Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048595.01.T01 | RHN46510.1 | 96.501 | 343 | 12 | 0 | 33 | 375 | 160 | 502 | 0 | 689 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048595.01.T01 | Q9FFT4 | 85.423 | 343 | 50 | 0 | 33 | 375 | 178 | 520 | 0 | 620 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048595.01.T01 | A0A396GZS6 | 96.501 | 343 | 12 | 0 | 33 | 375 | 160 | 502 | 0.0 | 689 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080047831.01 | MsG0080048595.01 | 0.832162 | 1.106493e-55 | 1.226603e-52 |
MsG0080048202.01 | MsG0080048595.01 | 0.826103 | 3.259373e-54 | 3.027656e-51 |
MsG0080048595.01 | MsG0080048597.01 | 0.923081 | 4.246464e-89 | 1.666107e-84 |
MsG0080048595.01 | MsG0080048889.01 | 0.864630 | 1.058965e-64 | 3.348092e-61 |
MsG0080048595.01 | MsG0080048896.01 | -0.803147 | 4.004949e-49 | 1.997548e-46 |
MsG0080048595.01 | MsG0080048992.01 | -0.846692 | 1.850981e-59 | 3.212496e-56 |
MsG0080048595.01 | MsG0080049018.01 | -0.802044 | 6.760691e-49 | 3.278615e-46 |
MsG0080048595.01 | MsG0080049023.01 | -0.850076 | 2.145577e-60 | 4.153382e-57 |
MsG0080048595.01 | MsG0080049038.01 | -0.803242 | 3.827591e-49 | 1.913760e-46 |
MsG0080048595.01 | MsG0080049066.01 | -0.825181 | 5.391407e-54 | 4.878805e-51 |
MsG0080048595.01 | MsG0080049133.01 | -0.846509 | 2.077386e-59 | 3.584136e-56 |
MsG0080048595.01 | MsG0180000322.01 | -0.832138 | 1.121294e-55 | 1.242156e-52 |
MsG0080048595.01 | MsG0180000367.01 | 0.842826 | 2.039648e-58 | 3.130089e-55 |
MsG0080048595.01 | MsG0180000423.01 | -0.802145 | 6.446180e-49 | 3.134154e-46 |
MsG0080048595.01 | MsG0180000466.01 | 0.809740 | 1.629479e-50 | 9.644739e-48 |
MsG0080048595.01 | MsG0180000552.01 | 0.800202 | 1.609569e-48 | 7.449774e-46 |
MsG0080048595.01 | MsG0180000556.01 | 0.857263 | 1.838528e-62 | 4.510873e-59 |
MsG0080048595.01 | MsG0180000583.01 | 0.824722 | 6.919269e-54 | 6.179922e-51 |
MsG0080048595.01 | MsG0180000719.01 | -0.843280 | 1.543836e-58 | 2.403618e-55 |
MsG0080048595.01 | MsG0180001054.01 | -0.840228 | 9.868953e-58 | 1.396714e-54 |
MsG0080048595.01 | MsG0180001484.01 | -0.822626 | 2.142370e-53 | 1.802964e-50 |
MsG0080048595.01 | MsG0180001513.01 | 0.815621 | 8.417405e-52 | 5.833131e-49 |
MsG0080048595.01 | MsG0180001614.01 | -0.837928 | 3.890732e-57 | 5.130863e-54 |
MsG0080048595.01 | MsG0180001615.01 | -0.803023 | 4.247981e-49 | 2.112000e-46 |
MsG0080048595.01 | MsG0180002099.01 | -0.837317 | 5.583299e-57 | 7.225174e-54 |
MsG0080048595.01 | MsG0180002214.01 | -0.817146 | 3.836595e-52 | 2.771742e-49 |
MsG0080048595.01 | MsG0180002425.01 | -0.824565 | 7.536112e-54 | 6.700141e-51 |
MsG0080048595.01 | MsG0180002809.01 | -0.800939 | 1.138964e-48 | 5.371330e-46 |
MsG0080048595.01 | MsG0180002935.01 | 0.812700 | 3.715407e-51 | 2.378717e-48 |
MsG0080048595.01 | MsG0180003235.01 | 0.820660 | 6.100895e-53 | 4.856669e-50 |
MsG0080048595.01 | MsG0180003324.01 | -0.806961 | 6.380009e-50 | 3.509727e-47 |
MsG0080048595.01 | MsG0180003372.01 | 0.800557 | 1.363249e-48 | 6.366791e-46 |
MsG0080048595.01 | MsG0180003757.01 | -0.836458 | 9.246597e-57 | 1.166017e-53 |
MsG0080048595.01 | MsG0180003758.01 | -0.811750 | 5.987904e-51 | 3.737238e-48 |
MsG0080048595.01 | MsG0180003880.01 | -0.806121 | 9.593495e-50 | 5.165252e-47 |
MsG0080048595.01 | MsG0180004058.01 | 0.827672 | 1.374869e-54 | 1.336293e-51 |
MsG0080048595.01 | MsG0180004124.01 | -0.822116 | 2.813186e-53 | 2.333031e-50 |
MsG0080048595.01 | MsG0180004125.01 | -0.821618 | 3.668642e-53 | 2.999642e-50 |
MsG0080048595.01 | MsG0180004322.01 | -0.833517 | 5.095921e-56 | 5.882743e-53 |
MsG0080048595.01 | MsG0180004453.01 | 0.826480 | 2.650620e-54 | 2.488681e-51 |
MsG0080048595.01 | MsG0180004502.01 | -0.857452 | 1.617058e-62 | 3.993144e-59 |
MsG0080048595.01 | MsG0180004553.01 | -0.810263 | 1.257462e-50 | 7.544931e-48 |
MsG0080048595.01 | MsG0180004580.01 | -0.821645 | 3.617361e-53 | 2.960016e-50 |
MsG0080048595.01 | MsG0180004581.01 | -0.837499 | 5.015019e-57 | 6.527029e-54 |
MsG0080048595.01 | MsG0180004737.01 | -0.811665 | 6.250311e-51 | 3.891924e-48 |
MsG0080048595.01 | MsG0180004773.01 | -0.860213 | 2.415820e-63 | 6.553296e-60 |
MsG0080048595.01 | MsG0180004942.01 | 0.801090 | 1.060797e-48 | 5.022071e-46 |
MsG0080048595.01 | MsG0180004957.01 | -0.820211 | 7.730932e-53 | 6.078814e-50 |
MsG0080048595.01 | MsG0180005328.01 | 0.808134 | 3.595548e-50 | 2.039465e-47 |
MsG0080048595.01 | MsG0180005353.01 | 0.801935 | 7.118293e-49 | 3.442466e-46 |
MsG0080048595.01 | MsG0180005369.01 | -0.810526 | 1.103262e-50 | 6.665708e-48 |
MsG0080048595.01 | MsG0180005542.01 | 0.803840 | 2.876936e-49 | 1.460783e-46 |
MsG0080048595.01 | MsG0180005632.01 | 0.817770 | 2.776054e-52 | 2.040211e-49 |
MsG0080048595.01 | MsG0180005833.01 | -0.802224 | 6.208251e-49 | 3.024535e-46 |
MsG0080048595.01 | MsG0180005848.01 | -0.807893 | 4.045865e-50 | 2.280249e-47 |
MsG0080048595.01 | MsG0180005984.01 | 0.847504 | 1.109255e-59 | 1.975816e-56 |
MsG0080048595.01 | MsG0180006212.01 | -0.834354 | 3.146673e-56 | 3.724932e-53 |
MsG0080048595.01 | MsG0180006227.01 | -0.841368 | 4.956584e-58 | 7.267222e-55 |
MsG0080048595.01 | MsG0280006381.01 | -0.842792 | 2.083179e-58 | 3.193407e-55 |
MsG0080048595.01 | MsG0280006402.01 | -0.803975 | 2.696920e-49 | 1.374149e-46 |
MsG0080048595.01 | MsG0280006534.01 | -0.857538 | 1.525021e-62 | 3.776581e-59 |
MsG0080048595.01 | MsG0280006606.01 | 0.800951 | 1.132450e-48 | 5.342287e-46 |
MsG0080048595.01 | MsG0280006853.01 | 0.829660 | 4.545084e-55 | 4.682272e-52 |
MsG0080048595.01 | MsG0280006855.01 | 0.847968 | 8.264994e-60 | 1.493952e-56 |
MsG0080048595.01 | MsG0280006883.01 | 0.815857 | 7.458122e-52 | 5.201064e-49 |
MsG0080048595.01 | MsG0280006973.01 | -0.826132 | 3.208083e-54 | 2.982540e-51 |
MsG0080048595.01 | MsG0280007016.01 | -0.819811 | 9.544051e-53 | 7.421715e-50 |
MsG0080048595.01 | MsG0280007017.01 | -0.823448 | 1.378025e-53 | 1.186795e-50 |
MsG0080048595.01 | MsG0280007163.01 | 0.858287 | 9.134846e-63 | 2.319736e-59 |
MsG0080048595.01 | MsG0280007201.01 | 0.807398 | 5.154423e-50 | 2.868041e-47 |
MsG0080048595.01 | MsG0280007216.01 | 0.804246 | 2.368823e-49 | 1.215288e-46 |
MsG0080048595.01 | MsG0280007227.01 | 0.812619 | 3.870480e-51 | 2.472694e-48 |
MsG0080048595.01 | MsG0280007291.01 | -0.805064 | 1.598376e-49 | 8.375555e-47 |
MsG0080048595.01 | MsG0280007426.01 | 0.823152 | 1.615776e-53 | 1.380076e-50 |
MsG0080048595.01 | MsG0280007505.01 | 0.828851 | 7.145596e-55 | 7.187415e-52 |
MsG0080048595.01 | MsG0280007649.01 | -0.800859 | 1.182619e-48 | 5.565943e-46 |
MsG0080048595.01 | MsG0280007650.01 | -0.800986 | 1.114265e-48 | 5.261331e-46 |
MsG0080048595.01 | MsG0280007911.01 | 0.817619 | 3.001265e-52 | 2.196553e-49 |
MsG0080048595.01 | MsG0280007912.01 | 0.815439 | 9.238736e-52 | 6.370055e-49 |
MsG0080048595.01 | MsG0280008263.01 | 0.831258 | 1.848369e-55 | 1.994948e-52 |
MsG0080048595.01 | MsG0280008405.01 | 0.817094 | 3.940125e-52 | 2.842483e-49 |
MsG0080048595.01 | MsG0280009079.01 | -0.840725 | 7.313463e-58 | 1.051096e-54 |
MsG0080048595.01 | MsG0280009094.01 | -0.853037 | 3.113111e-61 | 6.636058e-58 |
MsG0080048595.01 | MsG0280009167.01 | 0.839379 | 1.640954e-57 | 2.262200e-54 |
MsG0080048595.01 | MsG0280009432.01 | 0.809000 | 2.348471e-50 | 1.362772e-47 |
MsG0080048595.01 | MsG0280009518.01 | -0.801464 | 8.895154e-49 | 4.250710e-46 |
MsG0080048595.01 | MsG0280009526.01 | 0.814715 | 1.337766e-51 | 9.043796e-49 |
MsG0080048595.01 | MsG0280009742.01 | -0.849897 | 2.406658e-60 | 4.631520e-57 |
MsG0080048595.01 | MsG0280009776.01 | -0.812047 | 5.160295e-51 | 3.246279e-48 |
MsG0080048595.01 | MsG0280009864.01 | -0.808216 | 3.453343e-50 | 1.963145e-47 |
MsG0080048595.01 | MsG0280010019.01 | 0.880007 | 7.820047e-70 | 4.334975e-66 |
MsG0080048595.01 | MsG0280010047.01 | 0.866474 | 2.776269e-65 | 9.368761e-62 |
MsG0080048595.01 | MsG0280010053.01 | 0.821495 | 3.916187e-53 | 3.191073e-50 |
MsG0080048595.01 | MsG0280010055.01 | 0.834129 | 3.583840e-56 | 4.213515e-53 |
MsG0080048595.01 | MsG0280010461.01 | -0.827923 | 1.196609e-54 | 1.171617e-51 |
MsG0080048595.01 | MsG0280010663.01 | 0.803980 | 2.690389e-49 | 1.371016e-46 |
MsG0080048595.01 | MsG0280010802.01 | 0.808960 | 2.396001e-50 | 1.388867e-47 |
MsG0080048595.01 | MsG0280010944.01 | 0.803253 | 3.806966e-49 | 1.904040e-46 |
MsG0080048595.01 | MsG0280010994.01 | -0.842990 | 1.844884e-58 | 2.845630e-55 |
MsG0080048595.01 | MsG0280011165.01 | 0.818443 | 1.955175e-52 | 1.463876e-49 |
MsG0080048595.01 | MsG0280011238.01 | 0.815174 | 1.058005e-51 | 7.241306e-49 |
MsG0080048595.01 | MsG0280011267.01 | 0.817335 | 3.478703e-52 | 2.526225e-49 |
MsG0080048595.01 | MsG0280011281.01 | -0.826172 | 3.139131e-54 | 2.921739e-51 |
MsG0080048595.01 | MsG0280011301.01 | -0.826199 | 3.091844e-54 | 2.880049e-51 |
MsG0080048595.01 | MsG0280011475.01 | -0.866426 | 2.876363e-65 | 9.689991e-62 |
MsG0080048595.01 | MsG0380011635.01 | 0.807019 | 6.201139e-50 | 3.416508e-47 |
MsG0080048595.01 | MsG0380011974.01 | 0.813878 | 2.047544e-51 | 1.353222e-48 |
MsG0080048595.01 | MsG0380012157.01 | -0.821900 | 3.157830e-53 | 2.602867e-50 |
MsG0080048595.01 | MsG0380012281.01 | -0.828601 | 8.212883e-55 | 8.202031e-52 |
MsG0080048595.01 | MsG0380012444.01 | -0.824502 | 7.797795e-54 | 6.919524e-51 |
MsG0080048595.01 | MsG0380013114.01 | -0.822394 | 2.425246e-53 | 2.027580e-50 |
MsG0080048595.01 | MsG0380013272.01 | 0.827036 | 1.952369e-54 | 1.862786e-51 |
MsG0080048595.01 | MsG0380013473.01 | -0.816363 | 5.747766e-52 | 4.064501e-49 |
MsG0080048595.01 | MsG0380013506.01 | -0.800114 | 1.677438e-48 | 7.746490e-46 |
MsG0080048595.01 | MsG0380014231.01 | -0.800879 | 1.171812e-48 | 5.517873e-46 |
MsG0080048595.01 | MsG0380014639.01 | -0.846145 | 2.610626e-59 | 4.450646e-56 |
MsG0080048595.01 | MsG0380014642.01 | -0.836474 | 9.163959e-57 | 1.156124e-53 |
MsG0080048595.01 | MsG0380014735.01 | -0.827310 | 1.679063e-54 | 1.615013e-51 |
MsG0080048595.01 | MsG0380015080.01 | 0.806963 | 6.372431e-50 | 3.505728e-47 |
MsG0080048595.01 | MsG0380015110.01 | 0.830273 | 3.221839e-55 | 3.378348e-52 |
MsG0080048595.01 | MsG0380015200.01 | -0.825395 | 4.799762e-54 | 4.369340e-51 |
MsG0080048595.01 | MsG0380015201.01 | -0.856742 | 2.618861e-62 | 6.312441e-59 |
MsG0080048595.01 | MsG0380015271.01 | -0.815039 | 1.133631e-51 | 7.731055e-49 |
MsG0080048595.01 | MsG0380015348.01 | -0.802975 | 4.346652e-49 | 2.158416e-46 |
MsG0080048595.01 | MsG0380015369.01 | 0.833939 | 3.997443e-56 | 4.673776e-53 |
MsG0080048595.01 | MsG0380015417.01 | -0.811700 | 6.140471e-51 | 3.827214e-48 |
MsG0080048595.01 | MsG0380015572.01 | 0.820620 | 6.229916e-53 | 4.953907e-50 |
MsG0080048595.01 | MsG0380015619.01 | -0.812426 | 4.265253e-51 | 2.711218e-48 |
MsG0080048595.01 | MsG0380015752.01 | -0.819192 | 1.321090e-52 | 1.009682e-49 |
MsG0080048595.01 | MsG0380015809.01 | 0.800419 | 1.454120e-48 | 6.767801e-46 |
MsG0080048595.01 | MsG0380015828.01 | -0.816953 | 4.238668e-52 | 3.046391e-49 |
MsG0080048595.01 | MsG0380016031.01 | 0.848642 | 5.380189e-60 | 9.938699e-57 |
MsG0080048595.01 | MsG0380016229.01 | -0.807933 | 3.966787e-50 | 2.238094e-47 |
MsG0080048595.01 | MsG0380016456.01 | -0.808229 | 3.431400e-50 | 1.951302e-47 |
MsG0080048595.01 | MsG0380016476.01 | 0.805653 | 1.203254e-49 | 6.401238e-47 |
MsG0080048595.01 | MsG0380016492.01 | -0.805578 | 1.247586e-49 | 6.624135e-47 |
MsG0080048595.01 | MsG0380016790.01 | -0.805620 | 1.222269e-49 | 6.496796e-47 |
MsG0080048595.01 | MsG0380016835.01 | -0.816003 | 6.917902e-52 | 4.843893e-49 |
MsG0080048595.01 | MsG0380016881.01 | -0.827218 | 1.766665e-54 | 1.694640e-51 |
MsG0080048595.01 | MsG0380016889.01 | -0.832915 | 7.198156e-56 | 8.160601e-53 |
MsG0080048595.01 | MsG0380016896.01 | -0.813745 | 2.190457e-51 | 1.442388e-48 |
MsG0080048595.01 | MsG0380016934.01 | -0.816114 | 6.535087e-52 | 4.589857e-49 |
MsG0080048595.01 | MsG0380016935.01 | -0.833091 | 6.506825e-56 | 7.416735e-53 |
MsG0080048595.01 | MsG0380016960.01 | -0.800639 | 1.311278e-48 | 6.136938e-46 |
MsG0080048595.01 | MsG0380017141.01 | -0.812131 | 4.947812e-51 | 3.119933e-48 |
MsG0080048595.01 | MsG0380017405.01 | -0.851392 | 9.145905e-61 | 1.848545e-57 |
MsG0080048595.01 | MsG0380017406.01 | -0.818593 | 1.807859e-52 | 1.358991e-49 |
MsG0080048595.01 | MsG0380017566.01 | -0.822280 | 2.577758e-53 | 2.147947e-50 |
MsG0080048595.01 | MsG0380017610.01 | 0.847338 | 1.232210e-59 | 2.182912e-56 |
MsG0080048595.01 | MsG0380017695.01 | 0.808232 | 3.426770e-50 | 1.948791e-47 |
MsG0080048595.01 | MsG0380017812.01 | -0.822303 | 2.545721e-53 | 2.122667e-50 |
MsG0080048595.01 | MsG0380017928.01 | -0.861401 | 1.053134e-63 | 2.976488e-60 |
MsG0080048595.01 | MsG0380017962.01 | -0.803403 | 3.544364e-49 | 1.779567e-46 |
MsG0080048595.01 | MsG0380018006.01 | 0.811389 | 7.175451e-51 | 4.435782e-48 |
MsG0080048595.01 | MsG0380018035.01 | -0.814901 | 1.216954e-51 | 8.267828e-49 |
MsG0080048595.01 | MsG0380018070.01 | 0.830952 | 2.197640e-55 | 2.350709e-52 |
MsG0080048595.01 | MsG0380018072.01 | -0.808078 | 3.695000e-50 | 2.092794e-47 |
MsG0080048595.01 | MsG0480018088.01 | -0.818247 | 2.165913e-52 | 1.612631e-49 |
MsG0080048595.01 | MsG0480018201.01 | -0.836691 | 8.065535e-57 | 1.024201e-53 |
MsG0080048595.01 | MsG0480018202.01 | -0.838481 | 2.803061e-57 | 3.759317e-54 |
MsG0080048595.01 | MsG0480018203.01 | -0.837487 | 5.048680e-57 | 6.568336e-54 |
MsG0080048595.01 | MsG0480018440.01 | 0.817084 | 3.961115e-52 | 2.856840e-49 |
MsG0080048595.01 | MsG0480018463.01 | -0.814126 | 1.805974e-51 | 1.201559e-48 |
MsG0080048595.01 | MsG0480018494.01 | -0.814854 | 1.246062e-51 | 8.455167e-49 |
MsG0080048595.01 | MsG0480018628.01 | -0.820492 | 6.665443e-53 | 5.281985e-50 |
MsG0080048595.01 | MsG0480019017.01 | 0.862533 | 4.737987e-64 | 1.392172e-60 |
MsG0080048595.01 | MsG0480019171.01 | 0.808964 | 2.390431e-50 | 1.385800e-47 |
MsG0080048595.01 | MsG0480019183.01 | -0.815532 | 8.807874e-52 | 6.088502e-49 |
MsG0080048595.01 | MsG0480019217.01 | 0.811733 | 6.038917e-51 | 3.767444e-48 |
MsG0080048595.01 | MsG0480019304.01 | 0.804572 | 2.025845e-49 | 1.048133e-46 |
MsG0080048595.01 | MsG0480019861.01 | -0.823458 | 1.370570e-53 | 1.180721e-50 |
MsG0080048595.01 | MsG0480020269.01 | -0.806673 | 7.339101e-50 | 4.007285e-47 |
MsG0080048595.01 | MsG0480020958.01 | 0.836518 | 8.927968e-57 | 1.127749e-53 |
MsG0080048595.01 | MsG0480020986.01 | 0.807729 | 4.384978e-50 | 2.460931e-47 |
MsG0080048595.01 | MsG0480021005.01 | 0.837750 | 4.323825e-57 | 5.671350e-54 |
MsG0080048595.01 | MsG0480021151.01 | -0.846622 | 1.934509e-59 | 3.349649e-56 |
MsG0080048595.01 | MsG0480021327.01 | -0.830864 | 2.309841e-55 | 2.464322e-52 |
MsG0080048595.01 | MsG0480021331.01 | -0.815789 | 7.720243e-52 | 5.374591e-49 |
MsG0080048595.01 | MsG0480022201.01 | -0.801071 | 1.070347e-48 | 5.064699e-46 |
MsG0080048595.01 | MsG0480022428.01 | 0.808703 | 2.718693e-50 | 1.565227e-47 |
MsG0080048595.01 | MsG0480022591.01 | -0.813883 | 2.043263e-51 | 1.350526e-48 |
MsG0080048595.01 | MsG0480022721.01 | 0.808694 | 2.730249e-50 | 1.571498e-47 |
MsG0080048595.01 | MsG0480022833.01 | 0.801512 | 8.695568e-49 | 4.160423e-46 |
MsG0080048595.01 | MsG0480022968.01 | 0.803070 | 4.154279e-49 | 2.067872e-46 |
MsG0080048595.01 | MsG0480023056.01 | -0.807279 | 5.461780e-50 | 3.029691e-47 |
MsG0080048595.01 | MsG0480023067.01 | 0.828253 | 9.963101e-55 | 9.849463e-52 |
MsG0080048595.01 | MsG0480023107.01 | 0.814769 | 1.301764e-51 | 8.812332e-49 |
MsG0080048595.01 | MsG0480023152.01 | -0.847510 | 1.105249e-59 | 1.968986e-56 |
MsG0080048595.01 | MsG0480023211.01 | -0.805194 | 1.501336e-49 | 7.893249e-47 |
MsG0080048595.01 | MsG0480023242.01 | -0.805449 | 1.327692e-49 | 7.026278e-47 |
MsG0080048595.01 | MsG0480023244.01 | -0.831451 | 1.657231e-55 | 1.799161e-52 |
MsG0080048595.01 | MsG0480023264.01 | -0.817031 | 4.072344e-52 | 2.932895e-49 |
MsG0080048595.01 | MsG0480023267.01 | 0.812502 | 4.105040e-51 | 2.614504e-48 |
MsG0080048595.01 | MsG0480023303.01 | 0.819978 | 8.742199e-53 | 6.829837e-50 |
MsG0080048595.01 | MsG0480023319.01 | -0.802309 | 5.964134e-49 | 2.912103e-46 |
MsG0080048595.01 | MsG0480023322.01 | 0.805010 | 1.640615e-49 | 8.584772e-47 |
MsG0080048595.01 | MsG0480023376.01 | -0.801004 | 1.104520e-48 | 5.217794e-46 |
MsG0080048595.01 | MsG0480023429.01 | 0.809656 | 1.698546e-50 | 1.003118e-47 |
MsG0080048595.01 | MsG0480023469.01 | -0.802473 | 5.518475e-49 | 2.705615e-46 |
MsG0080048595.01 | MsG0480023482.01 | -0.801085 | 1.063287e-48 | 5.033151e-46 |
MsG0080048595.01 | MsG0480023528.01 | 0.815252 | 1.016717e-51 | 6.973690e-49 |
MsG0080048595.01 | MsG0480023695.01 | -0.867318 | 1.494665e-65 | 5.196720e-62 |
MsG0080048595.01 | MsG0580024220.01 | 0.806485 | 8.041368e-50 | 4.369864e-47 |
MsG0080048595.01 | MsG0580024278.01 | -0.802369 | 5.798010e-49 | 2.835279e-46 |
MsG0080048595.01 | MsG0580024309.01 | -0.840033 | 1.109483e-57 | 1.560898e-54 |
MsG0080048595.01 | MsG0580024398.01 | 0.826450 | 2.695168e-54 | 2.528468e-51 |
MsG0080048595.01 | MsG0580024408.01 | 0.810939 | 8.981452e-51 | 5.487289e-48 |
MsG0080048595.01 | MsG0580024442.01 | -0.806969 | 6.353846e-50 | 3.496111e-47 |
MsG0080048595.01 | MsG0580024493.01 | -0.849846 | 2.487508e-60 | 4.778794e-57 |
MsG0080048595.01 | MsG0580024678.01 | -0.820692 | 5.997709e-53 | 4.778937e-50 |
MsG0080048595.01 | MsG0580024688.01 | -0.813119 | 3.008091e-51 | 1.947249e-48 |
MsG0080048595.01 | MsG0580024768.01 | -0.808435 | 3.101555e-50 | 1.773319e-47 |
MsG0080048595.01 | MsG0580025023.01 | 0.805641 | 1.209918e-49 | 6.434710e-47 |
MsG0080048595.01 | MsG0580025105.01 | -0.822277 | 2.581091e-53 | 2.150540e-50 |
MsG0080048595.01 | MsG0580025317.01 | -0.800481 | 1.412684e-48 | 6.584779e-46 |
MsG0080048595.01 | MsG0580025447.01 | -0.816272 | 6.024531e-52 | 4.249724e-49 |
MsG0080048595.01 | MsG0580025507.01 | 0.804074 | 2.572424e-49 | 1.314044e-46 |
MsG0080048595.01 | MsG0580025961.01 | 0.805553 | 1.262561e-49 | 6.699224e-47 |
MsG0080048595.01 | MsG0580026029.01 | 0.838737 | 2.407706e-57 | 3.254461e-54 |
MsG0080048595.01 | MsG0580026073.01 | -0.857482 | 1.584098e-62 | 3.915478e-59 |
MsG0080048595.01 | MsG0580026362.01 | -0.843075 | 1.751269e-58 | 2.708492e-55 |
MsG0080048595.01 | MsG0580026492.01 | 0.876601 | 1.226575e-68 | 5.982505e-65 |
MsG0080048595.01 | MsG0580027095.01 | -0.815758 | 7.846040e-52 | 5.457495e-49 |
MsG0080048595.01 | MsG0580027135.01 | 0.800300 | 1.537212e-48 | 7.133050e-46 |
MsG0080048595.01 | MsG0580027276.01 | -0.830867 | 2.305738e-55 | 2.460145e-52 |
MsG0080048595.01 | MsG0580027325.01 | -0.800986 | 1.113935e-48 | 5.259889e-46 |
MsG0080048595.01 | MsG0580027638.01 | 0.828235 | 1.006416e-54 | 9.944248e-52 |
MsG0080048595.01 | MsG0580027646.01 | 0.813309 | 2.731532e-51 | 1.777587e-48 |
MsG0080048595.01 | MsG0580027797.01 | 0.810775 | 9.748727e-51 | 5.929646e-48 |
MsG0080048595.01 | MsG0580028159.01 | -0.802343 | 5.867685e-49 | 2.867436e-46 |
MsG0080048595.01 | MsG0580028587.01 | 0.807754 | 4.331379e-50 | 2.432416e-47 |
MsG0080048595.01 | MsG0580028899.01 | 0.820370 | 7.107979e-53 | 5.613811e-50 |
MsG0080048595.01 | MsG0580029177.01 | -0.805594 | 1.237953e-49 | 6.575692e-47 |
MsG0080048595.01 | MsG0580029218.01 | 0.807150 | 5.816386e-50 | 3.215435e-47 |
MsG0080048595.01 | MsG0580029296.01 | 0.800329 | 1.516469e-48 | 7.041877e-46 |
MsG0080048595.01 | MsG0580029820.01 | -0.838693 | 2.470775e-57 | 3.335242e-54 |
MsG0080048595.01 | MsG0580030133.01 | 0.814314 | 1.640861e-51 | 1.097359e-48 |
MsG0080048595.01 | MsG0580030135.01 | 0.808048 | 3.750157e-50 | 2.122309e-47 |
MsG0080048595.01 | MsG0580030145.01 | 0.856061 | 4.148187e-62 | 9.777586e-59 |
MsG0080048595.01 | MsG0580030197.01 | -0.828483 | 8.768778e-55 | 8.727357e-52 |
MsG0080048595.01 | MsG0580030237.01 | -0.820536 | 6.513223e-53 | 5.167558e-50 |
MsG0080048595.01 | MsG0680030441.01 | -0.823331 | 1.467184e-53 | 1.259424e-50 |
MsG0080048595.01 | MsG0680030644.01 | -0.806113 | 9.629401e-50 | 5.183472e-47 |
MsG0080048595.01 | MsG0680030719.01 | 0.815694 | 8.106359e-52 | 5.628402e-49 |
MsG0080048595.01 | MsG0680030732.01 | 0.846746 | 1.789904e-59 | 3.111752e-56 |
MsG0080048595.01 | MsG0680030878.01 | -0.824449 | 8.021796e-54 | 7.107178e-51 |
MsG0080048595.01 | MsG0680030960.01 | 0.812745 | 3.633164e-51 | 2.328780e-48 |
MsG0080048595.01 | MsG0680031009.01 | 0.810590 | 1.068891e-50 | 6.469266e-48 |
MsG0080048595.01 | MsG0680031204.01 | -0.844425 | 7.619337e-59 | 1.229591e-55 |
MsG0080048595.01 | MsG0680031813.01 | -0.826141 | 3.191532e-54 | 2.967939e-51 |
MsG0080048595.01 | MsG0680034229.01 | -0.820970 | 5.177432e-53 | 4.158031e-50 |
MsG0080048595.01 | MsG0680034255.01 | 0.815379 | 9.529056e-52 | 6.559172e-49 |
MsG0080048595.01 | MsG0680034316.01 | 0.865143 | 7.309317e-65 | 2.353305e-61 |
MsG0080048595.01 | MsG0680034317.01 | 0.832455 | 9.361591e-56 | 1.046856e-52 |
MsG0080048595.01 | MsG0680035584.01 | -0.826189 | 3.108957e-54 | 2.895102e-51 |
MsG0080048595.01 | MsG0780035993.01 | 0.860329 | 2.228603e-63 | 6.068660e-60 |
MsG0080048595.01 | MsG0780035994.01 | -0.803250 | 3.813829e-49 | 1.907257e-46 |
MsG0080048595.01 | MsG0780036054.01 | 0.812448 | 4.218565e-51 | 2.683106e-48 |
MsG0080048595.01 | MsG0780036421.01 | 0.823105 | 1.656958e-53 | 1.413417e-50 |
MsG0080048595.01 | MsG0780036426.01 | 0.828083 | 1.094819e-54 | 1.077041e-51 |
MsG0080048595.01 | MsG0780036471.01 | 0.804167 | 2.460539e-49 | 1.259826e-46 |
MsG0080048595.01 | MsG0780036661.01 | 0.839806 | 1.271150e-57 | 1.775424e-54 |
MsG0080048595.01 | MsG0780037458.01 | -0.825329 | 4.973983e-54 | 4.519894e-51 |
MsG0080048595.01 | MsG0780037698.01 | -0.826087 | 3.287982e-54 | 3.052779e-51 |
MsG0080048595.01 | MsG0780038030.01 | -0.829727 | 4.379364e-55 | 4.520558e-52 |
MsG0080048595.01 | MsG0780038047.01 | -0.838567 | 2.662768e-57 | 3.580601e-54 |
MsG0080048595.01 | MsG0780038108.01 | -0.854953 | 8.732152e-62 | 1.983646e-58 |
MsG0080048595.01 | MsG0780038136.01 | 0.800101 | 1.687545e-48 | 7.790724e-46 |
MsG0080048595.01 | MsG0780038263.01 | -0.803895 | 2.802030e-49 | 1.424811e-46 |
MsG0080048595.01 | MsG0780038305.01 | 0.865639 | 5.103982e-65 | 1.672851e-61 |
MsG0080048595.01 | MsG0780038321.01 | 0.825586 | 4.323781e-54 | 3.957697e-51 |
MsG0080048595.01 | MsG0780038431.01 | 0.803739 | 3.019436e-49 | 1.529131e-46 |
MsG0080048595.01 | MsG0780038573.01 | -0.844522 | 7.177423e-59 | 1.161836e-55 |
MsG0080048595.01 | MsG0780038860.01 | 0.855611 | 5.616173e-62 | 1.304052e-58 |
MsG0080048595.01 | MsG0780038922.01 | 0.805252 | 1.459890e-49 | 7.686497e-47 |
MsG0080048595.01 | MsG0780039287.01 | -0.804216 | 2.402488e-49 | 1.231658e-46 |
MsG0080048595.01 | MsG0780039431.01 | 0.813224 | 2.852190e-51 | 1.851672e-48 |
MsG0080048595.01 | MsG0780039480.01 | 0.806604 | 7.588124e-50 | 4.136088e-47 |
MsG0080048595.01 | MsG0780039576.01 | 0.815937 | 7.154869e-52 | 5.000752e-49 |
MsG0080048595.01 | MsG0780039704.01 | -0.808203 | 3.475146e-50 | 1.974892e-47 |
MsG0080048595.01 | MsG0780039821.01 | -0.800390 | 1.474068e-48 | 6.855337e-46 |
MsG0080048595.01 | MsG0780039836.01 | -0.863936 | 1.744068e-64 | 5.380194e-61 |
MsG0080048595.01 | MsG0780039838.01 | -0.830497 | 2.840194e-55 | 2.997387e-52 |
MsG0080048595.01 | MsG0780039839.01 | -0.859769 | 3.288512e-63 | 8.784988e-60 |
MsG0080048595.01 | MsG0780039873.01 | -0.807173 | 5.753138e-50 | 3.182367e-47 |
MsG0080048595.01 | MsG0780039879.01 | -0.800848 | 1.188938e-48 | 5.593994e-46 |
MsG0080048595.01 | MsG0780039978.01 | 0.801896 | 7.252839e-49 | 3.504215e-46 |
MsG0080048595.01 | MsG0780040121.01 | -0.815539 | 8.776655e-52 | 6.068020e-49 |
MsG0080048595.01 | MsG0780040158.01 | -0.821012 | 5.062564e-53 | 4.070636e-50 |
MsG0080048595.01 | MsG0780040321.01 | -0.854610 | 1.097336e-61 | 2.464720e-58 |
MsG0080048595.01 | MsG0780040429.01 | -0.817115 | 3.898364e-52 | 2.813905e-49 |
MsG0080048595.01 | MsG0780040685.01 | -0.801792 | 7.618916e-49 | 3.671183e-46 |
MsG0080048595.01 | MsG0780040702.01 | -0.806178 | 9.329947e-50 | 5.030854e-47 |
MsG0080048595.01 | MsG0780040719.01 | 0.803180 | 3.941684e-49 | 1.967722e-46 |
MsG0080048595.01 | MsG0780040805.01 | 0.818055 | 2.393070e-52 | 1.772436e-49 |
MsG0080048595.01 | MsG0780040806.01 | 0.809027 | 2.318087e-50 | 1.346117e-47 |
MsG0080048595.01 | MsG0780040838.01 | -0.813374 | 2.644208e-51 | 1.723839e-48 |
MsG0080048595.01 | MsG0780040977.01 | 0.842413 | 2.625628e-58 | 3.978333e-55 |
MsG0080048595.01 | MsG0780040991.01 | 0.823924 | 1.065576e-53 | 9.302244e-51 |
MsG0080048595.01 | MsG0780041121.01 | -0.831165 | 1.948485e-55 | 2.097314e-52 |
MsG0080048595.01 | MsG0780041254.01 | -0.826074 | 3.311002e-54 | 3.073003e-51 |
MsG0080048595.01 | MsG0780041436.01 | 0.806441 | 8.212770e-50 | 4.458057e-47 |
MsG0080048595.01 | MsG0780041531.01 | -0.808519 | 2.976591e-50 | 1.705553e-47 |
MsG0080048595.01 | MsG0780041561.01 | -0.822385 | 2.437528e-53 | 2.037257e-50 |
MsG0080048595.01 | MsG0780041620.01 | -0.842371 | 2.693931e-58 | 4.076327e-55 |
MsG0080048595.01 | MsG0780041720.01 | -0.815843 | 7.510946e-52 | 5.235899e-49 |
MsG0080048595.01 | MsG0780041783.01 | -0.844439 | 7.556612e-59 | 1.219923e-55 |
MsG0080048595.01 | MsG0880041835.01 | -0.825613 | 4.260355e-54 | 3.902736e-51 |
MsG0080048595.01 | MsG0880041855.01 | -0.819347 | 1.218000e-52 | 9.348210e-50 |
MsG0080048595.01 | MsG0880041908.01 | -0.813802 | 2.128541e-51 | 1.403828e-48 |
MsG0080048595.01 | MsG0880042122.01 | 0.827715 | 1.342199e-54 | 1.306256e-51 |
MsG0080048595.01 | MsG0880042588.01 | -0.816199 | 6.253364e-52 | 4.402364e-49 |
MsG0080048595.01 | MsG0880042740.01 | 0.811734 | 6.035584e-51 | 3.765489e-48 |
MsG0080048595.01 | MsG0880042858.01 | -0.817491 | 3.208356e-52 | 2.339951e-49 |
MsG0080048595.01 | MsG0880042895.01 | -0.808134 | 3.595906e-50 | 2.039663e-47 |
MsG0080048595.01 | MsG0880043017.01 | 0.829347 | 5.417040e-55 | 5.530089e-52 |
MsG0080048595.01 | MsG0880043069.01 | -0.818221 | 2.194531e-52 | 1.632843e-49 |
MsG0080048595.01 | MsG0880043364.01 | 0.838646 | 2.541182e-57 | 3.425555e-54 |
MsG0080048595.01 | MsG0880043472.01 | 0.813402 | 2.606565e-51 | 1.700605e-48 |
MsG0080048595.01 | MsG0880043481.01 | 0.807831 | 4.170633e-50 | 2.346846e-47 |
MsG0080048595.01 | MsG0880043515.01 | -0.819095 | 1.389966e-52 | 1.059501e-49 |
MsG0080048595.01 | MsG0880043550.01 | 0.836246 | 1.047357e-56 | 1.312505e-53 |
MsG0080048595.01 | MsG0880044545.01 | -0.807355 | 5.264310e-50 | 2.925806e-47 |
MsG0080048595.01 | MsG0880044548.01 | -0.817614 | 3.010282e-52 | 2.202782e-49 |
MsG0080048595.01 | MsG0880044715.01 | -0.814211 | 1.729587e-51 | 1.153364e-48 |
MsG0080048595.01 | MsG0880044968.01 | -0.864906 | 8.679230e-65 | 2.770001e-61 |
MsG0080048595.01 | MsG0880045188.01 | -0.828986 | 6.626073e-55 | 6.691375e-52 |
MsG0080048595.01 | MsG0880045369.01 | -0.855758 | 5.089459e-62 | 1.187661e-58 |
MsG0080048595.01 | MsG0880045385.01 | -0.863405 | 2.549540e-64 | 7.719756e-61 |
MsG0080048595.01 | MsG0880045413.01 | -0.817405 | 3.355165e-52 | 2.441208e-49 |
MsG0080048595.01 | MsG0880045677.01 | 0.809827 | 1.560653e-50 | 9.258185e-48 |
MsG0080048595.01 | MsG0880045755.01 | -0.849991 | 2.266428e-60 | 4.374854e-57 |
MsG0080048595.01 | MsG0880045968.01 | -0.843809 | 1.114912e-58 | 1.764733e-55 |
MsG0080048595.01 | MsG0880045991.01 | 0.836205 | 1.072525e-56 | 1.342435e-53 |
MsG0080048595.01 | MsG0880046010.01 | -0.820706 | 5.951919e-53 | 4.744492e-50 |
MsG0080048595.01 | MsG0880046105.01 | -0.803825 | 2.897417e-49 | 1.470587e-46 |
MsG0080048595.01 | MsG0880046151.01 | -0.819332 | 1.227697e-52 | 9.418743e-50 |
MsG0080048595.01 | MsG0880046174.01 | -0.840587 | 7.949202e-58 | 1.137511e-54 |
MsG0080048595.01 | MsG0880046189.01 | -0.856426 | 3.242267e-62 | 7.736307e-59 |
MsG0080048595.01 | MsG0880046219.01 | -0.812124 | 4.963483e-51 | 3.129271e-48 |
MsG0080048595.01 | MsG0880046227.01 | 0.801576 | 8.437390e-49 | 4.043379e-46 |
MsG0080048595.01 | MsG0880046341.01 | -0.825594 | 4.305377e-54 | 3.941748e-51 |
MsG0080048595.01 | MsG0880046429.01 | 0.800250 | 1.574295e-48 | 7.295372e-46 |
MsG0080048595.01 | MsG0880046469.01 | -0.845695 | 3.460046e-59 | 5.814490e-56 |
MsG0080048595.01 | MsG0880046630.01 | -0.816865 | 4.436421e-52 | 3.180590e-49 |
MsG0080048595.01 | MsG0880046876.01 | -0.805610 | 1.228258e-49 | 6.526908e-47 |
MsG0080048595.01 | MsG0880047090.01 | 0.837553 | 4.857233e-57 | 6.331792e-54 |
MsG0080048595.01 | MsG0880047251.01 | -0.811146 | 8.099197e-51 | 4.974987e-48 |
MsG0080048595.01 | MsG0880047318.01 | -0.828157 | 1.050778e-54 | 1.035958e-51 |
MsG0080048595.01 | MsG0880047406.01 | -0.823087 | 1.672949e-53 | 1.426360e-50 |
MsG0080048595.01 | MsG0880047493.01 | 0.821206 | 4.567513e-53 | 3.692243e-50 |
MsG0080048595.01 | MsG0880047542.01 | 0.821168 | 4.658930e-53 | 3.762040e-50 |
MsG0080048595.01 | MsG0880047627.01 | -0.808104 | 3.648521e-50 | 2.067877e-47 |
MsG0080048595.01 | MsG0880047697.01 | 0.848920 | 4.506774e-60 | 8.401740e-57 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048595.01.T01 | MTR_7g069540 | 96.501 | 343 | 12 | 0 | 33 | 375 | 176 | 518 | 0.0 | 689 |
MsG0080048595.01.T01 | MTR_4g017200 | 87.464 | 343 | 43 | 0 | 33 | 375 | 178 | 520 | 0.0 | 608 |
MsG0080048595.01.T01 | MTR_5g046610 | 87.172 | 343 | 44 | 0 | 33 | 375 | 178 | 520 | 0.0 | 607 |
MsG0080048595.01.T01 | MTR_7g069500 | 82.799 | 343 | 31 | 2 | 33 | 375 | 174 | 488 | 0.0 | 558 |
MsG0080048595.01.T01 | MTR_2g015560 | 78.426 | 343 | 74 | 0 | 33 | 375 | 153 | 495 | 0.0 | 553 |
MsG0080048595.01.T01 | MTR_2g009330 | 67.055 | 343 | 113 | 0 | 33 | 375 | 183 | 525 | 1.99e-176 | 504 |
MsG0080048595.01.T01 | MTR_5g046620 | 50.207 | 241 | 43 | 5 | 92 | 331 | 1 | 165 | 3.81e-66 | 207 |
MsG0080048595.01.T01 | MTR_1g011530 | 59.649 | 57 | 20 | 1 | 208 | 264 | 31 | 84 | 4.82e-17 | 76.3 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048595.01.T01 | AT5G54960 | 85.423 | 343 | 50 | 0 | 33 | 375 | 178 | 520 | 0.0 | 620 |
MsG0080048595.01.T01 | AT4G33070 | 83.673 | 343 | 56 | 0 | 33 | 375 | 178 | 520 | 0.0 | 611 |
MsG0080048595.01.T01 | AT5G01320 | 82.216 | 343 | 61 | 0 | 33 | 375 | 174 | 516 | 0.0 | 598 |
MsG0080048595.01.T01 | AT5G01330 | 81.050 | 343 | 65 | 0 | 33 | 375 | 163 | 505 | 0.0 | 589 |
Find 106 sgRNAs with CRISPR-Local
Find 170 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
CCCATTTCATTGGAACTTAT+TGG | 0.122987 | contig366end:-916 | MsG0080048595.01.T01:CDS |
CCATTTCATTGGAACTTATT+GGG | 0.218907 | contig366end:-915 | MsG0080048595.01.T01:CDS |
TTAACTCTCAAAGGTTCTTT+TGG | 0.268831 | contig366end:+599 | None:intergenic |
CCCAATAAGTTCCAATGAAA+TGG | 0.289567 | contig366end:+915 | None:intergenic |
TGTATCCGCCATTATTTATC+AGG | 0.290602 | contig366end:+120 | None:intergenic |
CCTCAGGCAATTTCAACTTT+TGG | 0.294722 | contig366end:+495 | None:intergenic |
CAATTGAGGTTGAAATTTGA+TGG | 0.302088 | contig366end:-97 | None:intergenic |
GACTTCAAAGGTTTCCCATT+TGG | 0.322846 | contig366end:+626 | None:intergenic |
GCTGATGCATACTTGTTTGC+TGG | 0.330059 | contig366end:-851 | MsG0080048595.01.T01:CDS |
CATAGGATATTTGTTCCAAA+TGG | 0.336215 | contig366end:-641 | MsG0080048595.01.T01:CDS |
CAAATGCAATATGGCTCAAT+TGG | 0.339341 | contig366end:-373 | MsG0080048595.01.T01:CDS |
ATTCCTAATGGACCTTCATT+TGG | 0.348436 | contig366end:-740 | MsG0080048595.01.T01:CDS |
ATCATCTTCCTGATAAATAA+TGG | 0.361652 | contig366end:-128 | MsG0080048595.01.T01:CDS |
ATGAAATGGGGATGGTGCTC+AGG | 0.369145 | contig366end:+929 | None:intergenic |
CAGCTAATGCTTATGTAAAC+AGG | 0.372535 | contig366end:+1504 | None:intergenic |
GGTCAGAGTGGTGGTTATAA+TGG | 0.387184 | contig366end:-2166 | MsG0080048595.01.T01:CDS |
ATCTGATGCCTTTGTCGAAC+TGG | 0.388724 | contig366end:-1005 | MsG0080048595.01.T01:CDS |
CCAATAAGTTCCAATGAAAT+GGG | 0.391316 | contig366end:+916 | None:intergenic |
CATCCAAATGAAGGTCCATT+AGG | 0.391659 | contig366end:+737 | None:intergenic |
GAGCACCATCCCCATTTCAT+TGG | 0.394834 | contig366end:-926 | MsG0080048595.01.T01:CDS |
TTGTTGAGCCCGATCGGGTT+GGG | 0.397568 | contig366end:-763 | MsG0080048595.01.T01:CDS |
GATCGGGTTGGGATTCCTAA+TGG | 0.404933 | contig366end:-752 | MsG0080048595.01.T01:CDS |
TATGAGTTTCAAATGCAATA+TGG | 0.409320 | contig366end:-382 | MsG0080048595.01.T01:CDS |
CTGCTGCTTCCAACCCCATC+TGG | 0.410581 | contig366end:+1107 | None:intergenic |
TACTTGGGAGCGCGTGAAAA+CGG | 0.426685 | contig366end:+1435 | None:intergenic |
GACGCTTCGCAAGTGCCTTA+AGG | 0.428488 | contig366end:+696 | None:intergenic |
ACAACATTTGTTGTATATGT+TGG | 0.429950 | contig366end:+567 | None:intergenic |
CAACGGTGGTTGGTGGTGGC+TGG | 0.430986 | contig366end:-2193 | MsG0080048595.01.T01:CDS |
CGATTATTGTTGAGCCCGAT+CGG | 0.432510 | contig366end:-769 | MsG0080048595.01.T01:CDS |
TGGTTGGTGGTGGCTGGCAG+TGG | 0.433600 | contig366end:-2187 | MsG0080048595.01.T01:CDS |
ACTTGGGAGCGCGTGAAAAC+GGG | 0.449334 | contig366end:+1436 | None:intergenic |
GATTATTGTTGAGCCCGATC+GGG | 0.458460 | contig366end:-768 | MsG0080048595.01.T01:CDS |
ATTATTTATCAGGAAGATGA+TGG | 0.461795 | contig366end:+130 | None:intergenic |
AAAAGTGGGGTGAGGAATTG+AGG | 0.461915 | contig366end:+1473 | None:intergenic |
GTTGATGAATGATTTCCTTA+AGG | 0.466656 | contig366end:-711 | MsG0080048595.01.T01:CDS |
CTCTATTCACATCTCCAATC+TGG | 0.472101 | contig366end:+2130 | None:intergenic |
TTAGGAATCCCAACCCGATC+GGG | 0.473259 | contig366end:+755 | None:intergenic |
GACAGGTTCACGACTAAAAG+TGG | 0.473332 | contig366end:+1458 | None:intergenic |
ATAGGATATTTGTTCCAAAT+GGG | 0.475146 | contig366end:-640 | MsG0080048595.01.T01:CDS |
GTAGTCAATGGTGGCCAGAT+TGG | 0.475254 | contig366end:-2144 | MsG0080048595.01.T01:CDS |
TGGTCTGTTGGTGCAACTCT+TGG | 0.476946 | contig366end:-349 | MsG0080048595.01.T01:CDS |
CCGTGATGCCATCAGCTAAA+GGG | 0.477384 | contig366end:-958 | MsG0080048595.01.T01:CDS |
CATTTCATTGGAACTTATTG+GGG | 0.478426 | contig366end:-914 | MsG0080048595.01.T01:CDS |
TTAACGACTACAGTTCTGTT+GGG | 0.482833 | contig366end:-820 | MsG0080048595.01.T01:CDS |
TTGAAATTGCCTGAGGGATG+TGG | 0.492977 | contig366end:-488 | MsG0080048595.01.T01:CDS |
TGCATTCTGTGCTGAGATTG+TGG | 0.494314 | contig366end:-879 | MsG0080048595.01.T01:CDS |
GCCGTGATGCCATCAGCTAA+AGG | 0.496857 | contig366end:-959 | MsG0080048595.01.T01:CDS |
GGCTCAATTGGATGGTCTGT+TGG | 0.501951 | contig366end:-361 | MsG0080048595.01.T01:CDS |
TGACCAACGGTGGTTGGTGG+TGG | 0.504634 | contig366end:-2197 | MsG0080048595.01.T01:CDS |
ACAAATGTTGTCTAGTGAAA+CGG | 0.504682 | contig366end:-555 | MsG0080048595.01.T01:CDS |
TGCAATATGGCTCAATTGGA+TGG | 0.506275 | contig366end:-369 | MsG0080048595.01.T01:CDS |
TTTAACGACTACAGTTCTGT+TGG | 0.512794 | contig366end:-821 | MsG0080048595.01.T01:CDS |
TTAGGACCACCTACTAGTAC+AGG | 0.512847 | contig366end:+1046 | None:intergenic |
CATTTGGAACAAATATCCTA+TGG | 0.518266 | contig366end:+642 | None:intergenic |
AACATAACATTAACTCTCAA+AGG | 0.524430 | contig366end:+590 | None:intergenic |
TTGTAGATTGACTAACCAGA+TGG | 0.530616 | contig366end:-1122 | MsG0080048595.01.T01:intron |
AAGCGAATAATTGCTTGCAT+TGG | 0.533361 | contig366end:-304 | MsG0080048595.01.T01:CDS |
ACGGTTGTGATTGCTGAGAC+GGG | 0.535250 | contig366end:-536 | MsG0080048595.01.T01:CDS |
ATTGTTGAGCCCGATCGGGT+TGG | 0.536663 | contig366end:-764 | MsG0080048595.01.T01:CDS |
AGCGCTTACCCACATCCCTC+AGG | 0.540837 | contig366end:+479 | None:intergenic |
AAAGTGGGGTGAGGAATTGA+GGG | 0.544961 | contig366end:+1474 | None:intergenic |
ATCAACACACATCCAAATGA+AGG | 0.547911 | contig366end:+728 | None:intergenic |
TGGTGACCAACGGTGGTTGG+TGG | 0.548885 | contig366end:-2200 | MsG0080048595.01.T01:CDS |
GGTTGTGATTGCTGAGACGG+GGG | 0.553648 | contig366end:-534 | MsG0080048595.01.T01:CDS |
GCTGGCAGTGGTCAGAGTGG+TGG | 0.554453 | contig366end:-2175 | MsG0080048595.01.T01:CDS |
GCAGTGAAGCCTGTACTAGT+AGG | 0.561087 | contig366end:-1055 | MsG0080048595.01.T01:CDS |
ATTAGGAATCCCAACCCGAT+CGG | 0.561904 | contig366end:+754 | None:intergenic |
ATAATTGCTTGCATTGGTGA+TGG | 0.566797 | contig366end:-298 | MsG0080048595.01.T01:CDS |
TGTAGATTGACTAACCAGAT+GGG | 0.567208 | contig366end:-1121 | MsG0080048595.01.T01:intron |
GTGGCTGGCAGTGGTCAGAG+TGG | 0.568270 | contig366end:-2178 | MsG0080048595.01.T01:CDS |
TGAAATGGGGATGGTGCTCA+GGG | 0.568384 | contig366end:+930 | None:intergenic |
AACGGTTGTGATTGCTGAGA+CGG | 0.568757 | contig366end:-537 | MsG0080048595.01.T01:CDS |
ATTGACTAACCAGATGGGGT+TGG | 0.572238 | contig366end:-1116 | MsG0080048595.01.T01:CDS |
GGGACCATCCCTTTAGCTGA+TGG | 0.572399 | contig366end:+950 | None:intergenic |
GGAGCGCGTGAAAACGGGAC+AGG | 0.574468 | contig366end:+1441 | None:intergenic |
CCCTTTAGCTGATGGCATCA+CGG | 0.575591 | contig366end:+958 | None:intergenic |
CGCATCTGCCAGTTCGACAA+AGG | 0.582374 | contig366end:+997 | None:intergenic |
GTGGTTATAATGGTAGTCAA+TGG | 0.585603 | contig366end:-2156 | MsG0080048595.01.T01:CDS |
ATAGGCTGTGGTGAATCACT+TGG | 0.585973 | contig366end:-1583 | MsG0080048595.01.T01:intron |
TTGCATATGAAAATTACCAT+AGG | 0.592094 | contig366end:-658 | MsG0080048595.01.T01:CDS |
CGGTTGTGATTGCTGAGACG+GGG | 0.606636 | contig366end:-535 | MsG0080048595.01.T01:CDS |
GTCGAACTGGCAGATGCGAG+TGG | 0.610851 | contig366end:-992 | MsG0080048595.01.T01:CDS |
AAATGGTGACCAACGGTGGT+TGG | 0.613935 | contig366end:-2203 | MsG0080048595.01.T01:CDS |
CAGCCACCACCAACCACCGT+TGG | 0.614965 | contig366end:+2194 | None:intergenic |
AAGTTCCAATGAAATGGGGA+TGG | 0.619469 | contig366end:+921 | None:intergenic |
TAATGGCGGATACACAATTG+AGG | 0.619516 | contig366end:-111 | MsG0080048595.01.T01:CDS |
GGGGTTGGAAGCAGCAGTTG+AGG | 0.620039 | contig366end:-1101 | MsG0080048595.01.T01:CDS |
ACAGGTTCACGACTAAAAGT+GGG | 0.620615 | contig366end:+1459 | None:intergenic |
CCAAAAGTTGAAATTGCCTG+AGG | 0.627567 | contig366end:-495 | MsG0080048595.01.T01:CDS |
AGTAGGTGGTCCTAAACTGA+GGG | 0.628023 | contig366end:-1038 | MsG0080048595.01.T01:CDS |
GTTATAATGGTAGTCAATGG+TGG | 0.636798 | contig366end:-2153 | MsG0080048595.01.T01:CDS |
TCACGACTAAAAGTGGGGTG+AGG | 0.639430 | contig366end:+1465 | None:intergenic |
TAGTAGGTGGTCCTAAACTG+AGG | 0.652385 | contig366end:-1039 | MsG0080048595.01.T01:CDS |
GTAGATTGACTAACCAGATG+GGG | 0.652566 | contig366end:-1120 | MsG0080048595.01.T01:intron |
TGAAATTGCCTGAGGGATGT+GGG | 0.655016 | contig366end:-487 | MsG0080048595.01.T01:intron |
AGGTGGTCCTAAACTGAGGG+TGG | 0.656562 | contig366end:-1035 | MsG0080048595.01.T01:CDS |
GATGCCATCAGCTAAAGGGA+TGG | 0.659243 | contig366end:-954 | MsG0080048595.01.T01:CDS |
CAATAAGTTCCAATGAAATG+GGG | 0.661557 | contig366end:+917 | None:intergenic |
GTGAAGCCTGTACTAGTAGG+TGG | 0.664654 | contig366end:-1052 | MsG0080048595.01.T01:CDS |
ATCTTCCTGATAAATAATGG+CGG | 0.670648 | contig366end:-125 | MsG0080048595.01.T01:CDS |
CAAAAGTTGAAATTGCCTGA+GGG | 0.678314 | contig366end:-494 | MsG0080048595.01.T01:CDS |
ATATCAACAATGCTGCGATG+TGG | 0.681337 | contig366end:-161 | MsG0080048595.01.T01:CDS |
GATTGGAGATGTGAATAGAG+TGG | 0.715778 | contig366end:-2127 | MsG0080048595.01.T01:intron |
CAGGTTCACGACTAAAAGTG+GGG | 0.719162 | contig366end:+1460 | None:intergenic |
GTGGATGAAATGGTGACCAA+CGG | 0.733765 | contig366end:-2210 | None:intergenic |
GATGAAATGGTGACCAACGG+TGG | 0.741382 | contig366end:-2207 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!! | TAAAAAAAATGAGGAATAAT+TGG | + | contig366end:1873-1892 | None:intergenic | 15.0% |
!!! | AAGTTATATGATTAATTTTG+TGG | - | contig366end:349-368 | MsG0080048595.01.T01:CDS | 15.0% |
!! | AAAGTTTAAATCAAACTTGA+CGG | - | contig366end:994-1013 | MsG0080048595.01.T01:CDS | 20.0% |
!! | AAATCAATCCAAAAACTAAA+CGG | + | contig366end:450-469 | None:intergenic | 20.0% |
!! | AACAACACTTTATACTAATA+GGG | + | contig366end:550-569 | None:intergenic | 20.0% |
!! | AGTTAGTTGTTTGTAAAAAA+CGG | - | contig366end:659-678 | MsG0080048595.01.T01:CDS | 20.0% |
!! | ATCAGCATATAAAAAAAATG+AGG | + | contig366end:1882-1901 | None:intergenic | 20.0% |
!! | ATGTAATTTATTCTTGAACA+TGG | - | contig366end:2078-2097 | MsG0080048595.01.T01:intron | 20.0% |
!! | TAACAACACTTTATACTAAT+AGG | + | contig366end:551-570 | None:intergenic | 20.0% |
!! | TAACAATTAAGTGAATGTTT+AGG | + | contig366end:1153-1172 | None:intergenic | 20.0% |
!!! | AGTATAAAGTGTTGTTAAAT+AGG | - | contig366end:554-573 | MsG0080048595.01.T01:CDS | 20.0% |
!!! | GTATAAAGTGTTGTTAAATA+GGG | - | contig366end:555-574 | MsG0080048595.01.T01:CDS | 20.0% |
!!! | TATAAAGTGTTGTTAAATAG+GGG | - | contig366end:556-575 | MsG0080048595.01.T01:CDS | 20.0% |
! | AACATAACATTAACTCTCAA+AGG | + | contig366end:1714-1733 | None:intergenic | 25.0% |
! | ATAGGATATTTGTTCCAAAT+GGG | - | contig366end:1661-1680 | MsG0080048595.01.T01:intron | 25.0% |
! | ATCATCTTCCTGATAAATAA+TGG | - | contig366end:2173-2192 | MsG0080048595.01.T01:CDS | 25.0% |
! | ATTATTTATCAGGAAGATGA+TGG | + | contig366end:2174-2193 | None:intergenic | 25.0% |
! | GTTAGTTGTTTGTAAAAAAC+GGG | - | contig366end:660-679 | MsG0080048595.01.T01:CDS | 25.0% |
! | TATGAGTTTCAAATGCAATA+TGG | - | contig366end:1919-1938 | MsG0080048595.01.T01:intron | 25.0% |
! | TTGCATATGAAAATTACCAT+AGG | - | contig366end:1643-1662 | MsG0080048595.01.T01:intron | 25.0% |
!! | TCTTAACTAAAATGTTTTGC+AGG | - | contig366end:2103-2122 | MsG0080048595.01.T01:intron | 25.0% |
!! | TTGTTATTGATATAGTGTAG+CGG | - | contig366end:582-601 | MsG0080048595.01.T01:CDS | 25.0% |
!!! | AAGGAGTTTTAATAGAATCA+TGG | - | contig366end:1069-1088 | MsG0080048595.01.T01:CDS | 25.0% |
!!! | ACAACATTTGTTGTATATGT+TGG | + | contig366end:1737-1756 | None:intergenic | 25.0% |
!!! | ATTGTGGTTGATTTGATAAT+AGG | - | contig366end:700-719 | MsG0080048595.01.T01:CDS | 25.0% |
!!! | TATTTTCAACTAGTCTATAG+TGG | - | contig366end:476-495 | MsG0080048595.01.T01:intron | 25.0% |
AAAGAGAGAAAGACTTACTT+GGG | + | contig366end:884-903 | None:intergenic | 30.0% | |
AACTGTAGTCGTTAAAAATG+GGG | + | contig366end:1476-1495 | None:intergenic | 30.0% | |
ACAAATGTTGTCTAGTGAAA+CGG | - | contig366end:1746-1765 | MsG0080048595.01.T01:intron | 30.0% | |
AGAACTGTAGTCGTTAAAAA+TGG | + | contig366end:1478-1497 | None:intergenic | 30.0% | |
ATCTTCCTGATAAATAATGG+CGG | - | contig366end:2176-2195 | MsG0080048595.01.T01:CDS | 30.0% | |
CAATAAGTTCCAATGAAATG+GGG | + | contig366end:1387-1406 | None:intergenic | 30.0% | |
CATAGGATATTTGTTCCAAA+TGG | - | contig366end:1660-1679 | MsG0080048595.01.T01:intron | 30.0% | |
CATTTCATTGGAACTTATTG+GGG | - | contig366end:1387-1406 | MsG0080048595.01.T01:intron | 30.0% | |
CCAATAAGTTCCAATGAAAT+GGG | + | contig366end:1388-1407 | None:intergenic | 30.0% | |
CCATTTCATTGGAACTTATT+GGG | - | contig366end:1386-1405 | MsG0080048595.01.T01:intron | 30.0% | |
CTGTTATAAACATGCATGTT+TGG | - | contig366end:1117-1136 | MsG0080048595.01.T01:CDS | 30.0% | |
GAACTGTAGTCGTTAAAAAT+GGG | + | contig366end:1477-1496 | None:intergenic | 30.0% | |
GCTGATAAAATCTTGTTGAT+AGG | - | contig366end:1896-1915 | MsG0080048595.01.T01:intron | 30.0% | |
TATTGCAGAACAAAACGATT+TGG | + | contig366end:527-546 | None:intergenic | 30.0% | |
TTCAACAACTTGTGTGTATT+TGG | - | contig366end:923-942 | MsG0080048595.01.T01:CDS | 30.0% | |
! | CATTTGGAACAAATATCCTA+TGG | + | contig366end:1662-1681 | None:intergenic | 30.0% |
! | GATTTGGTCAAATTCTACTT+AGG | + | contig366end:511-530 | None:intergenic | 30.0% |
! | GTTGATGAATGATTTCCTTA+AGG | - | contig366end:1590-1609 | MsG0080048595.01.T01:intron | 30.0% |
! | TTAACTCTCAAAGGTTCTTT+TGG | + | contig366end:1705-1724 | None:intergenic | 30.0% |
! | TTTTAGCAAAAGCTACACTA+AGG | - | contig366end:1050-1069 | MsG0080048595.01.T01:CDS | 30.0% |
AAGCGAATAATTGCTTGCAT+TGG | - | contig366end:1997-2016 | MsG0080048595.01.T01:intron | 35.0% | |
ATCAACACACATCCAAATGA+AGG | + | contig366end:1576-1595 | None:intergenic | 35.0% | |
CAAAAGTTGAAATTGCCTGA+GGG | - | contig366end:1807-1826 | MsG0080048595.01.T01:intron | 35.0% | |
CAAAGAGAGAAAGACTTACT+TGG | + | contig366end:885-904 | None:intergenic | 35.0% | |
CAAATGCAATATGGCTCAAT+TGG | - | contig366end:1928-1947 | MsG0080048595.01.T01:intron | 35.0% | |
CAGCTAATGCTTATGTAAAC+AGG | + | contig366end:800-819 | None:intergenic | 35.0% | |
CCACAATCAAAACAATCATC+AGG | + | contig366end:687-706 | None:intergenic | 35.0% | |
CCCAATAAGTTCCAATGAAA+TGG | + | contig366end:1389-1408 | None:intergenic | 35.0% | |
CCCATTTCATTGGAACTTAT+TGG | - | contig366end:1385-1404 | MsG0080048595.01.T01:intron | 35.0% | |
GTGGTTATAATGGTAGTCAA+TGG | - | contig366end:145-164 | MsG0080048595.01.T01:CDS | 35.0% | |
GTTATAATGGTAGTCAATGG+TGG | - | contig366end:148-167 | MsG0080048595.01.T01:CDS | 35.0% | |
TGTAGATTGACTAACCAGAT+GGG | - | contig366end:1180-1199 | MsG0080048595.01.T01:intron | 35.0% | |
TGTATCCGCCATTATTTATC+AGG | + | contig366end:2184-2203 | None:intergenic | 35.0% | |
TTAACGACTACAGTTCTGTT+GGG | - | contig366end:1481-1500 | MsG0080048595.01.T01:CDS | 35.0% | |
TTGTAGATTGACTAACCAGA+TGG | - | contig366end:1179-1198 | MsG0080048595.01.T01:intron | 35.0% | |
TTTAACGACTACAGTTCTGT+TGG | - | contig366end:1480-1499 | MsG0080048595.01.T01:CDS | 35.0% | |
! | ATAATTGCTTGCATTGGTGA+TGG | - | contig366end:2003-2022 | MsG0080048595.01.T01:intron | 35.0% |
! | ATTCCTAATGGACCTTCATT+TGG | - | contig366end:1561-1580 | MsG0080048595.01.T01:CDS | 35.0% |
!! | AAGCAATTATTCGCTTTTCG+GGG | + | contig366end:1993-2012 | None:intergenic | 35.0% |
!! | AGTAACTGACTTTTCGTGTT+AGG | - | contig366end:967-986 | MsG0080048595.01.T01:CDS | 35.0% |
!! | CAAGCAATTATTCGCTTTTC+GGG | + | contig366end:1994-2013 | None:intergenic | 35.0% |
!! | GCAAGCAATTATTCGCTTTT+CGG | + | contig366end:1995-2014 | None:intergenic | 35.0% |
!! | GTTGATTTGATAATAGGCTG+TGG | - | contig366end:706-725 | MsG0080048595.01.T01:CDS | 35.0% |
!! | TTGGTTGGTGATAGTCAAAA+TGG | - | contig366end:262-281 | MsG0080048595.01.T01:intron | 35.0% |
!!! | CCTGATGATTGTTTTGATTG+TGG | - | contig366end:684-703 | MsG0080048595.01.T01:CDS | 35.0% |
AAAAACTAAACGGCCTTTCG+GGG | + | contig366end:440-459 | None:intergenic | 40.0% | |
AAAACTTACGCGACTAACAC+TGG | - | contig366end:613-632 | MsG0080048595.01.T01:CDS | 40.0% | |
AAGTTCCAATGAAATGGGGA+TGG | + | contig366end:1383-1402 | None:intergenic | 40.0% | |
ACAGGTTCACGACTAAAAGT+GGG | + | contig366end:845-864 | None:intergenic | 40.0% | |
ATATCAACAATGCTGCGATG+TGG | - | contig366end:2140-2159 | MsG0080048595.01.T01:CDS | 40.0% | |
CAAAAACTAAACGGCCTTTC+GGG | + | contig366end:441-460 | None:intergenic | 40.0% | |
CATCCAAATGAAGGTCCATT+AGG | + | contig366end:1567-1586 | None:intergenic | 40.0% | |
CCAAAAACTAAACGGCCTTT+CGG | + | contig366end:442-461 | None:intergenic | 40.0% | |
CCAAAAGTTGAAATTGCCTG+AGG | - | contig366end:1806-1825 | MsG0080048595.01.T01:intron | 40.0% | |
CTCTATTCACATCTCCAATC+TGG | + | contig366end:174-193 | None:intergenic | 40.0% | |
GACTTCAAAGGTTTCCCATT+TGG | + | contig366end:1678-1697 | None:intergenic | 40.0% | |
GATGTGAATAGAGTGGTGAT+CGG | - | contig366end:181-200 | MsG0080048595.01.T01:intron | 40.0% | |
GATTGGAGATGTGAATAGAG+TGG | - | contig366end:174-193 | MsG0080048595.01.T01:CDS | 40.0% | |
GTAGATTGACTAACCAGATG+GGG | - | contig366end:1181-1200 | MsG0080048595.01.T01:intron | 40.0% | |
GTCAAAGTGATGATAGGTGT+TGG | - | contig366end:243-262 | MsG0080048595.01.T01:intron | 40.0% | |
TGCAATATGGCTCAATTGGA+TGG | - | contig366end:1932-1951 | MsG0080048595.01.T01:intron | 40.0% | |
! | CCTCAGGCAATTTCAACTTT+TGG | + | contig366end:1809-1828 | None:intergenic | 40.0% |
!! | AAGTGATGATAGGTGTTGGT+TGG | - | contig366end:247-266 | MsG0080048595.01.T01:intron | 40.0% |
!! | GTTGGTGATAGTCAAAATGG+TGG | - | contig366end:265-284 | MsG0080048595.01.T01:intron | 40.0% |
!! | TAATGGCGGATACACAATTG+AGG | - | contig366end:2190-2209 | MsG0080048595.01.T01:CDS | 40.0% |
!!! | CATTGGTGATGGAAGTTTTC+AGG | - | contig366end:2014-2033 | MsG0080048595.01.T01:intron | 40.0% |
!!! | TCTTTTGGCTCAGACTTCAA+AGG | + | contig366end:1690-1709 | None:intergenic | 40.0% |
AAAACTCCAAACACCCCGAA+AGG | - | contig366end:424-443 | MsG0080048595.01.T01:intron | 45.0% | |
AAAAGTGGGGTGAGGAATTG+AGG | + | contig366end:831-850 | None:intergenic | 45.0% | |
AAAGTGGGGTGAGGAATTGA+GGG | + | contig366end:830-849 | None:intergenic | 45.0% | |
AACGGTTGTGATTGCTGAGA+CGG | - | contig366end:1764-1783 | MsG0080048595.01.T01:intron | 45.0% | |
AATAGAGTGGTGATCGGAGA+GGG | - | contig366end:187-206 | MsG0080048595.01.T01:intron | 45.0% | |
AGTAGGTGGTCCTAAACTGA+GGG | - | contig366end:1263-1282 | MsG0080048595.01.T01:intron | 45.0% | |
ATAGGCTGTGGTGAATCACT+TGG | - | contig366end:718-737 | MsG0080048595.01.T01:CDS | 45.0% | |
ATCTGATGCCTTTGTCGAAC+TGG | - | contig366end:1296-1315 | MsG0080048595.01.T01:intron | 45.0% | |
ATTAGGAATCCCAACCCGAT+CGG | + | contig366end:1550-1569 | None:intergenic | 45.0% | |
ATTGACTAACCAGATGGGGT+TGG | - | contig366end:1185-1204 | MsG0080048595.01.T01:intron | 45.0% | |
CAGGTTCACGACTAAAAGTG+GGG | + | contig366end:844-863 | None:intergenic | 45.0% | |
CGATTATTGTTGAGCCCGAT+CGG | - | contig366end:1532-1551 | MsG0080048595.01.T01:CDS | 45.0% | |
GACAGGTTCACGACTAAAAG+TGG | + | contig366end:846-865 | None:intergenic | 45.0% | |
GATTATTGTTGAGCCCGATC+GGG | - | contig366end:1533-1552 | MsG0080048595.01.T01:CDS | 45.0% | |
GCTGATGCATACTTGTTTGC+TGG | - | contig366end:1450-1469 | MsG0080048595.01.T01:CDS | 45.0% | |
GGTCAGAGTGGTGGTTATAA+TGG | - | contig366end:135-154 | MsG0080048595.01.T01:CDS | 45.0% | |
GTGAGTTTCGCAGAATCACA+GGG | - | contig366end:1016-1035 | MsG0080048595.01.T01:CDS | 45.0% | |
TAATGCTAACAAGTCACCGC+AGG | + | contig366end:317-336 | None:intergenic | 45.0% | |
TAGTAGGTGGTCCTAAACTG+AGG | - | contig366end:1262-1281 | MsG0080048595.01.T01:intron | 45.0% | |
TGAAATTGCCTGAGGGATGT+GGG | - | contig366end:1814-1833 | MsG0080048595.01.T01:intron | 45.0% | |
TGCATTCTGTGCTGAGATTG+TGG | - | contig366end:1422-1441 | MsG0080048595.01.T01:intron | 45.0% | |
TTAGGACCACCTACTAGTAC+AGG | + | contig366end:1258-1277 | None:intergenic | 45.0% | |
TTGAAATTGCCTGAGGGATG+TGG | - | contig366end:1813-1832 | MsG0080048595.01.T01:intron | 45.0% | |
!! | TTCGGGGTGTTTGGAGTTTT+TGG | + | contig366end:424-443 | None:intergenic | 45.0% |
!!! | CCGAAAGGCCGTTTAGTTTT+TGG | - | contig366end:439-458 | MsG0080048595.01.T01:intron | 45.0% |
ACGGTTGTGATTGCTGAGAC+GGG | - | contig366end:1765-1784 | MsG0080048595.01.T01:intron | 50.0% | |
ATGAAATGGGGATGGTGCTC+AGG | + | contig366end:1375-1394 | None:intergenic | 50.0% | |
CCCTTTAGCTGATGGCATCA+CGG | + | contig366end:1346-1365 | None:intergenic | 50.0% | |
CCGTGATGCCATCAGCTAAA+GGG | - | contig366end:1343-1362 | MsG0080048595.01.T01:intron | 50.0% | |
GAATAGAGTGGTGATCGGAG+AGG | - | contig366end:186-205 | MsG0080048595.01.T01:intron | 50.0% | |
GAGCACCATCCCCATTTCAT+TGG | - | contig366end:1375-1394 | MsG0080048595.01.T01:intron | 50.0% | |
GATGCCATCAGCTAAAGGGA+TGG | - | contig366end:1347-1366 | MsG0080048595.01.T01:intron | 50.0% | |
GCAGTGAAGCCTGTACTAGT+AGG | - | contig366end:1246-1265 | MsG0080048595.01.T01:intron | 50.0% | |
GGCTCAATTGGATGGTCTGT+TGG | - | contig366end:1940-1959 | MsG0080048595.01.T01:intron | 50.0% | |
GGTGAGTTTCGCAGAATCAC+AGG | - | contig366end:1015-1034 | MsG0080048595.01.T01:CDS | 50.0% | |
GTAGTCAATGGTGGCCAGAT+TGG | - | contig366end:157-176 | MsG0080048595.01.T01:CDS | 50.0% | |
GTGAAGCCTGTACTAGTAGG+TGG | - | contig366end:1249-1268 | MsG0080048595.01.T01:intron | 50.0% | |
GTGGCGGTCAAAGTGATGAT+AGG | - | contig366end:237-256 | MsG0080048595.01.T01:intron | 50.0% | |
TCACGACTAAAAGTGGGGTG+AGG | + | contig366end:839-858 | None:intergenic | 50.0% | |
TGAAATGGGGATGGTGCTCA+GGG | + | contig366end:1374-1393 | None:intergenic | 50.0% | |
TGATCGGAGAGGGTTTGAGT+TGG | - | contig366end:197-216 | MsG0080048595.01.T01:intron | 50.0% | |
TGGTCTGTTGGTGCAACTCT+TGG | - | contig366end:1952-1971 | MsG0080048595.01.T01:intron | 50.0% | |
TTAGGAATCCCAACCCGATC+GGG | + | contig366end:1549-1568 | None:intergenic | 50.0% | |
! | GATCGGAGAGGGTTTGAGTT+GGG | - | contig366end:198-217 | MsG0080048595.01.T01:intron | 50.0% |
! | GCTTTTGCCACCCTCAGTTT+AGG | + | contig366end:1276-1295 | None:intergenic | 50.0% |
! | TACTTGGGAGCGCGTGAAAA+CGG | + | contig366end:869-888 | None:intergenic | 50.0% |
! | TGTTACTTAGCGAGCACCTG+CGG | - | contig366end:298-317 | MsG0080048595.01.T01:CDS | 50.0% |
!! | ATCGGAGAGGGTTTGAGTTG+GGG | - | contig366end:199-218 | MsG0080048595.01.T01:intron | 50.0% |
!! | GAGTTGGGGTTGGTAGTGAT+CGG | - | contig366end:213-232 | MsG0080048595.01.T01:intron | 50.0% |
!! | GATCGGGTTGGGATTCCTAA+TGG | - | contig366end:1549-1568 | MsG0080048595.01.T01:CDS | 50.0% |
AGGTGGTCCTAAACTGAGGG+TGG | - | contig366end:1266-1285 | MsG0080048595.01.T01:intron | 55.0% | |
ATTGTTGAGCCCGATCGGGT+TGG | - | contig366end:1537-1556 | MsG0080048595.01.T01:CDS | 55.0% | |
CGCATCTGCCAGTTCGACAA+AGG | + | contig366end:1307-1326 | None:intergenic | 55.0% | |
CGGTTGTGATTGCTGAGACG+GGG | - | contig366end:1766-1785 | MsG0080048595.01.T01:intron | 55.0% | |
GACGCTTCGCAAGTGCCTTA+AGG | + | contig366end:1608-1627 | None:intergenic | 55.0% | |
GCCGTGATGCCATCAGCTAA+AGG | - | contig366end:1342-1361 | MsG0080048595.01.T01:intron | 55.0% | |
GGGACCATCCCTTTAGCTGA+TGG | + | contig366end:1354-1373 | None:intergenic | 55.0% | |
GGTTGTGATTGCTGAGACGG+GGG | - | contig366end:1767-1786 | MsG0080048595.01.T01:intron | 55.0% | |
TTGTTGAGCCCGATCGGGTT+GGG | - | contig366end:1538-1557 | MsG0080048595.01.T01:CDS | 55.0% | |
! | AAACGGCCTTTCGGGGTGTT+TGG | + | contig366end:433-452 | None:intergenic | 55.0% |
! | ACTTGGGAGCGCGTGAAAAC+GGG | + | contig366end:868-887 | None:intergenic | 55.0% |
!! | GAGAGGGTTTGAGTTGGGGT+TGG | - | contig366end:203-222 | MsG0080048595.01.T01:intron | 55.0% |
!! | GTTGGTAGTGATCGGAGTGG+CGG | - | contig366end:221-240 | MsG0080048595.01.T01:intron | 55.0% |
AGCGCTTACCCACATCCCTC+AGG | + | contig366end:1825-1844 | None:intergenic | 60.0% | |
GGGGTTGGAAGCAGCAGTTG+AGG | - | contig366end:1200-1219 | MsG0080048595.01.T01:intron | 60.0% | |
GTCGAACTGGCAGATGCGAG+TGG | - | contig366end:1309-1328 | MsG0080048595.01.T01:intron | 60.0% | |
TGGTGACCAACGGTGGTTGG+TGG | - | contig366end:101-120 | MsG0080048595.01.T01:CDS | 60.0% | |
TTGCTGAGACGGGGGACTCA+TGG | - | contig366end:1775-1794 | MsG0080048595.01.T01:intron | 60.0% | |
! | CTGCTGCTTCCAACCCCATC+TGG | + | contig366end:1197-1216 | None:intergenic | 60.0% |
!! | GGGGTTGGTAGTGATCGGAG+TGG | - | contig366end:218-237 | MsG0080048595.01.T01:intron | 60.0% |
!! | TGACCAACGGTGGTTGGTGG+TGG | - | contig366end:104-123 | MsG0080048595.01.T01:CDS | 60.0% |
CAGCCACCACCAACCACCGT+TGG | + | contig366end:110-129 | None:intergenic | 65.0% | |
GCTGGCAGTGGTCAGAGTGG+TGG | - | contig366end:126-145 | MsG0080048595.01.T01:CDS | 65.0% | |
GGAGCGCGTGAAAACGGGAC+AGG | + | contig366end:863-882 | None:intergenic | 65.0% | |
GTGGCTGGCAGTGGTCAGAG+TGG | - | contig366end:123-142 | MsG0080048595.01.T01:CDS | 65.0% | |
!! | CAACGGTGGTTGGTGGTGGC+TGG | - | contig366end:108-127 | MsG0080048595.01.T01:CDS | 65.0% |
!! | TGGTTGGTGGTGGCTGGCAG+TGG | - | contig366end:114-133 | MsG0080048595.01.T01:CDS | 65.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
contig366end | gene | 100 | 2223 | 100 | ID=MsG0080048595.01;Name=MsG0080048595.01 |
contig366end | mRNA | 100 | 2223 | 100 | ID=MsG0080048595.01.T01;Parent=MsG0080048595.01;Name=MsG0080048595.01.T01;_AED=0.48;_eAED=0.52;_QI=0|0|0|1|1|1|5|0|375 |
contig366end | exon | 2128 | 2223 | 2128 | ID=MsG0080048595.01.T01:exon:26929;Parent=MsG0080048595.01.T01 |
contig366end | exon | 1438 | 1601 | 1438 | ID=MsG0080048595.01.T01:exon:26930;Parent=MsG0080048595.01.T01 |
contig366end | exon | 488 | 1138 | 488 | ID=MsG0080048595.01.T01:exon:26931;Parent=MsG0080048595.01.T01 |
contig366end | exon | 288 | 405 | 288 | ID=MsG0080048595.01.T01:exon:26932;Parent=MsG0080048595.01.T01 |
contig366end | exon | 100 | 198 | 100 | ID=MsG0080048595.01.T01:exon:26933;Parent=MsG0080048595.01.T01 |
contig366end | CDS | 2128 | 2223 | 2128 | ID=MsG0080048595.01.T01:cds;Parent=MsG0080048595.01.T01 |
contig366end | CDS | 1438 | 1601 | 1438 | ID=MsG0080048595.01.T01:cds;Parent=MsG0080048595.01.T01 |
contig366end | CDS | 488 | 1138 | 488 | ID=MsG0080048595.01.T01:cds;Parent=MsG0080048595.01.T01 |
contig366end | CDS | 288 | 405 | 288 | ID=MsG0080048595.01.T01:cds;Parent=MsG0080048595.01.T01 |
contig366end | CDS | 100 | 198 | 100 | ID=MsG0080048595.01.T01:cds;Parent=MsG0080048595.01.T01 |
Gene Sequence |
Protein sequence |