080049029.01 | MsG0180005822.01 | 0.836341 | 9.906624e-57 | 1.244923e-53 |
MsG0080049029.01 | MsG0180005879.01 | 0.823703 | 1.200988e-53 | 1.042040e-50 |
MsG0080049029.01 | MsG0180005961.01 | 0.909278 | 6.795685e-82 | 1.312246e-77 |
MsG0080049029.01 | MsG0180005964.01 | 0.830626 | 2.641908e-55 | 2.798736e-52 |
MsG0080049029.01 | MsG0180006030.01 | 0.801453 | 8.938581e-49 | 4.270409e-46 |
MsG0080049029.01 | MsG0180006042.01 | 0.870723 | 1.176503e-66 | 4.623686e-63 |
MsG0080049029.01 | MsG0180006136.01 | 0.867005 | 1.881523e-65 | 6.468750e-62 |
MsG0080049029.01 | MsG0180006159.01 | 0.801507 | 8.714329e-49 | 4.168985e-46 |
MsG0080049029.01 | MsG0180006176.01 | 0.822504 | 2.286384e-53 | 1.917368e-50 |
MsG0080049029.01 | MsG0180006200.01 | 0.868626 | 5.678294e-66 | 2.068121e-62 |
MsG0080049029.01 | MsG0180006217.01 | 0.829221 | 5.811496e-55 | 5.910642e-52 |
MsG0080049029.01 | MsG0180006218.01 | 0.856490 | 3.105072e-62 | 7.425108e-59 |
MsG0080049029.01 | MsG0180006223.01 | 0.839950 | 1.166156e-57 | 1.636238e-54 |
MsG0080049029.01 | MsG0280006571.01 | 0.848863 | 4.674020e-60 | 8.697072e-57 |
MsG0080049029.01 | MsG0280006607.01 | 0.872602 | 2.804021e-67 | 1.180472e-63 |
MsG0080049029.01 | MsG0280006718.01 | 0.869956 | 2.098150e-66 | 8.020447e-63 |
MsG0080049029.01 | MsG0280006805.01 | 0.889354 | 2.611786e-73 | 2.100140e-69 |
MsG0080049029.01 | MsG0280006825.01 | 0.842847 | 2.014041e-58 | 3.092862e-55 |
MsG0080049029.01 | MsG0280006848.01 | 0.803113 | 4.070790e-49 | 2.028551e-46 |
MsG0080049029.01 | MsG0280006996.01 | 0.833914 | 4.055673e-56 | 4.738362e-53 |
MsG0080049029.01 | MsG0280007075.01 | 0.822604 | 2.167312e-53 | 1.822840e-50 |
MsG0080049029.01 | MsG0280007102.01 | 0.811536 | 6.666338e-51 | 4.137280e-48 |
MsG0080049029.01 | MsG0280007502.01 | 0.885695 | 6.514715e-72 | 4.516180e-68 |
MsG0080049029.01 | MsG0280007628.01 | 0.803757 | 2.993326e-49 | 1.516619e-46 |
MsG0080049029.01 | MsG0280007771.01 | 0.800530 | 1.380422e-48 | 6.442555e-46 |
MsG0080049029.01 | MsG0280007814.01 | 0.829861 | 4.060849e-55 | 4.208554e-52 |
MsG0080049029.01 | MsG0280007831.01 | 0.891943 | 2.502465e-74 | 2.238803e-70 |
MsG0080049029.01 | MsG0280007852.01 | 0.856262 | 3.622222e-62 | 8.594675e-59 |
MsG0080049029.01 | MsG0280007853.01 | 0.833149 | 6.296200e-56 | 7.188734e-53 |
MsG0080049029.01 | MsG0280008223.01 | 0.886696 | 2.731866e-72 | 1.972071e-68 |
MsG0080049029.01 | MsG0280008227.01 | 0.833911 | 4.063055e-56 | 4.746644e-53 |
MsG0080049029.01 | MsG0280008388.01 | 0.865041 | 7.872808e-65 | 2.526042e-61 |
MsG0080049029.01 | MsG0280008394.01 | 0.840520 | 8.278642e-58 | 1.182243e-54 |
MsG0080049029.01 | MsG0280008419.01 | 0.813536 | 2.435723e-51 | 1.594915e-48 |
MsG0080049029.01 | MsG0280008451.01 | 0.865315 | 6.453581e-65 | 2.090256e-61 |
MsG0080049029.01 | MsG0280008591.01 | 0.863034 | 3.320608e-64 | 9.926175e-61 |
MsG0080049029.01 | MsG0280008709.01 | 0.817715 | 2.855383e-52 | 2.095318e-49 |
MsG0080049029.01 | MsG0280008922.01 | 0.853948 | 1.704859e-61 | 3.746817e-58 |
MsG0080049029.01 | MsG0280008928.01 | 0.815242 | 1.021840e-51 | 7.006893e-49 |
MsG0080049029.01 | MsG0280008929.01 | 0.821301 | 4.341887e-53 | 3.518937e-50 |
MsG0080049029.01 | MsG0280008935.01 | 0.817351 | 3.449812e-52 | 2.506283e-49 |
MsG0080049029.01 | MsG0280008942.01 | 0.840122 | 1.051484e-57 | 1.483273e-54 |
MsG0080049029.01 | MsG0280009430.01 | 0.835641 | 1.490735e-56 | 1.834000e-53 |
MsG0080049029.01 | MsG0280009431.01 | 0.841386 | 4.904029e-58 | 7.194341e-55 |
MsG0080049029.01 | MsG0280009685.01 | 0.825429 | 4.710937e-54 | 4.292573e-51 |
MsG0080049029.01 | MsG0280009751.01 | 0.817947 | 2.531761e-52 | 1.869596e-49 |
MsG0080049029.01 | MsG0280009756.01 | 0.854832 | 9.466271e-62 | 2.141931e-58 |
MsG0080049029.01 | MsG0280009853.01 | 0.805011 | 1.640054e-49 | 8.582080e-47 |
MsG0080049029.01 | MsG0280010008.01 | -0.803808 | 2.921196e-49 | 1.481978e-46 |
MsG0080049029.01 | MsG0280010016.01 | 0.821685 | 3.539583e-53 | 2.899824e-50 |
MsG0080049029.01 | MsG0280010271.01 | 0.854679 | 1.048559e-61 | 2.360505e-58 |
MsG0080049029.01 | MsG0280010353.01 | 0.881176 | 2.983078e-70 | 1.729914e-66 |
MsG0080049029.01 | MsG0280010376.01 | 0.902623 | 8.025139e-79 | 1.146519e-74 |
MsG0080049029.01 | MsG0280010496.01 | 0.829748 | 4.327911e-55 | 4.470351e-52 |
MsG0080049029.01 | MsG0280010503.01 | 0.840806 | 6.966991e-58 | 1.003826e-54 |
MsG0080049029.01 | MsG0280010564.01 | 0.843488 | 1.358652e-58 | 2.129043e-55 |
MsG0080049029.01 | MsG0280010661.01 | 0.869554 | 2.838548e-66 | 1.069739e-62 |
MsG0080049029.01 | MsG0280010728.01 | 0.811864 | 5.654805e-51 | 3.540001e-48 |
MsG0080049029.01 | MsG0280010926.01 | 0.874841 | 4.927879e-68 | 2.252416e-64 |
MsG0080049029.01 | MsG0280010975.01 | 0.811308 | 7.471373e-51 | 4.608697e-48 |
MsG0080049029.01 | MsG0280011162.01 | 0.834125 | 3.590611e-56 | 4.221037e-53 |
MsG0080049029.01 | MsG0280011180.01 | 0.850858 | 1.293356e-60 | 2.568657e-57 |
MsG0080049029.01 | MsG0280011218.01 | 0.840137 | 1.042372e-57 | 1.471099e-54 |
MsG0080049029.01 | MsG0280011255.01 | 0.801481 | 8.821550e-49 | 4.217514e-46 |
MsG0080049029.01 | MsG0280011411.01 | 0.862960 | 3.499271e-64 | 1.043492e-60 |
MsG0080049029.01 | MsG0380011495.01 | 0.805643 | 1.208775e-49 | 6.428980e-47 |
MsG0080049029.01 | MsG0380011632.01 | 0.847998 | 8.108046e-60 | 1.466937e-56 |
MsG0080049029.01 | MsG0380011652.01 | 0.802183 | 6.330778e-49 | 3.080950e-46 |
MsG0080049029.01 | MsG0380011739.01 | 0.837846 | 4.084074e-57 | 5.372626e-54 |
MsG0080049029.01 | MsG0380012625.01 | 0.816850 | 4.470504e-52 | 3.203704e-49 |
MsG0080049029.01 | MsG0380012780.01 | 0.822714 | 2.042997e-53 | 1.723529e-50 |
MsG0080049029.01 | MsG0380012800.01 | 0.817369 | 3.418344e-52 | 2.484683e-49 |
MsG0080049029.01 | MsG0380012801.01 | 0.854178 | 1.462801e-61 | 3.239659e-58 |
MsG0080049029.01 | MsG0380012804.01 | 0.819957 | 8.842021e-53 | 6.903610e-50 |
MsG0080049029.01 | MsG0380012868.01 | 0.869633 | 2.675179e-66 | 1.010968e-62 |
MsG0080049029.01 | MsG0380012876.01 | 0.847113 | 1.420354e-59 | 2.498662e-56 |
MsG0080049029.01 | MsG0380013111.01 | 0.817565 | 3.087979e-52 | 2.256598e-49 |
MsG0080049029.01 | MsG0380013472.01 | 0.863567 | 2.270338e-64 | 6.912970e-61 |
MsG0080049029.01 | MsG0380013970.01 | 0.808275 | 3.355164e-50 | 1.910313e-47 |
MsG0080049029.01 | MsG0380014007.01 | 0.814501 | 1.491922e-51 | 1.002839e-48 |
MsG0080049029.01 | MsG0380014053.01 | 0.822189 | 2.705494e-53 | 2.248322e-50 |
MsG0080049029.01 | MsG0380014470.01 | 0.856390 | 3.323917e-62 | 7.921317e-59 |
MsG0080049029.01 | MsG0380014584.01 | 0.808952 | 2.404563e-50 | 1.393521e-47 |
MsG0080049029.01 | MsG0380014588.01 | 0.886582 | 3.017381e-72 | 2.167957e-68 |
MsG0080049029.01 | MsG0380014729.01 | 0.801433 | 9.025118e-49 | 4.309532e-46 |
MsG0080049029.01 | MsG0380014809.01 | 0.827948 | 1.179889e-54 | 1.156144e-51 |
MsG0080049029.01 | MsG0380014909.01 | 0.834811 | 2.415467e-56 | 2.898458e-53 |
MsG0080049029.01 | MsG0380014940.01 | 0.864777 | 9.524874e-65 | 3.026860e-61 |
MsG0080049029.01 | MsG0380015356.01 | 0.835614 | 1.514592e-56 | 1.861851e-53 |
MsG0080049029.01 | MsG0380015399.01 | 0.827190 | 1.793757e-54 | 1.719316e-51 |
MsG0080049029.01 | MsG0380015438.01 | 0.807411 | 5.120720e-50 | 2.850252e-47 |
MsG0080049029.01 | MsG0380015496.01 | 0.839231 | 1.793291e-57 | 2.460822e-54 |
MsG0080049029.01 | MsG0380015547.01 | 0.850091 | 2.124632e-60 | 4.114947e-57 |
MsG0080049029.01 | MsG0380015602.01 | 0.824988 | 5.990132e-54 | 5.390569e-51 |
MsG0080049029.01 | MsG0380015603.01 | 0.908211 | 2.189084e-81 | 4.021183e-77 |
MsG0080049029.01 | MsG0380015668.01 | 0.816928 | 4.294655e-52 | 3.084261e-49 |
MsG0080049029.01 | MsG0380015742.01 | 0.843820 | 1.107283e-58 | 1.753356e-55 |
MsG0080049029.01 | MsG0380015743.01 | 0.841730 | 3.980024e-58 | 5.901059e-55 |
MsG0080049029.01 | MsG0380015896.01 | 0.814639 | 1.390552e-51 | 9.381465e-49 |
MsG0080049029.01 | MsG0380015900.01 | 0.827808 | 1.275246e-54 | 1.244339e-51 |
MsG0080049029.01 | MsG0380015902.01 | 0.805613 | 1.226642e-49 | 6.518847e-47 |
MsG0080049029.01 | MsG0380016057.01 | 0.869937 | 2.129322e-66 | 8.133751e-63 |
MsG0080049029.01 | MsG0380016058.01 | 0.860617 | 1.822442e-63 | 5.012446e-60 |
MsG0080049029.01 | MsG0380016137.01 | 0.813235 | 2.836935e-51 | 1.842272e-48 |
MsG0080049029.01 | MsG0380016172.01 | 0.818497 | 1.900653e-52 | 1.425051e-49 |
MsG0080049029.01 | MsG0380016192.01 | 0.836535 | 8.837958e-57 | 1.116985e-53 |
MsG0080049029.01 | MsG0380016194.01 | 0.880280 | 6.249981e-70 | 3.499435e-66 |
MsG0080049029.01 | MsG0380016284.01 | 0.856502 | 3.081315e-62 | 7.371098e-59 |
MsG0080049029.01 | MsG0380016452.01 | 0.836968 | 6.855780e-57 | 8.778874e-54 |
MsG0080049029.01 | MsG0380016540.01 | 0.803385 | 3.574556e-49 | 1.793834e-46 |
MsG0080049029.01 | MsG0380016543.01 | 0.820562 | 6.424547e-53 | 5.100780e-50 |
MsG0080049029.01 | MsG0380016544.01 | 0.846750 | 1.785421e-59 | 3.104388e-56 |
MsG0080049029.01 | MsG0380016574.01 | -0.801555 | 8.518648e-49 | 4.080206e-46 |
MsG0080049029.01 | MsG0380016659.01 | 0.826024 | 3.403107e-54 | 3.154147e-51 |
MsG0080049029.01 | MsG0380016699.01 | 0.828729 | 7.645043e-55 | 7.662801e-52 |
MsG0080049029.01 | MsG0380016730.01 | 0.833734 | 4.498622e-56 | 5.226634e-53 |
MsG0080049029.01 | MsG0380016762.01 | 0.815442 | 9.225485e-52 | 6.361428e-49 |
MsG0080049029.01 | MsG0380016764.01 | 0.816861 | 4.445311e-52 | 3.186567e-49 |
MsG0080049029.01 | MsG0380016836.01 | 0.870237 | 1.698434e-66 | 6.559498e-63 |
MsG0080049029.01 | MsG0380016957.01 | 0.816124 | 6.500038e-52 | 4.566427e-49 |
MsG0080049029.01 | MsG0380017017.01 | 0.846769 | 1.764217e-59 | 3.069435e-56 |
MsG0080049029.01 | MsG0380017028.01 | 0.842674 | 2.239236e-58 | 3.419995e-55 |
MsG0080049029.01 | MsG0380017087.01 | 0.821020 | 5.041764e-53 | 4.054723e-50 |
MsG0080049029.01 | MsG0380017088.01 | 0.821820 | 3.294585e-53 | 2.709505e-50 |
MsG0080049029.01 | MsG0380017143.01 | 0.891478 | 3.828679e-74 | 3.362366e-70 |
MsG0080049029.01 | MsG0380017162.01 | 0.821848 | 3.246093e-53 | 2.671735e-50 |
MsG0080049029.01 | MsG0380017307.01 | -0.808477 | 3.037911e-50 | 1.738839e-47 |
MsG0080049029.01 | MsG0380017309.01 | 0.805504 | 1.292937e-49 | 6.851760e-47 |
MsG0080049029.01 | MsG0380017338.01 | 0.801963 | 7.026543e-49 | 3.400380e-46 |
MsG0080049029.01 | MsG0380017359.01 | 0.809870 | 1.527934e-50 | 9.074274e-48 |
MsG0080049029.01 | MsG0380017423.01 | 0.820692 | 5.997842e-53 | 4.779037e-50 |
MsG0080049029.01 | MsG0380017427.01 | 0.844146 | 9.058295e-59 | 1.449113e-55 |
MsG0080049029.01 | MsG0380017509.01 | 0.833510 | 5.117755e-56 | 5.906574e-53 |
MsG0080049029.01 | MsG0380017639.01 | -0.812413 | 4.292667e-51 | 2.727690e-48 |
MsG0080049029.01 | MsG0380017651.01 | 0.835643 | 1.488742e-56 | 1.831703e-53 |
MsG0080049029.01 | MsG0380017703.01 | 0.894423 | 2.502075e-75 | 2.485685e-71 |
MsG0080049029.01 | MsG0380017727.01 | 0.817343 | 3.463248e-52 | 2.515569e-49 |
MsG0080049029.01 | MsG0380017728.01 | 0.875381 | 3.223823e-68 | 1.501836e-64 |
MsG0080049029.01 | MsG0380017884.01 | 0.820909 | 5.346582e-53 | 4.286341e-50 |
MsG0080049029.01 | MsG0380017966.01 | 0.811977 | 5.344004e-51 | 3.355653e-48 |
MsG0080049029.01 | MsG0380017976.01 | 0.830062 | 3.627533e-55 | 3.780461e-52 |
MsG0080049029.01 | MsG0380018027.01 | 0.830167 | 3.419730e-55 | 3.575006e-52 |
MsG0080049029.01 | MsG0380018037.01 | 0.835181 | 1.949000e-56 | 2.364953e-53 |
MsG0080049029.01 | MsG0380018061.01 | 0.865712 | 4.841297e-65 | 1.590604e-61 |
MsG0080049029.01 | MsG0380018069.01 | 0.873487 | 1.416042e-67 | 6.157030e-64 |
MsG0080049029.01 | MsG0480018107.01 | 0.822997 | 1.755919e-53 | 1.493241e-50 |
MsG0080049029.01 | MsG0480018592.01 | 0.846567 | 2.002361e-59 | 3.460851e-56 |
MsG0080049029.01 | MsG0480018644.01 | 0.891915 | 2.566717e-74 | 2.294142e-70 |
MsG0080049029.01 | MsG0480018848.01 | 0.821107 | 4.814434e-53 | 3.881057e-50 |
MsG0080049029.01 | MsG0480018905.01 | 0.808883 | 2.488160e-50 | 1.439306e-47 |
MsG0080049029.01 | MsG0480019284.01 | 0.813764 | 2.169913e-51 | 1.429573e-48 |
MsG0080049029.01 | MsG0480019340.01 | 0.816728 | 4.762285e-52 | 3.401248e-49 |
MsG0080049029.01 | MsG0480019501.01 | 0.851573 | 8.125012e-61 | 1.651717e-57 |
MsG0080049029.01 | MsG0480019592.01 | 0.842548 | 2.417470e-58 | 3.678271e-55 |
MsG0080049029.01 | MsG0480019641.01 | 0.866342 | 3.058588e-65 | 1.027389e-61 |
MsG0080049029.01 | MsG0480019751.01 | 0.871465 | 6.697032e-67 | 2.704510e-63 |
MsG0080049029.01 | MsG0480019956.01 | 0.875509 | 2.913354e-68 | 1.363725e-64 |
MsG0080049029.01 | MsG0480019971.01 | 0.868590 | 5.831901e-66 | 2.121265e-62 |
MsG0080049029.01 | MsG0480020151.01 | 0.819708 | 1.007559e-52 | 7.812210e-50 |
MsG0080049029.01 | MsG0480020350.01 | 0.868389 | 6.770057e-66 | 2.444568e-62 |
MsG0080049029.01 | MsG0480020408.01 | 0.852467 | 4.528379e-61 | 9.470842e-58 |
MsG0080049029.01 | MsG0480020473.01 | 0.800069 | 1.713409e-48 | 7.903776e-46 |
MsG0080049029.01 | MsG0480020690.01 | 0.894027 | 3.625941e-75 | 3.542197e-71 |
MsG0080049029.01 | MsG0480020753.01 | 0.882735 | 8.116428e-71 | 5.002149e-67 |
MsG0080049029.01 | MsG0480020758.01 | 0.809545 | 1.794648e-50 | 1.056714e-47 |
MsG0080049029.01 | MsG0480020783.01 | 0.815763 | 7.824526e-52 | 5.443277e-49 |
MsG0080049029.01 | MsG0480020888.01 | 0.824942 | 6.140187e-54 | 5.518542e-51 |
MsG0080049029.01 | MsG0480021059.01 | 0.815916 | 7.233041e-52 | 5.052402e-49 |
MsG0080049029.01 | MsG0480021168.01 | 0.889031 | 3.483497e-73 | 2.764495e-69 |
MsG0080049029.01 | MsG0480021207.01 | 0.811357 | 7.290168e-51 | 4.502743e-48 |
MsG0080049029.01 | MsG0480021213.01 | 0.831075 | 2.050287e-55 | 2.201109e-52 |
MsG0080049029.01 | MsG0480021248.01 | 0.845634 | 3.594374e-59 | 6.027648e-56 |
MsG0080049029.01 | MsG0480021254.01 | 0.833007 | 6.828479e-56 | 7.763385e-53 |
MsG0080049029.01 | MsG0480021294.01 | 0.836806 | 7.542424e-57 | 9.610697e-54 |
MsG0080049029.01 | MsG0480021303.01 | 0.873145 | 1.845095e-67 | 7.922955e-64 |
MsG0080049029.01 | MsG0480021377.01 | 0.829632 | 4.616848e-55 | 4.752140e-52 |
MsG0080049029.01 | MsG0480021406.01 | 0.852606 | 4.133998e-61 | 8.685108e-58 |
MsG0080049029.01 | MsG0480021521.01 | 0.827287 | 1.700018e-54 | 1.634095e-51 |
MsG0080049029.01 | MsG0480021682.01 | 0.868783 | 5.052424e-66 | 1.850734e-62 |
MsG0080049029.01 | MsG0480021709.01 | 0.869345 | 3.319464e-66 | 1.241746e-62 |
MsG0080049029.01 | MsG0480021754.01 | 0.861891 | 7.456774e-64 | 2.142126e-60 |
MsG0080049029.01 | MsG0480021777.01 | 0.863192 | 2.967436e-64 | 8.919396e-61 |
MsG0080049029.01 | MsG0480021783.01 | 0.898825 | 3.630074e-77 | 4.366826e-73 |
MsG0080049029.01 | MsG0480021795.01 | 0.816807 | 4.570756e-52 | 3.271577e-49 |
MsG0080049029.01 | MsG0480021803.01 | 0.877992 | 4.024063e-69 | 2.065841e-65 |
MsG0080049029.01 | MsG0480021817.01 | 0.894360 | 2.653373e-75 | 2.629767e-71 |
MsG0080049029.01 | MsG0480021875.01 | 0.835048 | 2.104610e-56 | 2.543590e-53 |
MsG0080049029.01 | MsG0480022113.01 | 0.826083 | 3.295024e-54 | 3.059021e-51 |
MsG0080049029.01 | MsG0480022130.01 | 0.833779 | 4.383001e-56 | 5.099579e-53 |
MsG0080049029.01 | MsG0480022149.01 | 0.837978 | 3.778708e-57 | 4.991091e-54 |
MsG0080049029.01 | MsG0480022200.01 | 0.821634 | 3.636878e-53 | 2.975095e-50 |
MsG0080049029.01 | MsG0480022239.01 | 0.809045 | 2.296827e-50 | 1.334467e-47 |
MsG0080049029.01 | MsG0480022260.01 | 0.867311 | 1.502314e-65 | 5.221898e-62 |
MsG0080049029.01 | MsG0480022286.01 | 0.812380 | 4.365249e-51 | 2.771217e-48 |
MsG0080049029.01 | MsG0480022417.01 | 0.810050 | 1.397893e-50 | 8.341099e-48 |
MsG0080049029.01 | MsG0480022537.01 | 0.821203 | 4.574911e-53 | 3.697902e-50 |
MsG0080049029.01 | MsG0480022646.01 | 0.887922 | 9.322565e-73 | 7.070052e-69 |
MsG0080049029.01 | MsG0480022647.01 | 0.880499 | 5.220883e-70 | 2.949491e-66 |
MsG0080049029.01 | MsG0480023098.01 | 0.841403 | 4.854267e-58 | 7.125291e-55 |
MsG0080049029.01 | MsG0480023166.01 | 0.830607 | 2.669941e-55 | 2.826985e-52 |
MsG0080049029.01 | MsG0480023216.01 | 0.859642 | 3.591269e-63 | 9.551477e-60 |
MsG0080049029.01 | MsG0480023314.01 | 0.896990 | 2.169312e-76 | 2.402434e-72 |
MsG0080049029.01 | MsG0480023351.01 | 0.849194 | 3.780526e-60 | 7.111979e-57 |
MsG0080049029.01 | MsG0480023367.01 | 0.892256 | 1.877624e-74 | 1.702698e-70 |
MsG0080049029.01 | MsG0480023389.01 | 0.853558 | 2.207266e-61 | 4.788615e-58 |
MsG0080049029.01 | MsG0480023406.01 | 0.822856 | 1.893463e-53 | 1.603827e-50 |
MsG0080049029.01 | MsG0480023422.01 | 0.811055 | 8.475796e-51 | 5.194090e-48 |
MsG0080049029.01 | MsG0480023444.01 | 0.902926 | 5.878888e-79 | 8.515244e-75 |
MsG0080049029.01 | MsG0480023495.01 | 0.802527 | 5.378156e-49 | 2.640364e-46 |
MsG0080049029.01 | MsG0480023650.01 | 0.804283 | 2.327377e-49 | 1.195204e-46 |
MsG0080049029.01 | MsG0480023661.01 | 0.829391 | 5.285025e-55 | 5.402021e-52 |
MsG0080049029.01 | MsG0480023703.01 | 0.826825 | 2.192769e-54 | 2.079286e-51 |
MsG0080049029.01 | MsG0480023845.01 | 0.871676 | 5.701667e-67 | 2.319825e-63 |
MsG0080049029.01 | MsG0480023881.01 | 0.809411 | 1.917505e-50 | 1.125069e-47 |
MsG0080049029.01 | MsG0480023990.01 | 0.848176 | 7.241064e-60 | 1.317530e-56 |
MsG0080049029.01 | MsG0480023991.01 | 0.840966 | 6.324288e-58 | 9.156928e-55 |
MsG0080049029.01 | MsG0480023992.01 | 0.861738 | 8.306920e-64 | 2.373851e-60 |
MsG0080049029.01 | MsG0480024011.01 | 0.826179 | 3.126057e-54 | 2.910180e-51 |
MsG0080049029.01 | MsG0580024285.01 | 0.824518 | 7.730308e-54 | 6.863065e-51 |
MsG0080049029.01 | MsG0580024327.01 | 0.806895 | 6.587670e-50 | 3.617731e-47 |
MsG0080049029.01 | MsG0580024385.01 | 0.826702 | 2.346190e-54 | 2.216935e-51 |
MsG0080049029.01 | MsG0580024487.01 | 0.853991 | 1.657092e-61 | 3.647037e-58 |
MsG0080049029.01 | MsG0580024679.01 | 0.880019 | 7.746672e-70 | 4.296157e-66 |
MsG0080049029.01 | MsG0580024782.01 | -0.809181 | 2.148203e-50 | 1.252681e-47 |
MsG0080049029.01 | MsG0580024836.01 | 0.803664 | 3.128753e-49 | 1.581390e-46 |
MsG0080049029.01 | MsG0580024873.01 | 0.892528 | 1.461283e-74 | 1.341408e-70 |
MsG0080049029.01 | MsG0580024944.01 | 0.831958 | 1.242253e-55 | 1.369104e-52 |
MsG0080049029.01 | MsG0580024950.01 | 0.813612 | 2.343202e-51 | 1.537528e-48 |
MsG0080049029.01 | MsG0580024982.01 | 0.845907 | 3.029837e-59 | 5.126832e-56 |
MsG0080049029.01 | MsG0580024994.01 | -0.806340 | 8.627063e-50 | 4.670775e-47 |
MsG0080049029.01 | MsG0580025054.01 | 0.810202 | 1.295818e-50 | 7.762454e-48 |
MsG0080049029.01 | MsG0580025097.01 | 0.829322 | 5.492628e-55 | 5.603402e-52 |
MsG0080049029.01 | MsG0580025256.01 | 0.824044 | 9.990134e-54 | 8.749619e-51 |
MsG0080049029.01 | MsG0580025366.01 | 0.857087 | 2.073003e-62 | 5.056238e-59 |
MsG0080049029.01 | MsG0580025502.01 | 0.872300 | 3.534931e-67 | 1.471532e-63 |
MsG0080049029.01 | MsG0580025513.01 | 0.844115 | 9.234443e-59 | 1.475928e-55 |
MsG0080049029.01 | MsG0580025589.01 | 0.807991 | 3.857218e-50 | 2.179634e-47 |
MsG0080049029.01 | MsG0580025627.01 | 0.853126 | 2.936365e-61 | 6.277901e-58 |
MsG0080049029.01 | MsG0580025845.01 | 0.836572 | 8.651873e-57 | 1.094635e-53 |
MsG0080049029.01 | MsG0580025859.01 | 0.809667 | 1.689914e-50 | 9.982927e-48 |
MsG0080049029.01 | MsG0580025906.01 | 0.819578 | 1.079032e-52 | 8.336237e-50 |
MsG0080049029.01 | MsG0580025971.01 | 0.834129 | 3.583667e-56 | 4.213325e-53 |
MsG0080049029.01 | MsG0580025992.01 | 0.810962 | 8.878966e-51 | 5.428080e-48 |
MsG0080049029.01 | MsG0580026206.01 | 0.804310 | 2.297063e-49 | 1.180469e-46 |
MsG0080049029.01 | MsG0580026211.01 | 0.801965 | 7.020122e-49 | 3.397437e-46 |
MsG0080049029.01 | MsG0580026298.01 | 0.828645 | 8.013358e-55 | 8.013034e-52 |
MsG0080049029.01 | MsG0580027082.01 | 0.822652 | 2.112046e-53 | 1.778696e-50 |
MsG0080049029.01 | MsG0580027189.01 | 0.828525 | 8.563312e-55 | 8.533581e-52 |
MsG0080049029.01 | MsG0580027236.01 | 0.814814 | 1.271638e-51 | 8.619580e-49 |
MsG0080049029.01 | MsG0580027394.01 | 0.871423 | 6.913641e-67 | 2.787812e-63 |
MsG0080049029.01 | MsG0580027887.01 | 0.874512 | 6.375167e-68 | 2.877621e-64 |
MsG0080049029.01 | MsG0580027899.01 | 0.806848 | 6.739557e-50 | 3.696857e-47 |
MsG0080049029.01 | MsG0580027979.01 | 0.848372 | 6.393570e-60 | 1.170832e-56 |
MsG0080049029.01 | MsG0580027983.01 | 0.807414 | 5.113509e-50 | 2.846457e-47 |
MsG0080049029.01 | MsG0580028024.01 | 0.874833 | 4.957390e-68 | 2.265112e-64 |
MsG0080049029.01 | MsG0580028033.01 | 0.807917 | 3.999004e-50 | 2.255266e-47 |
MsG0080049029.01 | MsG0580028059.01 | 0.860935 | 1.459660e-63 | 4.058456e-60 |
MsG0080049029.01 | MsG0580028073.01 | 0.833767 | 4.414227e-56 | 5.134057e-53 |
MsG0080049029.01 | MsG0580028111.01 | 0.851137 | 1.079434e-60 | 2.163622e-57 |
MsG0080049029.01 | MsG0580028306.01 | 0.877522 | 5.875912e-69 | 2.963446e-65 |
MsG0080049029.01 | MsG0580028335.01 | 0.847463 | 1.137996e-59 | 2.024454e-56 |
MsG0080049029.01 | MsG0580028461.01 | 0.835654 | 1.480023e-56 | 1.821537e-53 |
MsG0080049029.01 | MsG0580028495.01 | 0.834041 | 3.769033e-56 | 4.419822e-53 |
MsG0080049029.01 | MsG0580028925.01 | 0.805981 | 1.026701e-49 | 5.508300e-47 |
MsG0080049029.01 | MsG0580029312.01 | 0.805760 | 1.142706e-49 | 6.096161e-47 |
MsG0080049029.01 | MsG0580029325.01 | 0.856451 | 3.188580e-62 | 7.614220e-59 |
MsG0080049029.01 | MsG0580029354.01 | 0.836968 | 6.855754e-57 | 8.778857e-54 |
MsG0080049029.01 | MsG0580029529.01 | 0.812191 | 4.799099e-51 | 3.031265e-48 |
MsG0080049029.01 | MsG0580029605.01 | 0.873423 | 1.487391e-67 | 6.451869e-64 |
MsG0080049029.01 | MsG0580029682.01 | 0.803513 | 3.363238e-49 | 1.693429e-46 |
MsG0080049029.01 | MsG0580029732.01 | 0.819209 | 1.309714e-52 | 1.001467e-49 |
MsG0080049029.01 | MsG0580029734.01 | 0.852969 | 3.255556e-61 | 6.923332e-58 |
MsG0080049029.01 | MsG0580029753.01 | 0.825534 | 4.447854e-54 | 4.065201e-51 |
MsG0080049029.01 | MsG0580029862.01 | 0.876105 | 1.818254e-68 | 8.707128e-65 |
MsG0080049029.01 | MsG0580029912.01 | 0.818694 | 1.714517e-52 | 1.292447e-49 |
MsG0080049029.01 | MsG0580029967.01 | 0.860128 | 2.563900e-63 | 6.935088e-60 |
MsG0080049029.01 | MsG0680030290.01 | 0.844878 | 5.755209e-59 | 9.420453e-56 |
MsG0080049029.01 | MsG0680030464.01 | 0.851568 | 8.151843e-61 | 1.656904e-57 |
MsG0080049029.01 | MsG0680030470.01 | 0.825848 | 3.746851e-54 | 3.455670e-51 |
MsG0080049029.01 | MsG0680030477.01 | 0.806104 | 9.672174e-50 | 5.205311e-47 |
MsG0080049029.01 | MsG0680030514.01 | 0.807055 | 6.093714e-50 | 3.360457e-47 |
MsG0080049029.01 | MsG0680030516.01 | 0.856736 | 2.629414e-62 | 6.336418e-59 |
MsG0080049029.01 | MsG0680030627.01 | 0.891279 | 4.591649e-74 | 3.999243e-70 |
MsG0080049029.01 | MsG0680030754.01 | 0.801306 | 9.580504e-49 | 4.560176e-46 |
MsG0080049029.01 | MsG0680030776.01 | 0.808421 | 3.123251e-50 | 1.785021e-47 |
MsG0080049029.01 | MsG0680030858.01 | 0.864330 | 1.314123e-64 | 4.110220e-61 |
MsG0080049029.01 | MsG0680030957.01 | 0.860486 | 1.997677e-63 | 5.469650e-60 |
MsG0080049029.01 | MsG0680031010.01 | 0.816769 | 4.662877e-52 | 3.334051e-49 |
MsG0080049029.01 | MsG0680031115.01 | 0.849488 | 3.131182e-60 | 5.945340e-57 |
MsG0080049029.01 | MsG0680031469.01 | 0.844414 | 7.674731e-59 | 1.238036e-55 |
MsG0080049029.01 | MsG0680031689.01 | 0.805180 | 1.511963e-49 | 7.946228e-47 |
MsG0080049029.01 | MsG0680031826.01 | 0.857363 | 1.717279e-62 | 4.227944e-59 |
MsG0080049029.01 | MsG0680031829.01 | 0.812975 | 3.234374e-51 | 2.085748e-48 |
MsG0080049029.01 | MsG0680032006.01 | 0.870055 | 1.948136e-66 | 7.474823e-63 |
MsG0080049029.01 | MsG0680032055.01 | 0.829975 | 3.810136e-55 | 3.960956e-52 |
MsG0080049029.01 | MsG0680032057.01 | 0.883208 | 5.450761e-71 | 3.423166e-67 |
MsG0080049029.01 | MsG0680032238.01 | 0.851115 | 1.094635e-60 | 2.192461e-57 |
MsG0080049029.01 | MsG0680032431.01 | 0.862815 | 3.879922e-64 | 1.151578e-60 |
MsG0080049029.01 | MsG0680032515.01 | 0.827886 | 1.221060e-54 | 1.194288e-51 |
MsG0080049029.01 | MsG0680032520.01 | 0.823696 | 1.205215e-53 | 1.045525e-50 |
MsG0080049029.01 | MsG0680032830.01 | 0.820239 | 7.617525e-53 | 5.994149e-50 |
MsG0080049029.01 | MsG0680032850.01 | 0.888171 | 7.477059e-73 | 5.729191e-69 |
MsG0080049029.01 | MsG0680033377.01 | 0.885553 | 7.365218e-72 | 5.077657e-68 |
MsG0080049029.01 | MsG0680034064.01 | 0.866711 | 2.334372e-65 | 7.945022e-62 |
MsG0080049029.01 | MsG0680035532.01 | 0.814500 | 1.492391e-51 | 1.003133e-48 |
MsG0080049029.01 | MsG0680035664.01 | 0.838874 | 2.218164e-57 | 3.010826e-54 |
MsG0080049029.01 | MsG0680035731.01 | 0.899365 | 2.129464e-77 | 2.625002e-73 |
MsG0080049029.01 | MsG0680035791.01 | 0.854245 | 1.399980e-61 | 3.107282e-58 |
MsG0080049029.01 | MsG0680035859.01 | 0.827970 | 1.165516e-54 | 1.142836e-51 |
MsG0080049029.01 | MsG0780035965.01 | 0.801541 | 8.577789e-49 | 4.107034e-46 |
MsG0080049029.01 | MsG0780035992.01 | 0.815030 | 1.138828e-51 | 7.764717e-49 |
MsG0080049029.01 | MsG0780036362.01 | 0.822025 | 2.953760e-53 | 2.443209e-50 |
MsG0080049029.01 | MsG0780036385.01 | 0.813405 | 2.602729e-51 | 1.698221e-48 |
MsG0080049029.01 | MsG0780036443.01 | 0.819543 | 1.098998e-52 | 8.482091e-50 |
MsG0080049029.01 | MsG0780036711.01 | 0.821751 | 3.418783e-53 | 2.805869e-50 |
MsG0080049029.01 | MsG0780036715.01 | 0.832709 | 8.098336e-56 | 9.125232e-53 |
MsG0080049029.01 | MsG0780036792.01 | 0.841911 | 3.565833e-58 | 5.317287e-55 |
MsG0080049029.01 | MsG0780037184.01 | 0.875905 | 2.131590e-68 | 1.013175e-64 |
MsG0080049029.01 | MsG0780037331.01 | 0.806571 | 7.711816e-50 | 4.199966e-47 |
MsG0080049029.01 | MsG0780037363.01 | 0.845579 | 3.720228e-59 | 6.227640e-56 |
MsG0080049029.01 | MsG0780037662.01 | 0.897992 | 8.204413e-77 | 9.511085e-73 |
MsG0080049029.01 | MsG0780037946.01 | 0.803321 | 3.685776e-49 | 1.846574e-46 |
MsG0080049029.01 | MsG0780038056.01 | 0.835773 | 1.380269e-56 | 1.704875e-53 |
MsG0080049029.01 | MsG0780038571.01 | 0.818919 | 1.524349e-52 | 1.156420e-49 |
MsG0080049029.01 | MsG0780038616.01 | 0.879425 | 1.259701e-69 | 6.826893e-66 |
MsG0080049029.01 | MsG0780038784.01 | 0.879809 | 9.201805e-70 | 5.061116e-66 |
MsG0080049029.01 | MsG0780038807.01 | 0.838235 | 3.244406e-57 | 4.318190e-54 |
MsG0080049029.01 | MsG0780038848.01 | 0.831758 | 1.391714e-55 | 1.524885e-52 |
MsG0080049029.01 | MsG0780038986.01 | 0.815447 | 9.200774e-52 | 6.345219e-49 |
MsG0080049029.01 | MsG0780039161.01 | 0.846032 | 2.802157e-59 | 4.760435e-56 |
MsG0080049029.01 | MsG0780039186.01 | 0.808353 | 3.229630e-50 | 1.842582e-47 |
MsG0080049029.01 | MsG0780039675.01 | 0.877181 | 7.720232e-69 | 3.845818e-65 |
MsG0080049029.01 | MsG0780039707.01 | 0.835915 | 1.270709e-56 | 1.576263e-53 |
MsG0080049029.01 | MsG0780039746.01 | 0.878011 | 3.963254e-69 | 2.035945e-65 |
MsG0080049029.01 | MsG0780039853.01 | 0.848506 | 5.870581e-60 | 1.079823e-56 |
MsG0080049029.01 | MsG0780039975.01 | 0.833721 | 4.532931e-56 | 5.264327e-53 |
MsG0080049029.01 | MsG0780039988.01 | 0.855066 | 8.095252e-62 | 1.845959e-58 |
MsG0080049029.01 | MsG0780040061.01 | 0.839024 | 2.029019e-57 | 2.766629e-54 |
MsG0080049029.01 | MsG0780040236.01 | 0.810836 | 9.454371e-51 | 5.760082e-48 |
MsG0080049029.01 | MsG0780040277.01 | 0.808320 | 3.281706e-50 | 1.870669e-47 |
MsG0080049029.01 | MsG0780040284.01 | 0.905229 | 5.351674e-80 | 8.573013e-76 |
MsG0080049029.01 | MsG0780040331.01 | 0.853388 | 2.469894e-61 | 5.327827e-58 |
MsG0080049029.01 | MsG0780040343.01 | 0.849636 | 2.847979e-60 | 5.433864e-57 |
MsG0080049029.01 | MsG0780040388.01 | 0.803700 | 3.075295e-49 | 1.555843e-46 |
MsG0080049029.01 | MsG0780040567.01 | 0.818150 | 2.278204e-52 | 1.691789e-49 |
MsG0080049029.01 | MsG0780040684.01 | 0.817303 | 3.536608e-52 | 2.565973e-49 |
MsG0080049029.01 | MsG0780040700.01 | 0.804373 | 2.229074e-49 | 1.147404e-46 |
MsG0080049029.01 | MsG0780040825.01 | -0.812907 | 3.347319e-51 | 2.154718e-48 |
MsG0080049029.01 | MsG0780040884.01 | 0.820550 | 6.465320e-53 | 5.131504e-50 |
MsG0080049029.01 | MsG0780040965.01 | 0.828798 | 7.358248e-55 | 7.390268e-52 |
MsG0080049029.01 | MsG0780041004.01 | 0.805059 | 1.602789e-49 | 8.397457e-47 |
MsG0080049029.01 | MsG0780041138.01 | 0.829222 | 5.806710e-55 | 5.906072e-52 |
MsG0080049029.01 | MsG0780041159.01 | 0.831198 | 1.912738e-55 | 2.060843e-52 |
MsG0080049029.01 | MsG0780041174.01 | 0.875926 | 2.095773e-68 | 9.969172e-65 |
MsG0080049029.01 | MsG0780041289.01 | 0.849255 | 3.636033e-60 | 6.853184e-57 |
MsG0080049029.01 | MsG0780041331.01 | 0.831184 | 1.927107e-55 | 2.075495e-52 |
MsG0080049029.01 | MsG0780041361.01 | 0.838388 | 2.961989e-57 | 3.961187e-54 |
MsG0080049029.01 | MsG0780041385.01 | 0.844090 | 9.375633e-59 | 1.497219e-55 |
MsG0080049029.01 | MsG0780041442.01 | 0.864620 | 1.066490e-64 | 3.370662e-61 |
MsG0080049029.01 | MsG0780041480.01 | 0.838685 | 2.483192e-57 | 3.351131e-54 |
MsG0080049029.01 | MsG0780041706.01 | 0.809684 | 1.675572e-50 | 9.902579e-48 |
MsG0080049029.01 | MsG0780041778.01 | 0.805136 | 1.543941e-49 | 8.105329e-47 |
MsG0080049029.01 | MsG0880041847.01 | 0.822083 | 2.862862e-53 | 2.371928e-50 |
MsG0080049029.01 | MsG0880041931.01 | 0.851555 | 8.225800e-61 | 1.671242e-57 |
MsG0080049029.01 | MsG0880041947.01 | 0.846653 | 1.897783e-59 | 3.289525e-56 |
MsG0080049029.01 | MsG0880042019.01 | 0.823877 | 1.093369e-53 | 9.532238e-51 |
MsG0080049029.01 | MsG0880042044.01 | 0.831527 | 1.587146e-55 | 1.726959e-52 |
MsG0080049029.01 | MsG0880042290.01 | 0.852972 | 3.249116e-61 | 6.910719e-58 |
MsG0080049029.01 | MsG0880042475.01 | 0.826242 | 3.020390e-54 | 2.816877e-51 |
MsG0080049029.01 | MsG0880042890.01 | 0.865898 | 4.226343e-65 | 1.397687e-61 |
MsG0080049029.01 | MsG0880043024.01 | 0.845642 | 3.574636e-59 | 5.996826e-56 |
MsG0080049029.01 | MsG0880043032.01 | 0.801894 | 7.259185e-49 | 3.507114e-46 |
MsG0080049029.01 | MsG0880043075.01 | 0.806635 | 7.476330e-50 | 4.078173e-47 |
MsG0080049029.01 | MsG0880043238.01 | 0.821663 | 3.582674e-53 | 2.933172e-50 |
MsG0080049029.01 | MsG0880043249.01 | 0.807430 | 5.073799e-50 | 2.825453e-47 |
MsG0080049029.01 | MsG0880043250.01 | 0.841210 | 5.454222e-58 | 7.956846e-55 |
MsG0080049029.01 | MsG0880043277.01 | 0.864800 | 9.366091e-65 | 2.978518e-61 |
MsG0080049029.01 | MsG0880043278.01 | 0.862165 | 6.149320e-64 | 1.783849e-60 |
MsG0080049029.01 | MsG0880043290.01 | 0.822995 | 1.757701e-53 | 1.494679e-50 |
MsG0080049029.01 | MsG0880043497.01 | 0.802766 | 4.801703e-49 | 2.371933e-46 |
MsG0080049029.01 | MsG0880043965.01 | 0.807199 | 5.679515e-50 | 3.143827e-47 |
MsG0080049029.01 | MsG0880044228.01 | 0.852224 | 5.311278e-61 | 1.102284e-57 |
MsG0080049029.01 | MsG0880044312.01 | 0.810088 | 1.371506e-50 | 8.191474e-48 |
MsG0080049029.01 | MsG0880044314.01 | 0.827528 | 1.488411e-54 | 1.440624e-51 |
MsG0080049029.01 | MsG0880044352.01 | 0.813718 | 2.221127e-51 | 1.461605e-48 |
MsG0080049029.01 | MsG0880044392.01 | 0.889022 | 3.511104e-73 | 2.785331e-69 |
MsG0080049029.01 | MsG0880044414.01 | 0.878861 | 1.993198e-69 | 1.057073e-65 |
MsG0080049029.01 | MsG0880044487.01 | 0.856330 | 3.460447e-62 | 8.229721e-59 |
MsG0080049029.01 | MsG0880044524.01 | 0.810769 | 9.777117e-51 | 5.945903e-48 |
MsG0080049029.01 | MsG0880044985.01 | 0.805652 | 1.203929e-49 | 6.404585e-47 |
MsG0080049029.01 | MsG0880045101.01 | 0.862411 | 5.167298e-64 | 1.511927e-60 |
MsG0080049029.01 | MsG0880045327.01 | 0.807570 | 4.739395e-50 | 2.648706e-47 |
MsG0080049029.01 | MsG0880045361.01 | 0.880250 | 6.405424e-70 | 3.582692e-66 |
MsG0080049029.01 | MsG0880045444.01 | 0.821621 | 3.663943e-53 | 2.995988e-50 |
MsG0080049029.01 | MsG0880045558.01 | 0.804241 | 2.373927e-49 | 1.217764e-46 |
MsG0080049029.01 | MsG0880045648.01 | 0.832448 | 9.399599e-56 | 1.050888e-52 |
MsG0080049029.01 | MsG0880045662.01 | 0.812779 | 3.570261e-51 | 2.290397e-48 |
MsG0080049029.01 | MsG0880046054.01 | 0.875706 | 2.493884e-68 | 1.176362e-64 |
MsG0080049029.01 | MsG0880046252.01 | 0.814784 | 1.291761e-51 | 8.748656e-49 |
MsG0080049029.01 | MsG0880046267.01 | 0.904987 | 6.903005e-80 | 1.093956e-75 |
MsG0080049029.01 | MsG0880046324.01 | 0.827357 | 1.636094e-54 | 1.575975e-51 |
MsG0080049029.01 | MsG0880046382.01 | 0.877188 | 7.676109e-69 | 3.824847e-65 |
MsG0080049029.01 | MsG0880046759.01 | 0.802425 | 5.644827e-49 | 2.764322e-46 |
MsG0080049029.01 | MsG0880046764.01 | 0.866166 | 3.477785e-65 | 1.160925e-61 |
MsG0080049029.01 | MsG0880046765.01 | 0.890852 | 6.770656e-74 | 5.791970e-70 |
MsG0080049029.01 | MsG0880046768.01 | -0.811918 | 5.503727e-51 | 3.450323e-48 |
MsG0080049029.01 | MsG0880046791.01 | 0.877260 | 7.247643e-69 | 3.621092e-65 |
MsG0080049029.01 | MsG0880046866.01 | 0.817657 | 2.942972e-52 | 2.156181e-49 |
MsG0080049029.01 | MsG0880046867.01 | 0.844004 | 9.889368e-59 | 1.575064e-55 |
MsG0080049029.01 | MsG0880047156.01 | 0.829863 | 4.057046e-55 | 4.204773e-52 |
MsG0080049029.01 | MsG0880047168.01 | 0.838672 | 2.502327e-57 | 3.375594e-54 |
MsG0080049029.01 | MsG0880047234.01 | 0.835573 | 1.551209e-56 | 1.904518e-53 |
MsG0080049029.01 | MsG0880047312.01 | -0.839557 | 1.475829e-57 | 2.045340e-54 |
MsG0080049029.01 | MsG0880047422.01 | -0.814636 | 1.392882e-51 | 9.396354e-49 |
MsG0080049029.01 | MsG0880047435.01 | 0.828338 | 9.503793e-55 | 9.418500e-52 |
MsG0080049029.01 | MsG0880047451.01 | 0.865515 | 5.584746e-65 | 1.821964e-61 |
MsG0080049029.01 | MsG0880047567.01 | 0.866207 | 3.374443e-65 | 1.127962e-61 |
MsG0080049029.01 | MsG0880047578.01 | 0.827473 | 1.534642e-54 | 1.483099e-51 |
MsG0080049029.01 | MsG0880047587.01 | 0.841571 | 4.384252e-58 | 6.468989e-55 |
MsG0080049029.01 | MsG0880047614.01 | 0.800610 | 1.329571e-48 | 6.217839e-46 |
MsG0080049029.01 | MsG0880047616.01 | 0.843851 | 1.086801e-58 | 1.722705e-55 |
MsG0080049029.01 | MsG0880047656.01 | 0.901100 | 3.769288e-78 | 5.015690e-74 |
MsG0080049029.01 | MsG0880047703.01 | 0.808393 | 3.166939e-50 | 1.808694e-47 |
MsG0080049029.01 | MsG0880047719.01 | 0.831783 | 1.372242e-55 | 1.504711e-52 |
MsG0080049029.01 | MsG0880047723.01 | 0.841395 | 4.875837e-58 | 7.155500e-55 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049029.01.T01 | MTR_2g080290 | 92.147 | 191 | 13 | 1 | 11 | 201 | 51 | 239 | 2.50e-117 | 333 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049029.01.T01 | AT4G27390 | 67.143 | 140 | 44 | 2 | 64 | 201 | 96 | 235 | 1.19e-65 | 202 |
Find 6 sgRNAs with CRISPR-Local
Find 369 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TTTATGGCAGACAAGGATTC+TGG | 0.347799 | contig619end:+15971 | MsG0080049029.01.T01:intron |
TGGCAATATGTAATTGTGTA+TGG | 0.421381 | contig619end:+16092 | MsG0080049029.01.T01:exon |
TTGCAATTCAGTGAAAGTAT+TGG | 0.442103 | contig619end:-16120 | MsG0080049029.01.T01:intergenic |
CTTCAATATTATGTTTGCAT+AGG | 0.490899 | contig619end:-16195 | MsG0080049029.01.T01:intergenic |
ATGCAAACATAATATTGAAG+AGG | 0.571274 | contig619end:+16198 | MsG0080049029.01.T01:exon |
GTTAATTATACTTACTAACA+TGG | 0.625795 | contig619end:-16055 | MsG0080049028.01.T01:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!! | TATATAAATTCTACATTATT+AGG | + | contig619end:11520-11539 | MsG0080049029.01.T01:intron | 10.0% |
!!! | ATGGTTAAATTTATTTTAAT+GGG | - | contig619end:10977-10996 | MsG0080049029.01.T01:intergenic | 10.0% |
!!! | ATTAACTAGTTTTTTTTTTT+TGG | + | contig619end:16072-16091 | MsG0080049029.01.T01:exon | 10.0% |
!!! | TATGGTTAAATTTATTTTAA+TGG | - | contig619end:10978-10997 | MsG0080049029.01.T01:intergenic | 10.0% |
!! | AAAAATTATTTACATTGAAC+AGG | - | contig619end:11604-11623 | MsG0080049029.01.T01:intergenic | 15.0% |
!! | AAAATATAAGTTTGAAAGTA+TGG | - | contig619end:13500-13519 | MsG0080049029.01.T01:intergenic | 15.0% |
!! | AATAAAGAATAAAGAGATAA+GGG | - | contig619end:15910-15929 | MsG0080049029.01.T01:intergenic | 15.0% |
!! | TAATAAAGAATAAAGAGATA+AGG | - | contig619end:15911-15930 | MsG0080049029.01.T01:intergenic | 15.0% |
!!! | ATATTTTATGAGTTCAATTA+AGG | + | contig619end:13513-13532 | MsG0080049029.01.T01:intron | 15.0% |
!!! | GTTTTAGTAAAGAATAATAA+AGG | + | contig619end:10633-10652 | MsG0080049029.01.T01:CDS | 15.0% |
!!! | TGGTTAAATTTATTTTAATG+GGG | - | contig619end:10976-10995 | MsG0080049029.01.T01:intergenic | 15.0% |
!! | AAAATAAAACTAGCGAAAAT+CGG | - | contig619end:11878-11897 | MsG0080049029.01.T01:intergenic | 20.0% |
!! | AAACATTGAGTAATCATAAT+TGG | + | contig619end:12739-12758 | MsG0080049029.01.T01:intron | 20.0% |
!! | AAAGATTTAAACAAGAACAT+TGG | - | contig619end:14903-14922 | MsG0080049029.01.T01:intergenic | 20.0% |
!! | AACAAAAACATCATTATCAA+CGG | - | contig619end:14155-14174 | MsG0080049029.01.T01:intergenic | 20.0% |
!! | AGAAATGTTTAAACAAACTT+TGG | + | contig619end:13049-13068 | MsG0080049029.01.T01:intron | 20.0% |
!! | AGATACATTTGTATTTAGTT+TGG | + | contig619end:15164-15183 | MsG0080049029.01.T01:intron | 20.0% |
!! | AGATTACATAAACATTTCAT+CGG | - | contig619end:13662-13681 | MsG0080049029.01.T01:intergenic | 20.0% |
!! | ATATAATTCATAAACATCTC+TGG | - | contig619end:15194-15213 | MsG0080049029.01.T01:intergenic | 20.0% |
!! | ATTCAACAATTTCACAAAAA+TGG | - | contig619end:12487-12506 | MsG0080049029.01.T01:intergenic | 20.0% |
!! | GAAATGTTTAAACAAACTTT+GGG | + | contig619end:13050-13069 | MsG0080049029.01.T01:intron | 20.0% |
!! | GTAAAGAATAATAAAGGATT+TGG | + | contig619end:10639-10658 | MsG0080049029.01.T01:CDS | 20.0% |
!! | GTTAAACCATTATAAATACA+AGG | + | contig619end:10871-10890 | MsG0080049029.01.T01:intron | 20.0% |
!! | GTTAATTATACTTACTAACA+TGG | - | contig619end:16058-16077 | MsG0080049029.01.T01:intergenic | 20.0% |
!! | TATCAATAACAATCAATGAA+AGG | - | contig619end:14611-14630 | MsG0080049029.01.T01:intergenic | 20.0% |
!! | TTATACGTATAAAATAACGA+TGG | - | contig619end:15559-15578 | MsG0080049029.01.T01:intergenic | 20.0% |
!! | TTCAACAATTTCACAAAAAT+GGG | - | contig619end:12486-12505 | MsG0080049029.01.T01:intergenic | 20.0% |
!!! | AAATGATGATTTTTGTTGTA+AGG | + | contig619end:12816-12835 | MsG0080049029.01.T01:intron | 20.0% |
!!! | AAATTTCTTGAAAAGTGTTT+CGG | + | contig619end:13595-13614 | MsG0080049029.01.T01:intron | 20.0% |
!!! | AACTTGTTTTACTTAGAAAA+TGG | + | contig619end:13571-13590 | MsG0080049029.01.T01:intron | 20.0% |
!!! | ATATTCTGTTATTTGAGATT+TGG | + | contig619end:15141-15160 | MsG0080049029.01.T01:intron | 20.0% |
!!! | GAATTTACATGTATAAGTTT+TGG | - | contig619end:11686-11705 | MsG0080049029.01.T01:intergenic | 20.0% |
!!! | GTTATTTTTTTAGTGTTTAG+TGG | + | contig619end:12067-12086 | MsG0080049029.01.T01:intron | 20.0% |
!!! | GTTCTTGTTTAAATCTTTTA+CGG | + | contig619end:14905-14924 | MsG0080049029.01.T01:intron | 20.0% |
!!! | GTTGTAATTGTTCTTTTATT+TGG | + | contig619end:13916-13935 | MsG0080049029.01.T01:intron | 20.0% |
!!! | TCACTAACATTAGTTTATAA+AGG | - | contig619end:12261-12280 | MsG0080049029.01.T01:intergenic | 20.0% |
!!! | TCTTTAAAGTGAATAAGTAA+AGG | - | contig619end:11007-11026 | MsG0080049029.01.T01:intergenic | 20.0% |
!!! | TTTAAGGTTGAATTAGAAAT+GGG | + | contig619end:12194-12213 | MsG0080049029.01.T01:intron | 20.0% |
!!! | TTTATTTTGATATCAGTTGA+TGG | + | contig619end:15749-15768 | MsG0080049029.01.T01:intron | 20.0% |
!!! | TTTCTTAAATTATGTTTTCC+CGG | + | contig619end:11035-11054 | MsG0080049029.01.T01:intron | 20.0% |
!!! | TTTTAAGGTTGAATTAGAAA+TGG | + | contig619end:12193-12212 | MsG0080049029.01.T01:intron | 20.0% |
!!! | TTTTATGAATTCATCGTATT+TGG | + | contig619end:13636-13655 | MsG0080049029.01.T01:intron | 20.0% |
! | AAAAGGTAAACCTATTTGAT+TGG | - | contig619end:11315-11334 | MsG0080049029.01.T01:intergenic | 25.0% |
! | AAAGGATTTGGATTCAATAA+TGG | + | contig619end:10651-10670 | MsG0080049029.01.T01:CDS | 25.0% |
! | AAATAAAACTAGCGAAAATC+GGG | - | contig619end:11877-11896 | MsG0080049029.01.T01:intergenic | 25.0% |
! | AAGAAGATAATGTAGATTGA+AGG | + | contig619end:10144-10163 | MsG0080049029.01.T01:exon | 25.0% |
! | AATAAGTAAAGGCTTATCTA+TGG | - | contig619end:10996-11015 | MsG0080049029.01.T01:intergenic | 25.0% |
! | AATTCAACTGCTATAATCAA+CGG | - | contig619end:14014-14033 | MsG0080049029.01.T01:intergenic | 25.0% |
! | AGAAGATAATGTAGATTGAA+GGG | + | contig619end:10145-10164 | MsG0080049029.01.T01:exon | 25.0% |
! | AGAGAAAAAGATGTGAATTA+TGG | - | contig619end:12460-12479 | MsG0080049029.01.T01:intergenic | 25.0% |
! | AGATGAAAAGAACTAAACTT+TGG | - | contig619end:10501-10520 | MsG0080049029.01.T01:intergenic | 25.0% |
! | AGATTGAAAATGATCATTGA+GGG | + | contig619end:13797-13816 | MsG0080049029.01.T01:intron | 25.0% |
! | AGTATTTAAACTATGATGTG+AGG | + | contig619end:13544-13563 | MsG0080049029.01.T01:intron | 25.0% |
! | ATATGTATATGCATATGATG+TGG | + | contig619end:14487-14506 | MsG0080049029.01.T01:intron | 25.0% |
! | ATGCAAACATAATATTGAAG+AGG | + | contig619end:16198-16217 | MsG0080049029.01.T01:exon | 25.0% |
! | ATTATGAGATGATGTATGAA+TGG | + | contig619end:13858-13877 | MsG0080049029.01.T01:intron | 25.0% |
! | ATTCTACAAGGAGTTTAAAA+AGG | - | contig619end:11332-11351 | MsG0080049029.01.T01:intergenic | 25.0% |
! | ATTTAAAAATGGGTGTATGT+GGG | + | contig619end:10578-10597 | MsG0080049029.01.T01:CDS | 25.0% |
! | CATATCAATCTAATCATAGA+GGG | - | contig619end:13838-13857 | MsG0080049029.01.T01:intergenic | 25.0% |
! | CTTCAATATTATGTTTGCAT+AGG | - | contig619end:16198-16217 | MsG0080049029.01.T01:intergenic | 25.0% |
! | GATGAAAAGAACTAAACTTT+GGG | - | contig619end:10500-10519 | MsG0080049029.01.T01:intergenic | 25.0% |
! | GTAAAATCTTAGTGTACTAA+TGG | - | contig619end:10356-10375 | MsG0080049029.01.T01:intergenic | 25.0% |
! | GTCTTGTATATGTTATCATT+GGG | - | contig619end:10447-10466 | MsG0080049029.01.T01:intergenic | 25.0% |
! | TAGAAGACATTATCAACTAA+GGG | - | contig619end:11646-11665 | MsG0080049029.01.T01:intergenic | 25.0% |
! | TAGATAGGTTATGTGAAATT+TGG | - | contig619end:11405-11424 | MsG0080049029.01.T01:intergenic | 25.0% |
! | TAGATTGAAAATGATCATTG+AGG | + | contig619end:13796-13815 | MsG0080049029.01.T01:intron | 25.0% |
! | TATTTAAAAATGGGTGTATG+TGG | + | contig619end:10577-10596 | MsG0080049029.01.T01:CDS | 25.0% |
! | TCAATCTACATTATCTTCTT+TGG | - | contig619end:10144-10163 | MsG0080049029.01.T01:intergenic | 25.0% |
! | TCATATCAATCTAATCATAG+AGG | - | contig619end:13839-13858 | MsG0080049029.01.T01:intergenic | 25.0% |
! | TGTATGAATTGTGGTTTATT+CGG | + | contig619end:15254-15273 | MsG0080049029.01.T01:intron | 25.0% |
! | TGTCTTGTATATGTTATCAT+TGG | - | contig619end:10448-10467 | MsG0080049029.01.T01:intergenic | 25.0% |
! | TTGTGACATAATTGAATATG+TGG | + | contig619end:14264-14283 | MsG0080049029.01.T01:intron | 25.0% |
! | TTTACCGCTTAATAGAAATA+GGG | + | contig619end:15322-15341 | MsG0080049029.01.T01:intron | 25.0% |
! | TTTATAAAGGCTCACTTAAT+GGG | - | contig619end:12248-12267 | MsG0080049029.01.T01:intergenic | 25.0% |
!! | AATGTACTAATAACTTGTGA+AGG | - | contig619end:15868-15887 | MsG0080049029.01.T01:intergenic | 25.0% |
!! | ATTTGTAAAGCATTTACAAG+AGG | - | contig619end:11067-11086 | MsG0080049029.01.T01:intergenic | 25.0% |
!! | TTTGAAGTTTGATGAGAAAT+GGG | + | contig619end:12791-12810 | MsG0080049029.01.T01:intron | 25.0% |
!! | TTTTACCGCTTAATAGAAAT+AGG | + | contig619end:15321-15340 | MsG0080049029.01.T01:intron | 25.0% |
!!! | AAAGTTTAGTTCTTTTCATC+TGG | + | contig619end:10500-10519 | MsG0080049029.01.T01:intron | 25.0% |
!!! | AAGTTTAGTTCTTTTCATCT+GGG | + | contig619end:10501-10520 | MsG0080049029.01.T01:intron | 25.0% |
!!! | ATTTTAGTCATTTTGGACTT+AGG | + | contig619end:11994-12013 | MsG0080049029.01.T01:intron | 25.0% |
!!! | CTTTTACACTTTTTAAACGA+TGG | + | contig619end:15366-15385 | MsG0080049029.01.T01:intron | 25.0% |
!!! | GATGTTTTTGTTACATCATA+AGG | + | contig619end:14163-14182 | MsG0080049029.01.T01:intron | 25.0% |
!!! | GTTCTTTTATTTGGAATGTA+AGG | + | contig619end:13925-13944 | MsG0080049029.01.T01:intron | 25.0% |
!!! | GTTTATTTGACTTGGTATTT+CGG | + | contig619end:15108-15127 | MsG0080049029.01.T01:intron | 25.0% |
!!! | TAATTTTGTTAGCTTTCCAA+TGG | + | contig619end:13344-13363 | MsG0080049029.01.T01:intron | 25.0% |
!!! | TTTACATGTATAAGTTTTGG+AGG | - | contig619end:11683-11702 | MsG0080049029.01.T01:intergenic | 25.0% |
!!! | TTTGACTTGAAAATGATTCT+TGG | + | contig619end:13373-13392 | MsG0080049029.01.T01:intron | 25.0% |
!!! | TTTTAGTCATTTTGGACTTA+GGG | + | contig619end:11995-12014 | MsG0080049029.01.T01:intron | 25.0% |
!!! | TTTTTTAAACGAAACACTGA+TGG | - | contig619end:15691-15710 | MsG0080049029.01.T01:intergenic | 25.0% |
AAATTGGAGAAAGAAAAGGT+GGG | - | contig619end:10474-10493 | MsG0080049028.01.T01:intergenic | 30.0% | |
AAGTATGGAAACAATCCATA+AGG | - | contig619end:13485-13504 | MsG0080049029.01.T01:intergenic | 30.0% | |
AATGTTAGTGAGAAGAGATA+GGG | + | contig619end:12270-12289 | MsG0080049029.01.T01:intron | 30.0% | |
ACACGAATTTGAAAGCAATT+AGG | - | contig619end:12514-12533 | MsG0080049029.01.T01:intergenic | 30.0% | |
ACATGGGGAATATTGTATAT+GGG | - | contig619end:10383-10402 | MsG0080049029.01.T01:intergenic | 30.0% | |
ACTAAACTTTGGGTCTAAAT+TGG | - | contig619end:10490-10509 | MsG0080049029.01.T01:intergenic | 30.0% | |
ACTGAATAAAGATTAAGCGA+AGG | + | contig619end:11460-11479 | MsG0080049029.01.T01:intron | 30.0% | |
ATAGCTTGAAATGTAAGTGA+TGG | + | contig619end:14687-14706 | MsG0080049029.01.T01:intron | 30.0% | |
ATGAACTTGGAATGATGATA+TGG | + | contig619end:14792-14811 | MsG0080049029.01.T01:intron | 30.0% | |
ATGATATGGAATGGTTTGAA+TGG | + | contig619end:14806-14825 | MsG0080049029.01.T01:intron | 30.0% | |
ATGATGTATGAATGGTTGTT+AGG | + | contig619end:13866-13885 | MsG0080049029.01.T01:intron | 30.0% | |
ATGTTGTTGTGATGAATTGT+TGG | + | contig619end:12660-12679 | MsG0080049029.01.T01:intron | 30.0% | |
ATTAGAAGAATGTTGCAATC+AGG | - | contig619end:11365-11384 | MsG0080049029.01.T01:intergenic | 30.0% | |
CAATTATGAGCCAATCAAAT+AGG | + | contig619end:11302-11321 | MsG0080049029.01.T01:intron | 30.0% | |
CACACACCTTGTATTTATAA+TGG | - | contig619end:10880-10899 | MsG0080049029.01.T01:intergenic | 30.0% | |
CCGGTAAAATATAACACTAT+CGG | - | contig619end:12156-12175 | MsG0080049029.01.T01:intergenic | 30.0% | |
CTACATTATTAGGCTATTTG+TGG | + | contig619end:11530-11549 | MsG0080049029.01.T01:intron | 30.0% | |
CTAGAAGACATTATCAACTA+AGG | - | contig619end:11647-11666 | MsG0080049029.01.T01:intergenic | 30.0% | |
CTGCAATTCTTCATTTAAAG+TGG | - | contig619end:15597-15616 | MsG0080049029.01.T01:intergenic | 30.0% | |
CTTATCTCACAAACCTTAAT+GGG | - | contig619end:12225-12244 | MsG0080049029.01.T01:intergenic | 30.0% | |
CTTTATGCATGTATGAATTG+TGG | + | contig619end:15245-15264 | MsG0080049029.01.T01:intron | 30.0% | |
GTAAATGCTTTACAAATGCA+AGG | + | contig619end:11070-11089 | MsG0080049029.01.T01:intron | 30.0% | |
GTCTAAATTGGAGAAAGAAA+AGG | - | contig619end:10478-10497 | MsG0080049029.01.T01:intergenic | 30.0% | |
GTTGCTACCTCTTAAAATTT+AGG | - | contig619end:11198-11217 | MsG0080049029.01.T01:intergenic | 30.0% | |
GTTTATAAAGGCTCACTTAA+TGG | - | contig619end:12249-12268 | MsG0080049029.01.T01:intergenic | 30.0% | |
TAAATTGGAGAAAGAAAAGG+TGG | - | contig619end:10475-10494 | MsG0080049029.01.T01:intergenic | 30.0% | |
TAATGTTAGTGAGAAGAGAT+AGG | + | contig619end:12269-12288 | MsG0080049029.01.T01:intron | 30.0% | |
TAGCTTGAAATGTAAGTGAT+GGG | + | contig619end:14688-14707 | MsG0080049029.01.T01:intron | 30.0% | |
TCAAACCAATCTACAACATT+TGG | + | contig619end:15803-15822 | MsG0080049029.01.T01:CDS | 30.0% | |
TCGACTTAGAAATAGTTATG+CGG | - | contig619end:13456-13475 | MsG0080049029.01.T01:intergenic | 30.0% | |
TGAAAATCATTTCCACAGTT+TGG | - | contig619end:15457-15476 | MsG0080049029.01.T01:intergenic | 30.0% | |
TGATGCTATTGTTTCCATTT+GGG | + | contig619end:10782-10801 | MsG0080049029.01.T01:CDS | 30.0% | |
TGCATGATGTTTATTTGACT+TGG | + | contig619end:15100-15119 | MsG0080049029.01.T01:intron | 30.0% | |
TGGCAATATGTAATTGTGTA+TGG | + | contig619end:16092-16111 | MsG0080049029.01.T01:exon | 30.0% | |
TGTACTAATGGAGTTAGAAA+AGG | - | contig619end:10344-10363 | MsG0080049029.01.T01:intergenic | 30.0% | |
TGTGTCAAATATCATCTTTG+AGG | - | contig619end:10268-10287 | MsG0080049029.01.T01:intergenic | 30.0% | |
TGTTTCTTGCTTCTTTAGAT+AGG | - | contig619end:11420-11439 | MsG0080049029.01.T01:intergenic | 30.0% | |
TTATCAACGGCTATAATCAA+CGG | - | contig619end:14142-14161 | MsG0080049029.01.T01:intergenic | 30.0% | |
TTATCCCTTATCTTTGTTGA+TGG | + | contig619end:15928-15947 | MsG0080049029.01.T01:intron | 30.0% | |
TTGATGCTATTGTTTCCATT+TGG | + | contig619end:10781-10800 | MsG0080049029.01.T01:CDS | 30.0% | |
TTTGAGAAGATAAGAGATAG+AGG | + | contig619end:12319-12338 | MsG0080049029.01.T01:intron | 30.0% | |
TTTGTTTGTGCTTATACACT+TGG | + | contig619end:14412-14431 | MsG0080049029.01.T01:intron | 30.0% | |
! | AAACTGTGGAAATGATTTTC+AGG | + | contig619end:15456-15475 | MsG0080049029.01.T01:CDS | 30.0% |
! | ACATCTCATATCACCATTTT+TGG | - | contig619end:12644-12663 | MsG0080049029.01.T01:intergenic | 30.0% |
! | ATTTTACCAAGTTACTAGAG+AGG | + | contig619end:12098-12117 | MsG0080049029.01.T01:intron | 30.0% |
! | CCGATAGTGTTATATTTTAC+CGG | + | contig619end:12153-12172 | MsG0080049029.01.T01:intron | 30.0% |
! | GAAATTACATGCTTAAGTTG+TGG | + | contig619end:12593-12612 | MsG0080049029.01.T01:intron | 30.0% |
! | GGTGAGTAGTAACATTTTTA+AGG | + | contig619end:12178-12197 | MsG0080049029.01.T01:intron | 30.0% |
! | GTTTGAAGTTTGATGAGAAA+TGG | + | contig619end:12790-12809 | MsG0080049029.01.T01:intron | 30.0% |
! | TACACTTGTTGATATGAACT+TGG | + | contig619end:14779-14798 | MsG0080049029.01.T01:intron | 30.0% |
! | TAGTGTTATATTTTACCGGT+AGG | + | contig619end:12157-12176 | MsG0080049029.01.T01:intron | 30.0% |
! | TTGCAATTCAGTGAAAGTAT+TGG | - | contig619end:16123-16142 | MsG0080049029.01.T01:intergenic | 30.0% |
! | TTTGCATTTTTGCCCAAAAA+TGG | + | contig619end:12628-12647 | MsG0080049029.01.T01:intron | 30.0% |
! | TTTTACCAAGTTACTAGAGA+GGG | + | contig619end:12099-12118 | MsG0080049029.01.T01:intron | 30.0% |
!! | AACACCCTATTTCTATTAAG+CGG | - | contig619end:15329-15348 | MsG0080049029.01.T01:intergenic | 30.0% |
!! | AATTTCTCGCGTTCTAAAAA+TGG | + | contig619end:15839-15858 | MsG0080049029.01.T01:CDS | 30.0% |
!! | ATTTGTGGATTGGTGAAATT+TGG | + | contig619end:14295-14314 | MsG0080049029.01.T01:intron | 30.0% |
!! | CATCTCATATCACCATTTTT+GGG | - | contig619end:12643-12662 | MsG0080049029.01.T01:intergenic | 30.0% |
!! | GATTGGTTTGAAAAATTCAC+AGG | - | contig619end:15794-15813 | MsG0080049029.01.T01:intergenic | 30.0% |
!! | TCAATCTGCGTCTTTTATTT+CGG | - | contig619end:16017-16036 | MsG0080049029.01.T01:intergenic | 30.0% |
!! | TTTAGTCATTTTGGACTTAG+GGG | + | contig619end:11996-12015 | MsG0080049029.01.T01:intron | 30.0% |
!!! | ACGATGGATTATTTTTCTTG+TGG | + | contig619end:15382-15401 | MsG0080049029.01.T01:intron | 30.0% |
!!! | GAAGGGTATTTTAGTCATTT+TGG | + | contig619end:11987-12006 | MsG0080049029.01.T01:intron | 30.0% |
!!! | TTCTGTTTTGAATTGGCTTT+CGG | + | contig619end:13300-13319 | MsG0080049029.01.T01:intron | 30.0% |
!!! | TTCTTGGTTTTTGAGTTATG+AGG | + | contig619end:13389-13408 | MsG0080049029.01.T01:intron | 30.0% |
AAAAAGGTTGACCGCAAAAT+GGG | - | contig619end:15625-15644 | MsG0080049028.01.T01:intergenic | 35.0% | |
AAAGGTTTAGACATGTCGAA+TGG | - | contig619end:10326-10345 | MsG0080049028.01.T01:intergenic | 35.0% | |
AAATGTTACTACTCACCTAC+CGG | - | contig619end:12175-12194 | MsG0080049028.01.T01:intergenic | 35.0% | |
AAGAATGTTGCAATCAGGAT+AGG | - | contig619end:11360-11379 | MsG0080049029.01.T01:intergenic | 35.0% | |
AATCAACGGCTATAAGTCAA+CGG | - | contig619end:14000-14019 | MsG0080049029.01.T01:intergenic | 35.0% | |
AATGTTGTGATTGTGTGGAT+TGG | + | contig619end:14320-14339 | MsG0080049029.01.T01:intron | 35.0% | |
AATTGTACAAGAGTGGACAT+GGG | - | contig619end:10399-10418 | MsG0080049029.01.T01:intergenic | 35.0% | |
AGAATGTTGCAATCAGGATA+GGG | - | contig619end:11359-11378 | MsG0080049029.01.T01:intergenic | 35.0% | |
AGCACCATCAACAAAGATAA+GGG | - | contig619end:15935-15954 | MsG0080049029.01.T01:intergenic | 35.0% | |
AGCTTGAAATGTAAGTGATG+GGG | + | contig619end:14689-14708 | MsG0080049029.01.T01:intron | 35.0% | |
AGTATGCTAAGTGAAGAATG+AGG | + | contig619end:14577-14596 | MsG0080049029.01.T01:intron | 35.0% | |
ATAGAGGGTTCATAAGCAAT+TGG | - | contig619end:13823-13842 | MsG0080049029.01.T01:intergenic | 35.0% | |
ATTTACAAGAGGCTAATTCC+GGG | - | contig619end:11056-11075 | MsG0080049029.01.T01:intergenic | 35.0% | |
CATTTACAAGAGGCTAATTC+CGG | - | contig619end:11057-11076 | MsG0080049029.01.T01:intergenic | 35.0% | |
CTTGGAATGATGATATGGAA+TGG | + | contig619end:14797-14816 | MsG0080049029.01.T01:intron | 35.0% | |
CTTGTCCAAATGTTGTAGAT+TGG | - | contig619end:15811-15830 | MsG0080049029.01.T01:intergenic | 35.0% | |
GACATGGGGAATATTGTATA+TGG | - | contig619end:10384-10403 | MsG0080049029.01.T01:intergenic | 35.0% | |
GAGGCGCAGTATTTAAAAAT+GGG | + | contig619end:10568-10587 | MsG0080049029.01.T01:CDS | 35.0% | |
GATAGAGAATTGTACAAGAG+TGG | - | contig619end:10406-10425 | MsG0080049029.01.T01:intergenic | 35.0% | |
GCTTATCTCACAAACCTTAA+TGG | - | contig619end:12226-12245 | MsG0080049029.01.T01:intergenic | 35.0% | |
GGAAACAATCCATAAGGTTT+GGG | - | contig619end:13479-13498 | MsG0080049029.01.T01:intergenic | 35.0% | |
GGATTTGGATTCAATAATGG+TGG | + | contig619end:10654-10673 | MsG0080049029.01.T01:CDS | 35.0% | |
TAACACTATCGGTCACTTAA+CGG | - | contig619end:12145-12164 | MsG0080049029.01.T01:intergenic | 35.0% | |
TAGACACTTGCATGAAAAAG+AGG | - | contig619end:15052-15071 | MsG0080049029.01.T01:intergenic | 35.0% | |
TAGGAGCTAAATTGAAGCTT+GGG | + | contig619end:12392-12411 | MsG0080049029.01.T01:intron | 35.0% | |
TATGTGGCTTGATGAATTTG+TGG | + | contig619end:14280-14299 | MsG0080049029.01.T01:intron | 35.0% | |
TCATGCAAGTGTCTAGATTA+GGG | + | contig619end:15057-15076 | MsG0080049029.01.T01:intron | 35.0% | |
TCTATGATAGGGTCATATGA+TGG | + | contig619end:11102-11121 | MsG0080049029.01.T01:intron | 35.0% | |
TGGAAACAATCCATAAGGTT+TGG | - | contig619end:13480-13499 | MsG0080049029.01.T01:intergenic | 35.0% | |
TGGGATCAAATTTGAGCTTT+GGG | + | contig619end:13069-13088 | MsG0080049029.01.T01:intron | 35.0% | |
TGTTGTGAACATATGCATTG+TGG | + | contig619end:14033-14052 | MsG0080049029.01.T01:intron | 35.0% | |
TTCATGCAAGTGTCTAGATT+AGG | + | contig619end:15056-15075 | MsG0080049029.01.T01:intron | 35.0% | |
TTGACTTATCTCTCAATGAC+TGG | + | contig619end:10741-10760 | MsG0080049029.01.T01:CDS | 35.0% | |
TTGGAAAGAACAACATGTGA+AGG | + | contig619end:10202-10221 | MsG0080049029.01.T01:intron | 35.0% | |
TTGGAATGTAAGGAACTATG+TGG | + | contig619end:13935-13954 | MsG0080049029.01.T01:intron | 35.0% | |
TTGGGATCAAATTTGAGCTT+TGG | + | contig619end:13068-13087 | MsG0080049029.01.T01:intron | 35.0% | |
TTGGTGTATATGTACATTGG+TGG | + | contig619end:14339-14358 | MsG0080049029.01.T01:intron | 35.0% | |
TTTGGATTCAATAATGGTGG+AGG | + | contig619end:10657-10676 | MsG0080049029.01.T01:CDS | 35.0% | |
! | AAGTCAAAATTGGGGTTTTG+GGG | + | contig619end:13092-13111 | MsG0080049029.01.T01:intron | 35.0% |
! | AAGTGAGTTTTTCTCGTAAC+AGG | + | contig619end:13120-13139 | MsG0080049029.01.T01:intron | 35.0% |
! | GAAGTCAAAATTGGGGTTTT+GGG | + | contig619end:13091-13110 | MsG0080049029.01.T01:intron | 35.0% |
! | GGATTGGTGTATATGTACAT+TGG | + | contig619end:14336-14355 | MsG0080049029.01.T01:intron | 35.0% |
! | GGCTCAACCTAAATTTTAAG+AGG | + | contig619end:11188-11207 | MsG0080049029.01.T01:intron | 35.0% |
! | GGTTGAATTAGAAATGGGTT+AGG | + | contig619end:12199-12218 | MsG0080049029.01.T01:intron | 35.0% |
! | TAATTAGTAAGCACTAGCCT+AGG | - | contig619end:10832-10851 | MsG0080049029.01.T01:intergenic | 35.0% |
! | TCATGCATCATATGTCGTTT+CGG | + | contig619end:14070-14089 | MsG0080049029.01.T01:intron | 35.0% |
! | TGATGGTAATGAGTTTGTCA+AGG | + | contig619end:15766-15785 | MsG0080049029.01.T01:CDS | 35.0% |
! | TTTGCCTCTGTGTGTATTTT+TGG | + | contig619end:11939-11958 | MsG0080049029.01.T01:intron | 35.0% |
!! | AGCTTTGGGAAGTCAAAATT+GGG | + | contig619end:13083-13102 | MsG0080049029.01.T01:intron | 35.0% |
!! | ATATAATGAAAGGCACTGTG+AGG | + | contig619end:11811-11830 | MsG0080049029.01.T01:intron | 35.0% |
!! | ATTTTAATGGGGCAACATCA+GGG | - | contig619end:10965-10984 | MsG0080049029.01.T01:intergenic | 35.0% |
!! | CCTTACAAGTCAGTTTTGTA+CGG | + | contig619end:11157-11176 | MsG0080049029.01.T01:intron | 35.0% |
!! | CTTACAAGTCAGTTTTGTAC+GGG | + | contig619end:11158-11177 | MsG0080049029.01.T01:intron | 35.0% |
!! | TACATTGGTGGATTTGTTGA+TGG | + | contig619end:14351-14370 | MsG0080049029.01.T01:intron | 35.0% |
!!! | CGTTTACTTGGTTTTGACTT+AGG | + | contig619end:13734-13753 | MsG0080049029.01.T01:intron | 35.0% |
!!! | CTCTGTGTGTATTTTTGGTT+GGG | + | contig619end:11944-11963 | MsG0080049029.01.T01:intron | 35.0% |
!!! | TATTTTAATGGGGCAACATC+AGG | - | contig619end:10966-10985 | MsG0080049029.01.T01:intergenic | 35.0% |
!!! | TTTAGTTCTTTTCATCTGGG+TGG | + | contig619end:10504-10523 | MsG0080049029.01.T01:intron | 35.0% |
AAATTTCACCAAGACCACCT+TGG | - | contig619end:13423-13442 | MsG0080049028.01.T01:intergenic | 40.0% | |
AACCACAGCTTACCAGAAAA+AGG | - | contig619end:15641-15660 | MsG0080049028.01.T01:intergenic | 40.0% | |
AAGATGCAAGAACGTGAAAC+AGG | - | contig619end:13270-13289 | MsG0080049029.01.T01:intergenic | 40.0% | |
AATGTTGCAATCAGGATAGG+GGG | - | contig619end:11357-11376 | MsG0080049029.01.T01:intergenic | 40.0% | |
AGAGAGAAGAACAAGTGCAA+GGG | + | contig619end:12344-12363 | MsG0080049029.01.T01:intron | 40.0% | |
AGATGCAAGAACGTGAAACA+GGG | - | contig619end:13269-13288 | MsG0080049029.01.T01:intergenic | 40.0% | |
ATTGTACAAGAGTGGACATG+GGG | - | contig619end:10398-10417 | MsG0080049029.01.T01:intergenic | 40.0% | |
CAGCACCATCAACAAAGATA+AGG | - | contig619end:15936-15955 | MsG0080049029.01.T01:intergenic | 40.0% | |
CATGTTACACAACATAGCAG+CGG | - | contig619end:15223-15242 | MsG0080049029.01.T01:intergenic | 40.0% | |
CCAACCAAAAATACACACAG+AGG | - | contig619end:11946-11965 | MsG0080049029.01.T01:intergenic | 40.0% | |
CTAGGAGCTAAATTGAAGCT+TGG | + | contig619end:12391-12410 | MsG0080049029.01.T01:intron | 40.0% | |
GAAAAAGGTTGACCGCAAAA+TGG | - | contig619end:15626-15645 | MsG0080049029.01.T01:intergenic | 40.0% | |
GAATGTTGCAATCAGGATAG+GGG | - | contig619end:11358-11377 | MsG0080049029.01.T01:intergenic | 40.0% | |
GAATTGTACAAGAGTGGACA+TGG | - | contig619end:10400-10419 | MsG0080049029.01.T01:intergenic | 40.0% | |
GCAAGTACTCATCATCATCA+AGG | - | contig619end:14519-14538 | MsG0080049029.01.T01:intergenic | 40.0% | |
GCAGGTCGAGATATAATGAA+AGG | + | contig619end:11801-11820 | MsG0080049029.01.T01:CDS | 40.0% | |
GCTTGAAATGTAAGTGATGG+GGG | + | contig619end:14690-14709 | MsG0080049029.01.T01:intron | 40.0% | |
GGCAATTGAACTCGTTTACT+TGG | + | contig619end:13722-13741 | MsG0080049029.01.T01:intron | 40.0% | |
GGCTATAATCAACGGCAATA+TGG | - | contig619end:14134-14153 | MsG0080049029.01.T01:intergenic | 40.0% | |
GGCTTGATGAATTTGTGGAT+TGG | + | contig619end:14285-14304 | MsG0080049029.01.T01:intron | 40.0% | |
GTGTTTCCGTGTTTCGTTTA+TGG | + | contig619end:15955-15974 | MsG0080049029.01.T01:intron | 40.0% | |
GTTATGAGGCAAATACTCCA+AGG | + | contig619end:13403-13422 | MsG0080049029.01.T01:intron | 40.0% | |
TAGACTCTTCTAGATGCATG+TGG | - | contig619end:14213-14232 | MsG0080049029.01.T01:intergenic | 40.0% | |
TAGAGAGAAGAACAAGTGCA+AGG | + | contig619end:12343-12362 | MsG0080049029.01.T01:intron | 40.0% | |
TATATGCAGTGTCCAAACTG+TGG | + | contig619end:15442-15461 | MsG0080049029.01.T01:intron | 40.0% | |
TATTCCCACACAGATCTTTG+CGG | + | contig619end:11737-11756 | MsG0080049029.01.T01:intron | 40.0% | |
TCAAGTCAAACCAAAGCCAT+TGG | - | contig619end:13363-13382 | MsG0080049029.01.T01:intergenic | 40.0% | |
TCATGTGATGCTAGTGTTCT+AGG | + | contig619end:14723-14742 | MsG0080049029.01.T01:intron | 40.0% | |
TGAACGTTAACACAGCAGTA+AGG | - | contig619end:11227-11246 | MsG0080049029.01.T01:intergenic | 40.0% | |
TGGCAAATGTTCGTTGGATT+TGG | + | contig619end:10183-10202 | MsG0080049029.01.T01:exon | 40.0% | |
TGGTGAATGTTGTGATTGTG+TGG | + | contig619end:14315-14334 | MsG0080049029.01.T01:intron | 40.0% | |
TGGTTGGGAATCGTAGAATT+CGG | + | contig619end:11959-11978 | MsG0080049029.01.T01:intron | 40.0% | |
TGTCTGCCATAAACGAAACA+CGG | - | contig619end:15964-15983 | MsG0080049029.01.T01:intergenic | 40.0% | |
TGTTGCAAGATGATAGCAAG+AGG | - | contig619end:11251-11270 | MsG0080049029.01.T01:intergenic | 40.0% | |
TGTTTCGTTTATGGCAGACA+AGG | + | contig619end:15964-15983 | MsG0080049029.01.T01:intron | 40.0% | |
TTTATGGCAGACAAGGATTC+TGG | + | contig619end:15971-15990 | MsG0080049029.01.T01:intron | 40.0% | |
! | AAAGCACCAAGACCTACTAT+CGG | - | contig619end:11771-11790 | MsG0080049029.01.T01:intergenic | 40.0% |
! | AAGCTTGGGTTAGAGAATCT+TGG | + | contig619end:12406-12425 | MsG0080049029.01.T01:intron | 40.0% |
! | AGGCAAGGAATGTCTTTTTC+AGG | - | contig619end:11140-11159 | MsG0080049029.01.T01:intergenic | 40.0% |
! | GGAAGTCAAAATTGGGGTTT+TGG | + | contig619end:13090-13109 | MsG0080049029.01.T01:intron | 40.0% |
! | GGAGGCGCAGTATTTAAAAA+TGG | + | contig619end:10567-10586 | MsG0080049029.01.T01:CDS | 40.0% |
! | TTTTGCGGTCAACCTTTTTC+TGG | + | contig619end:15626-15645 | MsG0080049029.01.T01:CDS | 40.0% |
!! | AACCTTTTTCTGGTAAGCTG+TGG | + | contig619end:15636-15655 | MsG0080049029.01.T01:intron | 40.0% |
!! | CAAAACTGACTTGTAAGGCA+AGG | - | contig619end:11155-11174 | MsG0080049029.01.T01:intergenic | 40.0% |
!! | CAGTTTTGTACGGGTGAATA+AGG | + | contig619end:11167-11186 | MsG0080049029.01.T01:intron | 40.0% |
!! | CCGTACAAAACTGACTTGTA+AGG | - | contig619end:11160-11179 | MsG0080049029.01.T01:intergenic | 40.0% |
!! | CGCTCGTTTCTGTTTTGAAT+TGG | + | contig619end:13293-13312 | MsG0080049029.01.T01:intron | 40.0% |
!! | CGTAGAATTCGGTGTTAGAA+GGG | + | contig619end:11970-11989 | MsG0080049029.01.T01:intron | 40.0% |
!! | GAGCTTTGGGAAGTCAAAAT+TGG | + | contig619end:13082-13101 | MsG0080049029.01.T01:intron | 40.0% |
!! | GATTTTGGGAAATCTTGCTC+TGG | + | contig619end:10710-10729 | MsG0080049029.01.T01:CDS | 40.0% |
!! | GCTTTGGGAAGTCAAAATTG+GGG | + | contig619end:13084-13103 | MsG0080049029.01.T01:intron | 40.0% |
!! | GGGCATTTTGGTCATTTTGA+GGG | + | contig619end:12016-12035 | MsG0080049029.01.T01:intron | 40.0% |
!! | TCGTAGAATTCGGTGTTAGA+AGG | + | contig619end:11969-11988 | MsG0080049029.01.T01:intron | 40.0% |
!! | TGTTAGCTTTCCAATGGCTT+TGG | + | contig619end:13350-13369 | MsG0080049029.01.T01:intron | 40.0% |
!! | TTAGAGAATCTTGGTGCTAG+AGG | + | contig619end:12415-12434 | MsG0080049029.01.T01:intron | 40.0% |
!! | TTAGTACCGATAGTAGGTCT+TGG | + | contig619end:11762-11781 | MsG0080049029.01.T01:CDS | 40.0% |
!! | TTTCAAGTTGAGAGCATGCA+GGG | + | contig619end:10527-10546 | MsG0080049029.01.T01:intron | 40.0% |
!!! | CATTTGCCACGTTGGTTTTA+AGG | - | contig619end:10172-10191 | MsG0080049029.01.T01:intergenic | 40.0% |
!!! | CCTCTGTGTGTATTTTTGGT+TGG | + | contig619end:11943-11962 | MsG0080049029.01.T01:intron | 40.0% |
!!! | TTTTGGACTTAGGGGCATTT+TGG | + | contig619end:12004-12023 | MsG0080049029.01.T01:intron | 40.0% |
AAAAGAGGAACTCCACTCCT+CGG | - | contig619end:15037-15056 | MsG0080049028.01.T01:intergenic | 45.0% | |
AACACCGCAAAGATCTGTGT+GGG | - | contig619end:11744-11763 | MsG0080049028.01.T01:intergenic | 45.0% | |
AAGGGTCCTTAAAACCAACG+TGG | + | contig619end:10163-10182 | MsG0080049029.01.T01:exon | 45.0% | |
ACATCATAAGGTGACGACCT+TGG | + | contig619end:14175-14194 | MsG0080049029.01.T01:intron | 45.0% | |
AGAACAAGTGCAAGGGTTAG+AGG | + | contig619end:12351-12370 | MsG0080049029.01.T01:intron | 45.0% | |
AGGTAAGACGCGTCTATGAT+AGG | + | contig619end:11090-11109 | MsG0080049029.01.T01:intron | 45.0% | |
ATGAGGCAAATACTCCAAGG+TGG | + | contig619end:13406-13425 | MsG0080049029.01.T01:intron | 45.0% | |
CAAATACTCCAAGGTGGTCT+TGG | + | contig619end:13412-13431 | MsG0080049029.01.T01:intron | 45.0% | |
CTAAGTCGACCCAAACCTTA+TGG | + | contig619end:13467-13486 | MsG0080049029.01.T01:intron | 45.0% | |
CTACACCCTCTCTAGTAACT+TGG | - | contig619end:12107-12126 | MsG0080049029.01.T01:intergenic | 45.0% | |
CTCTCAATGACTGGACAACT+TGG | + | contig619end:10750-10769 | MsG0080049029.01.T01:CDS | 45.0% | |
CTTGAGAGGATACATGGCAT+AGG | + | contig619end:13701-13720 | MsG0080049029.01.T01:intron | 45.0% | |
GATGCAAGAACGTGAAACAG+GGG | - | contig619end:13268-13287 | MsG0080049029.01.T01:intergenic | 45.0% | |
GATGTAATGCTAACCCTCAG+TGG | + | contig619end:14936-14955 | MsG0080049029.01.T01:intron | 45.0% | |
GCAAGAGGGATTCATCATCT+AGG | + | contig619end:12373-12392 | MsG0080049029.01.T01:intron | 45.0% | |
GCACATATGTGTGACTTGAG+AGG | + | contig619end:13687-13706 | MsG0080049029.01.T01:intron | 45.0% | |
GGGTGTATGTGGGAAGAAAA+GGG | + | contig619end:10588-10607 | MsG0080049029.01.T01:CDS | 45.0% | |
GGTAAGACGCGTCTATGATA+GGG | + | contig619end:11091-11110 | MsG0080049029.01.T01:intron | 45.0% | |
GGTGTATGTGGGAAGAAAAG+GGG | + | contig619end:10589-10608 | MsG0080049029.01.T01:CDS | 45.0% | |
GTGTGACTTGAGAGGATACA+TGG | + | contig619end:13695-13714 | MsG0080049029.01.T01:intron | 45.0% | |
TAACACAGCAGTAAGGTTGC+TGG | - | contig619end:11220-11239 | MsG0080049029.01.T01:intergenic | 45.0% | |
TAACACCGCAAAGATCTGTG+TGG | - | contig619end:11745-11764 | MsG0080049029.01.T01:intergenic | 45.0% | |
TCTCTCTCTCTTGGTTTCCT+AGG | + | contig619end:10812-10831 | MsG0080049029.01.T01:intron | 45.0% | |
TCTCTGTATGGATGGGTAGA+CGG | + | contig619end:14979-14998 | MsG0080049029.01.T01:intron | 45.0% | |
TGGGTGTATGTGGGAAGAAA+AGG | + | contig619end:10587-10606 | MsG0080049029.01.T01:CDS | 45.0% | |
! | CTAGATTAGGGCTCTGATCT+AGG | + | contig619end:15069-15088 | MsG0080049029.01.T01:intron | 45.0% |
! | GGATTCAATAATGGTGGAGG+TGG | + | contig619end:10660-10679 | MsG0080049029.01.T01:CDS | 45.0% |
! | GGTAGCACTGCTAGGATTTT+GGG | + | contig619end:10696-10715 | MsG0080049029.01.T01:CDS | 45.0% |
! | TGGTAGCACTGCTAGGATTT+TGG | + | contig619end:10695-10714 | MsG0080049029.01.T01:CDS | 45.0% |
! | TGTGATGCTAGTGTTCTAGG+AGG | + | contig619end:14726-14745 | MsG0080049029.01.T01:intron | 45.0% |
! | TTCAATAATGGTGGAGGTGG+TGG | + | contig619end:10663-10682 | MsG0080049029.01.T01:CDS | 45.0% |
! | TTGCAGTTGTGCCCATTTTG+CGG | + | contig619end:15611-15630 | MsG0080049029.01.T01:CDS | 45.0% |
!! | AGAGAGAGAGAGTACCCAAA+TGG | - | contig619end:10799-10818 | MsG0080049029.01.T01:intergenic | 45.0% |
!! | ATCTTGGTGCTAGAGGTAAG+AGG | + | contig619end:12422-12441 | MsG0080049029.01.T01:intron | 45.0% |
!! | GAAATGGGTTAGGCCCATTA+AGG | + | contig619end:12209-12228 | MsG0080049029.01.T01:intron | 45.0% |
!! | GGGGCATTTTGGTCATTTTG+AGG | + | contig619end:12015-12034 | MsG0080049029.01.T01:intron | 45.0% |
!! | GTGATGCTAGTGTTCTAGGA+GGG | + | contig619end:14727-14746 | MsG0080049029.01.T01:intron | 45.0% |
!! | GTTTCAAGTTGAGAGCATGC+AGG | + | contig619end:10526-10545 | MsG0080049029.01.T01:intron | 45.0% |
!! | TCTTGGTGCTAGAGGTAAGA+GGG | + | contig619end:12423-12442 | MsG0080049029.01.T01:intron | 45.0% |
!! | TTTGGTCATTTTGAGGGCAG+TGG | + | contig619end:12022-12041 | MsG0080049029.01.T01:intron | 45.0% |
!!! | AGGGAGAGGTGCTCTTTTTT+GGG | + | contig619end:10546-10565 | MsG0080049029.01.T01:intron | 45.0% |
ACCCATCCATACAGAGAGGT+AGG | - | contig619end:14976-14995 | MsG0080049029.01.T01:intergenic | 50.0% | |
CAATGACTGGACAACTTGGC+TGG | + | contig619end:10754-10773 | MsG0080049029.01.T01:CDS | 50.0% | |
CATCCATACAGAGAGGTAGG+CGG | - | contig619end:14973-14992 | MsG0080049029.01.T01:intergenic | 50.0% | |
CCAACGAACATTTGCCACGT+TGG | - | contig619end:10180-10199 | MsG0080049029.01.T01:intergenic | 50.0% | |
CCAACGTGGCAAATGTTCGT+TGG | + | contig619end:10177-10196 | MsG0080049029.01.T01:exon | 50.0% | |
GAAATCTTGCTCTGGCTGCT+GGG | + | contig619end:10718-10737 | MsG0080049029.01.T01:CDS | 50.0% | |
GCCTACCTCTCTGTATGGAT+GGG | + | contig619end:14972-14991 | MsG0080049029.01.T01:intron | 50.0% | |
GCGAGTAGATTTACTCGCCA+CGG | + | contig619end:13221-13240 | MsG0080049029.01.T01:intron | 50.0% | |
GGATAGGGGGAGATTCTACA+AGG | - | contig619end:11344-11363 | MsG0080049029.01.T01:intergenic | 50.0% | |
GGTACTCTCTCTCTCTCTCT+TGG | + | contig619end:10803-10822 | MsG0080049029.01.T01:intron | 50.0% | |
GTCTACCCATCCATACAGAG+AGG | - | contig619end:14980-14999 | MsG0080049029.01.T01:intergenic | 50.0% | |
GTGCAAGAGGGAAAAGAGAG+TGG | + | contig619end:10611-10630 | MsG0080049029.01.T01:CDS | 50.0% | |
TCATAAGGTGACGACCTTGG+AGG | + | contig619end:14178-14197 | MsG0080049029.01.T01:intron | 50.0% | |
TGCAAGGGTTAGAGGCAAGA+GGG | + | contig619end:12359-12378 | MsG0080049029.01.T01:intron | 50.0% | |
TGTGGTACCAAACTCCTCCA+AGG | - | contig619end:14195-14214 | MsG0080049029.01.T01:intergenic | 50.0% | |
! | GAGATGATGGTAGCACTGCT+AGG | + | contig619end:10688-10707 | MsG0080049029.01.T01:CDS | 50.0% |
! | GGAAGAAAAGGGGTGCAAGA+GGG | + | contig619end:10599-10618 | MsG0080049029.01.T01:CDS | 50.0% |
! | GTTGTTGCTTGTTGATGCCG+AGG | + | contig619end:15017-15036 | MsG0080049029.01.T01:intron | 50.0% |
!! | ATGCTAGTGTTCTAGGAGGG+AGG | + | contig619end:14730-14749 | MsG0080049029.01.T01:intron | 50.0% |
!! | GCGGTGTTAGTACCGATAGT+AGG | + | contig619end:11756-11775 | MsG0080049029.01.T01:CDS | 50.0% |
!! | TAGGTCTTGGTGCTTTCCTC+TGG | + | contig619end:11775-11794 | MsG0080049029.01.T01:CDS | 50.0% |
!! | TCTTGGTGCTTTCCTCTGGT+GGG | + | contig619end:11779-11798 | MsG0080049029.01.T01:CDS | 50.0% |
!! | TGCTAGTGTTCTAGGAGGGA+GGG | + | contig619end:14731-14750 | MsG0080049029.01.T01:intron | 50.0% |
!!! | CAGGGAGAGGTGCTCTTTTT+TGG | + | contig619end:10545-10564 | MsG0080049029.01.T01:intron | 50.0% |
!!! | GAGAGGTGCTCTTTTTTGGG+AGG | + | contig619end:10549-10568 | MsG0080049029.01.T01:CDS | 50.0% |
CGCCTACCTCTCTGTATGGA+TGG | + | contig619end:14971-14990 | MsG0080049029.01.T01:intron | 55.0% | |
GGAAATCTTGCTCTGGCTGC+TGG | + | contig619end:10717-10736 | MsG0080049029.01.T01:CDS | 55.0% | |
GGCGAGTAAATCTACTCGCG+AGG | - | contig619end:13220-13239 | MsG0080049029.01.T01:intergenic | 55.0% | |
GTGACGACCTTGGAGGAGTT+TGG | + | contig619end:14185-14204 | MsG0080049029.01.T01:intron | 55.0% | |
GTGCAAGGGTTAGAGGCAAG+AGG | + | contig619end:12358-12377 | MsG0080049029.01.T01:intron | 55.0% | |
TAACCCTCAGTGGTCTGTGG+TGG | + | contig619end:14946-14965 | MsG0080049029.01.T01:intron | 55.0% | |
TGCTAACCCTCAGTGGTCTG+TGG | + | contig619end:14943-14962 | MsG0080049029.01.T01:intron | 55.0% | |
! | AGTTGAGAGCATGCAGGGAG+AGG | + | contig619end:10532-10551 | MsG0080049029.01.T01:intron | 55.0% |
! | GGGAAGAAAAGGGGTGCAAG+AGG | + | contig619end:10598-10617 | MsG0080049029.01.T01:CDS | 55.0% |
! | TGCTTGTTGATGCCGAGGAG+TGG | + | contig619end:15022-15041 | MsG0080049029.01.T01:intron | 55.0% |
!! | GGAGGTGGTGGAAGAGATGA+TGG | + | contig619end:10675-10694 | MsG0080049029.01.T01:CDS | 55.0% |
!! | GTCTTGGTGCTTTCCTCTGG+TGG | + | contig619end:11778-11797 | MsG0080049029.01.T01:CDS | 55.0% |
GGACCGCCTACCTCTCTGTA+TGG | + | contig619end:14967-14986 | MsG0080049029.01.T01:intron | 60.0% | |
GGTCCACCACAGACCACTGA+GGG | - | contig619end:14952-14971 | MsG0080049029.01.T01:intergenic | 60.0% | |
TATCTCGACCTGCCCACCAG+AGG | - | contig619end:11794-11813 | MsG0080049029.01.T01:intergenic | 60.0% | |
!!! | AGGCGAGCAGGAGGTGCTTT+TGG | + | contig619end:13182-13201 | MsG0080049029.01.T01:intron | 60.0% |
AACTCGCCACAGCGAGTGGG+AGG | + | contig619end:13151-13170 | MsG0080049029.01.T01:intron | 65.0% | |
AACTCGCCTCCCACTCGCTG+TGG | - | contig619end:13160-13179 | MsG0080049029.01.T01:intergenic | 65.0% | |
ACAGCGAGTGGGAGGCGAGT+TGG | + | contig619end:13159-13178 | MsG0080049029.01.T01:intron | 65.0% | |
CCCAACTCGCCACAGCGAGT+GGG | + | contig619end:13148-13167 | MsG0080049029.01.T01:intron | 65.0% | |
CCCACTCGCTGTGGCGAGTT+GGG | - | contig619end:13151-13170 | MsG0080049029.01.T01:intergenic | 65.0% | |
CGGTCCACCACAGACCACTG+AGG | - | contig619end:14953-14972 | MsG0080049029.01.T01:intergenic | 65.0% | |
TCCCAACTCGCCACAGCGAG+TGG | + | contig619end:13147-13166 | MsG0080049029.01.T01:intron | 65.0% | |
TCCCACTCGCTGTGGCGAGT+TGG | - | contig619end:13152-13171 | MsG0080049029.01.T01:intergenic | 65.0% | |
TGGATGGGTAGACGGCGTGC+AGG | + | contig619end:14987-15006 | MsG0080049029.01.T01:intron | 65.0% | |
TGTCACTGTGCAGCTCGCCG+TGG | - | contig619end:13241-13260 | MsG0080049029.01.T01:intergenic | 65.0% | |
! | GGTGCTTTCCTCTGGTGGGC+AGG | + | contig619end:11783-11802 | MsG0080049029.01.T01:CDS | 65.0% |
! | GAGGCGAGTTGGAGGCGAGC+AGG | + | contig619end:13170-13189 | MsG0080049029.01.T01:intron | 70.0% |
! | GCGAGTGGGAGGCGAGTTGG+AGG | + | contig619end:13162-13181 | MsG0080049029.01.T01:intron | 70.0% |
! | GCGAGTTGGAGGCGAGCAGG+AGG | + | contig619end:13173-13192 | MsG0080049029.01.T01:intron | 70.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
contig619end | gene | 10116 | 16240 | 10116 | ID=MsG0080049029.01; |
contig619end | mRNA | 10116 | 16240 | 10116 | ID=MsG0080049029.01.T01;Parent=MsG0080049029.01 |
contig619end | exon | 10116 | 10217 | 10116 | ID=MsG0080049029.01.T01.exon;Parent=MsG0080049029.01.T01 |
contig619end | CDS | 10189 | 10217 | 10189 | ID=MsG0080049029.01.T01.cds;Parent=MsG0080049029.01.T01 |
contig619end | CDS | 10548 | 10803 | 10548 | ID=MsG0080049029.01.T01.cds;Parent=MsG0080049029.01.T01 |
contig619end | exon | 10548 | 10803 | 10548 | ID=MsG0080049029.01.T01.exon;Parent=MsG0080049029.01.T01 |
contig619end | CDS | 11750 | 11827 | 11750 | ID=MsG0080049029.01.T01.cds;Parent=MsG0080049029.01.T01 |
contig619end | exon | 11750 | 11827 | 11750 | ID=MsG0080049029.01.T01.exon;Parent=MsG0080049029.01.T01 |
contig619end | CDS | 15451 | 15485 | 15451 | ID=MsG0080049029.01.T01.cds;Parent=MsG0080049029.01.T01 |
contig619end | exon | 15451 | 15485 | 15451 | ID=MsG0080049029.01.T01.exon;Parent=MsG0080049029.01.T01 |
contig619end | CDS | 15592 | 15647 | 15592 | ID=MsG0080049029.01.T01.cds;Parent=MsG0080049029.01.T01 |
contig619end | exon | 15592 | 15647 | 15592 | ID=MsG0080049029.01.T01.exon;Parent=MsG0080049029.01.T01 |
contig619end | CDS | 15765 | 15860 | 15765 | ID=MsG0080049029.01.T01.cds;Parent=MsG0080049029.01.T01 |
contig619end | exon | 15765 | 15860 | 15765 | ID=MsG0080049029.01.T01.exon;Parent=MsG0080049029.01.T01 |
contig619end | CDS | 15981 | 16036 | 15981 | ID=MsG0080049029.01.T01.cds;Parent=MsG0080049029.01.T01 |
contig619end | exon | 15981 | 16240 | 15981 | ID=MsG0080049029.01.T01.exon;Parent=MsG0080049029.01.T01 |
Gene Sequence |
Protein sequence |