Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048896.01.T01 | XP_003606253.1 | 96.95 | 459 | 14 | 0 | 15 | 473 | 51 | 509 | 0 | 919 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048896.01.T01 | Q9FNJ9 | 68.233 | 447 | 128 | 4 | 25 | 466 | 44 | 481 | 0 | 633 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048896.01.T01 | G7JKZ0 | 96.950 | 459 | 14 | 0 | 15 | 473 | 51 | 509 | 0.0 | 919 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080047831.01 | MsG0080048896.01 | -0.828726 | 7.660752e-55 | 7.677834e-52 |
MsG0080047910.01 | MsG0080048896.01 | 0.854224 | 1.419579e-61 | 3.148490e-58 |
MsG0080047945.01 | MsG0080048896.01 | 0.838855 | 2.243521e-57 | 3.043469e-54 |
MsG0080047955.01 | MsG0080048896.01 | 0.813968 | 1.956603e-51 | 1.296236e-48 |
MsG0080047956.01 | MsG0080048896.01 | 0.835651 | 1.482252e-56 | 1.824151e-53 |
MsG0080047967.01 | MsG0080048896.01 | 0.825312 | 5.021446e-54 | 4.560629e-51 |
MsG0080048059.01 | MsG0080048896.01 | 0.901452 | 2.640659e-78 | 3.570178e-74 |
MsG0080048256.01 | MsG0080048896.01 | -0.858717 | 6.802576e-63 | 1.752504e-59 |
MsG0080048273.01 | MsG0080048896.01 | 0.842052 | 3.272112e-58 | 4.901078e-55 |
MsG0080048274.01 | MsG0080048896.01 | 0.856290 | 3.554775e-62 | 8.441830e-59 |
MsG0080048486.01 | MsG0080048896.01 | -0.809318 | 2.007773e-50 | 1.175048e-47 |
MsG0080048487.01 | MsG0080048896.01 | -0.807234 | 5.583561e-50 | 3.093526e-47 |
MsG0080048488.01 | MsG0080048896.01 | -0.807528 | 4.836907e-50 | 2.700403e-47 |
MsG0080048489.01 | MsG0080048896.01 | -0.808925 | 2.437708e-50 | 1.411684e-47 |
MsG0080048528.01 | MsG0080048896.01 | 0.849111 | 3.988207e-60 | 7.481781e-57 |
MsG0080048560.01 | MsG0080048896.01 | 0.827291 | 1.697003e-54 | 1.631334e-51 |
MsG0080048595.01 | MsG0080048896.01 | -0.803147 | 4.004949e-49 | 1.997548e-46 |
MsG0080048611.01 | MsG0080048896.01 | 0.832353 | 9.923699e-56 | 1.106365e-52 |
MsG0080048694.01 | MsG0080048896.01 | 0.841035 | 6.064213e-58 | 8.798974e-55 |
MsG0080048695.01 | MsG0080048896.01 | 0.841782 | 3.856002e-58 | 5.726667e-55 |
MsG0080048697.01 | MsG0080048896.01 | 0.841392 | 4.885327e-58 | 7.168437e-55 |
MsG0080048776.01 | MsG0080048896.01 | 0.825462 | 4.625995e-54 | 4.219167e-51 |
MsG0080048813.01 | MsG0080048896.01 | 0.811095 | 8.307694e-51 | 5.096335e-48 |
MsG0080048887.01 | MsG0080048896.01 | 0.908068 | 2.557954e-81 | 4.665239e-77 |
MsG0080048896.01 | MsG0080048900.01 | 0.870527 | 1.363959e-66 | 5.322944e-63 |
MsG0080048896.01 | MsG0080048909.01 | 0.869386 | 3.218893e-66 | 1.205930e-62 |
MsG0080048896.01 | MsG0080048917.01 | 0.838659 | 2.522307e-57 | 3.401271e-54 |
MsG0080048896.01 | MsG0080048918.01 | 0.866488 | 2.749675e-65 | 9.283488e-62 |
MsG0080048896.01 | MsG0080048919.01 | 0.853602 | 2.144054e-61 | 4.658419e-58 |
MsG0080048896.01 | MsG0080048929.01 | 0.896711 | 2.837011e-76 | 3.105561e-72 |
MsG0080048896.01 | MsG0080048969.01 | 0.821471 | 3.968284e-53 | 3.231270e-50 |
MsG0080048896.01 | MsG0080048978.01 | 0.825427 | 4.715798e-54 | 4.296783e-51 |
MsG0080048896.01 | MsG0080048987.01 | 0.840114 | 1.056845e-57 | 1.490433e-54 |
MsG0080048896.01 | MsG0080048992.01 | 0.864393 | 1.255606e-64 | 3.936177e-61 |
MsG0080048896.01 | MsG0080049004.01 | 0.834689 | 2.592516e-56 | 3.099306e-53 |
MsG0080048896.01 | MsG0080049015.01 | 0.825968 | 3.509657e-54 | 3.247788e-51 |
MsG0080048896.01 | MsG0080049016.01 | 0.862403 | 5.193144e-64 | 1.519045e-60 |
MsG0080048896.01 | MsG0080049018.01 | 0.879134 | 1.596734e-69 | 8.557716e-66 |
MsG0080048896.01 | MsG0080049019.01 | 0.839698 | 1.356152e-57 | 1.887674e-54 |
MsG0080048896.01 | MsG0080049023.01 | 0.871066 | 9.070459e-67 | 3.609766e-63 |
MsG0080048896.01 | MsG0080049024.01 | 0.886402 | 3.527881e-72 | 2.516527e-68 |
MsG0080048896.01 | MsG0080049038.01 | 0.875965 | 2.031951e-68 | 9.679469e-65 |
MsG0080048896.01 | MsG0080049053.01 | 0.854021 | 1.623936e-61 | 3.577759e-58 |
MsG0080048896.01 | MsG0080049062.01 | 0.937222 | 4.915046e-98 | 4.391934e-93 |
MsG0080048896.01 | MsG0080049066.01 | 0.878626 | 2.411044e-69 | 1.268070e-65 |
MsG0080048896.01 | MsG0080049072.01 | 0.862315 | 5.528038e-64 | 1.611983e-60 |
MsG0080048896.01 | MsG0080049076.01 | 0.805489 | 1.302315e-49 | 6.899018e-47 |
MsG0080048896.01 | MsG0080049129.01 | 0.864947 | 8.427138e-65 | 2.693845e-61 |
MsG0080048896.01 | MsG0080049133.01 | 0.857859 | 1.224759e-62 | 3.065793e-59 |
MsG0080048896.01 | MsG0180000017.01 | 0.800899 | 1.160756e-48 | 5.468625e-46 |
MsG0080048896.01 | MsG0180000040.01 | 0.801651 | 8.143331e-49 | 3.909818e-46 |
MsG0080048896.01 | MsG0180000193.01 | 0.845476 | 3.964858e-59 | 6.615631e-56 |
MsG0080048896.01 | MsG0180000194.01 | 0.845164 | 4.816711e-59 | 7.956294e-56 |
MsG0080048896.01 | MsG0180000305.01 | 0.836591 | 8.554875e-57 | 1.083012e-53 |
MsG0080048896.01 | MsG0180000306.01 | 0.871114 | 8.744086e-67 | 3.485511e-63 |
MsG0080048896.01 | MsG0180000322.01 | 0.848490 | 5.930265e-60 | 1.090226e-56 |
MsG0080048896.01 | MsG0180000325.01 | 0.893273 | 7.331546e-75 | 6.939445e-71 |
MsG0080048896.01 | MsG0180000352.01 | 0.880416 | 5.589095e-70 | 3.146605e-66 |
MsG0080048896.01 | MsG0180000367.01 | -0.844386 | 7.807724e-59 | 1.258352e-55 |
MsG0080048896.01 | MsG0180000412.01 | 0.808287 | 3.335959e-50 | 1.899903e-47 |
MsG0080048896.01 | MsG0180000417.01 | 0.897811 | 9.784157e-77 | 1.124178e-72 |
MsG0080048896.01 | MsG0180000423.01 | 0.870025 | 1.992144e-66 | 7.635447e-63 |
MsG0080048896.01 | MsG0180000467.01 | 0.899443 | 1.971578e-77 | 2.439054e-73 |
MsG0080048896.01 | MsG0180000490.01 | 0.827329 | 1.661535e-54 | 1.599140e-51 |
MsG0080048896.01 | MsG0180000491.01 | 0.800756 | 1.241071e-48 | 5.825486e-46 |
MsG0080048896.01 | MsG0180000502.01 | 0.805186 | 1.507426e-49 | 7.923611e-47 |
MsG0080048896.01 | MsG0180000541.01 | 0.882380 | 1.093994e-70 | 6.648314e-67 |
MsG0080048896.01 | MsG0180000638.01 | 0.824558 | 7.564333e-54 | 6.723701e-51 |
MsG0080048896.01 | MsG0180000708.01 | 0.871328 | 7.428988e-67 | 2.985152e-63 |
MsG0080048896.01 | MsG0180000719.01 | 0.854888 | 9.117992e-62 | 2.066765e-58 |
MsG0080048896.01 | MsG0180000786.01 | 0.805539 | 1.271589e-49 | 6.744562e-47 |
MsG0080048896.01 | MsG0180000793.01 | 0.809397 | 1.930855e-50 | 1.132458e-47 |
MsG0080048896.01 | MsG0180001054.01 | 0.879841 | 8.962103e-70 | 4.934786e-66 |
MsG0080048896.01 | MsG0180001072.01 | 0.831262 | 1.844162e-55 | 1.990648e-52 |
MsG0080048896.01 | MsG0180001084.01 | -0.822635 | 2.131611e-53 | 1.794357e-50 |
MsG0080048896.01 | MsG0180001113.01 | 0.878397 | 2.904114e-69 | 1.514077e-65 |
MsG0080048896.01 | MsG0180001137.01 | 0.828233 | 1.007468e-54 | 9.953982e-52 |
MsG0080048896.01 | MsG0180001249.01 | 0.866619 | 2.497800e-65 | 8.473121e-62 |
MsG0080048896.01 | MsG0180001264.01 | -0.844659 | 6.592098e-59 | 1.071632e-55 |
MsG0080048896.01 | MsG0180001484.01 | 0.865139 | 7.334702e-65 | 2.361143e-61 |
MsG0080048896.01 | MsG0180001614.01 | 0.908001 | 2.752750e-81 | 5.006810e-77 |
MsG0080048896.01 | MsG0180001615.01 | 0.840586 | 7.954670e-58 | 1.138260e-54 |
MsG0080048896.01 | MsG0180001664.01 | 0.905259 | 5.185943e-80 | 8.318303e-76 |
MsG0080048896.01 | MsG0180001797.01 | -0.805650 | 1.205120e-49 | 6.410546e-47 |
MsG0080048896.01 | MsG0180001827.01 | 0.886647 | 2.850195e-72 | 2.053279e-68 |
MsG0080048896.01 | MsG0180001907.01 | 0.834305 | 3.236540e-56 | 3.825764e-53 |
MsG0080048896.01 | MsG0180001925.01 | 0.841981 | 3.416982e-58 | 5.106828e-55 |
MsG0080048896.01 | MsG0180002021.01 | 0.804573 | 2.024940e-49 | 1.047689e-46 |
MsG0080048896.01 | MsG0180002099.01 | 0.874143 | 8.499926e-68 | 3.784008e-64 |
MsG0080048896.01 | MsG0180002214.01 | 0.831676 | 1.458088e-55 | 1.593614e-52 |
MsG0080048896.01 | MsG0180002227.01 | 0.818333 | 2.070504e-52 | 1.545388e-49 |
MsG0080048896.01 | MsG0180002425.01 | 0.875670 | 2.566444e-68 | 1.208812e-64 |
MsG0080048896.01 | MsG0180002426.01 | 0.818746 | 1.668580e-52 | 1.259663e-49 |
MsG0080048896.01 | MsG0180002454.01 | 0.838322 | 3.080652e-57 | 4.111218e-54 |
MsG0080048896.01 | MsG0180002671.01 | 0.838590 | 2.626751e-57 | 3.534777e-54 |
MsG0080048896.01 | MsG0180002809.01 | 0.888621 | 5.019313e-73 | 3.917733e-69 |
MsG0080048896.01 | MsG0180002935.01 | -0.824868 | 6.390914e-54 | 5.731820e-51 |
MsG0080048896.01 | MsG0180002982.01 | 0.924474 | 6.711465e-90 | 2.841703e-85 |
MsG0080048896.01 | MsG0180003114.01 | 0.902560 | 8.556025e-79 | 1.218651e-74 |
MsG0080048896.01 | MsG0180003235.01 | -0.820445 | 6.833542e-53 | 5.408165e-50 |
MsG0080048896.01 | MsG0180003274.01 | 0.819672 | 1.026808e-52 | 7.953410e-50 |
MsG0080048896.01 | MsG0180003296.01 | 0.863142 | 3.073216e-64 | 9.221364e-61 |
MsG0080048896.01 | MsG0180003324.01 | 0.858492 | 7.935719e-63 | 2.028987e-59 |
MsG0080048896.01 | MsG0180003325.01 | 0.818285 | 2.122818e-52 | 1.582275e-49 |
MsG0080048896.01 | MsG0180003350.01 | 0.863696 | 2.070641e-64 | 6.334817e-61 |
MsG0080048896.01 | MsG0180003351.01 | 0.880320 | 6.047182e-70 | 3.391192e-66 |
MsG0080048896.01 | MsG0180003405.01 | 0.843291 | 1.533703e-58 | 2.388673e-55 |
MsG0080048896.01 | MsG0180003442.01 | 0.882822 | 7.547563e-71 | 4.667171e-67 |
MsG0080048896.01 | MsG0180003451.01 | 0.841196 | 5.500703e-58 | 8.021625e-55 |
MsG0080048896.01 | MsG0180003453.01 | 0.883262 | 5.207993e-71 | 3.278063e-67 |
MsG0080048896.01 | MsG0180003503.01 | 0.841252 | 5.318002e-58 | 7.768259e-55 |
MsG0080048896.01 | MsG0180003605.01 | 0.859583 | 3.740232e-63 | 9.926848e-60 |
MsG0080048896.01 | MsG0180003617.01 | 0.804423 | 2.175365e-49 | 1.121153e-46 |
MsG0080048896.01 | MsG0180003757.01 | 0.889188 | 3.029819e-73 | 2.419397e-69 |
MsG0080048896.01 | MsG0180003758.01 | 0.915148 | 8.300258e-85 | 2.138294e-80 |
MsG0080048896.01 | MsG0180003759.01 | 0.849129 | 3.942137e-60 | 7.400235e-57 |
MsG0080048896.01 | MsG0180003779.01 | 0.870822 | 1.091378e-66 | 4.304619e-63 |
MsG0080048896.01 | MsG0180003880.01 | 0.893673 | 5.049260e-75 | 4.858979e-71 |
MsG0080048896.01 | MsG0180003904.01 | 0.907347 | 5.588638e-81 | 9.877830e-77 |
MsG0080048896.01 | MsG0180003908.01 | 0.801949 | 7.072224e-49 | 3.421365e-46 |
MsG0080048896.01 | MsG0180003933.01 | 0.885802 | 5.937053e-72 | 4.134024e-68 |
MsG0080048896.01 | MsG0180003980.01 | 0.865869 | 4.319182e-65 | 1.426787e-61 |
MsG0080048896.01 | MsG0180003985.01 | 0.926999 | 2.163022e-91 | 1.055319e-86 |
MsG0080048896.01 | MsG0180004018.01 | 0.854226 | 1.417323e-61 | 3.143763e-58 |
MsG0080048896.01 | MsG0180004059.01 | -0.805503 | 1.293814e-49 | 6.856189e-47 |
MsG0080048896.01 | MsG0180004124.01 | 0.856157 | 3.889933e-62 | 9.197436e-59 |
MsG0080048896.01 | MsG0180004125.01 | 0.857283 | 1.813384e-62 | 4.452096e-59 |
MsG0080048896.01 | MsG0180004177.01 | 0.921163 | 5.086904e-88 | 1.789967e-83 |
MsG0080048896.01 | MsG0180004187.01 | 0.811964 | 5.379297e-51 | 3.376589e-48 |
MsG0080048896.01 | MsG0180004193.01 | 0.881833 | 1.727046e-70 | 1.027338e-66 |
MsG0080048896.01 | MsG0180004226.01 | 0.827785 | 1.291141e-54 | 1.259052e-51 |
MsG0080048896.01 | MsG0180004292.01 | 0.921978 | 1.784591e-88 | 6.568922e-84 |
MsG0080048896.01 | MsG0180004301.01 | 0.815487 | 9.015454e-52 | 6.224499e-49 |
MsG0080048896.01 | MsG0180004302.01 | 0.839593 | 1.444032e-57 | 2.003638e-54 |
MsG0080048896.01 | MsG0180004311.01 | 0.870131 | 1.839365e-66 | 7.075928e-63 |
MsG0080048896.01 | MsG0180004322.01 | 0.919529 | 4.015818e-87 | 1.295342e-82 |
MsG0080048896.01 | MsG0180004386.01 | 0.895907 | 6.129916e-76 | 6.480903e-72 |
MsG0080048896.01 | MsG0180004458.01 | 0.865106 | 7.510508e-65 | 2.414878e-61 |
MsG0080048896.01 | MsG0180004502.01 | 0.889714 | 1.891065e-73 | 1.543206e-69 |
MsG0080048896.01 | MsG0180004504.01 | 0.893943 | 3.923997e-75 | 3.820577e-71 |
MsG0080048896.01 | MsG0180004553.01 | 0.924721 | 4.822372e-90 | 2.066945e-85 |
MsG0080048896.01 | MsG0180004580.01 | 0.914805 | 1.244492e-84 | 3.151339e-80 |
MsG0080048896.01 | MsG0180004581.01 | 0.915046 | 9.368395e-85 | 2.401362e-80 |
MsG0080048896.01 | MsG0180004586.01 | 0.849659 | 2.806571e-60 | 5.358799e-57 |
MsG0080048896.01 | MsG0180004634.01 | 0.860413 | 2.101585e-63 | 5.739864e-60 |
MsG0080048896.01 | MsG0180004672.01 | 0.811997 | 5.290398e-51 | 3.323813e-48 |
MsG0080048896.01 | MsG0180004731.01 | 0.804014 | 2.646619e-49 | 1.349859e-46 |
MsG0080048896.01 | MsG0180004737.01 | 0.824885 | 6.332171e-54 | 5.682125e-51 |
MsG0080048896.01 | MsG0180004739.01 | 0.816476 | 5.423017e-52 | 3.846568e-49 |
MsG0080048896.01 | MsG0180004773.01 | 0.863228 | 2.891353e-64 | 8.702484e-61 |
MsG0080048896.01 | MsG0180004782.01 | 0.859525 | 3.895501e-63 | 1.031860e-59 |
MsG0080048896.01 | MsG0180004787.01 | 0.824059 | 9.911153e-54 | 8.684070e-51 |
MsG0080048896.01 | MsG0180004852.01 | 0.895855 | 6.445860e-76 | 6.800976e-72 |
MsG0080048896.01 | MsG0180004865.01 | 0.842282 | 2.843317e-58 | 4.290120e-55 |
MsG0080048896.01 | MsG0180004937.01 | 0.818708 | 1.702651e-52 | 1.283976e-49 |
MsG0080048896.01 | MsG0180004957.01 | 0.834970 | 2.202483e-56 | 2.655895e-53 |
MsG0080048896.01 | MsG0180004978.01 | 0.822997 | 1.755490e-53 | 1.492883e-50 |
MsG0080048896.01 | MsG0180004987.01 | 0.820620 | 6.229326e-53 | 4.953455e-50 |
MsG0080048896.01 | MsG0180005016.01 | 0.800654 | 1.302387e-48 | 6.097642e-46 |
MsG0080048896.01 | MsG0180005119.01 | 0.829627 | 4.631961e-55 | 4.766830e-52 |
MsG0080048896.01 | MsG0180005150.01 | 0.853566 | 2.196228e-61 | 4.765838e-58 |
MsG0080048896.01 | MsG0180005242.01 | 0.824857 | 6.430400e-54 | 5.765286e-51 |
MsG0080048896.01 | MsG0180005283.01 | 0.891584 | 3.476940e-74 | 3.067256e-70 |
MsG0080048896.01 | MsG0180005291.01 | 0.854422 | 1.243651e-61 | 2.775895e-58 |
MsG0080048896.01 | MsG0180005369.01 | 0.854874 | 9.202779e-62 | 2.085191e-58 |
MsG0080048896.01 | MsG0180005416.01 | 0.800925 | 1.146746e-48 | 5.406066e-46 |
MsG0080048896.01 | MsG0180005431.01 | 0.833955 | 3.959893e-56 | 4.632064e-53 |
MsG0080048896.01 | MsG0180005471.01 | -0.836498 | 9.035878e-57 | 1.140710e-53 |
MsG0080048896.01 | MsG0180005474.01 | 0.810864 | 9.322320e-51 | 5.683914e-48 |
MsG0080048896.01 | MsG0180005516.01 | 0.911897 | 3.611258e-83 | 7.913589e-79 |
MsG0080048896.01 | MsG0180005542.01 | -0.815293 | 9.958020e-52 | 6.838262e-49 |
MsG0080048896.01 | MsG0180005561.01 | 0.868389 | 6.769455e-66 | 2.444382e-62 |
MsG0080048896.01 | MsG0180005613.01 | 0.839492 | 1.534087e-57 | 2.122105e-54 |
MsG0080048896.01 | MsG0180005657.01 | 0.820832 | 5.567548e-53 | 4.454035e-50 |
MsG0080048896.01 | MsG0180005672.01 | 0.887188 | 1.776429e-72 | 1.307789e-68 |
MsG0080048896.01 | MsG0180005760.01 | 0.847709 | 9.738535e-60 | 1.746098e-56 |
MsG0080048896.01 | MsG0180005767.01 | 0.817615 | 3.008098e-52 | 2.201243e-49 |
MsG0080048896.01 | MsG0180005791.01 | 0.856820 | 2.484837e-62 | 6.004883e-59 |
MsG0080048896.01 | MsG0180005806.01 | 0.853658 | 2.066470e-61 | 4.497714e-58 |
MsG0080048896.01 | MsG0180005811.01 | 0.845045 | 5.185995e-59 | 8.535319e-56 |
MsG0080048896.01 | MsG0180005822.01 | 0.800010 | 1.761554e-48 | 8.113415e-46 |
MsG0080048896.01 | MsG0180005833.01 | 0.903977 | 1.984178e-79 | 3.004296e-75 |
MsG0080048896.01 | MsG0180005848.01 | 0.879500 | 1.184151e-69 | 6.434999e-66 |
MsG0080048896.01 | MsG0180005879.01 | 0.863242 | 2.862951e-64 | 8.621198e-61 |
MsG0080048896.01 | MsG0180005991.01 | 0.847206 | 1.339275e-59 | 2.362768e-56 |
MsG0080048896.01 | MsG0180006042.01 | 0.858527 | 7.747749e-63 | 1.983264e-59 |
MsG0080048896.01 | MsG0180006159.01 | 0.884292 | 2.171623e-71 | 1.425083e-67 |
MsG0080048896.01 | MsG0180006200.01 | 0.829664 | 4.534700e-55 | 4.672176e-52 |
MsG0080048896.01 | MsG0180006212.01 | 0.888331 | 6.489866e-73 | 5.006854e-69 |
MsG0080048896.01 | MsG0180006223.01 | 0.875741 | 2.425743e-68 | 1.145724e-64 |
MsG0080048896.01 | MsG0180006227.01 | 0.896456 | 3.625482e-76 | 3.924685e-72 |
MsG0080048896.01 | MsG0180006239.01 | 0.843186 | 1.635680e-58 | 2.538710e-55 |
MsG0080048896.01 | MsG0280006307.01 | 0.835345 | 1.771652e-56 | 2.160631e-53 |
MsG0080048896.01 | MsG0280006316.01 | -0.814320 | 1.635600e-51 | 1.094016e-48 |
MsG0080048896.01 | MsG0280006336.01 | 0.909803 | 3.802453e-82 | 7.527919e-78 |
MsG0080048896.01 | MsG0280006381.01 | 0.884276 | 2.202380e-71 | 1.444207e-67 |
MsG0080048896.01 | MsG0280006402.01 | 0.815819 | 7.603326e-52 | 5.297016e-49 |
MsG0080048896.01 | MsG0280006451.01 | 0.857678 | 1.385639e-62 | 3.447716e-59 |
MsG0080048896.01 | MsG0280006452.01 | 0.901522 | 2.461929e-78 | 3.339360e-74 |
MsG0080048896.01 | MsG0280006534.01 | 0.880234 | 6.492929e-70 | 3.629396e-66 |
MsG0080048896.01 | MsG0280006607.01 | 0.825196 | 5.347627e-54 | 4.841089e-51 |
MsG0080048896.01 | MsG0280006706.01 | 0.828340 | 9.492813e-55 | 9.408151e-52 |
MsG0080048896.01 | MsG0280006737.01 | -0.835403 | 1.712933e-56 | 2.092537e-53 |
MsG0080048896.01 | MsG0280006764.01 | 0.804068 | 2.579392e-49 | 1.317427e-46 |
MsG0080048896.01 | MsG0280006898.01 | -0.812658 | 3.795325e-51 | 2.427133e-48 |
MsG0080048896.01 | MsG0280006964.01 | 0.802678 | 5.005713e-49 | 2.467041e-46 |
MsG0080048896.01 | MsG0280006973.01 | 0.871327 | 7.436112e-67 | 2.987874e-63 |
MsG0080048896.01 | MsG0280007016.01 | 0.901988 | 1.533386e-78 | 2.125343e-74 |
MsG0080048896.01 | MsG0280007017.01 | 0.913943 | 3.419716e-84 | 8.291666e-80 |
MsG0080048896.01 | MsG0280007041.01 | 0.820462 | 6.771437e-53 | 5.361722e-50 |
MsG0080048896.01 | MsG0280007069.01 | 0.815326 | 9.792753e-52 | 6.730734e-49 |
MsG0080048896.01 | MsG0280007079.01 | 0.857995 | 1.115636e-62 | 2.805567e-59 |
MsG0080048896.01 | MsG0280007102.01 | 0.869440 | 3.092136e-66 | 1.160686e-62 |
MsG0080048896.01 | MsG0280007136.01 | 0.887227 | 1.717620e-72 | 1.266538e-68 |
MsG0080048896.01 | MsG0280007201.01 | -0.821684 | 3.542881e-53 | 2.902364e-50 |
MsG0080048896.01 | MsG0280007216.01 | -0.835411 | 1.704167e-56 | 2.082323e-53 |
MsG0080048896.01 | MsG0280007227.01 | -0.813775 | 2.158282e-51 | 1.422332e-48 |
MsG0080048896.01 | MsG0280007233.01 | 0.851325 | 9.554410e-61 | 1.926992e-57 |
MsG0080048896.01 | MsG0280007247.01 | 0.910946 | 1.059151e-82 | 2.218512e-78 |
MsG0080048896.01 | MsG0280007248.01 | 0.849645 | 2.831617e-60 | 5.403873e-57 |
MsG0080048896.01 | MsG0280007288.01 | 0.853360 | 2.515756e-61 | 5.421647e-58 |
MsG0080048896.01 | MsG0280007291.01 | 0.846538 | 2.040248e-59 | 3.523047e-56 |
MsG0080048896.01 | MsG0280007322.01 | 0.911057 | 9.346097e-83 | 1.967587e-78 |
MsG0080048896.01 | MsG0280007418.01 | 0.847924 | 8.497535e-60 | 1.533963e-56 |
MsG0080048896.01 | MsG0280007511.01 | 0.834920 | 2.267526e-56 | 2.730115e-53 |
MsG0080048896.01 | MsG0280007576.01 | 0.832657 | 8.340883e-56 | 9.384179e-53 |
MsG0080048896.01 | MsG0280007600.01 | 0.860891 | 1.505873e-63 | 4.180571e-60 |
MsG0080048896.01 | MsG0280007628.01 | 0.801326 | 9.493566e-49 | 4.520957e-46 |
MsG0080048896.01 | MsG0280007649.01 | 0.877657 | 5.272814e-69 | 2.672704e-65 |
MsG0080048896.01 | MsG0280007650.01 | 0.878454 | 2.772568e-69 | 1.448773e-65 |
MsG0080048896.01 | MsG0280007653.01 | 0.867196 | 1.635984e-65 | 5.662464e-62 |
MsG0080048896.01 | MsG0280007702.01 | 0.851884 | 6.632586e-61 | 1.361545e-57 |
MsG0080048896.01 | MsG0280007703.01 | 0.800392 | 1.472804e-48 | 6.849792e-46 |
MsG0080048896.01 | MsG0280007783.01 | 0.821218 | 4.537055e-53 | 3.668917e-50 |
MsG0080048896.01 | MsG0280007786.01 | -0.841287 | 5.208186e-58 | 7.615945e-55 |
MsG0080048896.01 | MsG0280007800.01 | 0.810109 | 1.357494e-50 | 8.112690e-48 |
MsG0080048896.01 | MsG0280008015.01 | 0.837270 | 5.737773e-57 | 7.414123e-54 |
MsG0080048896.01 | MsG0280008227.01 | 0.851210 | 1.029188e-60 | 2.067866e-57 |
MsG0080048896.01 | MsG0280008233.01 | 0.843635 | 1.241312e-58 | 1.954431e-55 |
MsG0080048896.01 | MsG0280008430.01 | 0.907987 | 2.795219e-81 | 5.082015e-77 |
MsG0080048896.01 | MsG0280008588.01 | 0.804191 | 2.431438e-49 | 1.245697e-46 |
MsG0080048896.01 | MsG0280008913.01 | 0.838568 | 2.662560e-57 | 3.580328e-54 |
MsG0080048896.01 | MsG0280008935.01 | 0.855441 | 6.294506e-62 | 1.453397e-58 |
MsG0080048896.01 | MsG0280009008.01 | 0.833920 | 4.041184e-56 | 4.722351e-53 |
MsG0080048896.01 | MsG0280009079.01 | 0.906617 | 1.225689e-80 | 2.093452e-76 |
MsG0080048896.01 | MsG0280009094.01 | 0.900522 | 6.736709e-78 | 8.748257e-74 |
MsG0080048896.01 | MsG0280009101.01 | 0.886417 | 3.482820e-72 | 2.485870e-68 |
MsG0080048896.01 | MsG0280009103.01 | 0.917018 | 8.844409e-86 | 2.498306e-81 |
MsG0080048896.01 | MsG0280009167.01 | -0.843290 | 1.534176e-58 | 2.389339e-55 |
MsG0080048896.01 | MsG0280009287.01 | 0.892673 | 1.277559e-74 | 1.179573e-70 |
MsG0080048896.01 | MsG0280009434.01 | 0.892589 | 1.380305e-74 | 1.269937e-70 |
MsG0080048896.01 | MsG0280009518.01 | 0.866455 | 2.815205e-65 | 9.493982e-62 |
MsG0080048896.01 | MsG0280009526.01 | -0.839476 | 1.548604e-57 | 2.141140e-54 |
MsG0080048896.01 | MsG0280009542.01 | 0.818282 | 2.126020e-52 | 1.584536e-49 |
MsG0080048896.01 | MsG0280009579.01 | 0.815071 | 1.115466e-51 | 7.613370e-49 |
MsG0080048896.01 | MsG0280009667.01 | -0.810927 | 9.034810e-51 | 5.518049e-48 |
MsG0080048896.01 | MsG0280009689.01 | -0.833192 | 6.142986e-56 | 7.022717e-53 |
MsG0080048896.01 | MsG0280009742.01 | 0.901686 | 2.084332e-78 | 2.848156e-74 |
MsG0080048896.01 | MsG0280009751.01 | 0.876672 | 1.158814e-68 | 5.667417e-65 |
MsG0080048896.01 | MsG0280009776.01 | 0.923332 | 3.053727e-89 | 1.214181e-84 |
MsG0080048896.01 | MsG0280009863.01 | 0.826708 | 2.339159e-54 | 2.210616e-51 |
MsG0080048896.01 | MsG0280009864.01 | 0.872431 | 3.197295e-67 | 1.337779e-63 |
MsG0080048896.01 | MsG0280009956.01 | 0.829499 | 4.975963e-55 | 5.101588e-52 |
MsG0080048896.01 | MsG0280010019.01 | -0.814163 | 1.771595e-51 | 1.179896e-48 |
MsG0080048896.01 | MsG0280010142.01 | 0.852631 | 4.066510e-61 | 8.549929e-58 |
MsG0080048896.01 | MsG0280010143.01 | 0.836364 | 9.774690e-57 | 1.229138e-53 |
MsG0080048896.01 | MsG0280010144.01 | 0.827839 | 1.253670e-54 | 1.224430e-51 |
MsG0080048896.01 | MsG0280010149.01 | 0.868744 | 5.200390e-66 | 1.902444e-62 |
MsG0080048896.01 | MsG0280010195.01 | 0.818896 | 1.542987e-52 | 1.169772e-49 |
MsG0080048896.01 | MsG0280010227.01 | 0.811345 | 7.334817e-51 | 4.528884e-48 |
MsG0080048896.01 | MsG0280010281.01 | 0.880119 | 7.136441e-70 | 3.972967e-66 |
MsG0080048896.01 | MsG0280010356.01 | 0.882415 | 1.062242e-70 | 6.464140e-67 |
MsG0080048896.01 | MsG0280010455.01 | 0.828049 | 1.115892e-54 | 1.096669e-51 |
MsG0080048896.01 | MsG0280010461.01 | 0.857346 | 1.738113e-62 | 4.276682e-59 |
MsG0080048896.01 | MsG0280010496.01 | 0.888162 | 7.535426e-73 | 5.771507e-69 |
MsG0080048896.01 | MsG0280010523.01 | 0.848641 | 5.385747e-60 | 9.948373e-57 |
MsG0080048896.01 | MsG0280010584.01 | 0.811170 | 8.002658e-51 | 4.918714e-48 |
MsG0080048896.01 | MsG0280010605.01 | 0.846482 | 2.113383e-59 | 3.643154e-56 |
MsG0080048896.01 | MsG0280010606.01 | 0.844613 | 6.782713e-59 | 1.101050e-55 |
MsG0080048896.01 | MsG0280010625.01 | 0.835191 | 1.937199e-56 | 2.351481e-53 |
MsG0080048896.01 | MsG0280010637.01 | 0.825447 | 4.665630e-54 | 4.253359e-51 |
MsG0080048896.01 | MsG0280010661.01 | 0.805662 | 1.198189e-49 | 6.375656e-47 |
MsG0080048896.01 | MsG0280010704.01 | 0.860267 | 2.327195e-63 | 6.323711e-60 |
MsG0080048896.01 | MsG0280010780.01 | 0.838932 | 2.143844e-57 | 2.915002e-54 |
MsG0080048896.01 | MsG0280010803.01 | 0.852365 | 4.844257e-61 | 1.009861e-57 |
MsG0080048896.01 | MsG0280010905.01 | 0.840834 | 6.847944e-58 | 9.875210e-55 |
MsG0080048896.01 | MsG0280010994.01 | 0.876724 | 1.111995e-68 | 5.448317e-65 |
MsG0080048896.01 | MsG0280010998.01 | 0.817127 | 3.873869e-52 | 2.797196e-49 |
MsG0080048896.01 | MsG0280011066.01 | 0.806991 | 6.284667e-50 | 3.459990e-47 |
MsG0080048896.01 | MsG0280011067.01 | 0.813253 | 2.810796e-51 | 1.826240e-48 |
MsG0080048896.01 | MsG0280011162.01 | 0.838808 | 2.307921e-57 | 3.126240e-54 |
MsG0080048896.01 | MsG0280011189.01 | 0.889428 | 2.443608e-73 | 1.970432e-69 |
MsG0080048896.01 | MsG0280011197.01 | 0.829914 | 3.942575e-55 | 4.091704e-52 |
MsG0080048896.01 | MsG0280011200.01 | 0.845463 | 3.997699e-59 | 6.667613e-56 |
MsG0080048896.01 | MsG0280011207.01 | 0.818731 | 1.682112e-52 | 1.269319e-49 |
MsG0080048896.01 | MsG0280011240.01 | 0.821737 | 3.444236e-53 | 2.825684e-50 |
MsG0080048896.01 | MsG0280011276.01 | 0.892343 | 1.732572e-74 | 1.577302e-70 |
MsG0080048896.01 | MsG0280011279.01 | 0.905523 | 3.921626e-80 | 6.367853e-76 |
MsG0080048896.01 | MsG0280011281.01 | 0.889114 | 3.235815e-73 | 2.576085e-69 |
MsG0080048896.01 | MsG0280011299.01 | 0.815732 | 7.952767e-52 | 5.527750e-49 |
MsG0080048896.01 | MsG0280011301.01 | 0.895841 | 6.531607e-76 | 6.887813e-72 |
MsG0080048896.01 | MsG0280011322.01 | 0.801964 | 7.022533e-49 | 3.398527e-46 |
MsG0080048896.01 | MsG0280011372.01 | 0.869922 | 2.153768e-66 | 8.223803e-63 |
MsG0080048896.01 | MsG0280011449.01 | 0.838709 | 2.447368e-57 | 3.305541e-54 |
MsG0080048896.01 | MsG0280011475.01 | 0.919392 | 4.769941e-87 | 1.529377e-82 |
MsG0080048896.01 | MsG0380011632.01 | 0.829588 | 4.733534e-55 | 4.865910e-52 |
MsG0080048896.01 | MsG0380011635.01 | -0.812315 | 4.511150e-51 | 2.858848e-48 |
MsG0080048896.01 | MsG0380011693.01 | 0.800938 | 1.139557e-48 | 5.374018e-46 |
MsG0080048896.01 | MsG0380011739.01 | 0.851810 | 6.963252e-61 | 1.426173e-57 |
MsG0080048896.01 | MsG0380011825.01 | 0.809605 | 1.741791e-50 | 1.027294e-47 |
MsG0080048896.01 | MsG0380011896.01 | 0.871631 | 5.899572e-67 | 2.396603e-63 |
MsG0080048896.01 | MsG0380012065.01 | 0.900338 | 8.098090e-78 | 1.042711e-73 |
MsG0080048896.01 | MsG0380012148.01 | 0.839738 | 1.323794e-57 | 1.844979e-54 |
MsG0080048896.01 | MsG0380012157.01 | 0.872948 | 2.147488e-67 | 9.154145e-64 |
MsG0080048896.01 | MsG0380012281.01 | 0.875395 | 3.188584e-68 | 1.486152e-64 |
MsG0080048896.01 | MsG0380012444.01 | 0.861578 | 9.300738e-64 | 2.644225e-60 |
MsG0080048896.01 | MsG0380012527.01 | 0.816242 | 6.118905e-52 | 4.312622e-49 |
MsG0080048896.01 | MsG0380012625.01 | 0.852034 | 6.014755e-61 | 1.240740e-57 |
MsG0080048896.01 | MsG0380012779.01 | 0.853736 | 1.962435e-61 | 4.282386e-58 |
MsG0080048896.01 | MsG0380012780.01 | 0.842480 | 2.520704e-58 | 3.827430e-55 |
MsG0080048896.01 | MsG0380012782.01 | 0.867891 | 9.797335e-66 | 3.475580e-62 |
MsG0080048896.01 | MsG0380012801.01 | 0.805199 | 1.498087e-49 | 7.877183e-47 |
MsG0080048896.01 | MsG0380012804.01 | 0.832839 | 7.517813e-56 | 8.503557e-53 |
MsG0080048896.01 | MsG0380012876.01 | 0.829104 | 6.204103e-55 | 6.287559e-52 |
MsG0080048896.01 | MsG0380013022.01 | 0.804500 | 2.096602e-49 | 1.082697e-46 |
MsG0080048896.01 | MsG0380013111.01 | 0.880192 | 6.721848e-70 | 3.751835e-66 |
MsG0080048896.01 | MsG0380013114.01 | 0.898418 | 5.412273e-77 | 6.390864e-73 |
MsG0080048896.01 | MsG0380013177.01 | 0.812243 | 4.676682e-51 | 2.958040e-48 |
MsG0080048896.01 | MsG0380013473.01 | 0.877922 | 4.258007e-69 | 2.180770e-65 |
MsG0080048896.01 | MsG0380013493.01 | 0.836604 | 8.491640e-57 | 1.075373e-53 |
MsG0080048896.01 | MsG0380013501.01 | 0.927958 | 5.675222e-92 | 2.914247e-87 |
MsG0080048896.01 | MsG0380013506.01 | 0.897911 | 8.880648e-77 | 1.025288e-72 |
MsG0080048896.01 | MsG0380013530.01 | 0.847015 | 1.510575e-59 | 2.648489e-56 |
MsG0080048896.01 | MsG0380013840.01 | 0.838493 | 2.782998e-57 | 3.733765e-54 |
MsG0080048896.01 | MsG0380013891.01 | 0.830805 | 2.388006e-55 | 2.543357e-52 |
MsG0080048896.01 | MsG0380013919.01 | 0.829581 | 4.752001e-55 | 4.883807e-52 |
MsG0080048896.01 | MsG0380013921.01 | 0.841021 | 6.116203e-58 | 8.870303e-55 |
MsG0080048896.01 | MsG0380013925.01 | 0.852043 | 5.980156e-61 | 1.233955e-57 |
MsG0080048896.01 | MsG0380013928.01 | 0.858570 | 7.524550e-63 | 1.928824e-59 |
MsG0080048896.01 | MsG0380013935.01 | 0.802823 | 4.673200e-49 | 2.311877e-46 |
MsG0080048896.01 | MsG0380013938.01 | 0.857808 | 1.268163e-62 | 3.168707e-59 |
MsG0080048896.01 | MsG0380013956.01 | 0.860535 | 1.929978e-63 | 5.293329e-60 |
MsG0080048896.01 | MsG0380013958.01 | 0.805214 | 1.487005e-49 | 7.821872e-47 |
MsG0080048896.01 | MsG0380013971.01 | 0.825357 | 4.898923e-54 | 4.454896e-51 |
MsG0080048896.01 | MsG0380013975.01 | 0.833995 | 3.870372e-56 | 4.532596e-53 |
MsG0080048896.01 | MsG0380013976.01 | 0.846885 | 1.639139e-59 | 2.862031e-56 |
MsG0080048896.01 | MsG0380013985.01 | 0.831101 | 2.019572e-55 | 2.169766e-52 |
MsG0080048896.01 | MsG0380013992.01 | 0.814603 | 1.416637e-51 | 9.547957e-49 |
MsG0080048896.01 | MsG0380014004.01 | 0.811422 | 7.057959e-51 | 4.367124e-48 |
MsG0080048896.01 | MsG0380014016.01 | 0.818038 | 2.414108e-52 | 1.787183e-49 |
MsG0080048896.01 | MsG0380014020.01 | 0.808009 | 3.822325e-50 | 2.160967e-47 |
MsG0080048896.01 | MsG0380014021.01 | 0.804826 | 1.793049e-49 | 9.338496e-47 |
MsG0080048896.01 | MsG0380014024.01 | 0.847680 | 9.920420e-60 | 1.777102e-56 |
MsG0080048896.01 | MsG0380014029.01 | 0.849512 | 3.082700e-60 | 5.857669e-57 |
MsG0080048896.01 | MsG0380014035.01 | 0.802454 | 5.568785e-49 | 2.728968e-46 |
MsG0080048896.01 | MsG0380014050.01 | 0.830338 | 3.106060e-55 | 3.263177e-52 |
MsG0080048896.01 | MsG0380014053.01 | 0.846789 | 1.741771e-59 | 3.032300e-56 |
MsG0080048896.01 | MsG0380014183.01 | 0.885302 | 9.142537e-72 | 6.242440e-68 |
MsG0080048896.01 | MsG0380014231.01 | 0.912239 | 2.445238e-83 | 5.449580e-79 |
MsG0080048896.01 | MsG0380014260.01 | 0.818308 | 2.097493e-52 | 1.564424e-49 |
MsG0080048896.01 | MsG0380014410.01 | -0.816531 | 5.272243e-52 | 3.745242e-49 |
MsG0080048896.01 | MsG0380014465.01 | 0.821433 | 4.048235e-53 | 3.293043e-50 |
MsG0080048896.01 | MsG0380014466.01 | 0.859319 | 4.490627e-63 | 1.181129e-59 |
MsG0080048896.01 | MsG0380014553.01 | 0.856530 | 3.022213e-62 | 7.236793e-59 |
MsG0080048896.01 | MsG0380014557.01 | 0.850035 | 2.202390e-60 | 4.257928e-57 |
MsG0080048896.01 | MsG0380014558.01 | 0.864923 | 8.572302e-65 | 2.737751e-61 |
MsG0080048896.01 | MsG0380014560.01 | 0.832531 | 8.962362e-56 | 1.004522e-52 |
MsG0080048896.01 | MsG0380014639.01 | 0.868856 | 4.782933e-66 | 1.756823e-62 |
MsG0080048896.01 | MsG0380014642.01 | 0.889247 | 2.873995e-73 | 2.300264e-69 |
MsG0080048896.01 | MsG0380014709.01 | 0.843971 | 1.008772e-58 | 1.604951e-55 |
MsG0080048896.01 | MsG0380014711.01 | 0.837162 | 6.115792e-57 | 7.876967e-54 |
MsG0080048896.01 | MsG0380014719.01 | 0.856599 | 2.884255e-62 | 6.921367e-59 |
MsG0080048896.01 | MsG0380014728.01 | 0.809340 | 1.986295e-50 | 1.163184e-47 |
MsG0080048896.01 | MsG0380014729.01 | 0.882563 | 9.376569e-71 | 5.738508e-67 |
MsG0080048896.01 | MsG0380014735.01 | 0.881451 | 2.374431e-70 | 1.391927e-66 |
MsG0080048896.01 | MsG0380014795.01 | 0.924658 | 5.250893e-90 | 2.243120e-85 |
MsG0080048896.01 | MsG0380014890.01 | 0.850843 | 1.306332e-60 | 2.593291e-57 |
MsG0080048896.01 | MsG0380015077.01 | 0.914614 | 1.558098e-84 | 3.906190e-80 |
MsG0080048896.01 | MsG0380015081.01 | 0.822161 | 2.747493e-53 | 2.281406e-50 |
MsG0080048896.01 | MsG0380015103.01 | 0.895130 | 1.283734e-75 | 1.314611e-71 |
MsG0080048896.01 | MsG0380015111.01 | 0.819182 | 1.327981e-52 | 1.014674e-49 |
MsG0080048896.01 | MsG0380015121.01 | 0.841162 | 5.618108e-58 | 8.183971e-55 |
MsG0080048896.01 | MsG0380015129.01 | 0.890709 | 7.708310e-74 | 6.557101e-70 |
MsG0080048896.01 | MsG0380015200.01 | 0.896380 | 3.901706e-76 | 4.209829e-72 |
MsG0080048896.01 | MsG0380015201.01 | 0.901139 | 3.624746e-78 | 4.831390e-74 |
MsG0080048896.01 | MsG0380015271.01 | 0.905550 | 3.812932e-80 | 6.199354e-76 |
MsG0080048896.01 | MsG0380015348.01 | 0.877609 | 5.476703e-69 | 2.770640e-65 |
MsG0080048896.01 | MsG0380015369.01 | -0.864613 | 1.072386e-64 | 3.388146e-61 |
MsG0080048896.01 | MsG0380015417.01 | 0.835058 | 2.092642e-56 | 2.529840e-53 |
MsG0080048896.01 | MsG0380015439.01 | 0.928000 | 5.351763e-92 | 2.752516e-87 |
MsG0080048896.01 | MsG0380015456.01 | 0.820242 | 7.605682e-53 | 5.985370e-50 |
MsG0080048896.01 | MsG0380015496.01 | 0.806076 | 9.805629e-50 | 5.273270e-47 |
MsG0080048896.01 | MsG0380015501.01 | 0.826880 | 2.127403e-54 | 2.020595e-51 |
MsG0080048896.01 | MsG0380015530.01 | 0.823035 | 1.719985e-53 | 1.464324e-50 |
MsG0080048896.01 | MsG0380015541.01 | -0.821360 | 4.208990e-53 | 3.416733e-50 |
MsG0080048896.01 | MsG0380015546.01 | 0.809585 | 1.759788e-50 | 1.037311e-47 |
MsG0080048896.01 | MsG0380015619.01 | 0.899201 | 2.504881e-77 | 3.065062e-73 |
MsG0080048896.01 | MsG0380015628.01 | 0.819420 | 1.172481e-52 | 9.018081e-50 |
MsG0080048896.01 | MsG0380015654.01 | 0.806731 | 7.135028e-50 | 3.901834e-47 |
MsG0080048896.01 | MsG0380015710.01 | 0.821002 | 5.088499e-53 | 4.090381e-50 |
MsG0080048896.01 | MsG0380015719.01 | 0.935338 | 9.918007e-97 | 7.924934e-92 |
MsG0080048896.01 | MsG0380015744.01 | 0.801386 | 9.225619e-49 | 4.400100e-46 |
MsG0080048896.01 | MsG0380015752.01 | 0.867640 | 1.179081e-65 | 4.146132e-62 |
MsG0080048896.01 | MsG0380015758.01 | 0.828306 | 9.673546e-55 | 9.577849e-52 |
MsG0080048896.01 | MsG0380015795.01 | 0.885663 | 6.695704e-72 | 4.636115e-68 |
MsG0080048896.01 | MsG0380015828.01 | 0.843408 | 1.427064e-58 | 2.230862e-55 |
MsG0080048896.01 | MsG0380015883.01 | 0.816479 | 5.414221e-52 | 3.840626e-49 |
MsG0080048896.01 | MsG0380015900.01 | 0.879693 | 1.011853e-69 | 5.539157e-66 |
MsG0080048896.01 | MsG0380015971.01 | 0.803994 | 2.672600e-49 | 1.362428e-46 |
MsG0080048896.01 | MsG0380015974.01 | 0.933858 | 9.870460e-96 | 7.205208e-91 |
MsG0080048896.01 | MsG0380015985.01 | 0.877778 | 4.783951e-69 | 2.435841e-65 |
MsG0080048896.01 | MsG0380016031.01 | -0.809674 | 1.683629e-50 | 9.947699e-48 |
MsG0080048896.01 | MsG0380016042.01 | 0.856412 | 3.273218e-62 | 7.806269e-59 |
MsG0080048896.01 | MsG0380016056.01 | 0.832634 | 8.453921e-56 | 9.504387e-53 |
MsG0080048896.01 | MsG0380016089.01 | 0.830855 | 2.321049e-55 | 2.475686e-52 |
MsG0080048896.01 | MsG0380016096.01 | 0.802787 | 4.753861e-49 | 2.349565e-46 |
MsG0080048896.01 | MsG0380016151.01 | 0.843589 | 1.277198e-58 | 2.007938e-55 |
MsG0080048896.01 | MsG0380016166.01 | 0.872472 | 3.098313e-67 | 1.298241e-63 |
MsG0080048896.01 | MsG0380016229.01 | 0.875739 | 2.429787e-68 | 1.147539e-64 |
MsG0080048896.01 | MsG0380016231.01 | 0.901230 | 3.305682e-78 | 4.424068e-74 |
MsG0080048896.01 | MsG0380016241.01 | 0.926591 | 3.800028e-91 | 1.808192e-86 |
MsG0080048896.01 | MsG0380016344.01 | 0.872690 | 2.618999e-67 | 1.106334e-63 |
MsG0080048896.01 | MsG0380016354.01 | 0.929897 | 3.589572e-93 | 2.056713e-88 |
MsG0080048896.01 | MsG0380016362.01 | 0.844544 | 7.080278e-59 | 1.146882e-55 |
MsG0080048896.01 | MsG0380016377.01 | -0.838242 | 3.231381e-57 | 4.301705e-54 |
MsG0080048896.01 | MsG0380016380.01 | 0.807899 | 4.035007e-50 | 2.274449e-47 |
MsG0080048896.01 | MsG0380016395.01 | 0.811554 | 6.607838e-51 | 4.102790e-48 |
MsG0080048896.01 | MsG0380016424.01 | 0.840271 | 9.614102e-58 | 1.362322e-54 |
MsG0080048896.01 | MsG0380016452.01 | 0.861592 | 9.206472e-64 | 2.618728e-60 |
MsG0080048896.01 | MsG0380016456.01 | 0.915160 | 8.188870e-85 | 2.111279e-80 |
MsG0080048896.01 | MsG0380016459.01 | 0.826890 | 2.116323e-54 | 2.010658e-51 |
MsG0080048896.01 | MsG0380016478.01 | 0.880628 | 4.695325e-70 | 2.666676e-66 |
MsG0080048896.01 | MsG0380016492.01 | 0.852514 | 4.392122e-61 | 9.199767e-58 |
MsG0080048896.01 | MsG0380016530.01 | 0.844742 | 6.263222e-59 | 1.020925e-55 |
MsG0080048896.01 | MsG0380016531.01 | 0.873123 | 1.875986e-67 | 8.049347e-64 |
MsG0080048896.01 | MsG0380016542.01 | 0.861890 | 7.464459e-64 | 2.144243e-60 |
MsG0080048896.01 | MsG0380016545.01 | 0.830265 | 3.236718e-55 | 3.393202e-52 |
MsG0080048896.01 | MsG0380016568.01 | 0.836229 | 1.057706e-56 | 1.324821e-53 |
MsG0080048896.01 | MsG0380016578.01 | 0.824049 | 9.961876e-54 | 8.726185e-51 |
MsG0080048896.01 | MsG0380016623.01 | 0.866583 | 2.564886e-65 | 8.689174e-62 |
MsG0080048896.01 | MsG0380016699.01 | 0.820997 | 5.101497e-53 | 4.100302e-50 |
MsG0080048896.01 | MsG0380016723.01 | 0.843144 | 1.678288e-58 | 2.601355e-55 |
MsG0080048896.01 | MsG0380016751.01 | 0.811776 | 5.911717e-51 | 3.692179e-48 |
MsG0080048896.01 | MsG0380016790.01 | 0.898907 | 3.347459e-77 | 4.040580e-73 |
MsG0080048896.01 | MsG0380016835.01 | 0.895388 | 1.004671e-75 | 1.040164e-71 |
MsG0080048896.01 | MsG0380016881.01 | 0.885043 | 1.142434e-71 | 7.721408e-68 |
MsG0080048896.01 | MsG0380016889.01 | 0.879133 | 1.598178e-69 | 8.564782e-66 |
MsG0080048896.01 | MsG0380016896.01 | 0.869627 | 2.687909e-66 | 1.015547e-62 |
MsG0080048896.01 | MsG0380016931.01 | 0.868806 | 4.964190e-66 | 1.819972e-62 |
MsG0080048896.01 | MsG0380016932.01 | 0.872883 | 2.257349e-67 | 9.599521e-64 |
MsG0080048896.01 | MsG0380016934.01 | 0.903388 | 3.651929e-79 | 5.394320e-75 |
MsG0080048896.01 | MsG0380016935.01 | 0.885135 | 1.055091e-71 | 7.157551e-68 |
MsG0080048896.01 | MsG0380016960.01 | 0.914057 | 2.993583e-84 | 7.299308e-80 |
MsG0080048896.01 | MsG0380017018.01 | 0.818444 | 1.953555e-52 | 1.462749e-49 |
MsG0080048896.01 | MsG0380017042.01 | 0.865554 | 5.429948e-65 | 1.774026e-61 |
MsG0080048896.01 | MsG0380017074.01 | 0.884056 | 2.655260e-71 | 1.725933e-67 |
MsG0080048896.01 | MsG0380017098.01 | 0.836147 | 1.109591e-56 | 1.386188e-53 |
MsG0080048896.01 | MsG0380017141.01 | 0.862445 | 5.043797e-64 | 1.477616e-60 |
MsG0080048896.01 | MsG0380017214.01 | 0.838354 | 3.022288e-57 | 4.037610e-54 |
MsG0080048896.01 | MsG0380017309.01 | 0.863106 | 3.154174e-64 | 9.452768e-61 |
MsG0080048896.01 | MsG0380017317.01 | 0.832059 | 1.173353e-55 | 1.296891e-52 |
MsG0080048896.01 | MsG0380017353.01 | 0.833386 | 5.496047e-56 | 6.319720e-53 |
MsG0080048896.01 | MsG0380017405.01 | 0.893008 | 9.369699e-75 | 8.771384e-71 |
MsG0080048896.01 | MsG0380017406.01 | 0.889552 | 2.187728e-73 | 1.773483e-69 |
MsG0080048896.01 | MsG0380017472.01 | 0.858578 | 7.482344e-63 | 1.918532e-59 |
MsG0080048896.01 | MsG0380017474.01 | 0.857351 | 1.732110e-62 | 4.262790e-59 |
MsG0080048896.01 | MsG0380017532.01 | 0.824198 | 9.193698e-54 | 8.087610e-51 |
MsG0080048896.01 | MsG0380017566.01 | 0.871815 | 5.125348e-67 | 2.095687e-63 |
MsG0080048896.01 | MsG0380017647.01 | 0.897595 | 1.207043e-76 | 1.373528e-72 |
MsG0080048896.01 | MsG0380017651.01 | 0.834461 | 2.957394e-56 | 3.512244e-53 |
MsG0080048896.01 | MsG0380017727.01 | 0.841211 | 5.453531e-58 | 7.955872e-55 |
MsG0080048896.01 | MsG0380017762.01 | 0.855876 | 4.699686e-62 | 1.100884e-58 |
MsG0080048896.01 | MsG0380017773.01 | 0.886460 | 3.356724e-72 | 2.400002e-68 |
MsG0080048896.01 | MsG0380017812.01 | 0.877157 | 7.868856e-69 | 3.917099e-65 |
MsG0080048896.01 | MsG0380017884.01 | 0.848473 | 5.992474e-60 | 1.101126e-56 |
MsG0080048896.01 | MsG0380017895.01 | 0.895784 | 6.898438e-76 | 7.256863e-72 |
MsG0080048896.01 | MsG0380017918.01 | 0.820027 | 8.520088e-53 | 6.665666e-50 |
MsG0080048896.01 | MsG0380017928.01 | 0.883377 | 4.724026e-71 | 2.987324e-67 |
MsG0080048896.01 | MsG0380017962.01 | 0.901260 | 3.208212e-78 | 4.299291e-74 |
MsG0080048896.01 | MsG0380017966.01 | 0.861534 | 9.590474e-64 | 2.722840e-60 |
MsG0080048896.01 | MsG0380017976.01 | 0.871566 | 6.199252e-67 | 2.512398e-63 |
MsG0080048896.01 | MsG0380018035.01 | 0.879190 | 1.524737e-69 | 8.190896e-66 |
MsG0080048896.01 | MsG0380018066.01 | 0.873389 | 1.527408e-67 | 6.616714e-64 |
MsG0080048896.01 | MsG0380018070.01 | -0.820790 | 5.693333e-53 | 4.549032e-50 |
MsG0080048896.01 | MsG0380018072.01 | 0.919989 | 2.254715e-87 | 7.457016e-83 |
MsG0080048896.01 | MsG0480018088.01 | 0.872211 | 3.784708e-67 | 1.570346e-63 |
MsG0080048896.01 | MsG0480018089.01 | 0.856332 | 3.455756e-62 | 8.219140e-59 |
MsG0080048896.01 | MsG0480018098.01 | 0.909042 | 8.815337e-82 | 1.683354e-77 |
MsG0080048896.01 | MsG0480018100.01 | 0.896170 | 4.768314e-76 | 5.098989e-72 |
MsG0080048896.01 | MsG0480018101.01 | 0.891389 | 4.153097e-74 | 3.634220e-70 |
MsG0080048896.01 | MsG0480018108.01 | 0.884190 | 2.369171e-71 | 1.548249e-67 |
MsG0080048896.01 | MsG0480018112.01 | 0.814008 | 1.917211e-51 | 1.271513e-48 |
MsG0080048896.01 | MsG0480018190.01 | 0.913430 | 6.213974e-84 | 1.468958e-79 |
MsG0080048896.01 | MsG0480018196.01 | 0.940828 | 1.195340e-100 | 1.339859e-95 |
MsG0080048896.01 | MsG0480018201.01 | 0.897645 | 1.150100e-76 | 1.311994e-72 |
MsG0080048896.01 | MsG0480018202.01 | 0.906842 | 9.624172e-81 | 1.660477e-76 |
MsG0080048896.01 | MsG0480018203.01 | 0.910413 | 1.926597e-82 | 3.929771e-78 |
MsG0080048896.01 | MsG0480018323.01 | 0.865314 | 6.461624e-65 | 2.092771e-61 |
MsG0080048896.01 | MsG0480018324.01 | 0.824747 | 6.824595e-54 | 6.099732e-51 |
MsG0080048896.01 | MsG0480018328.01 | 0.941026 | 8.498489e-101 | 9.666232e-96 |
MsG0080048896.01 | MsG0480018329.01 | 0.913917 | 3.524887e-84 | 8.534494e-80 |
MsG0080048896.01 | MsG0480018330.01 | 0.936006 | 3.453793e-97 | 2.874965e-92 |
MsG0080048896.01 | MsG0480018406.01 | -0.808123 | 3.614690e-50 | 2.049754e-47 |
MsG0080048896.01 | MsG0480018409.01 | -0.821323 | 4.290980e-53 | 3.479870e-50 |
MsG0080048896.01 | MsG0480018440.01 | -0.817245 | 3.644869e-52 | 2.640320e-49 |
MsG0080048896.01 | MsG0480018463.01 | 0.828159 | 1.049801e-54 | 1.035047e-51 |
MsG0080048896.01 | MsG0480018494.01 | 0.936869 | 8.700790e-98 | 7.634275e-93 |
MsG0080048896.01 | MsG0480018626.01 | 0.842968 | 1.870264e-58 | 2.882790e-55 |
MsG0080048896.01 | MsG0480018628.01 | 0.878057 | 3.819842e-69 | 1.965378e-65 |
MsG0080048896.01 | MsG0480018629.01 | 0.895598 | 8.233509e-76 | 8.602994e-72 |
MsG0080048896.01 | MsG0480018631.01 | 0.864484 | 1.176008e-64 | 3.698279e-61 |
MsG0080048896.01 | MsG0480018658.01 | 0.925391 | 1.954118e-90 | 8.698683e-86 |
MsG0080048896.01 | MsG0480018840.01 | 0.871294 | 7.623733e-67 | 3.059500e-63 |
MsG0080048896.01 | MsG0480018844.01 | 0.846441 | 2.168428e-59 | 3.732986e-56 |
MsG0080048896.01 | MsG0480018983.01 | 0.847068 | 1.461264e-59 | 2.566785e-56 |
MsG0080048896.01 | MsG0480019017.01 | -0.803596 | 3.232836e-49 | 1.631244e-46 |
MsG0080048896.01 | MsG0480019046.01 | 0.881640 | 2.028985e-70 | 1.197985e-66 |
MsG0080048896.01 | MsG0480019146.01 | -0.805767 | 1.138627e-49 | 6.075385e-47 |
MsG0080048896.01 | MsG0480019171.01 | -0.805745 | 1.151096e-49 | 6.138497e-47 |
MsG0080048896.01 | MsG0480019183.01 | 0.854082 | 1.559853e-61 | 3.443662e-58 |
MsG0080048896.01 | MsG0480019341.01 | 0.866540 | 2.645320e-65 | 8.948629e-62 |
MsG0080048896.01 | MsG0480019349.01 | 0.845643 | 3.573182e-59 | 5.994535e-56 |
MsG0080048896.01 | MsG0480019376.01 | 0.909455 | 5.588972e-82 | 1.087944e-77 |
MsG0080048896.01 | MsG0480019377.01 | 0.805465 | 1.317450e-49 | 6.975011e-47 |
MsG0080048896.01 | MsG0480019484.01 | 0.837415 | 5.268153e-57 | 6.838036e-54 |
MsG0080048896.01 | MsG0480019485.01 | 0.899833 | 1.339695e-77 | 1.685347e-73 |
MsG0080048896.01 | MsG0480019592.01 | 0.831618 | 1.507608e-55 | 1.644822e-52 |
MsG0080048896.01 | MsG0480019604.01 | 0.844221 | 8.647532e-59 | 1.386647e-55 |
MsG0080048896.01 | MsG0480019693.01 | 0.846275 | 2.405256e-59 | 4.117959e-56 |
MsG0080048896.01 | MsG0480019752.01 | 0.872236 | 3.712307e-67 | 1.541849e-63 |
MsG0080048896.01 | MsG0480019838.01 | 0.805296 | 1.429849e-49 | 7.537028e-47 |
MsG0080048896.01 | MsG0480019852.01 | 0.816863 | 4.440450e-52 | 3.183311e-49 |
MsG0080048896.01 | MsG0480019861.01 | 0.896076 | 5.216077e-76 | 5.554040e-72 |
MsG0080048896.01 | MsG0480019974.01 | 0.855326 | 6.802922e-62 | 1.564917e-58 |
MsG0080048896.01 | MsG0480020027.01 | 0.859732 | 3.374529e-63 | 9.002815e-60 |
MsG0080048896.01 | MsG0480020051.01 | 0.826732 | 2.308592e-54 | 2.183228e-51 |
MsG0080048896.01 | MsG0480020072.01 | 0.855285 | 6.987927e-62 | 1.605188e-58 |
MsG0080048896.01 | MsG0480020076.01 | 0.852536 | 4.329325e-61 | 9.074131e-58 |
MsG0080048896.01 | MsG0480020122.01 | 0.881190 | 2.949133e-70 | 1.711207e-66 |
MsG0080048896.01 | MsG0480020253.01 | 0.802124 | 6.510945e-49 | 3.163858e-46 |
MsG0080048896.01 | MsG0480020269.01 | 0.875388 | 3.204442e-68 | 1.493247e-64 |
MsG0080048896.01 | MsG0480020350.01 | 0.804706 | 1.899463e-49 | 9.861666e-47 |
MsG0080048896.01 | MsG0480020393.01 | 0.887625 | 1.210813e-72 | 9.071254e-69 |
MsG0080048896.01 | MsG0480020496.01 | 0.857291 | 1.803533e-62 | 4.428975e-59 |
MsG0080048896.01 | MsG0480020498.01 | 0.812895 | 3.367290e-51 | 2.166902e-48 |
MsG0080048896.01 | MsG0480020539.01 | -0.816074 | 6.668683e-52 | 4.678779e-49 |
MsG0080048896.01 | MsG0480020550.01 | 0.880530 | 5.087415e-70 | 2.878108e-66 |
MsG0080048896.01 | MsG0480020726.01 | 0.832922 | 7.168611e-56 | 8.128705e-53 |
MsG0080048896.01 | MsG0480020838.01 | 0.810943 | 8.963894e-51 | 5.477152e-48 |
MsG0080048896.01 | MsG0480020841.01 | 0.863850 | 1.854451e-64 | 5.703161e-61 |
MsG0080048896.01 | MsG0480020842.01 | 0.860849 | 1.550335e-63 | 4.297957e-60 |
MsG0080048896.01 | MsG0480020928.01 | -0.806353 | 8.572776e-50 | 4.642896e-47 |
MsG0080048896.01 | MsG0480020938.01 | 0.844987 | 5.377155e-59 | 8.832938e-56 |
MsG0080048896.01 | MsG0480020958.01 | -0.818727 | 1.685921e-52 | 1.272048e-49 |
MsG0080048896.01 | MsG0480021005.01 | -0.805923 | 1.056121e-49 | 5.657469e-47 |
MsG0080048896.01 | MsG0480021039.01 | 0.916104 | 2.658159e-85 | 7.190393e-81 |
MsG0080048896.01 | MsG0480021129.01 | -0.805705 | 1.173134e-49 | 6.249768e-47 |
MsG0080048896.01 | MsG0480021143.01 | 0.879974 | 8.035294e-70 | 4.448600e-66 |
MsG0080048896.01 | MsG0480021151.01 | 0.818640 | 1.763669e-52 | 1.327483e-49 |
MsG0080048896.01 | MsG0480021169.01 | 0.824260 | 8.887873e-54 | 7.832067e-51 |
MsG0080048896.01 | MsG0480021205.01 | 0.873721 | 1.180822e-67 | 5.177096e-64 |
MsG0080048896.01 | MsG0480021260.01 | 0.860857 | 1.541313e-63 | 4.274244e-60 |
MsG0080048896.01 | MsG0480021307.01 | 0.860785 | 1.620674e-63 | 4.483714e-60 |
MsG0080048896.01 | MsG0480021308.01 | 0.886350 | 3.692939e-72 | 2.628199e-68 |
MsG0080048896.01 | MsG0480021312.01 | 0.838001 | 3.726778e-57 | 4.925849e-54 |
MsG0080048896.01 | MsG0480021314.01 | 0.855781 | 5.009919e-62 | 1.170032e-58 |
MsG0080048896.01 | MsG0480021315.01 | 0.834868 | 2.336024e-56 | 2.808126e-53 |
MsG0080048896.01 | MsG0480021316.01 | 0.818949 | 1.500691e-52 | 1.139411e-49 |
MsG0080048896.01 | MsG0480021317.01 | 0.888678 | 4.772322e-73 | 3.733006e-69 |
MsG0080048896.01 | MsG0480021318.01 | 0.832664 | 8.309300e-56 | 9.350657e-53 |
MsG0080048896.01 | MsG0480021327.01 | 0.891489 | 3.790348e-74 | 3.330425e-70 |
MsG0080048896.01 | MsG0480021331.01 | 0.885305 | 9.120208e-72 | 6.227820e-68 |
MsG0080048896.01 | MsG0480021420.01 | 0.860283 | 2.300337e-63 | 6.254429e-60 |
MsG0080048896.01 | MsG0480021474.01 | 0.815618 | 8.428952e-52 | 5.840764e-49 |
MsG0080048896.01 | MsG0480021483.01 | 0.847939 | 8.418354e-60 | 1.520356e-56 |
MsG0080048896.01 | MsG0480021497.01 | 0.876136 | 1.774605e-68 | 8.507816e-65 |
MsG0080048896.01 | MsG0480021521.01 | 0.843959 | 1.016787e-58 | 1.617120e-55 |
MsG0080048896.01 | MsG0480021597.01 | 0.805680 | 1.187433e-49 | 6.321636e-47 |
MsG0080048896.01 | MsG0480021654.01 | 0.865627 | 5.146948e-65 | 1.686153e-61 |
MsG0080048896.01 | MsG0480021667.01 | 0.813776 | 2.157184e-51 | 1.421642e-48 |
MsG0080048896.01 | MsG0480021668.01 | 0.855089 | 7.968610e-62 | 1.818422e-58 |
MsG0080048896.01 | MsG0480021691.01 | 0.848040 | 7.896392e-60 | 1.430459e-56 |
MsG0080048896.01 | MsG0480021709.01 | 0.828987 | 6.622903e-55 | 6.688322e-52 |
MsG0080048896.01 | MsG0480021777.01 | 0.800313 | 1.528136e-48 | 7.093151e-46 |
MsG0080048896.01 | MsG0480021795.01 | 0.825696 | 4.070867e-54 | 3.738044e-51 |
MsG0080048896.01 | MsG0480021856.01 | 0.815009 | 1.151427e-51 | 7.846185e-49 |
MsG0080048896.01 | MsG0480021893.01 | 0.816833 | 4.510865e-52 | 3.231017e-49 |
MsG0080048896.01 | MsG0480021912.01 | 0.812815 | 3.505891e-51 | 2.251151e-48 |
MsG0080048896.01 | MsG0480021915.01 | 0.816141 | 6.444064e-52 | 4.529314e-49 |
MsG0080048896.01 | MsG0480021967.01 | 0.836735 | 7.861064e-57 | 9.995600e-54 |
MsG0080048896.01 | MsG0480021999.01 | 0.842708 | 2.193120e-58 | 3.353200e-55 |
MsG0080048896.01 | MsG0480022002.01 | 0.895275 | 1.119061e-75 | 1.153344e-71 |
MsG0080048896.01 | MsG0480022088.01 | 0.851487 | 8.597982e-61 | 1.742894e-57 |
MsG0080048896.01 | MsG0480022201.01 | 0.834889 | 2.308563e-56 | 2.776760e-53 |
MsG0080048896.01 | MsG0480022286.01 | 0.856905 | 2.344822e-62 | 5.683907e-59 |
MsG0080048896.01 | MsG0480022295.01 | 0.871837 | 5.041984e-67 | 2.063313e-63 |
MsG0080048896.01 | MsG0480022296.01 | 0.854471 | 1.204135e-61 | 2.692147e-58 |
MsG0080048896.01 | MsG0480022297.01 | 0.827855 | 1.242568e-54 | 1.214265e-51 |
MsG0080048896.01 | MsG0480022366.01 | 0.829388 | 5.293596e-55 | 5.410277e-52 |
MsG0080048896.01 | MsG0480022411.01 | 0.885683 | 6.580181e-72 | 4.559657e-68 |
MsG0080048896.01 | MsG0480022412.01 | 0.906139 | 2.041760e-80 | 3.411686e-76 |
MsG0080048896.01 | MsG0480022417.01 | 0.892141 | 2.086149e-74 | 1.882453e-70 |
MsG0080048896.01 | MsG0480022458.01 | 0.892057 | 2.254658e-74 | 2.027431e-70 |
MsG0080048896.01 | MsG0480022459.01 | 0.872359 | 3.380092e-67 | 1.410365e-63 |
MsG0080048896.01 | MsG0480022466.01 | 0.895192 | 1.210806e-75 | 1.243000e-71 |
MsG0080048896.01 | MsG0480022581.01 | 0.817432 | 3.307070e-52 | 2.408124e-49 |
MsG0080048896.01 | MsG0480022584.01 | 0.912164 | 2.663735e-83 | 5.910763e-79 |
MsG0080048896.01 | MsG0480022591.01 | 0.867086 | 1.773410e-65 | 6.114152e-62 |
MsG0080048896.01 | MsG0480022622.01 | 0.814793 | 1.285445e-51 | 8.708232e-49 |
MsG0080048896.01 | MsG0480022626.01 | 0.913804 | 4.022607e-84 | 9.686795e-80 |
MsG0080048896.01 | MsG0480022665.01 | 0.837637 | 4.622017e-57 | 6.041307e-54 |
MsG0080048896.01 | MsG0480022687.01 | 0.867010 | 1.875516e-65 | 6.448879e-62 |
MsG0080048896.01 | MsG0480022721.01 | -0.861601 | 9.145715e-64 | 2.602263e-60 |
MsG0080048896.01 | MsG0480022765.01 | 0.829379 | 5.319759e-55 | 5.435815e-52 |
MsG0080048896.01 | MsG0480022804.01 | 0.822735 | 2.020033e-53 | 1.705250e-50 |
MsG0080048896.01 | MsG0480022805.01 | 0.812876 | 3.399534e-51 | 2.186501e-48 |
MsG0080048896.01 | MsG0480022837.01 | 0.892819 | 1.116477e-74 | 1.036675e-70 |
MsG0080048896.01 | MsG0480022935.01 | 0.859858 | 3.091060e-63 | 8.283092e-60 |
MsG0080048896.01 | MsG0480022968.01 | -0.810725 | 9.991937e-51 | 6.069514e-48 |
MsG0080048896.01 | MsG0480023006.01 | 0.855602 | 5.651132e-62 | 1.311784e-58 |
MsG0080048896.01 | MsG0480023056.01 | 0.918884 | 8.977914e-87 | 2.799098e-82 |
MsG0080048896.01 | MsG0480023067.01 | -0.826656 | 2.407321e-54 | 2.271650e-51 |
MsG0080048896.01 | MsG0480023103.01 | 0.905946 | 2.505568e-80 | 4.151080e-76 |
MsG0080048896.01 | MsG0480023104.01 | 0.907931 | 2.970048e-81 | 5.385614e-77 |
MsG0080048896.01 | MsG0480023125.01 | -0.810589 | 1.069318e-50 | 6.471670e-48 |
MsG0080048896.01 | MsG0480023148.01 | 0.860998 | 1.396602e-63 | 3.891772e-60 |
MsG0080048896.01 | MsG0480023152.01 | 0.888890 | 3.951677e-73 | 3.118314e-69 |
MsG0080048896.01 | MsG0480023166.01 | 0.835495 | 1.623320e-56 | 1.988482e-53 |
MsG0080048896.01 | MsG0480023169.01 | 0.824098 | 9.704099e-54 | 8.512327e-51 |
MsG0080048896.01 | MsG0480023173.01 | 0.875976 | 2.014037e-68 | 9.598842e-65 |
MsG0080048896.01 | MsG0480023187.01 | 0.843760 | 1.149384e-58 | 1.816553e-55 |
MsG0080048896.01 | MsG0480023211.01 | 0.891750 | 2.985610e-74 | 2.651539e-70 |
MsG0080048896.01 | MsG0480023217.01 | 0.914042 | 3.046891e-84 | 7.423432e-80 |
MsG0080048896.01 | MsG0480023242.01 | 0.800136 | 1.660704e-48 | 7.673492e-46 |
MsG0080048896.01 | MsG0480023244.01 | 0.834376 | 3.106364e-56 | 3.679746e-53 |
MsG0080048896.01 | MsG0480023264.01 | 0.898603 | 4.513889e-77 | 5.372879e-73 |
MsG0080048896.01 | MsG0480023298.01 | 0.891939 | 2.510871e-74 | 2.246147e-70 |
MsG0080048896.01 | MsG0480023319.01 | 0.877406 | 6.446972e-69 | 3.238384e-65 |
MsG0080048896.01 | MsG0480023332.01 | 0.855757 | 5.093021e-62 | 1.188452e-58 |
MsG0080048896.01 | MsG0480023344.01 | 0.829921 | 3.927685e-55 | 4.076930e-52 |
MsG0080048896.01 | MsG0480023351.01 | 0.834545 | 2.817650e-56 | 3.354663e-53 |
MsG0080048896.01 | MsG0480023371.01 | 0.866375 | 2.984470e-65 | 1.003633e-61 |
MsG0080048896.01 | MsG0480023376.01 | 0.924906 | 3.762803e-90 | 1.629981e-85 |
MsG0080048896.01 | MsG0480023386.01 | 0.842468 | 2.539521e-58 | 3.854333e-55 |
MsG0080048896.01 | MsG0480023422.01 | 0.852976 | 3.242212e-61 | 6.896725e-58 |
MsG0080048896.01 | MsG0480023429.01 | -0.815037 | 1.135202e-51 | 7.741217e-49 |
MsG0080048896.01 | MsG0480023466.01 | 0.840877 | 6.671219e-58 | 9.633418e-55 |
MsG0080048896.01 | MsG0480023469.01 | 0.900238 | 8.947376e-78 | 1.146571e-73 |
MsG0080048896.01 | MsG0480023481.01 | 0.826534 | 2.573500e-54 | 2.419999e-51 |
MsG0080048896.01 | MsG0480023482.01 | 0.872801 | 2.405879e-67 | 1.020084e-63 |
MsG0080048896.01 | MsG0480023483.01 | 0.870092 | 1.895031e-66 | 7.279896e-63 |
MsG0080048896.01 | MsG0480023502.01 | 0.889248 | 2.870529e-73 | 2.297516e-69 |
MsG0080048896.01 | MsG0480023505.01 | 0.843502 | 1.347199e-58 | 2.112074e-55 |
MsG0080048896.01 | MsG0480023531.01 | 0.843028 | 1.802226e-58 | 2.783204e-55 |
MsG0080048896.01 | MsG0480023577.01 | 0.800918 | 1.150051e-48 | 5.420857e-46 |
MsG0080048896.01 | MsG0480023616.01 | 0.813500 | 2.479991e-51 | 1.622344e-48 |
MsG0080048896.01 | MsG0480023695.01 | 0.882588 | 9.184993e-71 | 5.626125e-67 |
MsG0080048896.01 | MsG0480023704.01 | 0.890562 | 8.803823e-74 | 7.442186e-70 |
MsG0080048896.01 | MsG0480023705.01 | 0.925049 | 3.105060e-90 | 1.356013e-85 |
MsG0080048896.01 | MsG0480023708.01 | 0.835345 | 1.771423e-56 | 2.160371e-53 |
MsG0080048896.01 | MsG0480023749.01 | 0.861404 | 1.050916e-63 | 2.970453e-60 |
MsG0080048896.01 | MsG0480023818.01 | 0.854814 | 9.577943e-62 | 2.166118e-58 |
MsG0080048896.01 | MsG0480023821.01 | 0.822002 | 2.990343e-53 | 2.471891e-50 |
MsG0080048896.01 | MsG0480023850.01 | 0.884095 | 2.569024e-71 | 1.672582e-67 |
MsG0080048896.01 | MsG0480023851.01 | 0.836007 | 1.203925e-56 | 1.497603e-53 |
MsG0080048896.01 | MsG0480023863.01 | -0.814474 | 1.512660e-51 | 1.016018e-48 |
MsG0080048896.01 | MsG0480023881.01 | 0.869546 | 2.855459e-66 | 1.075873e-62 |
MsG0080048896.01 | MsG0480023933.01 | 0.849902 | 2.400202e-60 | 4.619881e-57 |
MsG0080048896.01 | MsG0480023993.01 | 0.922660 | 7.367356e-89 | 2.820595e-84 |
MsG0080048896.01 | MsG0580024054.01 | 0.814601 | 1.417732e-51 | 9.554963e-49 |
MsG0080048896.01 | MsG0580024128.01 | 0.886771 | 2.559274e-72 | 1.852635e-68 |
MsG0080048896.01 | MsG0580024135.01 | 0.916477 | 1.699206e-85 | 4.678684e-81 |
MsG0080048896.01 | MsG0580024140.01 | 0.858517 | 7.802999e-63 | 1.996760e-59 |
MsG0080048896.01 | MsG0580024278.01 | 0.899023 | 2.986382e-77 | 3.624625e-73 |
MsG0080048896.01 | MsG0580024309.01 | 0.901342 | 2.951806e-78 | 3.971656e-74 |
MsG0080048896.01 | MsG0580024327.01 | 0.821774 | 3.376745e-53 | 2.773339e-50 |
MsG0080048896.01 | MsG0580024329.01 | 0.830789 | 2.410175e-55 | 2.565670e-52 |
MsG0080048896.01 | MsG0580024360.01 | 0.808065 | 3.718916e-50 | 2.105593e-47 |
MsG0080048896.01 | MsG0580024371.01 | 0.892086 | 2.193857e-74 | 1.975005e-70 |
MsG0080048896.01 | MsG0580024372.01 | 0.842241 | 2.916306e-58 | 4.394221e-55 |
MsG0080048896.01 | MsG0580024385.01 | 0.811396 | 7.150076e-51 | 4.421080e-48 |
MsG0080048896.01 | MsG0580024386.01 | 0.893865 | 4.221476e-75 | 4.097072e-71 |
MsG0080048896.01 | MsG0580024442.01 | 0.902341 | 1.069884e-78 | 1.507934e-74 |
MsG0080048896.01 | MsG0580024487.01 | 0.812453 | 4.208667e-51 | 2.677171e-48 |
MsG0080048896.01 | MsG0580024493.01 | 0.924110 | 1.091132e-89 | 4.530516e-85 |
MsG0080048896.01 | MsG0580024496.01 | 0.814140 | 1.792627e-51 | 1.193168e-48 |
MsG0080048896.01 | MsG0580024537.01 | 0.810445 | 1.148716e-50 | 6.925471e-48 |
MsG0080048896.01 | MsG0580024567.01 | 0.829878 | 4.021898e-55 | 4.169941e-52 |
MsG0080048896.01 | MsG0580024571.01 | 0.859136 | 5.095459e-63 | 1.331680e-59 |
MsG0080048896.01 | MsG0580024665.01 | 0.800414 | 1.457500e-48 | 6.782584e-46 |
MsG0080048896.01 | MsG0580024666.01 | 0.806739 | 7.106962e-50 | 3.887330e-47 |
MsG0080048896.01 | MsG0580024673.01 | 0.802884 | 4.538010e-49 | 2.248369e-46 |
MsG0080048896.01 | MsG0580024678.01 | 0.897197 | 1.776214e-76 | 1.985137e-72 |
MsG0080048896.01 | MsG0580024688.01 | 0.883586 | 3.957761e-71 | 2.524768e-67 |
MsG0080048896.01 | MsG0580024763.01 | 0.857141 | 1.997638e-62 | 4.881818e-59 |
MsG0080048896.01 | MsG0580024764.01 | 0.821597 | 3.709720e-53 | 3.031392e-50 |
MsG0080048896.01 | MsG0580024766.01 | 0.805178 | 1.513387e-49 | 7.953280e-47 |
MsG0080048896.01 | MsG0580024768.01 | 0.879639 | 1.056982e-69 | 5.774023e-66 |
MsG0080048896.01 | MsG0580024836.01 | 0.827295 | 1.692577e-54 | 1.627314e-51 |
MsG0080048896.01 | MsG0580024875.01 | 0.896522 | 3.404318e-76 | 3.696452e-72 |
MsG0080048896.01 | MsG0580024944.01 | 0.803734 | 3.025762e-49 | 1.532155e-46 |
MsG0080048896.01 | MsG0580024950.01 | 0.812261 | 4.634274e-51 | 2.932663e-48 |
MsG0080048896.01 | MsG0580024982.01 | 0.882240 | 1.229884e-70 | 7.435384e-67 |
MsG0080048896.01 | MsG0580025023.01 | -0.800594 | 1.339766e-48 | 6.262868e-46 |
MsG0080048896.01 | MsG0580025105.01 | 0.909409 | 5.880334e-82 | 1.141979e-77 |
MsG0080048896.01 | MsG0580025252.01 | 0.809764 | 1.610075e-50 | 9.536124e-48 |
MsG0080048896.01 | MsG0580025259.01 | 0.887360 | 1.528666e-72 | 1.133280e-68 |
MsG0080048896.01 | MsG0580025315.01 | 0.847246 | 1.305418e-59 | 2.306184e-56 |
MsG0080048896.01 | MsG0580025317.01 | 0.836542 | 8.805343e-57 | 1.113068e-53 |
MsG0080048896.01 | MsG0580025355.01 | 0.825069 | 5.731803e-54 | 5.169997e-51 |
MsG0080048896.01 | MsG0580025373.01 | 0.890415 | 1.006268e-73 | 8.452840e-70 |
MsG0080048896.01 | MsG0580025392.01 | 0.927892 | 6.225161e-92 | 3.185575e-87 |
MsG0080048896.01 | MsG0580025447.01 | 0.908378 | 1.826189e-81 | 3.380973e-77 |
MsG0080048896.01 | MsG0580025486.01 | 0.860927 | 1.467923e-63 | 4.080412e-60 |
MsG0080048896.01 | MsG0580025513.01 | 0.853791 | 1.891926e-61 | 4.136182e-58 |
MsG0080048896.01 | MsG0580025589.01 | 0.839770 | 1.298556e-57 | 1.811606e-54 |
MsG0080048896.01 | MsG0580025830.01 | 0.812972 | 3.239249e-51 | 2.088687e-48 |
MsG0080048896.01 | MsG0580025983.01 | 0.870126 | 1.847157e-66 | 7.104334e-63 |
MsG0080048896.01 | MsG0580025997.01 | 0.838682 | 2.487345e-57 | 3.356482e-54 |
MsG0080048896.01 | MsG0580026073.01 | 0.882813 | 7.603549e-71 | 4.699917e-67 |
MsG0080048896.01 | MsG0580026211.01 | 0.904708 | 9.249897e-80 | 1.448391e-75 |
MsG0080048896.01 | MsG0580026291.01 | 0.858004 | 1.109285e-62 | 2.790325e-59 |
MsG0080048896.01 | MsG0580026298.01 | 0.830036 | 3.682463e-55 | 3.834755e-52 |
MsG0080048896.01 | MsG0580026362.01 | 0.903719 | 2.592962e-79 | 3.886170e-75 |
MsG0080048896.01 | MsG0580026492.01 | -0.858951 | 5.789936e-63 | 1.503710e-59 |
MsG0080048896.01 | MsG0580026529.01 | -0.810963 | 8.877057e-51 | 5.426971e-48 |
MsG0080048896.01 | MsG0580027094.01 | 0.845191 | 4.737222e-59 | 7.831787e-56 |
MsG0080048896.01 | MsG0580027095.01 | 0.917803 | 3.398031e-86 | 1.000377e-81 |
MsG0080048896.01 | MsG0580027098.01 | 0.854345 | 1.309765e-61 | 2.916035e-58 |
MsG0080048896.01 | MsG0580027099.01 | 0.840513 | 8.309984e-58 | 1.186503e-54 |
MsG0080048896.01 | MsG0580027135.01 | -0.833577 | 4.922886e-56 | 5.692831e-53 |
MsG0080048896.01 | MsG0580027249.01 | 0.885203 | 9.952415e-72 | 6.769513e-68 |
MsG0080048896.01 | MsG0580027254.01 | 0.842087 | 3.203814e-58 | 4.804347e-55 |
MsG0080048896.01 | MsG0580027276.01 | 0.883066 | 6.143392e-71 | 3.836495e-67 |
MsG0080048896.01 | MsG0580027325.01 | 0.888572 | 5.243099e-73 | 4.084433e-69 |
MsG0080048896.01 | MsG0580027646.01 | -0.819022 | 1.444542e-52 | 1.098967e-49 |
MsG0080048896.01 | MsG0580027750.01 | 0.852186 | 5.445309e-61 | 1.128791e-57 |
MsG0080048896.01 | MsG0580027761.01 | 0.879593 | 1.097674e-69 | 5.986548e-66 |
MsG0080048896.01 | MsG0580027983.01 | 0.814878 | 1.230762e-51 | 8.356572e-49 |
MsG0080048896.01 | MsG0580028092.01 | 0.874259 | 7.765603e-68 | 3.472496e-64 |
MsG0080048896.01 | MsG0580028093.01 | 0.834398 | 3.067414e-56 | 3.635843e-53 |
MsG0080048896.01 | MsG0580028159.01 | 0.865757 | 4.683938e-65 | 1.541310e-61 |
MsG0080048896.01 | MsG0580028209.01 | 0.835162 | 1.970023e-56 | 2.389145e-53 |
MsG0080048896.01 | MsG0580028248.01 | 0.802463 | 5.545111e-49 | 2.717976e-46 |
MsG0080048896.01 | MsG0580028461.01 | 0.834267 | 3.308152e-56 | 3.905979e-53 |
MsG0080048896.01 | MsG0580028982.01 | 0.813217 | 2.862264e-51 | 1.857851e-48 |
MsG0080048896.01 | MsG0580029032.01 | 0.840129 | 1.047366e-57 | 1.477761e-54 |
MsG0080048896.01 | MsG0580029172.01 | 0.885778 | 6.061198e-72 | 4.216451e-68 |
MsG0080048896.01 | MsG0580029177.01 | 0.858298 | 9.071140e-63 | 2.304505e-59 |
MsG0080048896.01 | MsG0580029227.01 | 0.831064 | 2.063254e-55 | 2.214317e-52 |
MsG0080048896.01 | MsG0580029296.01 | -0.814666 | 1.371398e-51 | 9.258571e-49 |
MsG0080048896.01 | MsG0580029706.01 | 0.869227 | 3.626200e-66 | 1.350464e-62 |
MsG0080048896.01 | MsG0580029719.01 | 0.880929 | 3.660441e-70 | 2.102759e-66 |
MsG0080048896.01 | MsG0580029792.01 | 0.800721 | 1.262183e-48 | 5.919185e-46 |
MsG0080048896.01 | MsG0580029816.01 | 0.841170 | 5.590735e-58 | 8.146155e-55 |
MsG0080048896.01 | MsG0580029820.01 | 0.898003 | 8.114400e-77 | 9.412514e-73 |
MsG0080048896.01 | MsG0580029918.01 | 0.808463 | 3.058912e-50 | 1.750227e-47 |
MsG0080048896.01 | MsG0580029991.01 | 0.839543 | 1.487971e-57 | 2.061303e-54 |
MsG0080048896.01 | MsG0580030014.01 | 0.859395 | 4.261265e-63 | 1.123867e-59 |
MsG0080048896.01 | MsG0580030063.01 | 0.821059 | 4.937266e-53 | 3.975084e-50 |
MsG0080048896.01 | MsG0580030197.01 | 0.903888 | 2.177349e-79 | 3.284637e-75 |
MsG0080048896.01 | MsG0580030203.01 | 0.845874 | 3.092180e-59 | 5.226834e-56 |
MsG0080048896.01 | MsG0580030237.01 | 0.879734 | 9.783066e-70 | 5.363936e-66 |
MsG0080048896.01 | MsG0680030290.01 | 0.884094 | 2.571860e-71 | 1.674364e-67 |
MsG0080048896.01 | MsG0680030399.01 | 0.843817 | 1.109370e-58 | 1.756481e-55 |
MsG0080048896.01 | MsG0680030439.01 | 0.874608 | 5.911722e-68 | 2.677908e-64 |
MsG0080048896.01 | MsG0680030441.01 | 0.923511 | 2.412619e-89 | 9.694792e-85 |
MsG0080048896.01 | MsG0680030635.01 | 0.854145 | 1.495949e-61 | 3.309492e-58 |
MsG0080048896.01 | MsG0680030644.01 | 0.817694 | 2.886713e-52 | 2.117093e-49 |
MsG0080048896.01 | MsG0680030658.01 | 0.840271 | 9.614102e-58 | 1.362322e-54 |
MsG0080048896.01 | MsG0680030754.01 | 0.879162 | 1.561014e-69 | 8.374729e-66 |
MsG0080048896.01 | MsG0680030757.01 | 0.807487 | 4.934761e-50 | 2.752128e-47 |
MsG0080048896.01 | MsG0680030760.01 | 0.803885 | 2.815549e-49 | 1.431303e-46 |
MsG0080048896.01 | MsG0680030776.01 | 0.841136 | 5.704780e-58 | 8.303714e-55 |
MsG0080048896.01 | MsG0680030875.01 | 0.875137 | 3.905006e-68 | 1.803742e-64 |
MsG0080048896.01 | MsG0680030878.01 | 0.909878 | 3.498771e-82 | 6.954245e-78 |
MsG0080048896.01 | MsG0680030879.01 | 0.856627 | 2.830664e-62 | 6.797900e-59 |
MsG0080048896.01 | MsG0680030902.01 | 0.880202 | 6.662643e-70 | 3.720317e-66 |
MsG0080048896.01 | MsG0680030960.01 | -0.820521 | 6.565334e-53 | 5.206459e-50 |
MsG0080048896.01 | MsG0680031204.01 | 0.923121 | 4.028537e-89 | 1.583893e-84 |
MsG0080048896.01 | MsG0680031449.01 | 0.825465 | 4.619645e-54 | 4.213664e-51 |
MsG0080048896.01 | MsG0680031791.01 | 0.802080 | 6.649033e-49 | 3.227381e-46 |
MsG0080048896.01 | MsG0680031813.01 | 0.883659 | 3.722126e-71 | 2.381780e-67 |
MsG0080048896.01 | MsG0680031866.01 | 0.832983 | 6.923312e-56 | 7.865588e-53 |
MsG0080048896.01 | MsG0680032055.01 | 0.886369 | 3.632229e-72 | 2.586754e-68 |
MsG0080048896.01 | MsG0680032160.01 | 0.836034 | 1.185081e-56 | 1.475359e-53 |
MsG0080048896.01 | MsG0680032191.01 | 0.819411 | 1.177953e-52 | 9.057718e-50 |
MsG0080048896.01 | MsG0680032197.01 | 0.801339 | 9.434560e-49 | 4.494375e-46 |
MsG0080048896.01 | MsG0680032245.01 | 0.841739 | 3.958782e-58 | 5.871088e-55 |
MsG0080048896.01 | MsG0680032514.01 | 0.804925 | 1.709123e-49 | 8.924557e-47 |
MsG0080048896.01 | MsG0680032840.01 | 0.838112 | 3.489936e-57 | 4.627912e-54 |
MsG0080048896.01 | MsG0680033007.01 | 0.815111 | 1.093054e-51 | 7.468408e-49 |
MsG0080048896.01 | MsG0680033901.01 | 0.891181 | 5.022197e-74 | 4.356049e-70 |
MsG0080048896.01 | MsG0680033902.01 | 0.900369 | 7.846550e-78 | 1.011971e-73 |
MsG0080048896.01 | MsG0680033952.01 | 0.829845 | 4.098339e-55 | 4.245395e-52 |
MsG0080048896.01 | MsG0680034040.01 | 0.831948 | 1.249690e-55 | 1.376858e-52 |
MsG0080048896.01 | MsG0680034122.01 | 0.814384 | 1.583425e-51 | 1.060980e-48 |
MsG0080048896.01 | MsG0680034229.01 | 0.885511 | 7.637305e-72 | 5.257347e-68 |
MsG0080048896.01 | MsG0680034255.01 | -0.801003 | 1.105395e-48 | 5.221675e-46 |
MsG0080048896.01 | MsG0680034316.01 | -0.846663 | 1.885008e-59 | 3.268532e-56 |
MsG0080048896.01 | MsG0680034317.01 | -0.803811 | 2.916708e-49 | 1.479847e-46 |
MsG0080048896.01 | MsG0680034419.01 | 0.865515 | 5.585578e-65 | 1.822218e-61 |
MsG0080048896.01 | MsG0680034431.01 | 0.812153 | 4.893112e-51 | 3.087362e-48 |
MsG0080048896.01 | MsG0680034724.01 | 0.843588 | 1.277897e-58 | 2.008976e-55 |
MsG0080048896.01 | MsG0680034729.01 | 0.812398 | 4.325794e-51 | 2.747648e-48 |
MsG0080048896.01 | MsG0680035368.01 | 0.831215 | 1.893971e-55 | 2.041655e-52 |
MsG0080048896.01 | MsG0680035584.01 | 0.863093 | 3.182577e-64 | 9.534022e-61 |
MsG0080048896.01 | MsG0680035612.01 | 0.892144 | 2.080932e-74 | 1.877945e-70 |
MsG0080048896.01 | MsG0680035619.01 | 0.880570 | 4.924683e-70 | 2.790527e-66 |
MsG0080048896.01 | MsG0680035841.01 | -0.803878 | 2.824771e-49 | 1.435735e-46 |
MsG0080048896.01 | MsG0680035870.01 | 0.827098 | 1.886887e-54 | 1.803604e-51 |
MsG0080048896.01 | MsG0780035939.01 | 0.814935 | 1.195883e-51 | 8.132214e-49 |
MsG0080048896.01 | MsG0780035993.01 | -0.836750 | 7.794493e-57 | 9.915534e-54 |
MsG0080048896.01 | MsG0780035994.01 | 0.902773 | 6.879411e-79 | 9.896550e-75 |
MsG0080048896.01 | MsG0780036064.01 | 0.870328 | 1.586140e-66 | 6.145464e-63 |
MsG0080048896.01 | MsG0780036067.01 | 0.902205 | 1.229579e-78 | 1.721875e-74 |
MsG0080048896.01 | MsG0780036068.01 | 0.867698 | 1.129550e-65 | 3.979969e-62 |
MsG0080048896.01 | MsG0780036236.01 | 0.855087 | 7.982053e-62 | 1.821331e-58 |
MsG0080048896.01 | MsG0780036583.01 | 0.898124 | 7.210818e-77 | 8.410301e-73 |
MsG0080048896.01 | MsG0780036584.01 | 0.819643 | 1.042973e-52 | 8.071795e-50 |
MsG0080048896.01 | MsG0780036586.01 | 0.800242 | 1.580005e-48 | 7.320300e-46 |
MsG0080048896.01 | MsG0780036909.01 | 0.909131 | 7.993289e-82 | 1.532231e-77 |
MsG0080048896.01 | MsG0780036925.01 | 0.816791 | 4.608237e-52 | 3.297038e-49 |
MsG0080048896.01 | MsG0780037436.01 | 0.849124 | 3.953496e-60 | 7.420226e-57 |
MsG0080048896.01 | MsG0780037453.01 | 0.805353 | 1.390850e-49 | 7.342223e-47 |
MsG0080048896.01 | MsG0780037458.01 | 0.843387 | 1.445812e-58 | 2.258684e-55 |
MsG0080048896.01 | MsG0780037507.01 | 0.827961 | 1.171438e-54 | 1.148350e-51 |
MsG0080048896.01 | MsG0780037655.01 | 0.876862 | 9.964056e-69 | 4.907192e-65 |
MsG0080048896.01 | MsG0780037698.01 | 0.900870 | 4.748392e-78 | 6.253318e-74 |
MsG0080048896.01 | MsG0780037734.01 | 0.869992 | 2.042452e-66 | 7.818788e-63 |
MsG0080048896.01 | MsG0780037963.01 | 0.844548 | 7.060963e-59 | 1.143919e-55 |
MsG0080048896.01 | MsG0780037988.01 | 0.844026 | 9.750811e-59 | 1.554150e-55 |
MsG0080048896.01 | MsG0780038030.01 | 0.872379 | 3.328469e-67 | 1.389891e-63 |
MsG0080048896.01 | MsG0780038047.01 | 0.883185 | 5.556661e-71 | 3.486356e-67 |
MsG0080048896.01 | MsG0780038106.01 | 0.855974 | 4.399517e-62 | 1.033959e-58 |
MsG0080048896.01 | MsG0780038108.01 | 0.876988 | 9.007892e-69 | 4.456080e-65 |
MsG0080048896.01 | MsG0780038136.01 | -0.811027 | 8.595881e-51 | 5.263860e-48 |
MsG0080048896.01 | MsG0780038197.01 | 0.817446 | 3.283504e-52 | 2.391838e-49 |
MsG0080048896.01 | MsG0780038337.01 | 0.801054 | 1.079171e-48 | 5.104312e-46 |
MsG0080048896.01 | MsG0780038381.01 | 0.824510 | 7.762490e-54 | 6.890099e-51 |
MsG0080048896.01 | MsG0780038416.01 | 0.837492 | 5.033985e-57 | 6.550396e-54 |
MsG0080048896.01 | MsG0780038496.01 | 0.872390 | 3.299404e-67 | 1.378229e-63 |
MsG0080048896.01 | MsG0780038539.01 | 0.821501 | 3.905470e-53 | 3.182719e-50 |
MsG0080048896.01 | MsG0780038571.01 | 0.810390 | 1.180641e-50 | 7.107336e-48 |
MsG0080048896.01 | MsG0780038573.01 | 0.861849 | 7.684028e-64 | 2.204289e-60 |
MsG0080048896.01 | MsG0780038653.01 | 0.816352 | 5.781044e-52 | 4.086852e-49 |
MsG0080048896.01 | MsG0780038756.01 | 0.894551 | 2.217047e-75 | 2.214368e-71 |
MsG0080048896.01 | MsG0780038834.01 | 0.904123 | 1.704417e-79 | 2.598936e-75 |
MsG0080048896.01 | MsG0780038839.01 | 0.840342 | 9.211236e-58 | 1.308071e-54 |
MsG0080048896.01 | MsG0780038848.01 | 0.897893 | 9.034502e-77 | 1.042272e-72 |
MsG0080048896.01 | MsG0780038922.01 | -0.812285 | 4.578157e-51 | 2.899064e-48 |
MsG0080048896.01 | MsG0780038986.01 | 0.853033 | 3.122607e-61 | 6.655070e-58 |
MsG0080048896.01 | MsG0780039179.01 | 0.817647 | 2.958926e-52 | 2.167176e-49 |
MsG0080048896.01 | MsG0780039287.01 | 0.891500 | 3.754570e-74 | 3.300481e-70 |
MsG0080048896.01 | MsG0780039382.01 | 0.865977 | 3.992175e-65 | 1.323988e-61 |
MsG0080048896.01 | MsG0780039401.01 | 0.801999 | 6.908289e-49 | 3.346309e-46 |
MsG0080048896.01 | MsG0780039431.01 | -0.840350 | 9.170453e-58 | 1.302654e-54 |
MsG0080048896.01 | MsG0780039449.01 | 0.853903 | 1.756431e-61 | 3.854252e-58 |
MsG0080048896.01 | MsG0780039593.01 | -0.803748 | 3.005790e-49 | 1.522577e-46 |
MsG0080048896.01 | MsG0780039596.01 | 0.905391 | 4.509103e-80 | 7.276425e-76 |
MsG0080048896.01 | MsG0780039704.01 | 0.884279 | 2.196758e-71 | 1.440757e-67 |
MsG0080048896.01 | MsG0780039805.01 | 0.861718 | 8.425608e-64 | 2.405938e-60 |
MsG0080048896.01 | MsG0780039816.01 | 0.802672 | 5.019981e-49 | 2.473712e-46 |
MsG0080048896.01 | MsG0780039821.01 | 0.888000 | 8.698830e-73 | 6.619695e-69 |
MsG0080048896.01 | MsG0780039836.01 | 0.905583 | 3.680569e-80 | 5.990882e-76 |
MsG0080048896.01 | MsG0780039838.01 | 0.879459 | 1.225025e-69 | 6.647075e-66 |
MsG0080048896.01 | MsG0780039839.01 | 0.896014 | 5.536333e-76 | 5.878483e-72 |
MsG0080048896.01 | MsG0780039859.01 | 0.899001 | 3.052165e-77 | 3.700371e-73 |
MsG0080048896.01 | MsG0780039860.01 | 0.938212 | 9.775000e-99 | 9.291546e-94 |
MsG0080048896.01 | MsG0780039873.01 | 0.835100 | 2.041979e-56 | 2.471568e-53 |
MsG0080048896.01 | MsG0780039879.01 | 0.847653 | 1.009358e-59 | 1.806551e-56 |
MsG0080048896.01 | MsG0780039902.01 | 0.824024 | 1.009557e-53 | 8.837144e-51 |
MsG0080048896.01 | MsG0780039955.01 | 0.850186 | 1.998660e-60 | 3.882780e-57 |
MsG0080048896.01 | MsG0780040072.01 | 0.893690 | 4.971326e-75 | 4.787574e-71 |
MsG0080048896.01 | MsG0780040080.01 | 0.821809 | 3.313551e-53 | 2.724246e-50 |
MsG0080048896.01 | MsG0780040121.01 | 0.894316 | 2.766623e-75 | 2.736544e-71 |
MsG0080048896.01 | MsG0780040154.01 | 0.857980 | 1.127626e-62 | 2.834304e-59 |
MsG0080048896.01 | MsG0780040155.01 | 0.817266 | 3.605343e-52 | 2.613102e-49 |
MsG0080048896.01 | MsG0780040158.01 | 0.906271 | 1.772923e-80 | 2.979904e-76 |
MsG0080048896.01 | MsG0780040159.01 | 0.910429 | 1.891594e-82 | 3.861038e-78 |
MsG0080048896.01 | MsG0780040167.01 | 0.848147 | 7.375408e-60 | 1.340625e-56 |
MsG0080048896.01 | MsG0780040175.01 | 0.824408 | 8.203592e-54 | 7.259495e-51 |
MsG0080048896.01 | MsG0780040283.01 | 0.817469 | 3.245015e-52 | 2.365350e-49 |
MsG0080048896.01 | MsG0780040315.01 | 0.822564 | 2.214316e-53 | 1.860192e-50 |
MsG0080048896.01 | MsG0780040319.01 | 0.859617 | 3.654832e-63 | 9.711187e-60 |
MsG0080048896.01 | MsG0780040321.01 | 0.906724 | 1.092707e-80 | 1.874564e-76 |
MsG0080048896.01 | MsG0780040352.01 | 0.854559 | 1.135918e-61 | 2.547020e-58 |
MsG0080048896.01 | MsG0780040412.01 | 0.803604 | 3.220172e-49 | 1.625198e-46 |
MsG0080048896.01 | MsG0780040413.01 | 0.863861 | 1.840113e-64 | 5.661244e-61 |
MsG0080048896.01 | MsG0780040429.01 | 0.917438 | 5.307561e-86 | 1.532155e-81 |
MsG0080048896.01 | MsG0780040437.01 | 0.909098 | 8.287894e-82 | 1.585931e-77 |
MsG0080048896.01 | MsG0780040567.01 | 0.847612 | 1.035760e-59 | 1.851207e-56 |
MsG0080048896.01 | MsG0780040640.01 | 0.838048 | 3.623969e-57 | 4.796891e-54 |
MsG0080048896.01 | MsG0780040644.01 | 0.880560 | 4.965570e-70 | 2.812641e-66 |
MsG0080048896.01 | MsG0780040649.01 | 0.853285 | 2.644483e-61 | 5.684484e-58 |
MsG0080048896.01 | MsG0780040685.01 | 0.902400 | 1.007649e-78 | 1.424144e-74 |
MsG0080048896.01 | MsG0780040702.01 | 0.857612 | 1.449576e-62 | 3.598966e-59 |
MsG0080048896.01 | MsG0780040804.01 | 0.821786 | 3.355290e-53 | 2.756694e-50 |
MsG0080048896.01 | MsG0780040805.01 | -0.813028 | 3.149257e-51 | 2.033780e-48 |
MsG0080048896.01 | MsG0780040806.01 | -0.809144 | 2.188263e-50 | 1.274783e-47 |
MsG0080048896.01 | MsG0780040833.01 | 0.908768 | 1.191262e-81 | 2.246222e-77 |
MsG0080048896.01 | MsG0780040838.01 | 0.910411 | 1.930671e-82 | 3.937491e-78 |
MsG0080048896.01 | MsG0780040849.01 | 0.865655 | 5.044486e-65 | 1.654260e-61 |
MsG0080048896.01 | MsG0780040884.01 | 0.833484 | 5.192675e-56 | 5.988254e-53 |
MsG0080048896.01 | MsG0780040892.01 | 0.902919 | 5.921190e-79 | 8.572498e-75 |
MsG0080048896.01 | MsG0780040894.01 | 0.890907 | 6.442642e-74 | 5.525035e-70 |
MsG0080048896.01 | MsG0780040977.01 | -0.812876 | 3.400088e-51 | 2.186816e-48 |
MsG0080048896.01 | MsG0780040991.01 | -0.804394 | 2.206229e-49 | 1.136224e-46 |
MsG0080048896.01 | MsG0780041035.01 | 0.901341 | 2.955117e-78 | 3.975561e-74 |
MsG0080048896.01 | MsG0780041075.01 | 0.814828 | 1.262923e-51 | 8.563561e-49 |
MsG0080048896.01 | MsG0780041106.01 | 0.873091 | 1.923114e-67 | 8.241626e-64 |
MsG0080048896.01 | MsG0780041119.01 | -0.803349 | 3.637076e-49 | 1.823457e-46 |
MsG0080048896.01 | MsG0780041121.01 | 0.860039 | 2.726907e-63 | 7.353157e-60 |
MsG0080048896.01 | MsG0780041249.01 | 0.834567 | 2.782502e-56 | 3.314970e-53 |
MsG0080048896.01 | MsG0780041254.01 | 0.858965 | 5.734516e-63 | 1.490074e-59 |
MsG0080048896.01 | MsG0780041288.01 | 0.810959 | 8.893799e-51 | 5.436673e-48 |
MsG0080048896.01 | MsG0780041289.01 | 0.862435 | 5.077646e-64 | 1.487020e-60 |
MsG0080048896.01 | MsG0780041478.01 | 0.939331 | 1.522140e-99 | 1.553510e-94 |
MsG0080048896.01 | MsG0780041492.01 | 0.894950 | 1.521263e-75 | 1.545908e-71 |
MsG0080048896.01 | MsG0780041531.01 | 0.821544 | 3.815723e-53 | 3.113626e-50 |
MsG0080048896.01 | MsG0780041615.01 | 0.814097 | 1.831978e-51 | 1.217917e-48 |
MsG0080048896.01 | MsG0780041617.01 | 0.833099 | 6.477029e-56 | 7.384307e-53 |
MsG0080048896.01 | MsG0780041618.01 | 0.827265 | 1.721523e-54 | 1.653688e-51 |
MsG0080048896.01 | MsG0780041620.01 | 0.884300 | 2.156731e-71 | 1.415775e-67 |
MsG0080048896.01 | MsG0780041637.01 | 0.820138 | 8.036590e-53 | 6.306847e-50 |
MsG0080048896.01 | MsG0780041640.01 | 0.833241 | 5.970047e-56 | 6.834919e-53 |
MsG0080048896.01 | MsG0780041691.01 | 0.837138 | 6.202572e-57 | 7.982793e-54 |
MsG0080048896.01 | MsG0780041706.01 | 0.855576 | 5.749639e-62 | 1.333462e-58 |
MsG0080048896.01 | MsG0780041720.01 | 0.881109 | 3.154139e-70 | 1.824290e-66 |
MsG0080048896.01 | MsG0780041768.01 | 0.847208 | 1.337735e-59 | 2.360144e-56 |
MsG0080048896.01 | MsG0780041778.01 | 0.820117 | 8.127288e-53 | 6.374725e-50 |
MsG0080048896.01 | MsG0780041783.01 | 0.893801 | 4.480102e-75 | 4.336684e-71 |
MsG0080048896.01 | MsG0780041792.01 | 0.845677 | 3.497931e-59 | 5.874916e-56 |
MsG0080048896.01 | MsG0780041809.01 | 0.894109 | 3.358255e-75 | 3.293424e-71 |
MsG0080048896.01 | MsG0880041835.01 | 0.922872 | 5.586126e-89 | 2.165480e-84 |
MsG0080048896.01 | MsG0880041855.01 | 0.901666 | 2.127351e-78 | 2.904255e-74 |
MsG0080048896.01 | MsG0880041908.01 | 0.902375 | 1.034378e-78 | 1.460221e-74 |
MsG0080048896.01 | MsG0880041909.01 | 0.841169 | 5.592313e-58 | 8.148350e-55 |
MsG0080048896.01 | MsG0880042005.01 | 0.822846 | 1.904294e-53 | 1.612517e-50 |
MsG0080048896.01 | MsG0880042006.01 | 0.866419 | 2.890880e-65 | 9.736679e-62 |
MsG0080048896.01 | MsG0880042021.01 | 0.812346 | 4.440094e-51 | 2.816254e-48 |
MsG0080048896.01 | MsG0880042030.01 | 0.819285 | 1.258356e-52 | 9.641836e-50 |
MsG0080048896.01 | MsG0880042043.01 | 0.927783 | 7.259981e-92 | 3.695092e-87 |
MsG0080048896.01 | MsG0880042239.01 | 0.834552 | 2.805578e-56 | 3.341056e-53 |
MsG0080048896.01 | MsG0880042291.01 | 0.815211 | 1.038171e-51 | 7.112863e-49 |
MsG0080048896.01 | MsG0880042500.01 | 0.826220 | 3.056496e-54 | 2.848727e-51 |
MsG0080048896.01 | MsG0880042588.01 | 0.885596 | 7.097107e-72 | 4.901667e-68 |
MsG0080048896.01 | MsG0880042740.01 | -0.804076 | 2.569863e-49 | 1.312808e-46 |
MsG0080048896.01 | MsG0880042858.01 | 0.884518 | 1.791591e-71 | 1.185445e-67 |
MsG0080048896.01 | MsG0880042889.01 | 0.897532 | 1.283634e-76 | 1.456406e-72 |
MsG0080048896.01 | MsG0880042895.01 | 0.888154 | 7.594656e-73 | 5.814645e-69 |
MsG0080048896.01 | MsG0880042921.01 | 0.890196 | 1.226151e-73 | 1.020620e-69 |
MsG0080048896.01 | MsG0880042922.01 | 0.803774 | 2.969533e-49 | 1.505185e-46 |
MsG0080048896.01 | MsG0880043017.01 | -0.803912 | 2.778980e-49 | 1.413726e-46 |
MsG0080048896.01 | MsG0880043032.01 | 0.871747 | 5.398494e-67 | 2.202102e-63 |
MsG0080048896.01 | MsG0880043069.01 | 0.931610 | 2.925925e-94 | 1.865971e-89 |
MsG0080048896.01 | MsG0880043075.01 | 0.864632 | 1.057617e-64 | 3.344016e-61 |
MsG0080048896.01 | MsG0880043259.01 | 0.851342 | 9.444416e-61 | 1.905860e-57 |
MsG0080048896.01 | MsG0880043343.01 | 0.920710 | 9.062580e-88 | 3.118542e-83 |
MsG0080048896.01 | MsG0880043364.01 | -0.853098 | 2.991762e-61 | 6.390450e-58 |
MsG0080048896.01 | MsG0880043472.01 | -0.844995 | 5.351954e-59 | 8.793454e-56 |
MsG0080048896.01 | MsG0880043515.01 | 0.918128 | 2.281245e-86 | 6.833758e-82 |
MsG0080048896.01 | MsG0880043786.01 | -0.820538 | 6.504667e-53 | 5.161136e-50 |
MsG0080048896.01 | MsG0880044312.01 | 0.875964 | 2.033978e-68 | 9.688786e-65 |
MsG0080048896.01 | MsG0880044314.01 | 0.824526 | 7.695425e-54 | 6.833730e-51 |
MsG0080048896.01 | MsG0880044317.01 | 0.831032 | 2.100986e-55 | 2.252514e-52 |
MsG0080048896.01 | MsG0880044318.01 | 0.831566 | 1.552737e-55 | 1.691496e-52 |
MsG0080048896.01 | MsG0880044339.01 | 0.847804 | 9.171447e-60 | 1.649218e-56 |
MsG0080048896.01 | MsG0880044352.01 | 0.874796 | 5.103262e-68 | 2.328290e-64 |
MsG0080048896.01 | MsG0880044387.01 | 0.822749 | 2.005090e-53 | 1.693311e-50 |
MsG0080048896.01 | MsG0880044435.01 | 0.818492 | 1.905293e-52 | 1.428358e-49 |
MsG0080048896.01 | MsG0880044453.01 | 0.818773 | 1.645887e-52 | 1.243476e-49 |
MsG0080048896.01 | MsG0880044488.01 | 0.841947 | 3.489002e-58 | 5.208705e-55 |
MsG0080048896.01 | MsG0880044545.01 | 0.854545 | 1.146455e-61 | 2.569459e-58 |
MsG0080048896.01 | MsG0880044548.01 | 0.872732 | 2.536514e-67 | 1.073064e-63 |
MsG0080048896.01 | MsG0880044595.01 | 0.833374 | 5.531928e-56 | 6.358860e-53 |
MsG0080048896.01 | MsG0880044636.01 | 0.852285 | 5.102269e-61 | 1.061081e-57 |
MsG0080048896.01 | MsG0880044715.01 | 0.842298 | 2.817226e-58 | 4.252923e-55 |
MsG0080048896.01 | MsG0880044720.01 | 0.818938 | 1.509289e-52 | 1.145634e-49 |
MsG0080048896.01 | MsG0880044727.01 | 0.836574 | 8.638521e-57 | 1.093021e-53 |
MsG0080048896.01 | MsG0880044834.01 | 0.826246 | 3.014598e-54 | 2.811759e-51 |
MsG0080048896.01 | MsG0880044968.01 | 0.916803 | 1.146446e-85 | 3.206424e-81 |
MsG0080048896.01 | MsG0880045031.01 | 0.805131 | 1.548106e-49 | 8.126091e-47 |
MsG0080048896.01 | MsG0880045063.01 | 0.908783 | 1.172335e-81 | 2.212496e-77 |
MsG0080048896.01 | MsG0880045073.01 | 0.905464 | 4.175645e-80 | 6.762396e-76 |
MsG0080048896.01 | MsG0880045188.01 | 0.873298 | 1.638480e-67 | 7.074522e-64 |
MsG0080048896.01 | MsG0880045246.01 | 0.801876 | 7.320485e-49 | 3.535180e-46 |
MsG0080048896.01 | MsG0880045252.01 | 0.894711 | 1.906549e-75 | 1.917712e-71 |
MsG0080048896.01 | MsG0880045261.01 | 0.871134 | 8.609643e-67 | 3.434377e-63 |
MsG0080048896.01 | MsG0880045274.01 | 0.890649 | 8.136806e-74 | 6.903140e-70 |
MsG0080048896.01 | MsG0880045283.01 | 0.831905 | 1.280317e-55 | 1.408923e-52 |
MsG0080048896.01 | MsG0880045321.01 | 0.844211 | 8.702024e-59 | 1.394961e-55 |
MsG0080048896.01 | MsG0880045324.01 | 0.830785 | 2.415320e-55 | 2.570865e-52 |
MsG0080048896.01 | MsG0880045369.01 | 0.902928 | 5.867792e-79 | 8.499716e-75 |
MsG0080048896.01 | MsG0880045374.01 | 0.864957 | 8.362223e-65 | 2.674377e-61 |
MsG0080048896.01 | MsG0880045385.01 | 0.895459 | 9.392706e-76 | 9.757671e-72 |
MsG0080048896.01 | MsG0880045400.01 | 0.803452 | 3.463059e-49 | 1.740894e-46 |
MsG0080048896.01 | MsG0880045412.01 | 0.872764 | 2.475526e-67 | 1.048372e-63 |
MsG0080048896.01 | MsG0880045413.01 | 0.891135 | 5.236635e-74 | 4.534176e-70 |
MsG0080048896.01 | MsG0880045414.01 | 0.877792 | 4.729024e-69 | 2.409191e-65 |
MsG0080048896.01 | MsG0880045457.01 | 0.812061 | 5.124291e-51 | 3.224909e-48 |
MsG0080048896.01 | MsG0880045458.01 | -0.819765 | 9.782675e-53 | 7.597334e-50 |
MsG0080048896.01 | MsG0880045628.01 | -0.821114 | 4.795801e-53 | 3.866720e-50 |
MsG0080048896.01 | MsG0880045648.01 | 0.811690 | 6.170809e-51 | 3.845094e-48 |
MsG0080048896.01 | MsG0880045697.01 | 0.819603 | 1.064886e-52 | 8.232203e-50 |
MsG0080048896.01 | MsG0880045698.01 | 0.866605 | 2.522675e-65 | 8.553195e-62 |
MsG0080048896.01 | MsG0880045703.01 | 0.860572 | 1.881418e-63 | 5.166438e-60 |
MsG0080048896.01 | MsG0880045755.01 | 0.851764 | 7.176672e-61 | 1.467797e-57 |
MsG0080048896.01 | MsG0880045778.01 | 0.913876 | 3.696483e-84 | 8.931514e-80 |
MsG0080048896.01 | MsG0880045839.01 | 0.815284 | 1.000320e-51 | 6.867753e-49 |
MsG0080048896.01 | MsG0880045923.01 | 0.800249 | 1.574829e-48 | 7.297658e-46 |
MsG0080048896.01 | MsG0880045968.01 | 0.871052 | 9.166384e-67 | 3.645978e-63 |
MsG0080048896.01 | MsG0880045991.01 | -0.831621 | 1.504603e-55 | 1.641694e-52 |
MsG0080048896.01 | MsG0880046010.01 | 0.851787 | 7.068332e-61 | 1.446640e-57 |
MsG0080048896.01 | MsG0880046040.01 | 0.901733 | 1.986849e-78 | 2.721131e-74 |
MsG0080048896.01 | MsG0880046051.01 | 0.850069 | 2.155112e-60 | 4.170961e-57 |
MsG0080048896.01 | MsG0880046092.01 | -0.801183 | 1.015429e-48 | 4.818245e-46 |
MsG0080048896.01 | MsG0880046104.01 | 0.845760 | 3.321860e-59 | 5.594387e-56 |
MsG0080048896.01 | MsG0880046105.01 | 0.860663 | 1.765240e-63 | 4.863027e-60 |
MsG0080048896.01 | MsG0880046149.01 | 0.861296 | 1.133256e-63 | 3.191659e-60 |
MsG0080048896.01 | MsG0880046150.01 | 0.840325 | 9.307181e-58 | 1.321031e-54 |
MsG0080048896.01 | MsG0880046151.01 | 0.886860 | 2.368352e-72 | 1.720547e-68 |
MsG0080048896.01 | MsG0880046158.01 | -0.810203 | 1.295323e-50 | 7.759669e-48 |
MsG0080048896.01 | MsG0880046160.01 | 0.804062 | 2.586642e-49 | 1.320934e-46 |
MsG0080048896.01 | MsG0880046167.01 | 0.831153 | 1.962137e-55 | 2.111276e-52 |
MsG0080048896.01 | MsG0880046174.01 | 0.810718 | 1.002646e-50 | 6.089420e-48 |
MsG0080048896.01 | MsG0880046189.01 | 0.894681 | 1.961987e-75 | 1.970880e-71 |
MsG0080048896.01 | MsG0880046219.01 | 0.883960 | 2.882664e-71 | 1.866590e-67 |
MsG0080048896.01 | MsG0880046252.01 | 0.813085 | 3.060410e-51 | 1.979328e-48 |
MsG0080048896.01 | MsG0880046288.01 | 0.834341 | 3.170226e-56 | 3.751396e-53 |
MsG0080048896.01 | MsG0880046324.01 | 0.805920 | 1.057477e-49 | 5.664393e-47 |
MsG0080048896.01 | MsG0880046341.01 | 0.897815 | 9.745560e-77 | 1.120028e-72 |
MsG0080048896.01 | MsG0880046347.01 | 0.800472 | 1.418537e-48 | 6.610598e-46 |
MsG0080048896.01 | MsG0880046462.01 | 0.850656 | 1.474632e-60 | 2.909174e-57 |
MsG0080048896.01 | MsG0880046469.01 | 0.899214 | 2.473918e-77 | 3.028810e-73 |
MsG0080048896.01 | MsG0880046574.01 | 0.843065 | 1.762311e-58 | 2.724726e-55 |
MsG0080048896.01 | MsG0880046584.01 | 0.920883 | 7.273391e-88 | 2.522652e-83 |
MsG0080048896.01 | MsG0880046630.01 | 0.841876 | 3.642764e-58 | 5.426197e-55 |
MsG0080048896.01 | MsG0880046639.01 | 0.907664 | 3.967920e-81 | 7.107853e-77 |
MsG0080048896.01 | MsG0880046759.01 | 0.890452 | 9.729227e-74 | 8.183354e-70 |
MsG0080048896.01 | MsG0880046805.01 | 0.832793 | 7.719558e-56 | 8.719800e-53 |
MsG0080048896.01 | MsG0880046854.01 | 0.834133 | 3.574715e-56 | 4.203229e-53 |
MsG0080048896.01 | MsG0880046856.01 | 0.819568 | 1.084804e-52 | 8.378416e-50 |
MsG0080048896.01 | MsG0880046866.01 | 0.826647 | 2.418218e-54 | 2.281380e-51 |
MsG0080048896.01 | MsG0880046876.01 | 0.907978 | 2.821941e-81 | 5.128815e-77 |
MsG0080048896.01 | MsG0880046968.01 | 0.832870 | 7.384986e-56 | 8.361619e-53 |
MsG0080048896.01 | MsG0880046969.01 | 0.823709 | 1.197080e-53 | 1.038813e-50 |
MsG0080048896.01 | MsG0880047076.01 | 0.826533 | 2.575280e-54 | 2.421606e-51 |
MsG0080048896.01 | MsG0880047111.01 | 0.814857 | 1.244386e-51 | 8.444414e-49 |
MsG0080048896.01 | MsG0880047112.01 | 0.837433 | 5.211705e-57 | 6.768916e-54 |
MsG0080048896.01 | MsG0880047161.01 | 0.819761 | 9.803149e-53 | 7.612313e-50 |
MsG0080048896.01 | MsG0880047251.01 | 0.807078 | 6.025953e-50 | 3.324950e-47 |
MsG0080048896.01 | MsG0880047318.01 | 0.887915 | 9.380456e-73 | 7.111893e-69 |
MsG0080048896.01 | MsG0880047363.01 | 0.880632 | 4.677702e-70 | 2.657067e-66 |
MsG0080048896.01 | MsG0880047392.01 | 0.815686 | 8.142594e-52 | 5.652331e-49 |
MsG0080048896.01 | MsG0880047406.01 | 0.843395 | 1.438949e-58 | 2.248567e-55 |
MsG0080048896.01 | MsG0880047536.01 | 0.803286 | 3.747951e-49 | 1.876037e-46 |
MsG0080048896.01 | MsG0880047537.01 | -0.828208 | 1.021575e-54 | 1.008668e-51 |
MsG0080048896.01 | MsG0880047540.01 | 0.872142 | 3.991090e-67 | 1.651673e-63 |
MsG0080048896.01 | MsG0880047567.01 | 0.830631 | 2.633999e-55 | 2.790876e-52 |
MsG0080048896.01 | MsG0880047568.01 | -0.811893 | 5.575316e-51 | 3.492783e-48 |
MsG0080048896.01 | MsG0880047578.01 | 0.818368 | 2.032774e-52 | 1.518800e-49 |
MsG0080048896.01 | MsG0880047605.01 | 0.822720 | 2.037148e-53 | 1.718872e-50 |
MsG0080048896.01 | MsG0880047616.01 | 0.811973 | 5.356093e-51 | 3.362852e-48 |
MsG0080048896.01 | MsG0880047627.01 | 0.862251 | 5.785737e-64 | 1.683381e-60 |
MsG0080048896.01 | MsG0880047628.01 | 0.897475 | 1.357067e-76 | 1.535622e-72 |
MsG0080048896.01 | MsG0880047660.01 | 0.817992 | 2.472855e-52 | 1.828437e-49 |
MsG0080048896.01 | MsG0880047661.01 | 0.921251 | 4.544448e-88 | 1.607828e-83 |
MsG0080048896.01 | MsG0880047669.01 | 0.876501 | 1.327793e-68 | 6.453361e-65 |
MsG0080048896.01 | MsG0880047697.01 | -0.819278 | 1.262899e-52 | 9.674870e-50 |
MsG0080048896.01 | MsG0880047723.01 | 0.858689 | 6.932565e-63 | 1.784363e-59 |
MsG0080048896.01 | MsG0880047727.01 | 0.888893 | 3.938995e-73 | 3.108668e-69 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048896.01.T01 | MTR_4g055260 | 96.950 | 459 | 14 | 0 | 15 | 473 | 51 | 509 | 0.0 | 919 |
MsG0080048896.01.T01 | MTR_2g013570 | 44.920 | 187 | 103 | 0 | 28 | 214 | 79 | 265 | 1.95e-51 | 176 |
MsG0080048896.01.T01 | MTR_2g013570 | 45.509 | 167 | 91 | 0 | 28 | 194 | 79 | 245 | 2.62e-46 | 161 |
MsG0080048896.01.T01 | MTR_2g013570 | 51.546 | 97 | 47 | 0 | 28 | 124 | 79 | 175 | 1.39e-26 | 106 |
MsG0080048896.01.T01 | MTR_6g007350 | 50.000 | 88 | 44 | 0 | 28 | 115 | 36 | 123 | 1.33e-21 | 90.5 |
MsG0080048896.01.T01 | MTR_7g446330 | 50.000 | 88 | 44 | 0 | 28 | 115 | 52 | 139 | 2.08e-21 | 90.5 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048896.01.T01 | AT5G22620 | 68.233 | 447 | 128 | 4 | 25 | 466 | 44 | 481 | 0.0 | 633 |
MsG0080048896.01.T01 | AT5G22620 | 68.233 | 447 | 128 | 4 | 25 | 466 | 44 | 481 | 0.0 | 633 |
MsG0080048896.01.T01 | AT5G22620 | 68.233 | 447 | 128 | 4 | 25 | 466 | 44 | 481 | 0.0 | 633 |
MsG0080048896.01.T01 | AT5G22620 | 67.720 | 443 | 128 | 5 | 25 | 466 | 44 | 472 | 0.0 | 615 |
MsG0080048896.01.T01 | AT5G22620 | 66.817 | 443 | 119 | 4 | 25 | 466 | 44 | 459 | 0.0 | 606 |
MsG0080048896.01.T01 | AT5G22620 | 66.817 | 443 | 119 | 4 | 25 | 466 | 44 | 459 | 0.0 | 606 |
MsG0080048896.01.T01 | AT3G50520 | 29.747 | 158 | 106 | 5 | 31 | 184 | 16 | 172 | 5.14e-11 | 63.2 |
Find 22 sgRNAs with CRISPR-Local
Find 824 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
ACTCTCTTTGCCACTTTCAA+TGG | 0.319254 | contig520end:+21358 | MsG0080048896.01.T01:intergenic |
CAAAGAGAGTGGTGCTTGTT+AGG | 0.341702 | contig520end:-21345 | MsG0080048896.01.T01:exon |
ATGTACTCAGAGCAGTGTTC+AGG | 0.406442 | contig520end:-21427 | MsG0080048896.01.T01:exon |
ACTTTGATGCTTGTTTCTCC+AGG | 0.455076 | contig520end:-21204 | MsG0080048896.01.T01:intron |
CTTGTTTCCTCCATTGAAAG+TGG | 0.458735 | contig520end:-21368 | MsG0080048896.01.T01:exon |
TACTAAGAAAGGTGAGTCTC+AGG | 0.462085 | contig520end:-21260 | MsG0080048896.01.T01:exon |
GAATGGAAATGATGATCAAA+GGG | 0.468568 | contig520end:+21486 | MsG0080048896.01.T01:intergenic |
AGAAAAGAATGTGGAGTTGT+GGG | 0.477265 | contig520end:-21400 | MsG0080048896.01.T01:exon |
TGTAGAGAAGAGGAACAAAA+AGG | 0.477645 | contig520end:+21513 | MsG0080048896.01.T01:intergenic |
TTGAGTATGTCTTTGTAGAA+TGG | 0.479785 | contig520end:+21469 | MsG0080048896.01.T01:intergenic |
AATGCTGAAGGGAGGATTCA+AGG | 0.496684 | contig520end:-21304 | MsG0080048896.01.T01:exon |
CTCTTTGCCACTTTCAATGG+AGG | 0.501348 | contig520end:+21361 | MsG0080048896.01.T01:intergenic |
AGAATGGAAATGATGATCAA+AGG | 0.520970 | contig520end:+21485 | MsG0080048896.01.T01:intergenic |
TAGAAAAGAATGTGGAGTTG+TGG | 0.526691 | contig520end:-21401 | MsG0080048896.01.T01:exon |
TTAGGCATGGACAGAGTACA+TGG | 0.546609 | contig520end:-21327 | MsG0080048896.01.T01:exon |
CAGAGTACATGGAATGCTGA+AGG | 0.576687 | contig520end:-21316 | MsG0080048896.01.T01:exon |
AGAGTGGTGCTTGTTAGGCA+TGG | 0.581954 | contig520end:-21340 | MsG0080048896.01.T01:exon |
TCAGGAGATAGAAAAGAATG+TGG | 0.591137 | contig520end:-21409 | MsG0080048896.01.T01:exon |
AAAGGGAACATGTAGAGAAG+AGG | 0.595389 | contig520end:+21503 | MsG0080048896.01.T01:intergenic |
ATTGAAAGTGGCAAAGAGAG+TGG | 0.607739 | contig520end:-21356 | MsG0080048896.01.T01:exon |
AGAGTACATGGAATGCTGAA+GGG | 0.634770 | contig520end:-21315 | MsG0080048896.01.T01:exon |
GTACATGGAATGCTGAAGGG+AGG | 0.686892 | contig520end:-21312 | MsG0080048896.01.T01:exon |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!! | AAAAATATTAATTAGAAGAA+TGG | + | contig520end:18834-18853 | MsG0080048896.01.T01:intergenic | 10.0% |
!! | AAAATATTAATTAGAAGAAT+GGG | + | contig520end:18833-18852 | MsG0080048896.01.T01:intergenic | 10.0% |
!! | ATCAATAAAATAAATTTACA+AGG | + | contig520end:11269-11288 | MsG0080048896.01.T01:intergenic | 10.0% |
!! | TCAATAAAATAAATTTACAA+GGG | + | contig520end:11268-11287 | MsG0080048896.01.T01:intergenic | 10.0% |
!! | AAATATTAATTAGAAGAATG+GGG | + | contig520end:18832-18851 | MsG0080048896.01.T01:intergenic | 15.0% |
!! | AAATGAAGAAAATATAAGTA+TGG | - | contig520end:17387-17406 | MsG0080048896.01.T01:intron | 15.0% |
!! | AATTTATTCCATACAATTTA+GGG | + | contig520end:19024-19043 | MsG0080048896.01.T01:intergenic | 15.0% |
!! | GTAAATAAAAACAAAGATAA+TGG | + | contig520end:11315-11334 | MsG0080048896.01.T01:intergenic | 15.0% |
!! | TAATTTATTCCATACAATTT+AGG | + | contig520end:19025-19044 | MsG0080048896.01.T01:intergenic | 15.0% |
!! | TATATTTAAACAATCCAAAA+AGG | - | contig520end:20449-20468 | MsG0080048896.01.T01:intron | 15.0% |
!!! | AAAAATCACAATTTTCAATA+GGG | + | contig520end:12465-12484 | MsG0080048896.01.T01:intergenic | 15.0% |
!!! | ACAAATTTTGGTTAATATTT+GGG | - | contig520end:19521-19540 | MsG0080048896.01.T01:intron | 15.0% |
!!! | ATTTTTTGTACTATTTTGAA+AGG | + | contig520end:16732-16751 | MsG0080048896.01.T01:intergenic | 15.0% |
!!! | GTTCAAGTATAAATTTTAAT+AGG | + | contig520end:20270-20289 | MsG0080048896.01.T01:intergenic | 15.0% |
!!! | TTAAATTCTTAAGTCATTTT+TGG | - | contig520end:16211-16230 | MsG0080048896.01.T01:intron | 15.0% |
!!! | TTGTAAATTCTGAAAATTTT+GGG | + | contig520end:12262-12281 | MsG0080048896.01.T01:intergenic | 15.0% |
!!! | TTTGTAAATTCTGAAAATTT+TGG | + | contig520end:12263-12282 | MsG0080048896.01.T01:intergenic | 15.0% |
!! | AAACAAAAACACAAAATCAA+TGG | + | contig520end:11069-11088 | MsG0080048896.01.T01:intergenic | 20.0% |
!! | AATACAAATTGAAATGTAGA+AGG | - | contig520end:20632-20651 | MsG0080048896.01.T01:intron | 20.0% |
!! | ACAATATTTATTTCAGAAAG+AGG | + | contig520end:18226-18245 | MsG0080048896.01.T01:intergenic | 20.0% |
!! | ACATATAATAGAAAATATGG+TGG | - | contig520end:10576-10595 | MsG0080048896.01.T01:CDS | 20.0% |
!! | AGCACATATAATAGAAAATA+TGG | - | contig520end:10573-10592 | MsG0080048896.01.T01:CDS | 20.0% |
!! | ATTAAGAGAGAAACTAAAAA+AGG | + | contig520end:11001-11020 | MsG0080048896.01.T01:intergenic | 20.0% |
!! | ATTCATTTATCAGAAATAAG+TGG | - | contig520end:19807-19826 | MsG0080048896.01.T01:intron | 20.0% |
!! | ATTCTTATTAAAACATAAGG+CGG | - | contig520end:15540-15559 | MsG0080048896.01.T01:intron | 20.0% |
!! | CAATATTTATTTCAGAAAGA+GGG | + | contig520end:18225-18244 | MsG0080048896.01.T01:intergenic | 20.0% |
!! | CTAAACAATAAACCTTTAAT+AGG | + | contig520end:20912-20931 | MsG0080048896.01.T01:intergenic | 20.0% |
!! | GGCTAAAATGTAATATATAA+GGG | - | contig520end:18425-18444 | MsG0080048896.01.T01:intron | 20.0% |
!! | TAATAATAGCACTAAAAGAA+AGG | + | contig520end:12496-12515 | MsG0080048896.01.T01:intergenic | 20.0% |
!! | TCCATTCTTATTAAAACATA+AGG | - | contig520end:15537-15556 | MsG0080048896.01.T01:intron | 20.0% |
!! | TGCAACTAATAAATTAACAT+AGG | + | contig520end:20055-20074 | MsG0080048896.01.T01:intergenic | 20.0% |
!! | TGGCTAAAATGTAATATATA+AGG | - | contig520end:18424-18443 | MsG0080048896.01.T01:intron | 20.0% |
!! | TTCATTTATCAGAAATAAGT+GGG | - | contig520end:19808-19827 | MsG0080048896.01.T01:intron | 20.0% |
!! | TTGCAATTTCAAAAAATACA+GGG | + | contig520end:12407-12426 | MsG0080048896.01.T01:intergenic | 20.0% |
!! | TTTGCAATTTCAAAAAATAC+AGG | + | contig520end:12408-12427 | MsG0080048896.01.T01:intergenic | 20.0% |
!!! | AAAATCACAATTTTCAATAG+GGG | + | contig520end:12464-12483 | MsG0080048896.01.T01:intergenic | 20.0% |
!!! | AATTATTAGAATGGTTTTAG+AGG | + | contig520end:18084-18103 | MsG0080048896.01.T01:intergenic | 20.0% |
!!! | ATATTTTTACATTTAGCACA+AGG | - | contig520end:18846-18865 | MsG0080048896.01.T01:intron | 20.0% |
!!! | ATGACAATTATGTTTTTAGT+TGG | + | contig520end:19090-19109 | MsG0080048896.01.T01:intergenic | 20.0% |
!!! | CACAAATTTTGGTTAATATT+TGG | - | contig520end:19520-19539 | MsG0080048896.01.T01:intron | 20.0% |
!!! | CTTTTCAATATGCATATATA+AGG | + | contig520end:11399-11418 | MsG0080048896.01.T01:intergenic | 20.0% |
!!! | GAAAAATCACAATTTTCAAT+AGG | + | contig520end:12466-12485 | MsG0080048896.01.T01:intergenic | 20.0% |
!!! | TCTTTCTTAATAGTTCTTTT+AGG | + | contig520end:10700-10719 | MsG0080048896.01.T01:intergenic | 20.0% |
!!! | TTATCTTGATAATAATGAGA+AGG | + | contig520end:13102-13121 | MsG0080048896.01.T01:intergenic | 20.0% |
!!! | TTGCAATTTCTGAAAATTTT+GGG | + | contig520end:12320-12339 | MsG0080048896.01.T01:intergenic | 20.0% |
!!! | TTTGCAATTTCTGAAAATTT+TGG | + | contig520end:12321-12340 | MsG0080048896.01.T01:intergenic | 20.0% |
! | AAAATTCTTATTATGCTCTG+TGG | - | contig520end:12520-12539 | MsG0080048896.01.T01:intron | 25.0% |
! | AAACTATACTTATGTGGTTT+CGG | - | contig520end:10599-10618 | MsG0080048896.01.T01:intron | 25.0% |
! | AACACTTAGAGATATTCAAA+TGG | - | contig520end:12666-12685 | MsG0080048896.01.T01:intron | 25.0% |
! | AATAGTTCGACTCTATTTAA+AGG | + | contig520end:18287-18306 | MsG0080048896.01.T01:intergenic | 25.0% |
! | AATCTAGTAAATGTCAAACA+TGG | + | contig520end:11640-11659 | MsG0080048896.01.T01:intergenic | 25.0% |
! | ACATGAAATACTCGATTAAT+TGG | + | contig520end:20569-20588 | MsG0080048896.01.T01:intergenic | 25.0% |
! | AGATCTAGAGATCAATAAAT+TGG | - | contig520end:10717-10736 | MsG0080048896.01.T01:intron | 25.0% |
! | AGTTGTAAATGTATGATTTG+AGG | - | contig520end:21369-21388 | MsG0080048896.01.T01:exon | 25.0% |
! | ATAAATTATACTGCACACTT+GGG | - | contig520end:21257-21276 | MsG0080048896.01.T01:exon | 25.0% |
! | ATAGTAGCGATTCATTAAAT+TGG | + | contig520end:20842-20861 | MsG0080048896.01.T01:intergenic | 25.0% |
! | ATCATCAAAATTTCCTTAGA+GGG | + | contig520end:17805-17824 | MsG0080048896.01.T01:intergenic | 25.0% |
! | ATGAGTTAAAAGATGTTGTA+TGG | - | contig520end:10414-10433 | MsG0080048896.01.T01:CDS | 25.0% |
! | ATTGCAATTTATGAAAGTTG+AGG | + | contig520end:12350-12369 | MsG0080048896.01.T01:intergenic | 25.0% |
! | ATTGTAATTTCAGAAAGAAC+AGG | + | contig520end:12437-12456 | MsG0080048896.01.T01:intergenic | 25.0% |
! | CAAAGAATAATACTGAATGT+TGG | + | contig520end:11024-11043 | MsG0080048896.01.T01:intergenic | 25.0% |
! | CAATAAATTGGATGCAAATA+TGG | - | contig520end:10729-10748 | MsG0080048896.01.T01:intron | 25.0% |
! | CATGATTTAAATTGCATTTG+CGG | - | contig520end:20077-20096 | MsG0080048896.01.T01:intron | 25.0% |
! | CATTATTCACTTCTATGATT+TGG | - | contig520end:17305-17324 | MsG0080048896.01.T01:intron | 25.0% |
! | CTAAAAACATAATTGTCATC+TGG | - | contig520end:19091-19110 | MsG0080048896.01.T01:intron | 25.0% |
! | CTTATGTTCAATAAGCTATT+AGG | - | contig520end:11367-11386 | MsG0080048896.01.T01:intron | 25.0% |
! | GAGTTGTAAAAATTTCACAT+AGG | - | contig520end:17351-17370 | MsG0080048896.01.T01:intron | 25.0% |
! | GGCATAAAATTCTTTATCAT+AGG | + | contig520end:15371-15390 | MsG0080048896.01.T01:intergenic | 25.0% |
! | TAAACTGAAACTTACTTGAA+AGG | + | contig520end:11212-11231 | MsG0080048896.01.T01:intergenic | 25.0% |
! | TAATATTACTTAGAGTCAGT+AGG | + | contig520end:18578-18597 | MsG0080048896.01.T01:intergenic | 25.0% |
! | TAATCGAGTATTTCATGTAT+AGG | - | contig520end:20571-20590 | MsG0080048896.01.T01:intron | 25.0% |
! | TAATGAGAGAGAATTTCTAT+TGG | - | contig520end:15860-15879 | MsG0080048896.01.T01:intron | 25.0% |
! | TATAAAATGAAGCTAATCCA+TGG | + | contig520end:15072-15091 | MsG0080048896.01.T01:intergenic | 25.0% |
! | TCTAATAAATCATCAAGTCT+AGG | + | contig520end:14584-14603 | MsG0080048896.01.T01:intergenic | 25.0% |
! | TGACTCTAAGTAATATTAGT+TGG | - | contig520end:18580-18599 | MsG0080048896.01.T01:intron | 25.0% |
! | TGCAATTTCAAAAAATACAG+GGG | + | contig520end:12406-12425 | MsG0080048896.01.T01:intergenic | 25.0% |
! | TGGTTTATGATAGAACATTA+TGG | - | contig520end:10749-10768 | MsG0080048896.01.T01:intron | 25.0% |
! | TTAGTGATTAAAGACACTAA+TGG | + | contig520end:14146-14165 | MsG0080048896.01.T01:intergenic | 25.0% |
! | TTCTTATTAAAACATAAGGC+GGG | - | contig520end:15541-15560 | MsG0080048896.01.T01:intron | 25.0% |
! | TTGCAATTTATGAAAGTTGA+GGG | + | contig520end:12349-12368 | MsG0080048896.01.T01:intergenic | 25.0% |
! | TTGTAATTTCAGAAAGAACA+GGG | + | contig520end:12436-12455 | MsG0080048896.01.T01:intergenic | 25.0% |
! | TTTGAATATCTCTAAGTGTT+TGG | + | contig520end:12666-12685 | MsG0080048896.01.T01:intergenic | 25.0% |
!! | AAACTGTTAGACATGATTTT+AGG | - | contig520end:20341-20360 | MsG0080048896.01.T01:CDS | 25.0% |
!! | AAACTTTTCTCATTTATTGC+AGG | - | contig520end:20935-20954 | MsG0080048896.01.T01:intron | 25.0% |
!! | ACTATAGATTCATATTGACT+TGG | + | contig520end:20738-20757 | MsG0080048896.01.T01:intergenic | 25.0% |
!! | AGAATAATTCTTTTCTGATG+TGG | + | contig520end:12566-12585 | MsG0080048896.01.T01:intergenic | 25.0% |
!! | ATATAATCTGAAGCTGTAAA+AGG | + | contig520end:18161-18180 | MsG0080048896.01.T01:intergenic | 25.0% |
!! | ATCCAGATTTTCAAAAGTTT+TGG | - | contig520end:15671-15690 | MsG0080048896.01.T01:intron | 25.0% |
!! | CCACAATATAATGATTTTAG+AGG | + | contig520end:20170-20189 | MsG0080048896.01.T01:intergenic | 25.0% |
!! | CGGTAAAAATCTAAAACAAT+GGG | - | contig520end:16353-16372 | MsG0080048896.01.T01:intron | 25.0% |
!! | GATTTAAAACTATGGATGTA+GGG | - | contig520end:18120-18139 | MsG0080048896.01.T01:intron | 25.0% |
!! | GCTGTTTACAAAAACTATTT+TGG | - | contig520end:10837-10856 | MsG0080048896.01.T01:intron | 25.0% |
!! | TATAATCTGAAGCTGTAAAA+GGG | + | contig520end:18160-18179 | MsG0080048896.01.T01:intergenic | 25.0% |
!! | TCGGTAAAAATCTAAAACAA+TGG | - | contig520end:16352-16371 | MsG0080048896.01.T01:intron | 25.0% |
!! | TGATTTAAAACTATGGATGT+AGG | - | contig520end:18119-18138 | MsG0080048896.01.T01:intron | 25.0% |
!! | TTTTCTGTTCTTACTAAGAA+AGG | - | contig520end:10259-10278 | MsG0080048896.01.T01:CDS | 25.0% |
!!! | AAGAAGTATCTAAGATGTAT+CGG | + | contig520end:19066-19085 | MsG0080048896.01.T01:intergenic | 25.0% |
!!! | AATCTTTAAAGTTGGAGATT+TGG | - | contig520end:16635-16654 | MsG0080048896.01.T01:intron | 25.0% |
!!! | AATTTTGATGATCAAAAGGT+TGG | - | contig520end:17813-17832 | MsG0080048896.01.T01:intron | 25.0% |
!!! | ACATCCATAGTTTTAAATCA+TGG | + | contig520end:18119-18138 | MsG0080048896.01.T01:intergenic | 25.0% |
!!! | AGGAAATTTTGATGATCAAA+AGG | - | contig520end:17809-17828 | MsG0080048896.01.T01:intron | 25.0% |
!!! | CCTCTAAAATCATTATATTG+TGG | - | contig520end:20167-20186 | MsG0080048896.01.T01:intron | 25.0% |
!!! | CTCACAAACTATTTGATTTT+AGG | - | contig520end:20526-20545 | MsG0080048896.01.T01:intron | 25.0% |
!!! | CTTTTGGAATTGTTTATTCA+TGG | - | contig520end:19647-19666 | MsG0080048896.01.T01:intron | 25.0% |
!!! | GATTAGCTTCATTTTATAGA+AGG | - | contig520end:15074-15093 | MsG0080048896.01.T01:intron | 25.0% |
!!! | GCCTTATGTTTTAATAAGAA+TGG | + | contig520end:15541-15560 | MsG0080048896.01.T01:intergenic | 25.0% |
!!! | GGGTATATTTTAATCTTTGA+AGG | + | contig520end:21452-21471 | MsG0080048896.01.T01:intergenic | 25.0% |
!!! | TGCAATTTCTGAAAATTTTG+GGG | + | contig520end:12319-12338 | MsG0080048896.01.T01:intergenic | 25.0% |
!!! | TTCCAAAACTTTTGAAAATC+TGG | + | contig520end:15676-15695 | MsG0080048896.01.T01:intergenic | 25.0% |
!!! | TTTCAGTCAAAAGTTGTTTT+AGG | + | contig520end:15198-15217 | MsG0080048896.01.T01:intergenic | 25.0% |
!!! | TTTTACTCCATTTTTGACAA+AGG | + | contig520end:14066-14085 | MsG0080048896.01.T01:intergenic | 25.0% |
AAAAAGCAAGATCAAGACTT+GGG | - | contig520end:13041-13060 | MsG0080048896.01.T01:intron | 30.0% | |
AAAGAGAGTAGATCAAATGA+AGG | - | contig520end:10645-10664 | MsG0080048896.01.T01:intron | 30.0% | |
AAATCATCAAGTCTAGGTAT+CGG | + | contig520end:14578-14597 | MsG0080048896.01.T01:intergenic | 30.0% | |
AAATTCTTATGACCATTGCT+TGG | + | contig520end:20608-20627 | MsG0080048896.01.T01:intergenic | 30.0% | |
AAGCTGTAAAAGGGATAATA+AGG | + | contig520end:18151-18170 | MsG0080048896.01.T01:intergenic | 30.0% | |
AATACAGAGGTAAGAAGAAA+TGG | - | contig520end:18404-18423 | MsG0080048896.01.T01:intron | 30.0% | |
AATCAATGACAATGCTTACA+AGG | - | contig520end:16749-16768 | MsG0080048896.01.T01:intron | 30.0% | |
AATCATTTCATCTTGATGCA+GGG | - | contig520end:21177-21196 | MsG0080048896.01.T01:intron | 30.0% | |
AATGACTTTCATTTGCATAG+TGG | + | contig520end:15617-15636 | MsG0080048896.01.T01:intergenic | 30.0% | |
AATGGAAATTTGAACTCTCA+AGG | + | contig520end:11297-11316 | MsG0080048896.01.T01:intergenic | 30.0% | |
AATTCAACTAATCAAGCTAC+TGG | - | contig520end:16411-16430 | MsG0080048896.01.T01:intron | 30.0% | |
ACGAACTACCTTATTATAAC+AGG | - | contig520end:19725-19744 | MsG0080048896.01.T01:intron | 30.0% | |
ACTACAAATTTGCCAATGAA+TGG | + | contig520end:14800-14819 | MsG0080048896.01.T01:intergenic | 30.0% | |
ACTACCTTATTATAACAGGA+CGG | - | contig520end:19729-19748 | MsG0080048896.01.T01:intron | 30.0% | |
ACTATGCAAATGAAAGTCAT+TGG | - | contig520end:15616-15635 | MsG0080048896.01.T01:intron | 30.0% | |
ACTTTATTCTGATATTGCTG+GGG | - | contig520end:19227-19246 | MsG0080048896.01.T01:intron | 30.0% | |
AGAATGGAAATGATGATCAA+AGG | + | contig520end:10048-10067 | MsG0080048896.01.T01:intergenic | 30.0% | |
AGACTTTATTCTGATATTGC+TGG | - | contig520end:19225-19244 | MsG0080048896.01.T01:intron | 30.0% | |
AGCATTTGTTCAATTTCTAC+TGG | + | contig520end:14251-14270 | MsG0080048896.01.T01:intergenic | 30.0% | |
ATACAAATGTACAATCTTGC+AGG | - | contig520end:10972-10991 | MsG0080048896.01.T01:intron | 30.0% | |
ATACCTGATTTAAGCGATTA+AGG | + | contig520end:17993-18012 | MsG0080048896.01.T01:intergenic | 30.0% | |
ATACTTGAACCAGTGAATTT+GGG | - | contig520end:20280-20299 | MsG0080048896.01.T01:intron | 30.0% | |
ATCGGATATTTCATCCAAAA+GGG | + | contig520end:21060-21079 | MsG0080048896.01.T01:intergenic | 30.0% | |
ATGAGCTCTTCATCATAAAT+TGG | + | contig520end:13630-13649 | MsG0080048896.01.T01:intergenic | 30.0% | |
ATGATTCATCATAGTGAATC+AGG | + | contig520end:20816-20835 | MsG0080048896.01.T01:intergenic | 30.0% | |
ATTAGACTAGAAGAATAGTG+AGG | + | contig520end:20320-20339 | MsG0080048896.01.T01:intergenic | 30.0% | |
ATTCATTGGCAAATTTGTAG+TGG | - | contig520end:14799-14818 | MsG0080048896.01.T01:intron | 30.0% | |
ATTCCTATAAGAATGCTTCT+TGG | + | contig520end:13352-13371 | MsG0080048896.01.T01:intergenic | 30.0% | |
CAAATTGTGTGAATACATGA+AGG | + | contig520end:11723-11742 | MsG0080048896.01.T01:intergenic | 30.0% | |
CAATGACTTCAATGATGTAA+GGG | + | contig520end:11591-11610 | MsG0080048896.01.T01:intergenic | 30.0% | |
CACTACGAACATTTATATTG+CGG | - | contig520end:20103-20122 | MsG0080048896.01.T01:intron | 30.0% | |
CAGGTATATAGTACATTTAC+TGG | - | contig520end:18006-18025 | MsG0080048896.01.T01:intron | 30.0% | |
CATAAATTATACTGCACACT+TGG | - | contig520end:21256-21275 | MsG0080048896.01.T01:exon | 30.0% | |
CATGGTAGTTGAAATAGTAA+TGG | + | contig520end:11669-11688 | MsG0080048896.01.T01:intergenic | 30.0% | |
CATTACTATTTCAACTACCA+TGG | - | contig520end:11667-11686 | MsG0080048896.01.T01:intron | 30.0% | |
CATTTATATTGCGGTAAATG+TGG | - | contig520end:20112-20131 | MsG0080048896.01.T01:intron | 30.0% | |
CTTATTTATAGCAATCCTAG+AGG | + | contig520end:11693-11712 | MsG0080048896.01.T01:intergenic | 30.0% | |
GAACATTAAGATAAAGCTCA+TGG | + | contig520end:14204-14223 | MsG0080048896.01.T01:intergenic | 30.0% | |
GAATGGAAATGATGATCAAA+GGG | + | contig520end:10047-10066 | MsG0080048896.01.T01:intergenic | 30.0% | |
GACTTTATTCTGATATTGCT+GGG | - | contig520end:19226-19245 | MsG0080048896.01.T01:intron | 30.0% | |
GATACATACCCTAAATTGTA+TGG | - | contig520end:19013-19032 | MsG0080048896.01.T01:intron | 30.0% | |
GATCATCAAAATTTCCTTAG+AGG | + | contig520end:17806-17825 | MsG0080048896.01.T01:intergenic | 30.0% | |
GATTTATTAGATCAGTTGCA+TGG | - | contig520end:14593-14612 | MsG0080048896.01.T01:intron | 30.0% | |
GCAATCGCAAATTATTAGAA+TGG | + | contig520end:18093-18112 | MsG0080048896.01.T01:intergenic | 30.0% | |
TAAATGTTTCTCCACTCTTA+TGG | + | contig520end:13328-13347 | MsG0080048896.01.T01:intergenic | 30.0% | |
TAAGCGATTAAGGCAAATAT+GGG | + | contig520end:17983-18002 | MsG0080048896.01.T01:intergenic | 30.0% | |
TACATTTACTGGTAGAATGT+GGG | - | contig520end:18017-18036 | MsG0080048896.01.T01:intron | 30.0% | |
TACTGATGTTTATCTGATGA+TGG | + | contig520end:16495-16514 | MsG0080048896.01.T01:intergenic | 30.0% | |
TATACTTGAACCAGTGAATT+TGG | - | contig520end:20279-20298 | MsG0080048896.01.T01:intron | 30.0% | |
TATAGAAAACCCAAATTCAC+TGG | + | contig520end:20292-20311 | MsG0080048896.01.T01:intergenic | 30.0% | |
TATGTAACAATCAGTGTGTT+TGG | - | contig520end:19257-19276 | MsG0080048896.01.T01:intron | 30.0% | |
TCGTAAGCACATAATTCAAA+TGG | + | contig520end:17847-17866 | MsG0080048896.01.T01:intergenic | 30.0% | |
TGACCCAAATTCTATTCTTA+CGG | + | contig520end:11449-11468 | MsG0080048896.01.T01:intergenic | 30.0% | |
TGCAATTTATGAAAGTTGAG+GGG | + | contig520end:12348-12367 | MsG0080048896.01.T01:intergenic | 30.0% | |
TGTAATTTCAGAAAGAACAG+GGG | + | contig520end:12435-12454 | MsG0080048896.01.T01:intergenic | 30.0% | |
TGTGATGTTATAATAGACAG+TGG | - | contig520end:13771-13790 | MsG0080048896.01.T01:CDS | 30.0% | |
TTAAGATAAAGCTCATGGTT+TGG | + | contig520end:14199-14218 | MsG0080048896.01.T01:intergenic | 30.0% | |
TTAAGCGATTAAGGCAAATA+TGG | + | contig520end:17984-18003 | MsG0080048896.01.T01:intergenic | 30.0% | |
TTATCAGAAATAAGTGGGAA+TGG | - | contig520end:19813-19832 | MsG0080048896.01.T01:intron | 30.0% | |
TTCCTATAAGAATGCTTCTT+GGG | + | contig520end:13351-13370 | MsG0080048896.01.T01:intergenic | 30.0% | |
TTCTCTACTCTTCCTATTAA+AGG | - | contig520end:20897-20916 | MsG0080048896.01.T01:intron | 30.0% | |
TTGAGTATGTCTTTGTAGAA+TGG | + | contig520end:10064-10083 | MsG0080048896.01.T01:intergenic | 30.0% | |
TTTAGTGAAAAGCTCAACAA+TGG | - | contig520end:15328-15347 | MsG0080048896.01.T01:intron | 30.0% | |
TTTCAATATTGGGTACATGT+TGG | + | contig520end:18977-18996 | MsG0080048896.01.T01:intergenic | 30.0% | |
TTTGTTCAATTTCTACTGGA+AGG | + | contig520end:14247-14266 | MsG0080048896.01.T01:intergenic | 30.0% | |
! | AAGATCGATCTTTGAAAAGA+TGG | + | contig520end:14624-14643 | MsG0080048896.01.T01:intergenic | 30.0% |
! | AATTTCACATAGGTTGACAA+TGG | - | contig520end:17361-17380 | MsG0080048896.01.T01:intron | 30.0% |
! | ACGTTTTCTTTAAGCTGTTT+GGG | + | contig520end:10926-10945 | MsG0080048896.01.T01:intergenic | 30.0% |
! | ATTCTATAAGCTGGTCTATT+AGG | + | contig520end:14374-14393 | MsG0080048896.01.T01:intergenic | 30.0% |
! | ATTTCACATAGGTTGACAAT+GGG | - | contig520end:17362-17381 | MsG0080048896.01.T01:intron | 30.0% |
! | CAGACCATGATTTAAAACTA+TGG | - | contig520end:18112-18131 | MsG0080048896.01.T01:intron | 30.0% |
! | CATAGGAAATAGTAGTTTGT+CGG | + | contig520end:20038-20057 | MsG0080048896.01.T01:intergenic | 30.0% |
! | CTGTAAGTTACTTACCTTTT+TGG | + | contig520end:20466-20485 | MsG0080048896.01.T01:intergenic | 30.0% |
! | GCATATAAAAACCAGTGTTT+TGG | + | contig520end:15957-15976 | MsG0080048896.01.T01:intergenic | 30.0% |
! | GTAGATATTCCTGATTTTGA+AGG | - | contig520end:12853-12872 | MsG0080048896.01.T01:intron | 30.0% |
! | GTCTCAATAGAAGATTTGTT+AGG | + | contig520end:19934-19953 | MsG0080048896.01.T01:intergenic | 30.0% |
! | GTGCATTTATGCACAAATTT+TGG | - | contig520end:19509-19528 | MsG0080048896.01.T01:intron | 30.0% |
! | GTTTTTGTTCTTGTGGTTTA+GGG | - | contig520end:17552-17571 | MsG0080048896.01.T01:intron | 30.0% |
! | TCAACTTTATTTAACCATCC+AGG | + | contig520end:20987-21006 | MsG0080048896.01.T01:intergenic | 30.0% |
! | TCTAACTCTTCTTCTTTTTC+AGG | + | contig520end:13606-13625 | MsG0080048896.01.T01:intergenic | 30.0% |
! | TGCAATTACGGAAAAGTTTT+GGG | + | contig520end:12291-12310 | MsG0080048896.01.T01:intergenic | 30.0% |
! | TGTGGATAGATTTTCAAAGA+TGG | - | contig520end:16074-16093 | MsG0080048896.01.T01:intron | 30.0% |
! | TTAAAGTTGGAGATTTGGTA+TGG | - | contig520end:16640-16659 | MsG0080048896.01.T01:intron | 30.0% |
! | TTTTAGATTTTCCCACCAAA+TGG | + | contig520end:13001-13020 | MsG0080048896.01.T01:intergenic | 30.0% |
! | TTTTCACTAAAGAAGGCTAT+AGG | + | contig520end:15319-15338 | MsG0080048896.01.T01:intergenic | 30.0% |
!! | ACTCAGGAATAATTTGTTGT+TGG | + | contig520end:11162-11181 | MsG0080048896.01.T01:intergenic | 30.0% |
!! | AGAAGTATCAAGATCAAGTT+TGG | - | contig520end:13943-13962 | MsG0080048896.01.T01:CDS | 30.0% |
!! | AGGCAACAAATCTTTAAAGT+TGG | - | contig520end:16627-16646 | MsG0080048896.01.T01:intron | 30.0% |
!! | CTCTAGGATTGCTATAAATA+AGG | - | contig520end:11691-11710 | MsG0080048896.01.T01:intron | 30.0% |
!! | CTTCTTTCATTTTAGTCCTT+TGG | - | contig520end:11096-11115 | MsG0080048896.01.T01:CDS | 30.0% |
!! | GATGTTTACTCACTTTTATG+TGG | - | contig520end:18670-18689 | MsG0080048896.01.T01:intron | 30.0% |
!! | GGAAAGTTTGAGTTTTCTAA+GGG | - | contig520end:11868-11887 | MsG0080048896.01.T01:intron | 30.0% |
!! | TCATGAATTGACTTTGGAAT+AGG | + | contig520end:15037-15056 | MsG0080048896.01.T01:intergenic | 30.0% |
!! | TGTTTTTGTTCTTGTGGTTT+AGG | - | contig520end:17551-17570 | MsG0080048896.01.T01:intron | 30.0% |
!! | TTGTCATGTTTTAAGCATCT+AGG | + | contig520end:18943-18962 | MsG0080048896.01.T01:intergenic | 30.0% |
!!! | ATACGTTGTTTTTGTTCTTG+TGG | - | contig520end:17545-17564 | MsG0080048896.01.T01:intron | 30.0% |
!!! | GCGTTAGTTTTGTGAAAAAA+TGG | + | contig520end:11940-11959 | MsG0080048896.01.T01:intergenic | 30.0% |
!!! | TACTTGCAAGTTTTAAACTG+CGG | + | contig520end:20206-20225 | MsG0080048896.01.T01:intergenic | 30.0% |
!!! | TTGTTTTTATCAAGTCCACT+CGG | + | contig520end:14110-14129 | MsG0080048896.01.T01:intergenic | 30.0% |
!!! | TTTTAAAGTCCAATTGGTCA+TGG | + | contig520end:19285-19304 | MsG0080048896.01.T01:intergenic | 30.0% |
AAAACAATGGGATCTCATCT+TGG | - | contig520end:16365-16384 | MsG0080048896.01.T01:intron | 35.0% | |
AAAACCGCTGAAATCATTTG+GGG | - | contig520end:11130-11149 | MsG0080048896.01.T01:CDS | 35.0% | |
AAACTACAATGGCTCAACAA+AGG | - | contig520end:13870-13889 | MsG0080048896.01.T01:CDS | 35.0% | |
AAATAGTCCCTAAGAGAGAA+CGG | + | contig520end:17510-17529 | MsG0080048896.01.T01:intergenic | 35.0% | |
AAATGATTCCAACCATTCCT+CGG | + | contig520end:21165-21184 | MsG0080048896.01.T01:intergenic | 35.0% | |
AAATGCACAACAAGCACAAT+TGG | - | contig520end:12729-12748 | MsG0080048896.01.T01:intron | 35.0% | |
AACAAGAAACTAGGTCTTGA+AGG | + | contig520end:21474-21493 | MsG0080048896.01.T01:intergenic | 35.0% | |
AACACCGTCCTGTTATAATA+AGG | + | contig520end:19736-19755 | MsG0080048896.01.T01:intergenic | 35.0% | |
AACATCTCTATCAGAAGTGA+TGG | + | contig520end:16193-16212 | MsG0080048896.01.T01:intergenic | 35.0% | |
AAGCGATTAAGGCAAATATG+GGG | + | contig520end:17982-18001 | MsG0080048896.01.T01:intergenic | 35.0% | |
AAGGAAATTGTTCGTCTTCA+TGG | - | contig520end:16156-16175 | MsG0080048896.01.T01:intron | 35.0% | |
AATTAGAAGAATGGGGTTGA+AGG | + | contig520end:18825-18844 | MsG0080048896.01.T01:intergenic | 35.0% | |
ACAAGAAACTAGGTCTTGAA+GGG | + | contig520end:21473-21492 | MsG0080048896.01.T01:intergenic | 35.0% | |
ACACAAGTGCTTATTTCATG+AGG | - | contig520end:17236-17255 | MsG0080048896.01.T01:intron | 35.0% | |
ACCTACTCCTTTGTCAAAAA+TGG | - | contig520end:14056-14075 | MsG0080048896.01.T01:intron | 35.0% | |
ACGAACAAGATATAAACTCG+AGG | - | contig520end:16841-16860 | MsG0080048896.01.T01:intron | 35.0% | |
ACTTGGATAGAGTTGAGATA+CGG | + | contig520end:20721-20740 | MsG0080048896.01.T01:intergenic | 35.0% | |
AGAAAACCGCTGAAATCATT+TGG | - | contig520end:11128-11147 | MsG0080048896.01.T01:CDS | 35.0% | |
AGAAAAGAATGTGGAGTTGT+GGG | - | contig520end:10130-10149 | MsG0080048896.01.T01:exon | 35.0% | |
AGCTGTAACTTTCACAGAAA+TGG | + | contig520end:18493-18512 | MsG0080048896.01.T01:intergenic | 35.0% | |
AGTTTGAGTGCAAGAATCAA+CGG | - | contig520end:11847-11866 | MsG0080048896.01.T01:intron | 35.0% | |
ATAACACCAAGCATGTTCAA+TGG | + | contig520end:19777-19796 | MsG0080048896.01.T01:intergenic | 35.0% | |
ATAAGAAGAATTCTCAGTGG+AGG | + | contig520end:13379-13398 | MsG0080048896.01.T01:intergenic | 35.0% | |
ATAATGTGTGAGCAAGACTT+AGG | + | contig520end:17291-17310 | MsG0080048896.01.T01:intergenic | 35.0% | |
ATAGGAAGAGTAGAGAAAAG+TGG | + | contig520end:20894-20913 | MsG0080048896.01.T01:intergenic | 35.0% | |
ATATCCGATGAATCTAGATC+AGG | - | contig520end:21071-21090 | MsG0080048896.01.T01:intron | 35.0% | |
ATCTACTCAAGGAAATACAG+AGG | - | contig520end:18391-18410 | MsG0080048896.01.T01:intron | 35.0% | |
ATCTTGATACTTCTGACCAA+TGG | + | contig520end:13937-13956 | MsG0080048896.01.T01:intergenic | 35.0% | |
ATGAACTCAGAACAGCATTA+TGG | - | contig520end:21009-21028 | MsG0080048896.01.T01:intron | 35.0% | |
ATTAGAAGAATGGGGTTGAA+GGG | + | contig520end:18824-18843 | MsG0080048896.01.T01:intergenic | 35.0% | |
ATTCCAAAAGCTCAGATTGT+TGG | + | contig520end:19637-19656 | MsG0080048896.01.T01:intergenic | 35.0% | |
CAAATGCAGTTCTTCATGTT+AGG | - | contig520end:19695-19714 | MsG0080048896.01.T01:intron | 35.0% | |
CAAGAATAAGATAAGCGTAG+CGG | - | contig520end:10462-10481 | MsG0080048896.01.T01:CDS | 35.0% | |
CATCGGATATTTCATCCAAA+AGG | + | contig520end:21061-21080 | MsG0080048896.01.T01:intergenic | 35.0% | |
CATTTAGCACAAGGTAATGT+AGG | - | contig520end:18855-18874 | MsG0080048896.01.T01:intron | 35.0% | |
CCACTTACAGATTGCATAAA+GGG | - | contig520end:15127-15146 | MsG0080048896.01.T01:intron | 35.0% | |
CCAGAGATGGTTTATATGAA+TGG | - | contig520end:14705-14724 | MsG0080048896.01.T01:intron | 35.0% | |
CCATTCATATAAACCATCTC+TGG | + | contig520end:14708-14727 | MsG0080048896.01.T01:intergenic | 35.0% | |
CCATTGCAACAAACAAGTAT+TGG | + | contig520end:18651-18670 | MsG0080048896.01.T01:intergenic | 35.0% | |
CCTTTATGCAATCTGTAAGT+GGG | + | contig520end:15129-15148 | MsG0080048896.01.T01:intergenic | 35.0% | |
CGAACAAGATATAAACTCGA+GGG | - | contig520end:16842-16861 | MsG0080048896.01.T01:intron | 35.0% | |
CTAGTAAATGTCAAACATGG+TGG | + | contig520end:11637-11656 | MsG0080048896.01.T01:intergenic | 35.0% | |
CTCATCCTTACAAACTACAA+TGG | - | contig520end:13859-13878 | MsG0080048896.01.T01:CDS | 35.0% | |
CTTAGGGACTATTTATGATG+TGG | - | contig520end:17516-17535 | MsG0080048896.01.T01:intron | 35.0% | |
CTTTATGCAATCTGTAAGTG+GGG | + | contig520end:15128-15147 | MsG0080048896.01.T01:intergenic | 35.0% | |
CTTTATTCTGATATTGCTGG+GGG | - | contig520end:19228-19247 | MsG0080048896.01.T01:intron | 35.0% | |
GAAAAAGCAAGATCAAGACT+TGG | - | contig520end:13040-13059 | MsG0080048896.01.T01:intron | 35.0% | |
GAAAACCGCTGAAATCATTT+GGG | - | contig520end:11129-11148 | MsG0080048896.01.T01:CDS | 35.0% | |
GAAATGTAGAAGGAAACATG+TGG | - | contig520end:20642-20661 | MsG0080048896.01.T01:intron | 35.0% | |
GAATCATTTCATCTTGATGC+AGG | - | contig520end:21176-21195 | MsG0080048896.01.T01:intron | 35.0% | |
GACATTCACATTGCTTATTG+TGG | + | contig520end:19475-19494 | MsG0080048896.01.T01:intergenic | 35.0% | |
GACCAATGGAAAAATTCACA+AGG | + | contig520end:13923-13942 | MsG0080048896.01.T01:intergenic | 35.0% | |
GACTCAATTCAAAGAAGTTG+TGG | - | contig520end:14166-14185 | MsG0080048896.01.T01:intron | 35.0% | |
GAGACTGTTACACATGAAAA+AGG | + | contig520end:19858-19877 | MsG0080048896.01.T01:intergenic | 35.0% | |
GATCAAAAACCGTAAAGCAT+TGG | + | contig520end:17425-17444 | MsG0080048896.01.T01:intergenic | 35.0% | |
GATTAAAGACACTAATGGCT+TGG | + | contig520end:14141-14160 | MsG0080048896.01.T01:intergenic | 35.0% | |
GCAATGACTTCAATGATGTA+AGG | + | contig520end:11592-11611 | MsG0080048896.01.T01:intergenic | 35.0% | |
GCTGTAACTTTCACAGAAAT+GGG | + | contig520end:18492-18511 | MsG0080048896.01.T01:intergenic | 35.0% | |
GGAGAAAAACGAATGCATTT+AGG | + | contig520end:21431-21450 | MsG0080048896.01.T01:intergenic | 35.0% | |
GTACATTTACTGGTAGAATG+TGG | - | contig520end:18016-18035 | MsG0080048896.01.T01:intron | 35.0% | |
GTATAAGTCAGCAACTTGAA+CGG | + | contig520end:16133-16152 | MsG0080048896.01.T01:intergenic | 35.0% | |
GTGTGAATACATGAAGGAAA+TGG | + | contig520end:11717-11736 | MsG0080048896.01.T01:intergenic | 35.0% | |
GTTGAAGAATTGCTGAAGAA+AGG | - | contig520end:14428-14447 | MsG0080048896.01.T01:intron | 35.0% | |
GTTGGCATAACAATCATGAT+GGG | + | contig520end:14036-14055 | MsG0080048896.01.T01:intergenic | 35.0% | |
TAAAGGGAGATCAATTCCAA+TGG | - | contig520end:15143-15162 | MsG0080048896.01.T01:intron | 35.0% | |
TACAAACGCAACAAGAAACT+AGG | + | contig520end:21483-21502 | MsG0080048896.01.T01:intergenic | 35.0% | |
TAGAAAAGAATGTGGAGTTG+TGG | - | contig520end:10129-10148 | MsG0080048896.01.T01:exon | 35.0% | |
TATCGGAAATCGATACTTGA+TGG | + | contig520end:14561-14580 | MsG0080048896.01.T01:intergenic | 35.0% | |
TATTCCTGAGTATGACCTAA+GGG | - | contig520end:11171-11190 | MsG0080048896.01.T01:intron | 35.0% | |
TATTCGTTTAGCCATAAGAG+TGG | - | contig520end:13314-13333 | MsG0080048896.01.T01:intron | 35.0% | |
TCAAAGTGTGGATAATGCAT+AGG | + | contig520end:18884-18903 | MsG0080048896.01.T01:intergenic | 35.0% | |
TCACATACGCTGAAAGATTT+CGG | + | contig520end:21408-21427 | MsG0080048896.01.T01:intergenic | 35.0% | |
TCAGGAGATAGAAAAGAATG+TGG | - | contig520end:10121-10140 | MsG0080048896.01.T01:exon | 35.0% | |
TCGCCGTAAGAATAGAATTT+GGG | - | contig520end:11443-11462 | MsG0080048896.01.T01:intron | 35.0% | |
TCTACGAGAAGCCATTATTT+GGG | - | contig520end:15783-15802 | MsG0080048896.01.T01:intron | 35.0% | |
TCTCTGAATGATTGTCTTTG+TGG | + | contig520end:12820-12839 | MsG0080048896.01.T01:intergenic | 35.0% | |
TGAACTCAGAACAGCATTAT+GGG | - | contig520end:21010-21029 | MsG0080048896.01.T01:intron | 35.0% | |
TGGTGGAAACTATACTTATG+TGG | - | contig520end:10593-10612 | MsG0080048896.01.T01:intron | 35.0% | |
TGTAGAGAAGAGGAACAAAA+AGG | + | contig520end:10020-10039 | MsG0080048896.01.T01:intergenic | 35.0% | |
TGTAGCTTTCCTTCAAAATC+AGG | + | contig520end:12865-12884 | MsG0080048896.01.T01:intergenic | 35.0% | |
TGTTGGCATAACAATCATGA+TGG | + | contig520end:14037-14056 | MsG0080048896.01.T01:intergenic | 35.0% | |
TTACAGTTTCTTGTAACTGC+TGG | + | contig520end:12711-12730 | MsG0080048896.01.T01:intergenic | 35.0% | |
TTAGGAAAGAAATACGTCAC+AGG | + | contig520end:18537-18556 | MsG0080048896.01.T01:intergenic | 35.0% | |
TTATGTACTTGTGAGTTGTG+AGG | + | contig520end:19408-19427 | MsG0080048896.01.T01:intergenic | 35.0% | |
TTATTCCTGAGTATGACCTA+AGG | - | contig520end:11170-11189 | MsG0080048896.01.T01:CDS | 35.0% | |
TTCCAAAAGCTCAGATTGTT+GGG | + | contig520end:19636-19655 | MsG0080048896.01.T01:intergenic | 35.0% | |
TTCGCCGTAAGAATAGAATT+TGG | - | contig520end:11442-11461 | MsG0080048896.01.T01:intron | 35.0% | |
TTGCCTTAATCGCTTAAATC+AGG | - | contig520end:17987-18006 | MsG0080048896.01.T01:intron | 35.0% | |
TTGGGAATTCAAATGCTTGA+GGG | + | contig520end:15467-15486 | MsG0080048896.01.T01:intergenic | 35.0% | |
TTGGGTTTATTTACTGTGGT+GGG | + | contig520end:13456-13475 | MsG0080048896.01.T01:intergenic | 35.0% | |
TTGTAAAAACTCACTCCAAG+CGG | + | contig520end:15512-15531 | MsG0080048896.01.T01:intergenic | 35.0% | |
TTTATTCTGATATTGCTGGG+GGG | - | contig520end:19229-19248 | MsG0080048896.01.T01:intron | 35.0% | |
! | AAAACTCTTTTGTGCTTGCT+CGG | + | contig520end:15170-15189 | MsG0080048896.01.T01:intergenic | 35.0% |
! | AACTTGGCATTTGGTTGTTT+TGG | + | contig520end:16690-16709 | MsG0080048896.01.T01:intergenic | 35.0% |
! | AAGTATCTAAGATGTATCGG+TGG | + | contig520end:19063-19082 | MsG0080048896.01.T01:intergenic | 35.0% |
! | AAGTTTGCAATCTTTTCACC+AGG | + | contig520end:19352-19371 | MsG0080048896.01.T01:intergenic | 35.0% |
! | ACGTTGGATTAGAAAGAGAA+TGG | - | contig520end:18732-18751 | MsG0080048896.01.T01:intron | 35.0% |
! | ACTGCATTTAAAACCAGAGA+TGG | - | contig520end:14692-14711 | MsG0080048896.01.T01:intron | 35.0% |
! | AGTACAAATCGATTTCCCTT+AGG | + | contig520end:11189-11208 | MsG0080048896.01.T01:intergenic | 35.0% |
! | ATCAGAATCTAGAACAGACA+AGG | - | contig520end:11470-11489 | MsG0080048896.01.T01:intron | 35.0% |
! | ATCGATCTTTGAAAAGATGG+TGG | + | contig520end:14621-14640 | MsG0080048896.01.T01:intergenic | 35.0% |
! | ATGATATTGCTTTGGATGTG+TGG | - | contig520end:10490-10509 | MsG0080048896.01.T01:CDS | 35.0% |
! | CACGTTTTCTTTAAGCTGTT+TGG | + | contig520end:10927-10946 | MsG0080048896.01.T01:intergenic | 35.0% |
! | CATGAGGGATTTTTGTTCAA+AGG | - | contig520end:15733-15752 | MsG0080048896.01.T01:intron | 35.0% |
! | CATTGTAGTTTGTAAGGATG+AGG | + | contig520end:13861-13880 | MsG0080048896.01.T01:intergenic | 35.0% |
! | CCAATACTTGTTTGTTGCAA+TGG | - | contig520end:18648-18667 | MsG0080048896.01.T01:intron | 35.0% |
! | CGTTTTCTTTAAGCTGTTTG+GGG | + | contig520end:10925-10944 | MsG0080048896.01.T01:intergenic | 35.0% |
! | CTATCAGAAGTGATGGTTTT+TGG | + | contig520end:16186-16205 | MsG0080048896.01.T01:intergenic | 35.0% |
! | CTCACATCATGAATTGACTT+TGG | + | contig520end:15043-15062 | MsG0080048896.01.T01:intergenic | 35.0% |
! | CTGCAATTACGGAAAAGTTT+TGG | + | contig520end:12292-12311 | MsG0080048896.01.T01:intergenic | 35.0% |
! | CTGCAATTTTCGAAAGTTGA+GGG | + | contig520end:12378-12397 | MsG0080048896.01.T01:intergenic | 35.0% |
! | GAAGCTGTTAACAGGATTTT+GGG | - | contig520end:16309-16328 | MsG0080048896.01.T01:intron | 35.0% |
! | GTTGAGCTTTTCACTAAAGA+AGG | + | contig520end:15326-15345 | MsG0080048896.01.T01:intergenic | 35.0% |
! | GTTTTCTTTAAGCTGTTTGG+GGG | + | contig520end:10924-10943 | MsG0080048896.01.T01:intergenic | 35.0% |
! | TACGGTTTTTGATCAGAACT+TGG | - | contig520end:17431-17450 | MsG0080048896.01.T01:intron | 35.0% |
! | TACTGGAAAATGTCCTTTTG+AGG | - | contig520end:16428-16447 | MsG0080048896.01.T01:intron | 35.0% |
! | TCTGCAATTTTCGAAAGTTG+AGG | + | contig520end:12379-12398 | MsG0080048896.01.T01:intergenic | 35.0% |
! | TCTGCGATTGATCTTTTGTT+GGG | + | contig520end:15485-15504 | MsG0080048896.01.T01:intergenic | 35.0% |
! | TGAAGCTGTTAACAGGATTT+TGG | - | contig520end:16308-16327 | MsG0080048896.01.T01:intron | 35.0% |
! | TGCAATTTTCGAAAGTTGAG+GGG | + | contig520end:12377-12396 | MsG0080048896.01.T01:intergenic | 35.0% |
! | TGCCTTGTGAATTTTTCCAT+TGG | - | contig520end:13918-13937 | MsG0080048896.01.T01:CDS | 35.0% |
! | TTGAGCCATTGTAGTTTGTA+AGG | + | contig520end:13867-13886 | MsG0080048896.01.T01:intergenic | 35.0% |
! | TTTGGGTTTATTTACTGTGG+TGG | + | contig520end:13457-13476 | MsG0080048896.01.T01:intergenic | 35.0% |
!! | AGAAGGTTTTGTAGAAGTAC+TGG | + | contig520end:13427-13446 | MsG0080048896.01.T01:intergenic | 35.0% |
!! | AGCAAGACTTAGGAAGTATT+TGG | + | contig520end:17281-17300 | MsG0080048896.01.T01:intergenic | 35.0% |
!! | AGCTTATGAAGAAGTTGATG+AGG | - | contig520end:13563-13582 | MsG0080048896.01.T01:CDS | 35.0% |
!! | AGCTTTGGGTTTATTTACTG+TGG | + | contig520end:13460-13479 | MsG0080048896.01.T01:intergenic | 35.0% |
!! | AGTTGCTGACTTATACTTCA+AGG | - | contig520end:16137-16156 | MsG0080048896.01.T01:intron | 35.0% |
!! | ATTTGGGTTTTGTCGTATCT+TGG | - | contig520end:19537-19556 | MsG0080048896.01.T01:intron | 35.0% |
!! | ATTTTAGTCCCCAAAAAGGA+TGG | - | contig520end:14491-14510 | MsG0080048896.01.T01:intron | 35.0% |
!! | ATTTTTGGAGAACCTTATGG+AGG | - | contig520end:16226-16245 | MsG0080048896.01.T01:intron | 35.0% |
!! | CATGCTATTGACTTTATTCC+TGG | - | contig520end:14338-14357 | MsG0080048896.01.T01:intron | 35.0% |
!! | CGGAAAGTTTGAGTTTTCTA+AGG | - | contig520end:11867-11886 | MsG0080048896.01.T01:intron | 35.0% |
!! | GACATGATTTTAGGTACAAG+AGG | - | contig520end:20350-20369 | MsG0080048896.01.T01:CDS | 35.0% |
!! | TACCCAAGAAGCATTCTTAT+AGG | - | contig520end:13346-13365 | MsG0080048896.01.T01:intron | 35.0% |
!! | TACCCAATATTGAAAGTGTC+CGG | - | contig520end:18982-19001 | MsG0080048896.01.T01:intron | 35.0% |
!! | TCCATTTTTGACAAAGGAGT+AGG | + | contig520end:14060-14079 | MsG0080048896.01.T01:intergenic | 35.0% |
!! | TCTGAAAATTTTGGGTGACT+GGG | + | contig520end:12254-12273 | MsG0080048896.01.T01:intergenic | 35.0% |
!! | TGCAATTTTAGTCCCCAAAA+AGG | - | contig520end:14487-14506 | MsG0080048896.01.T01:intron | 35.0% |
!! | TTCTGAAAATTTTGGGTGAC+TGG | + | contig520end:12255-12274 | MsG0080048896.01.T01:intergenic | 35.0% |
!! | TTTTTGGGGACTAAAATTGC+AGG | + | contig520end:14488-14507 | MsG0080048896.01.T01:intergenic | 35.0% |
!!! | CATCAAGAATTTTAGCTCAG+TGG | - | contig520end:15099-15118 | MsG0080048896.01.T01:intron | 35.0% |
!!! | CATCATTAGTCTTTTGGCAT+GGG | + | contig520end:16110-16129 | MsG0080048896.01.T01:intergenic | 35.0% |
!!! | CTGATCGTTATTTGTTTTGC+GGG | + | contig520end:13403-13422 | MsG0080048896.01.T01:intergenic | 35.0% |
!!! | CTTCTTTTTCAGGTTCATCT+TGG | + | contig520end:13596-13615 | MsG0080048896.01.T01:intergenic | 35.0% |
!!! | GAAGGTTTTGTAGAAGTACT+GGG | + | contig520end:13426-13445 | MsG0080048896.01.T01:intergenic | 35.0% |
!!! | GCTGATCGTTATTTGTTTTG+CGG | + | contig520end:13404-13423 | MsG0080048896.01.T01:intergenic | 35.0% |
!!! | GTCATTTTTGGAGAACCTTA+TGG | - | contig520end:16223-16242 | MsG0080048896.01.T01:intron | 35.0% |
!!! | TGATCGTTATTTGTTTTGCG+GGG | + | contig520end:13402-13421 | MsG0080048896.01.T01:intergenic | 35.0% |
!!! | TGATCTTGCTTTTTCCTTCA+CGG | + | contig520end:13035-13054 | MsG0080048896.01.T01:intergenic | 35.0% |
!!! | TGCACGTTTTAAAGTCCAAT+TGG | + | contig520end:19291-19310 | MsG0080048896.01.T01:intergenic | 35.0% |
AAAACTATGGATGTAGGGCT+TGG | - | contig520end:18125-18144 | MsG0080048896.01.T01:intron | 40.0% | |
AAAAGGTTCATGTTAGCACC+TGG | - | contig520end:19331-19350 | MsG0080048896.01.T01:intron | 40.0% | |
AAAATTGCAGGAACAGCACA+AGG | + | contig520end:14476-14495 | MsG0080048896.01.T01:intergenic | 40.0% | |
AAAGGGAACATGTAGAGAAG+AGG | + | contig520end:10030-10049 | MsG0080048896.01.T01:intergenic | 40.0% | |
AAATCCTAGCTCATGATAGC+AGG | - | contig520end:17709-17728 | MsG0080048896.01.T01:intron | 40.0% | |
AAATTGCAGGAACAGCACAA+GGG | + | contig520end:14475-14494 | MsG0080048896.01.T01:intergenic | 40.0% | |
AACTCTTCAACATCCTCAGT+TGG | + | contig520end:21308-21327 | MsG0080048896.01.T01:intergenic | 40.0% | |
AAGATGTCGAGTATGCCATT+TGG | - | contig520end:15918-15937 | MsG0080048896.01.T01:intron | 40.0% | |
AATAGTCCCTAAGAGAGAAC+GGG | + | contig520end:17509-17528 | MsG0080048896.01.T01:intergenic | 40.0% | |
ACAGCATTATGGGATCAATC+AGG | - | contig520end:21020-21039 | MsG0080048896.01.T01:intron | 40.0% | |
ACTTTACTTCAGAGCAACTG+TGG | - | contig520end:17913-17932 | MsG0080048896.01.T01:intron | 40.0% | |
ACTTTGTGCTTGGATTACCT+CGG | - | contig520end:16019-16038 | MsG0080048896.01.T01:intron | 40.0% | |
AGAACCATCACCATCATCAA+AGG | - | contig520end:13537-13556 | MsG0080048896.01.T01:intron | 40.0% | |
AGAACCTTATGGAGGAAGAT+GGG | - | contig520end:16234-16253 | MsG0080048896.01.T01:intron | 40.0% | |
AGAAGATGACATGCATCCAT+TGG | + | contig520end:13981-14000 | MsG0080048896.01.T01:intergenic | 40.0% | |
AGAGTACATGGAATGCTGAA+GGG | - | contig520end:10215-10234 | MsG0080048896.01.T01:exon | 40.0% | |
AGATCCCCAAATGATTTCAG+CGG | + | contig520end:11137-11156 | MsG0080048896.01.T01:intergenic | 40.0% | |
AGCACTTTGCAACTAGCATT+AGG | + | contig520end:18555-18574 | MsG0080048896.01.T01:intergenic | 40.0% | |
AGGCTGAAATGAAGGAAAAC+TGG | + | contig520end:20967-20986 | MsG0080048896.01.T01:intergenic | 40.0% | |
AGTGTGAAGCTACGTCTAAA+AGG | - | contig520end:19314-19333 | MsG0080048896.01.T01:intron | 40.0% | |
AGTGTTTGGTCGTTTCTTCT+TGG | + | contig520end:12652-12671 | MsG0080048896.01.T01:intergenic | 40.0% | |
AGTTACAGCTGATACACCAA+CGG | - | contig520end:18503-18522 | MsG0080048896.01.T01:intron | 40.0% | |
AGTTAGATCACTAGAGACAG+AGG | - | contig520end:10670-10689 | MsG0080048896.01.T01:intron | 40.0% | |
ATAAGCTTCGCCTTTGATGA+TGG | + | contig520end:13550-13569 | MsG0080048896.01.T01:intergenic | 40.0% | |
ATCATGGGCTTCCCAAATAA+TGG | + | contig520end:15797-15816 | MsG0080048896.01.T01:intergenic | 40.0% | |
ATCCACACTTTGAGCTTGAA+TGG | - | contig520end:18891-18910 | MsG0080048896.01.T01:intron | 40.0% | |
ATCCAGATATGGTGAAAGGT+CGG | + | contig520end:16820-16839 | MsG0080048896.01.T01:intergenic | 40.0% | |
ATCCAGATGAGTTCGTTGAT+TGG | - | contig520end:12884-12903 | MsG0080048896.01.T01:intron | 40.0% | |
ATCGTCTGATTGCATGTGTT+GGG | + | contig520end:12758-12777 | MsG0080048896.01.T01:intergenic | 40.0% | |
ATCTTCTATTGAGACAGCCA+TGG | - | contig520end:19939-19958 | MsG0080048896.01.T01:intron | 40.0% | |
ATGATGTAAGGGATGATGCA+AGG | + | contig520end:11580-11599 | MsG0080048896.01.T01:intergenic | 40.0% | |
ATGCCGGACACTTTCAATAT+TGG | + | contig520end:18988-19007 | MsG0080048896.01.T01:intergenic | 40.0% | |
ATTAGAGAGAGAGAGAGAGT+TGG | - | contig520end:10547-10566 | MsG0080048896.01.T01:CDS | 40.0% | |
ATTAGTCCTATGTGAATCGC+AGG | + | contig520end:21122-21141 | MsG0080048896.01.T01:intergenic | 40.0% | |
ATTATTTGGGAAGCCCATGA+TGG | - | contig520end:15796-15815 | MsG0080048896.01.T01:intron | 40.0% | |
ATTCAGAGACAACGACATCA+AGG | - | contig520end:12831-12850 | MsG0080048896.01.T01:intron | 40.0% | |
ATTCTTTAACTGCTCCTCCA+TGG | - | contig520end:18698-18717 | MsG0080048896.01.T01:intron | 40.0% | |
ATTGAAAGTGGCAAAGAGAG+TGG | - | contig520end:10174-10193 | MsG0080048896.01.T01:exon | 40.0% | |
ATTTCCCTTAGGTCATACTC+AGG | + | contig520end:11178-11197 | MsG0080048896.01.T01:intergenic | 40.0% | |
ATTTCCTTAGAGGGAGAAAC+AGG | + | contig520end:17796-17815 | MsG0080048896.01.T01:intergenic | 40.0% | |
CAAAGACTCGTTCAACAGTT+TGG | + | contig520end:12912-12931 | MsG0080048896.01.T01:intergenic | 40.0% | |
CAAATGTACAATCTTGCAGG+AGG | - | contig520end:10975-10994 | MsG0080048896.01.T01:intron | 40.0% | |
CAACAAAGGTAGTGAAGTGA+AGG | - | contig520end:13884-13903 | MsG0080048896.01.T01:CDS | 40.0% | |
CAACGTAAGATTGCTTACCA+TGG | + | contig520end:18718-18737 | MsG0080048896.01.T01:intergenic | 40.0% | |
CAAGAAACTAGGTCTTGAAG+GGG | + | contig520end:21472-21491 | MsG0080048896.01.T01:intergenic | 40.0% | |
CAAGTACTTCGACCATTCAT+TGG | - | contig520end:14785-14804 | MsG0080048896.01.T01:intron | 40.0% | |
CAGCATCACAACCAAAATTG+TGG | + | contig520end:20138-20157 | MsG0080048896.01.T01:intergenic | 40.0% | |
CAGTATTGTTGGAGTTGAAC+TGG | + | contig520end:13279-13298 | MsG0080048896.01.T01:intergenic | 40.0% | |
CAGTGGTAGTTGTGAAAATG+TGG | - | contig520end:13788-13807 | MsG0080048896.01.T01:CDS | 40.0% | |
CAGTTCAACTCCAACAATAC+TGG | - | contig520end:13277-13296 | MsG0080048896.01.T01:intron | 40.0% | |
CATCTCGAAACTCTACTTTG+CGG | - | contig520end:11914-11933 | MsG0080048896.01.T01:intron | 40.0% | |
CATGATGTGAGAAGTTTCCA+TGG | - | contig520end:15052-15071 | MsG0080048896.01.T01:intron | 40.0% | |
CATGGTAAGCAATCTTACGT+TGG | - | contig520end:18716-18735 | MsG0080048896.01.T01:intron | 40.0% | |
CATTTGCATAGTGGCAAGTA+GGG | + | contig520end:15608-15627 | MsG0080048896.01.T01:intergenic | 40.0% | |
CCCACTTACAGATTGCATAA+AGG | - | contig520end:15126-15145 | MsG0080048896.01.T01:intron | 40.0% | |
CCCATGTATCCAATGCTTTA+CGG | - | contig520end:17413-17432 | MsG0080048896.01.T01:intron | 40.0% | |
CCCTTTATGCAATCTGTAAG+TGG | + | contig520end:15130-15149 | MsG0080048896.01.T01:intergenic | 40.0% | |
CGGAGATGATGATATTGCTT+TGG | - | contig520end:10482-10501 | MsG0080048896.01.T01:CDS | 40.0% | |
CGTCAGTATTTAATCCACCA+AGG | + | contig520end:13248-13267 | MsG0080048896.01.T01:intergenic | 40.0% | |
CGTCTAATGTCCAGTATTGT+TGG | + | contig520end:13290-13309 | MsG0080048896.01.T01:intergenic | 40.0% | |
CTCATTTGAGAGTTAGAGAG+TGG | - | contig520end:11765-11784 | MsG0080048896.01.T01:CDS | 40.0% | |
CTCTACGAGAAGCCATTATT+TGG | - | contig520end:15782-15801 | MsG0080048896.01.T01:intron | 40.0% | |
CTTGATCTACAGCAAACACA+AGG | - | contig520end:14838-14857 | MsG0080048896.01.T01:intron | 40.0% | |
CTTGTTTCCTCCATTGAAAG+TGG | - | contig520end:10162-10181 | MsG0080048896.01.T01:exon | 40.0% | |
GAAACAGGTACCAATTGATG+TGG | + | contig520end:17781-17800 | MsG0080048896.01.T01:intergenic | 40.0% | |
GAAGTGCGACATTCATGAAA+GGG | - | contig520end:13200-13219 | MsG0080048896.01.T01:CDS | 40.0% | |
GAAGTGGATACCATCAAATC+AGG | - | contig520end:14645-14664 | MsG0080048896.01.T01:intron | 40.0% | |
GAATGATCTTGACCAAGCAA+TGG | - | contig520end:20593-20612 | MsG0080048896.01.T01:intron | 40.0% | |
GACAAACTGAAGCTGTTAAC+AGG | - | contig520end:16301-16320 | MsG0080048896.01.T01:intron | 40.0% | |
GATACCATCAAATCAGGCTT+AGG | - | contig520end:14651-14670 | MsG0080048896.01.T01:intron | 40.0% | |
GATAGATGAATAGACAGACC+TGG | + | contig520end:10347-10366 | MsG0080048896.01.T01:intergenic | 40.0% | |
GATCAACCATTGAACATGCT+TGG | - | contig520end:19768-19787 | MsG0080048896.01.T01:intron | 40.0% | |
GATCAAGAAACTGCATGAAC+AGG | - | contig520end:16545-16564 | MsG0080048896.01.T01:intron | 40.0% | |
GCCTATTTCAGAAAGCTACT+TGG | + | contig520end:17167-17186 | MsG0080048896.01.T01:intergenic | 40.0% | |
GGACTAACGATTTAGCATGA+TGG | + | contig520end:20008-20027 | MsG0080048896.01.T01:intergenic | 40.0% | |
GGATGTGCTGTAAAATGCAT+AGG | - | contig520end:17326-17345 | MsG0080048896.01.T01:intron | 40.0% | |
GGGATAAGAAGAATTCTCAG+TGG | + | contig520end:13382-13401 | MsG0080048896.01.T01:intergenic | 40.0% | |
GGGTATGTATCTGAAAATGC+CGG | + | contig520end:19004-19023 | MsG0080048896.01.T01:intergenic | 40.0% | |
GGTTACATAATCACTGCTGA+AGG | - | contig520end:14968-14987 | MsG0080048896.01.T01:intron | 40.0% | |
GTAATGACTCCAATGTTGCA+AGG | + | contig520end:15404-15423 | MsG0080048896.01.T01:intergenic | 40.0% | |
GTCTCCTGATCTAGATTCAT+CGG | + | contig520end:21078-21097 | MsG0080048896.01.T01:intergenic | 40.0% | |
GTTCAACTATGTTCGCAATG+TGG | - | contig520end:18244-18263 | MsG0080048896.01.T01:intron | 40.0% | |
GTTGGGAATTCAAATGCTTG+AGG | + | contig520end:15468-15487 | MsG0080048896.01.T01:intergenic | 40.0% | |
TACTAAGAAAGGTGAGTCTC+AGG | - | contig520end:10270-10289 | MsG0080048896.01.T01:CDS | 40.0% | |
TAGCAAAAGTGAGCTTACCT+GGG | + | contig520end:19971-19990 | MsG0080048896.01.T01:intergenic | 40.0% | |
TCAAAGATCGATCTTCGAAG+TGG | - | contig520end:14629-14648 | MsG0080048896.01.T01:intron | 40.0% | |
TCATTTGCATAGTGGCAAGT+AGG | + | contig520end:15609-15628 | MsG0080048896.01.T01:intergenic | 40.0% | |
TCTTGTTCGTCATCCAGATA+TGG | + | contig520end:16831-16850 | MsG0080048896.01.T01:intergenic | 40.0% | |
TGAAGTGCGACATTCATGAA+AGG | - | contig520end:13199-13218 | MsG0080048896.01.T01:CDS | 40.0% | |
TGCCGGACACTTTCAATATT+GGG | + | contig520end:18987-19006 | MsG0080048896.01.T01:intergenic | 40.0% | |
TGCGATTCACATAGGACTAA+TGG | - | contig520end:21121-21140 | MsG0080048896.01.T01:intron | 40.0% | |
TGCTCACAATGCTGTTAATC+AGG | - | contig520end:17746-17765 | MsG0080048896.01.T01:intron | 40.0% | |
TGTGCTGTAAAATGCATAGG+TGG | - | contig520end:17329-17348 | MsG0080048896.01.T01:intron | 40.0% | |
TGTGGACTCATTCTATAAGC+TGG | + | contig520end:14383-14402 | MsG0080048896.01.T01:intergenic | 40.0% | |
TTAGAAGAATGGGGTTGAAG+GGG | + | contig520end:18823-18842 | MsG0080048896.01.T01:intergenic | 40.0% | |
TTAGAGAGAGAGAGAGAGTT+GGG | - | contig520end:10548-10567 | MsG0080048896.01.T01:CDS | 40.0% | |
TTAGCACAAGGTAATGTAGG+AGG | - | contig520end:18858-18877 | MsG0080048896.01.T01:intron | 40.0% | |
TTATATTGTGGCCGTGATTG+TGG | - | contig520end:20179-20198 | MsG0080048896.01.T01:intron | 40.0% | |
TTCAGTTTGTCCATCTGTCT+GGG | + | contig520end:16292-16311 | MsG0080048896.01.T01:intergenic | 40.0% | |
TTGAAACACTGGGTAGCTTT+GGG | + | contig520end:13474-13493 | MsG0080048896.01.T01:intergenic | 40.0% | |
TTGATTCATGAGACGCATGA+AGG | + | contig520end:14768-14787 | MsG0080048896.01.T01:intergenic | 40.0% | |
TTGGTGTGATGTTGTTCCAA+TGG | - | contig520end:13962-13981 | MsG0080048896.01.T01:intron | 40.0% | |
TTTGACAAAGGAGTAGGTGT+TGG | + | contig520end:14054-14073 | MsG0080048896.01.T01:intergenic | 40.0% | |
! | AAATGTGGTGTCGAACTACA+TGG | - | contig520end:13803-13822 | MsG0080048896.01.T01:CDS | 40.0% |
! | ACTTTGATGCTTGTTTCTCC+AGG | - | contig520end:10326-10345 | MsG0080048896.01.T01:CDS | 40.0% |
! | AGTTTTCCTTCATTTCAGCC+TGG | - | contig520end:20966-20985 | MsG0080048896.01.T01:intron | 40.0% |
! | ATCACAAACTTTTCCAGCAG+TGG | + | contig520end:13757-13776 | MsG0080048896.01.T01:intergenic | 40.0% |
! | CAGACAAGTTTTTCTGACGA+AGG | + | contig520end:13143-13162 | MsG0080048896.01.T01:intergenic | 40.0% |
! | CATTGGATTTGAGACAGTCA+AGG | - | contig520end:15633-15652 | MsG0080048896.01.T01:intron | 40.0% |
! | GGAGCATTAGATAACCCAAA+GGG | + | contig520end:14740-14759 | MsG0080048896.01.T01:intergenic | 40.0% |
! | GGTAAATGTGGCCACAATTT+TGG | - | contig520end:20124-20143 | MsG0080048896.01.T01:intron | 40.0% |
! | GTCTGCGATTGATCTTTTGT+TGG | + | contig520end:15486-15505 | MsG0080048896.01.T01:intergenic | 40.0% |
! | GTTTTCTTTGATCGTGCCAA+AGG | + | contig520end:11115-11134 | MsG0080048896.01.T01:intergenic | 40.0% |
! | TAGACGTCTCTTTCAAGTCT+TGG | + | contig520end:15886-15905 | MsG0080048896.01.T01:intergenic | 40.0% |
! | TGAAGAAGCATGCTTCCATT+TGG | - | contig520end:12983-13002 | MsG0080048896.01.T01:intron | 40.0% |
! | TGGAGCATTAGATAACCCAA+AGG | + | contig520end:14741-14760 | MsG0080048896.01.T01:intergenic | 40.0% |
! | TGTTTGGAACCATGACCAAT+TGG | - | contig520end:19273-19292 | MsG0080048896.01.T01:intron | 40.0% |
! | TTAGAGAGTGGATTCTCTCT+TGG | - | contig520end:11777-11796 | MsG0080048896.01.T01:CDS | 40.0% |
! | TTTGAAACACTGGGTAGCTT+TGG | + | contig520end:13475-13494 | MsG0080048896.01.T01:intergenic | 40.0% |
! | TTTGGGGCAAACTGCAATTA+CGG | + | contig520end:12303-12322 | MsG0080048896.01.T01:intergenic | 40.0% |
! | TTTTTATCAAGTCCACTCGG+TGG | + | contig520end:14107-14126 | MsG0080048896.01.T01:intergenic | 40.0% |
!! | ACCGTAAAGCATTGGATACA+TGG | + | contig520end:17417-17436 | MsG0080048896.01.T01:intergenic | 40.0% |
!! | ACTCTCTTTGCCACTTTCAA+TGG | + | contig520end:10175-10194 | MsG0080048896.01.T01:intergenic | 40.0% |
!! | AGAGCACTGAGGAATACATA+AGG | + | contig520end:15764-15783 | MsG0080048896.01.T01:intergenic | 40.0% |
!! | AGTTGGTCTTGTAATAGGGA+TGG | + | contig520end:21291-21310 | MsG0080048896.01.T01:intergenic | 40.0% |
!! | CCGTAAAGCATTGGATACAT+GGG | + | contig520end:17416-17435 | MsG0080048896.01.T01:intergenic | 40.0% |
!! | CCTCAGTTGGTCTTGTAATA+GGG | + | contig520end:21295-21314 | MsG0080048896.01.T01:intergenic | 40.0% |
!! | GAACATGCTTGGTGTTATAC+AGG | - | contig520end:19779-19798 | MsG0080048896.01.T01:intron | 40.0% |
!! | GACTTAGGAAGTATTTGGAC+TGG | + | contig520end:17276-17295 | MsG0080048896.01.T01:intergenic | 40.0% |
!! | GATGATGGAGTCAAGTCTAA+CGG | + | contig520end:16480-16499 | MsG0080048896.01.T01:intergenic | 40.0% |
!! | GCCAAGTAGCTTTCTGAAAT+AGG | - | contig520end:17163-17182 | MsG0080048896.01.T01:intron | 40.0% |
!! | GGATTTTGGGAAACCTACTT+CGG | - | contig520end:16322-16341 | MsG0080048896.01.T01:intron | 40.0% |
!! | TAGGGTTTGTTGAAGGAAGA+GGG | - | contig520end:17570-17589 | MsG0080048896.01.T01:intron | 40.0% |
!! | TCCTCAGTTGGTCTTGTAAT+AGG | + | contig520end:21296-21315 | MsG0080048896.01.T01:intergenic | 40.0% |
!! | TGTGGTTTAGGGTTTGTTGA+AGG | - | contig520end:17563-17582 | MsG0080048896.01.T01:intron | 40.0% |
!! | TTAGGGTTTGTTGAAGGAAG+AGG | - | contig520end:17569-17588 | MsG0080048896.01.T01:intron | 40.0% |
!! | TTTTGGTTGTGATGCTGTTG+CGG | - | contig520end:20141-20160 | MsG0080048896.01.T01:intron | 40.0% |
!!! | AAAACCAGTGTTTTGGCCTT+TGG | + | contig520end:15950-15969 | MsG0080048896.01.T01:intergenic | 40.0% |
!!! | GAACGGCATCATTAGTCTTT+TGG | + | contig520end:16116-16135 | MsG0080048896.01.T01:intergenic | 40.0% |
!!! | GATCTTGCTTTTTCCTTCAC+GGG | + | contig520end:13034-13053 | MsG0080048896.01.T01:intergenic | 40.0% |
!!! | GCATCATTAGTCTTTTGGCA+TGG | + | contig520end:16111-16130 | MsG0080048896.01.T01:intergenic | 40.0% |
!!! | TGTCCTTTTGAGGTAGCATA+CGG | - | contig520end:16438-16457 | MsG0080048896.01.T01:intron | 40.0% |
!!! | TTGGTGTCAGTTCATTTTCG+TGG | - | contig520end:17450-17469 | MsG0080048896.01.T01:intron | 40.0% |
!!! | TTGGTTCGGCTTTTCATCAA+TGG | - | contig520end:17604-17623 | MsG0080048896.01.T01:intron | 40.0% |
AACCATCCAGGCTGAAATGA+AGG | + | contig520end:20975-20994 | MsG0080048896.01.T01:intergenic | 45.0% | |
AACGTCACAAGTCTGAGTTC+TGG | + | contig520end:18760-18779 | MsG0080048896.01.T01:intergenic | 45.0% | |
AAGTGAGCTTACCTGGGATA+TGG | + | contig520end:19965-19984 | MsG0080048896.01.T01:intergenic | 45.0% | |
AAGTTGTCACCAAGAGCTGA+TGG | - | contig520end:16705-16724 | MsG0080048896.01.T01:intron | 45.0% | |
AATCCTTGTGGAACAGCTTC+TGG | + | contig520end:14296-14315 | MsG0080048896.01.T01:intergenic | 45.0% | |
AATGCTGAAGGGAGGATTCA+AGG | - | contig520end:10226-10245 | MsG0080048896.01.T01:CDS | 45.0% | |
AATGGACAGTGATGCCCTTT+GGG | - | contig520end:14723-14742 | MsG0080048896.01.T01:intron | 45.0% | |
ACAGCTTCTGGTACAACATC+TGG | + | contig520end:14284-14303 | MsG0080048896.01.T01:intergenic | 45.0% | |
ACCATTCCTCGGTCAAGTTA+AGG | + | contig520end:21154-21173 | MsG0080048896.01.T01:intergenic | 45.0% | |
ACCTGCTAATCCTCCATCAT+GGG | + | contig520end:15812-15831 | MsG0080048896.01.T01:intergenic | 45.0% | |
ACCTTGCTCTGATGCCAAAA+TGG | + | contig520end:11811-11830 | MsG0080048896.01.T01:intergenic | 45.0% | |
ACCTTGGGAAGATGTTAGCA+TGG | - | contig520end:15996-16015 | MsG0080048896.01.T01:intron | 45.0% | |
AGATCACTAGAGACAGAGGT+AGG | - | contig520end:10674-10693 | MsG0080048896.01.T01:intron | 45.0% | |
AGCCAATCAACGAACTCATC+TGG | + | contig520end:12889-12908 | MsG0080048896.01.T01:intergenic | 45.0% | |
AGCCATTCAAGCTCAAAGTG+TGG | + | contig520end:18896-18915 | MsG0080048896.01.T01:intergenic | 45.0% | |
AGTACCCATCTTCCTCCATA+AGG | + | contig520end:16241-16260 | MsG0080048896.01.T01:intergenic | 45.0% | |
AGTTGTGACGCTTCCAATTC+AGG | - | contig520end:15262-15281 | MsG0080048896.01.T01:intron | 45.0% | |
ATACTGCACACTTGGGAAGA+TGG | - | contig520end:21264-21283 | MsG0080048896.01.T01:exon | 45.0% | |
ATAGTCCCTAAGAGAGAACG+GGG | + | contig520end:17508-17527 | MsG0080048896.01.T01:intergenic | 45.0% | |
ATGGTGGCTTCAATGAGGTA+AGG | + | contig520end:11621-11640 | MsG0080048896.01.T01:intergenic | 45.0% | |
ATGTACTCAGAGCAGTGTTC+AGG | - | contig520end:10103-10122 | MsG0080048896.01.T01:exon | 45.0% | |
ATGTCTGTAGTAGTCCTGAG+AGG | + | contig520end:15716-15735 | MsG0080048896.01.T01:intergenic | 45.0% | |
ATGTTCCTTCCTAACCAACG+AGG | - | contig520end:14934-14953 | MsG0080048896.01.T01:intron | 45.0% | |
ATTATCCTGTGAGAGAGCTG+TGG | - | contig520end:17661-17680 | MsG0080048896.01.T01:intron | 45.0% | |
CAAACAATCGCTCGTTACCT+TGG | - | contig520end:13228-13247 | MsG0080048896.01.T01:intron | 45.0% | |
CAAACATGGTGGCTTCAATG+AGG | + | contig520end:11626-11645 | MsG0080048896.01.T01:intergenic | 45.0% | |
CAAAGAGAGTGGTGCTTGTT+AGG | - | contig520end:10185-10204 | MsG0080048896.01.T01:exon | 45.0% | |
CAAATCGTGACAAGCACAGA+AGG | - | contig520end:16607-16626 | MsG0080048896.01.T01:intron | 45.0% | |
CACAACTTACTTCGAACACC+TGG | + | contig520end:15249-15268 | MsG0080048896.01.T01:intergenic | 45.0% | |
CACTTCCATTCCAAACAACC+AGG | - | contig520end:17868-17887 | MsG0080048896.01.T01:intron | 45.0% | |
CAGAGTACATGGAATGCTGA+AGG | - | contig520end:10214-10233 | MsG0080048896.01.T01:exon | 45.0% | |
CAGCAGTGATTATGTAACCC+AGG | + | contig520end:14967-14986 | MsG0080048896.01.T01:intergenic | 45.0% | |
CAGCATCACAATCGCAATTG+CGG | + | contig520end:18052-18071 | MsG0080048896.01.T01:intergenic | 45.0% | |
CAGCTTCTGGTACAACATCT+GGG | + | contig520end:14283-14302 | MsG0080048896.01.T01:intergenic | 45.0% | |
CAGGACTACTACAGACATGA+GGG | - | contig520end:15718-15737 | MsG0080048896.01.T01:intron | 45.0% | |
CATCGTCTGATTGCATGTGT+TGG | + | contig520end:12759-12778 | MsG0080048896.01.T01:intergenic | 45.0% | |
CCAAACCTGGTTGTTTGGAA+TGG | + | contig520end:17876-17895 | MsG0080048896.01.T01:intergenic | 45.0% | |
CCATTCCAAACAACCAGGTT+TGG | - | contig520end:17873-17892 | MsG0080048896.01.T01:intron | 45.0% | |
CCCTATTACAAGACCAACTG+AGG | - | contig520end:21292-21311 | MsG0080048896.01.T01:exon | 45.0% | |
CGCAAAGTAGAGTTTCGAGA+TGG | + | contig520end:11916-11935 | MsG0080048896.01.T01:intergenic | 45.0% | |
CGCAATGTGGACATCTGTTT+AGG | - | contig520end:18257-18276 | MsG0080048896.01.T01:intron | 45.0% | |
CGTAAGATTGCTTACCATGG+AGG | + | contig520end:18715-18734 | MsG0080048896.01.T01:intergenic | 45.0% | |
CGTCATCCAGATATGGTGAA+AGG | + | contig520end:16824-16843 | MsG0080048896.01.T01:intergenic | 45.0% | |
CTACCATCACAGAATCCTTC+TGG | + | contig520end:16053-16072 | MsG0080048896.01.T01:intergenic | 45.0% | |
CTATGTTGAGACGAAGCAGA+AGG | - | contig520end:20407-20426 | MsG0080048896.01.T01:CDS | 45.0% | |
CTATTAGGAATGACAGCTCC+AGG | + | contig520end:14359-14378 | MsG0080048896.01.T01:intergenic | 45.0% | |
CTCAAACTCAACTCCGGATT+TGG | + | contig520end:11835-11854 | MsG0080048896.01.T01:intergenic | 45.0% | |
CTGAGAGGATTGTGAATCAG+TGG | + | contig520end:15701-15720 | MsG0080048896.01.T01:intergenic | 45.0% | |
CTTCAGTTTGTCCATCTGTC+TGG | + | contig520end:16293-16312 | MsG0080048896.01.T01:intergenic | 45.0% | |
CTTGCACTCAAACTCAACTC+CGG | + | contig520end:11841-11860 | MsG0080048896.01.T01:intergenic | 45.0% | |
GAACTATTAATGCAGACGCC+TGG | - | contig520end:18299-18318 | MsG0080048896.01.T01:intron | 45.0% | |
GAAGAGGGAAAAGCGAGATT+TGG | - | contig520end:17585-17604 | MsG0080048896.01.T01:intron | 45.0% | |
GAAGCATGCTTCCATTTGGT+GGG | - | contig520end:12987-13006 | MsG0080048896.01.T01:intron | 45.0% | |
GACGCTTCCAATTCAGGAAT+TGG | - | contig520end:15268-15287 | MsG0080048896.01.T01:intron | 45.0% | |
GAGAACCTTATGGAGGAAGA+TGG | - | contig520end:16233-16252 | MsG0080048896.01.T01:intron | 45.0% | |
GAGCTCATTGTTGCTGATCA+TGG | - | contig520end:13642-13661 | MsG0080048896.01.T01:CDS | 45.0% | |
GAGTGACAAATCATGCCTCA+AGG | + | contig520end:20509-20528 | MsG0080048896.01.T01:intergenic | 45.0% | |
GATCTACAGCAAACACAAGG+AGG | - | contig520end:14841-14860 | MsG0080048896.01.T01:intron | 45.0% | |
GATGCATGTCATCTTCTCCT+TGG | - | contig520end:13984-14003 | MsG0080048896.01.T01:intron | 45.0% | |
GCATGTTGAATGTCTCGCAT+TGG | + | contig520end:14323-14342 | MsG0080048896.01.T01:intergenic | 45.0% | |
GCTCTTGTTGCCACATCAAT+TGG | - | contig520end:17768-17787 | MsG0080048896.01.T01:intron | 45.0% | |
GCTTACAAGGTAGAATTGCC+AGG | - | contig520end:16762-16781 | MsG0080048896.01.T01:intron | 45.0% | |
GGATGAGGATGACTTTGTGT+TGG | + | contig520end:13846-13865 | MsG0080048896.01.T01:intergenic | 45.0% | |
GGATTCTGTGATGGTAGTTG+TGG | - | contig520end:16056-16075 | MsG0080048896.01.T01:intron | 45.0% | |
GTAGAATTGCCAGGTACCTA+TGG | - | contig520end:16771-16790 | MsG0080048896.01.T01:intron | 45.0% | |
GTAGCAAAAGTGAGCTTACC+TGG | + | contig520end:19972-19991 | MsG0080048896.01.T01:intergenic | 45.0% | |
GTGATTTCAGCATGCTCTTG+TGG | + | contig520end:14401-14420 | MsG0080048896.01.T01:intergenic | 45.0% | |
GTTAGCATGGACTTTGTGCT+TGG | - | contig520end:16009-16028 | MsG0080048896.01.T01:intron | 45.0% | |
GTTCCGTATGCTACCTCAAA+AGG | + | contig520end:16444-16463 | MsG0080048896.01.T01:intergenic | 45.0% | |
GTTTGGTCGTTTCTTCTTGG+AGG | + | contig520end:12649-12668 | MsG0080048896.01.T01:intergenic | 45.0% | |
TAAACTGCGGTCCACAATCA+CGG | + | contig520end:20193-20212 | MsG0080048896.01.T01:intergenic | 45.0% | |
TAACTTGACCGAGGAATGGT+TGG | - | contig520end:21154-21173 | MsG0080048896.01.T01:intron | 45.0% | |
TAGAGAGAGAGAGAGAGTTG+GGG | - | contig520end:10549-10568 | MsG0080048896.01.T01:CDS | 45.0% | |
TATAGCAATCCTAGAGGCCA+TGG | + | contig520end:11687-11706 | MsG0080048896.01.T01:intergenic | 45.0% | |
TCACTCCAGCTTCGTAAACT+CGG | - | contig520end:11239-11258 | MsG0080048896.01.T01:intron | 45.0% | |
TCAGAGCAAGGTTCCAAATC+CGG | - | contig520end:11819-11838 | MsG0080048896.01.T01:intron | 45.0% | |
TCAGGACTACTACAGACATG+AGG | - | contig520end:15717-15736 | MsG0080048896.01.T01:intron | 45.0% | |
TCAGTTTGTCCATCTGTCTG+GGG | + | contig520end:16291-16310 | MsG0080048896.01.T01:intergenic | 45.0% | |
TCCATGCTAACATCTTCCCA+AGG | + | contig520end:16000-16019 | MsG0080048896.01.T01:intergenic | 45.0% | |
TCGAACACCTGGTCAAAGTT+GGG | + | contig520end:15238-15257 | MsG0080048896.01.T01:intergenic | 45.0% | |
TGAAAGGTCGGCAACATTGA+AGG | + | contig520end:16808-16827 | MsG0080048896.01.T01:intergenic | 45.0% | |
TGACAAAAACCTCCAGTCCA+AGG | + | contig520end:11990-12009 | MsG0080048896.01.T01:intergenic | 45.0% | |
TGATAGCAGGTCTGTTCTTG+TGG | - | contig520end:17722-17741 | MsG0080048896.01.T01:intron | 45.0% | |
TGATTACGCCTCTTCCCTTA+GGG | + | contig520end:21232-21251 | MsG0080048896.01.T01:intergenic | 45.0% | |
TGGTGGCTTCAATGAGGTAA+GGG | + | contig520end:11620-11639 | MsG0080048896.01.T01:intergenic | 45.0% | |
TGTAAGGGATGATGCAAGGT+AGG | + | contig520end:11576-11595 | MsG0080048896.01.T01:intergenic | 45.0% | |
TGTCATCCTGCGATTCACAT+AGG | - | contig520end:21113-21132 | MsG0080048896.01.T01:intron | 45.0% | |
TGTTGAATGTCTCGCATTGG+CGG | + | contig520end:14320-14339 | MsG0080048896.01.T01:intergenic | 45.0% | |
TTAACTCCATTACCACCGAG+TGG | - | contig520end:14092-14111 | MsG0080048896.01.T01:intron | 45.0% | |
TTAGGCATGGACAGAGTACA+TGG | - | contig520end:10203-10222 | MsG0080048896.01.T01:exon | 45.0% | |
TTATCCTGTGAGAGAGCTGT+GGG | - | contig520end:17662-17681 | MsG0080048896.01.T01:intron | 45.0% | |
TTCATCCAAAAGGGATTGCC+AGG | + | contig520end:21051-21070 | MsG0080048896.01.T01:intergenic | 45.0% | |
TTCCAAACAACCAGGTTTGG+AGG | - | contig520end:17876-17895 | MsG0080048896.01.T01:intron | 45.0% | |
TTCCAATTCAGGAATTGGCG+CGG | - | contig520end:15273-15292 | MsG0080048896.01.T01:intron | 45.0% | |
TTCCTTCATTTCAGCCTGGA+TGG | - | contig520end:20970-20989 | MsG0080048896.01.T01:intron | 45.0% | |
TTCGAACACCTGGTCAAAGT+TGG | + | contig520end:15239-15258 | MsG0080048896.01.T01:intergenic | 45.0% | |
TTGAAAGGACCATCAGCTCT+TGG | + | contig520end:16717-16736 | MsG0080048896.01.T01:intergenic | 45.0% | |
TTGTGAGGATCGCAACAAGA+AGG | + | contig520end:19393-19412 | MsG0080048896.01.T01:intergenic | 45.0% | |
TTGTTGCAGATGCTCTTAGC+AGG | - | contig520end:15575-15594 | MsG0080048896.01.T01:intron | 45.0% | |
TTTCAACTACCATGGCCTCT+AGG | - | contig520end:11675-11694 | MsG0080048896.01.T01:intron | 45.0% | |
! | AAAAGCCTGGCAATCCCTTT+TGG | - | contig520end:21043-21062 | MsG0080048896.01.T01:intron | 45.0% |
! | AACCAACGAGGTTACTTTCC+TGG | - | contig520end:14946-14965 | MsG0080048896.01.T01:intron | 45.0% |
! | AACCTACTTCGGAGCTTTGT+CGG | - | contig520end:16333-16352 | MsG0080048896.01.T01:intron | 45.0% |
! | AAGCTTTATCCCGCTAACTG+GGG | + | contig520end:10798-10817 | MsG0080048896.01.T01:intergenic | 45.0% |
! | ACCAACGAGGTTACTTTCCT+GGG | - | contig520end:14947-14966 | MsG0080048896.01.T01:intron | 45.0% |
! | ACCTCCAGTCCAAGGTTTTT+CGG | + | contig520end:11982-12001 | MsG0080048896.01.T01:intergenic | 45.0% |
! | AGAAGCATGCTTCCATTTGG+TGG | - | contig520end:12986-13005 | MsG0080048896.01.T01:intron | 45.0% |
! | AGTAACCTCGTTGGTTAGGA+AGG | + | contig520end:14942-14961 | MsG0080048896.01.T01:intergenic | 45.0% |
! | ATCAGCTCTTGGTGACAACT+TGG | + | contig520end:16706-16725 | MsG0080048896.01.T01:intergenic | 45.0% |
! | CACCCAACAATCTGAGCTTT+TGG | - | contig520end:19631-19650 | MsG0080048896.01.T01:intron | 45.0% |
! | CGGATCGTACTTGTTTGCTA+CGG | - | contig520end:18368-18387 | MsG0080048896.01.T01:intron | 45.0% |
! | CTCCAGCTTCCATCCTTTTT+GGG | + | contig520end:14503-14522 | MsG0080048896.01.T01:intergenic | 45.0% |
! | CTGGAGGTTTTTGTCACCAA+CGG | - | contig520end:11994-12013 | MsG0080048896.01.T01:intron | 45.0% |
! | CTTGGTGACAACTTGGCATT+TGG | + | contig520end:16699-16718 | MsG0080048896.01.T01:intergenic | 45.0% |
! | GAAGCTTTATCCCGCTAACT+GGG | + | contig520end:10799-10818 | MsG0080048896.01.T01:intergenic | 45.0% |
! | GGAAAGTAACCTCGTTGGTT+AGG | + | contig520end:14946-14965 | MsG0080048896.01.T01:intergenic | 45.0% |
! | GGGAAAAGCGAGATTTGGTT+CGG | - | contig520end:17590-17609 | MsG0080048896.01.T01:intron | 45.0% |
! | GTTGGGTGAAAGCACATGAA+AGG | + | contig520end:19619-19638 | MsG0080048896.01.T01:intergenic | 45.0% |
! | GTTTGCTACGGATCTACTCA+AGG | - | contig520end:18380-18399 | MsG0080048896.01.T01:intron | 45.0% |
! | TAGTAGTTTGTCGGCATGAC+AGG | + | contig520end:20029-20048 | MsG0080048896.01.T01:intergenic | 45.0% |
! | TCCAGCTTCCATCCTTTTTG+GGG | + | contig520end:14502-14521 | MsG0080048896.01.T01:intergenic | 45.0% |
! | TCGAGTATGCCATTTGGCAA+AGG | - | contig520end:15924-15943 | MsG0080048896.01.T01:intron | 45.0% |
! | TCTCCAGCTTCCATCCTTTT+TGG | + | contig520end:14504-14523 | MsG0080048896.01.T01:intergenic | 45.0% |
! | TCTTGGCTTCTGAGCCATTT+TGG | - | contig520end:11794-11813 | MsG0080048896.01.T01:intron | 45.0% |
! | TGAAGCTTTATCCCGCTAAC+TGG | + | contig520end:10800-10819 | MsG0080048896.01.T01:intergenic | 45.0% |
! | TGTCAGCTCAAGAAGAGCAT+TGG | - | contig520end:13700-13719 | MsG0080048896.01.T01:intron | 45.0% |
! | TTCGGCTTTTCATCAATGGC+AGG | - | contig520end:17608-17627 | MsG0080048896.01.T01:intron | 45.0% |
!! | ACTGTGGTGGGTTTAAGAGA+AGG | + | contig520end:13444-13463 | MsG0080048896.01.T01:intergenic | 45.0% |
!! | ATGAGACGCATGAAGGTACT+TGG | + | contig520end:14761-14780 | MsG0080048896.01.T01:intergenic | 45.0% |
!! | ATGGTGATGGTTCTTCGTGT+TGG | + | contig520end:13531-13550 | MsG0080048896.01.T01:intergenic | 45.0% |
!! | CACTGATTCACAATCCTCTC+AGG | - | contig520end:15699-15718 | MsG0080048896.01.T01:intron | 45.0% |
!! | CTCAAGAAGAGCATTGGTTG+AGG | - | contig520end:13706-13725 | MsG0080048896.01.T01:intron | 45.0% |
!! | CTCTTTGCCACTTTCAATGG+AGG | + | contig520end:10172-10191 | MsG0080048896.01.T01:intergenic | 45.0% |
!! | GGAGGATTAGCAGGTCATTT+TGG | - | contig520end:15817-15836 | MsG0080048896.01.T01:intron | 45.0% |
!! | TTCGCCTTTGATGATGGTGA+TGG | + | contig520end:13544-13563 | MsG0080048896.01.T01:intergenic | 45.0% |
!!! | CAGGACGGTGTTCTTTTTTC+TGG | - | contig520end:19744-19763 | MsG0080048896.01.T01:intron | 45.0% |
!!! | TTTTTTTTTTTTTTTTTGAA+GGG | + | contig520end:12616-12635 | MsG0080048896.01.T01:intergenic | 5.0% |
!!! | TTTTTTTTTTTTTTTTTTGA+AGG | + | contig520end:12617-12636 | MsG0080048896.01.T01:intergenic | 5.0% |
AAAACAAAGCGAGCCCGTGA+AGG | - | contig520end:13018-13037 | MsG0080048896.01.T01:intron | 50.0% | |
AACCGCGCCAATTCCTGAAT+TGG | + | contig520end:15278-15297 | MsG0080048896.01.T01:intergenic | 50.0% | |
AAGGCCAAAGGCCAAAACAC+TGG | - | contig520end:15943-15962 | MsG0080048896.01.T01:intron | 50.0% | |
AAGGCCGAAAAACCTTGGAC+TGG | - | contig520end:11975-11994 | MsG0080048896.01.T01:intron | 50.0% | |
AAGGGATGATGCAAGGTAGG+TGG | + | contig520end:11573-11592 | MsG0080048896.01.T01:intergenic | 50.0% | |
AAGTACTCTGCCTCCAAACC+TGG | + | contig520end:17889-17908 | MsG0080048896.01.T01:intergenic | 50.0% | |
AAGTCGTGTCTGGGCTTCTT+AGG | - | contig520end:19580-19599 | MsG0080048896.01.T01:intron | 50.0% | |
ACAAGAGGCTGCAGATTGCT+TGG | - | contig520end:20365-20384 | MsG0080048896.01.T01:CDS | 50.0% | |
ACAATCGCTCGTTACCTTGG+TGG | - | contig520end:13231-13250 | MsG0080048896.01.T01:intron | 50.0% | |
ACACCTGGTCAAAGTTGGGA+AGG | + | contig520end:15234-15253 | MsG0080048896.01.T01:intergenic | 50.0% | |
ACCCAGGAAAGTAACCTCGT+TGG | + | contig520end:14951-14970 | MsG0080048896.01.T01:intergenic | 50.0% | |
ACGCCAGAAGGATTCTGTGA+TGG | - | contig520end:16047-16066 | MsG0080048896.01.T01:intron | 50.0% | |
AGGGAAATCTGGAGGTAGAG+AGG | - | contig520end:18337-18356 | MsG0080048896.01.T01:intron | 50.0% | |
ATCTTCTCCTTGGAAGACCC+TGG | - | contig520end:13994-14013 | MsG0080048896.01.T01:intron | 50.0% | |
ATGTAGCTGACCCCAGTTAG+CGG | - | contig520end:10785-10804 | MsG0080048896.01.T01:intron | 50.0% | |
ATGTTGCAAGGCTCGGACAA+TGG | + | contig520end:15392-15411 | MsG0080048896.01.T01:intergenic | 50.0% | |
ATTTGGGAAGCCCATGATGG+AGG | - | contig520end:15799-15818 | MsG0080048896.01.T01:intron | 50.0% | |
CAACTGTGGTGTAAGTGTGC+TGG | - | contig520end:17927-17946 | MsG0080048896.01.T01:intron | 50.0% | |
CAAGAGGCTGCAGATTGCTT+GGG | - | contig520end:20366-20385 | MsG0080048896.01.T01:CDS | 50.0% | |
CACCTGGTCAAAGTTGGGAA+GGG | + | contig520end:15233-15252 | MsG0080048896.01.T01:intergenic | 50.0% | |
CAGACCTGCTATCATGAGCT+AGG | + | contig520end:17716-17735 | MsG0080048896.01.T01:intergenic | 50.0% | |
CAGTTTGTCCATCTGTCTGG+GGG | + | contig520end:16290-16309 | MsG0080048896.01.T01:intergenic | 50.0% | |
CATATTGCCAGGGTCTTCCA+AGG | + | contig520end:14004-14023 | MsG0080048896.01.T01:intergenic | 50.0% | |
CATCAAATCAGGCTTAGGCC+AGG | - | contig520end:14656-14675 | MsG0080048896.01.T01:intron | 50.0% | |
CGTCTTCAACCTCTGACTTC+CGG | + | contig520end:12080-12099 | MsG0080048896.01.T01:intergenic | 50.0% | |
CTGATTACGCCTCTTCCCTT+AGG | + | contig520end:21233-21252 | MsG0080048896.01.T01:intergenic | 50.0% | |
CTTGAGCTGACATAGCGTGT+AGG | + | contig520end:13692-13711 | MsG0080048896.01.T01:intergenic | 50.0% | |
GAAGGTTGCTGAGACACCAT+AGG | + | contig520end:16790-16809 | MsG0080048896.01.T01:intergenic | 50.0% | |
GAATGGACAGTGATGCCCTT+TGG | - | contig520end:14722-14741 | MsG0080048896.01.T01:intron | 50.0% | |
GACCTGCTAATCCTCCATCA+TGG | + | contig520end:15813-15832 | MsG0080048896.01.T01:intergenic | 50.0% | |
GACTCCAATGTTGCAAGGCT+CGG | + | contig520end:15399-15418 | MsG0080048896.01.T01:intergenic | 50.0% | |
GAGGTAGAGAGGCAAGTAAG+CGG | - | contig520end:18348-18367 | MsG0080048896.01.T01:intron | 50.0% | |
GCACGACGATCATATTGCCA+GGG | + | contig520end:14014-14033 | MsG0080048896.01.T01:intergenic | 50.0% | |
GCAGTCTTCCATTCATCTCC+TGG | + | contig520end:14677-14696 | MsG0080048896.01.T01:intergenic | 50.0% | |
GGGATCAATCAGGAAAAGCC+TGG | - | contig520end:21030-21049 | MsG0080048896.01.T01:intron | 50.0% | |
GGTGACTAGCACTACTGAAC+TGG | + | contig520end:16269-16288 | MsG0080048896.01.T01:intergenic | 50.0% | |
GTACATGGAATGCTGAAGGG+AGG | - | contig520end:10218-10237 | MsG0080048896.01.T01:exon | 50.0% | |
GTACCAGAAGCTGTTCCACA+AGG | - | contig520end:14290-14309 | MsG0080048896.01.T01:intron | 50.0% | |
GTGCGACATTCATGAAAGGG+AGG | - | contig520end:13203-13222 | MsG0080048896.01.T01:CDS | 50.0% | |
TAAGAAGCCCAGACACGACT+TGG | + | contig520end:19581-19600 | MsG0080048896.01.T01:intergenic | 50.0% | |
TACCGACAAAGCTCCGAAGT+AGG | + | contig520end:16338-16357 | MsG0080048896.01.T01:intergenic | 50.0% | |
TCCCCAAAAAGGATGGAAGC+TGG | - | contig520end:14498-14517 | MsG0080048896.01.T01:intron | 50.0% | |
TGAATGGCTCTTGCGTGATG+AGG | - | contig520end:18907-18926 | MsG0080048896.01.T01:intron | 50.0% | |
TGCATGAACAGGTTCGACAG+CGG | - | contig520end:16556-16575 | MsG0080048896.01.T01:intron | 50.0% | |
TGCCGACCTTTCACCATATC+TGG | - | contig520end:16815-16834 | MsG0080048896.01.T01:intron | 50.0% | |
TGCCTCCAAACCTGGTTGTT+TGG | + | contig520end:17881-17900 | MsG0080048896.01.T01:intergenic | 50.0% | |
TGCTGATCATGGTGAGTCTC+TGG | - | contig520end:13653-13672 | MsG0080048896.01.T01:intron | 50.0% | |
TGCTTCGTCTCAACATAGCG+TGG | + | contig520end:20405-20424 | MsG0080048896.01.T01:intergenic | 50.0% | |
TGGAATAGGCCAACTGCTGA+TGG | + | contig520end:15023-15042 | MsG0080048896.01.T01:intergenic | 50.0% | |
TGTTGAGACGAAGCAGAAGG+AGG | - | contig520end:20410-20429 | MsG0080048896.01.T01:CDS | 50.0% | |
TTCGGAAGGCCGAAAAACCT+TGG | - | contig520end:11970-11989 | MsG0080048896.01.T01:intron | 50.0% | |
TTGTCCGAGCCTTGCAACAT+TGG | - | contig520end:15392-15411 | MsG0080048896.01.T01:intron | 50.0% | |
TTTGTGCTTGCTCGGTCCAT+TGG | + | contig520end:15162-15181 | MsG0080048896.01.T01:intergenic | 50.0% | |
! | ACATCTTCCCAAGGTGCTTC+TGG | + | contig520end:15991-16010 | MsG0080048896.01.T01:intergenic | 50.0% |
! | AGAGTGGTGCTTGTTAGGCA+TGG | - | contig520end:10190-10209 | MsG0080048896.01.T01:exon | 50.0% |
! | CTAAGGGAAGAGGCGTAATC+AGG | - | contig520end:21231-21250 | MsG0080048896.01.T01:exon | 50.0% |
! | CTGGCCTAAGCCTGATTTGA+TGG | + | contig520end:14658-14677 | MsG0080048896.01.T01:intergenic | 50.0% |
! | GCCTTAACTTGACCGAGGAA+TGG | - | contig520end:21150-21169 | MsG0080048896.01.T01:intron | 50.0% |
! | GGCTTTTCATCAATGGCAGG+TGG | - | contig520end:17611-17630 | MsG0080048896.01.T01:intron | 50.0% |
! | GGTACCTGTTTCTCCCTCTA+AGG | - | contig520end:17789-17808 | MsG0080048896.01.T01:intron | 50.0% |
! | TCAAGTCCACTCGGTGGTAA+TGG | + | contig520end:14101-14120 | MsG0080048896.01.T01:intergenic | 50.0% |
! | TGCCATTTGGCAAAGGCCAA+AGG | - | contig520end:15931-15950 | MsG0080048896.01.T01:intron | 50.0% |
!! | GCCATTTTGGCATCAGAGCA+AGG | - | contig520end:11807-11826 | MsG0080048896.01.T01:intron | 50.0% |
!! | GTCAAGTCTAACGGACTGTG+TGG | + | contig520end:16471-16490 | MsG0080048896.01.T01:intergenic | 50.0% |
!! | GTCACAGGAGAAGTATCCGT+TGG | + | contig520end:18522-18541 | MsG0080048896.01.T01:intergenic | 50.0% |
!! | TATTCGAGTTGACCCCAGCA+AGG | - | contig520end:14991-15010 | MsG0080048896.01.T01:intron | 50.0% |
!! | TGATGTGTCAGGTTGACACG+TGG | + | contig520end:12158-12177 | MsG0080048896.01.T01:intergenic | 50.0% |
ACTAACGCCGCCATTGCGTT+CGG | - | contig520end:11952-11971 | MsG0080048896.01.T01:intron | 55.0% | |
ACTGCTGTATCATCCTCCCC+GGG | + | contig520end:16882-16901 | MsG0080048896.01.T01:intergenic | 55.0% | |
AGCCCTTCCCAACTTTGACC+AGG | - | contig520end:15228-15247 | MsG0080048896.01.T01:intron | 55.0% | |
AGGGCGAGTTCTGTTCAACC+CGG | - | contig520end:16861-16880 | MsG0080048896.01.T01:intron | 55.0% | |
AGGTTGAGGCCATCAGCAGT+TGG | - | contig520end:15011-15030 | MsG0080048896.01.T01:intron | 55.0% | |
AGTTGACCCCAGCAAGGTTG+AGG | - | contig520end:14997-15016 | MsG0080048896.01.T01:intron | 55.0% | |
ATATGGGGAGAACCACCGTC+CGG | + | contig520end:17967-17986 | MsG0080048896.01.T01:intergenic | 55.0% | |
CAGCAGTGGTGCAACGAGTA+TGG | + | contig520end:13743-13762 | MsG0080048896.01.T01:intergenic | 55.0% | |
CATACTCGTTGCACCACTGC+TGG | - | contig520end:13741-13760 | MsG0080048896.01.T01:intron | 55.0% | |
CCAGATTTCCCTCCAGCAAC+AGG | + | contig520end:18329-18348 | MsG0080048896.01.T01:intergenic | 55.0% | |
CCTGTTGCTGGAGGGAAATC+TGG | - | contig520end:18326-18345 | MsG0080048896.01.T01:intron | 55.0% | |
CTCCACCCCGTTCTCTCTTA+GGG | - | contig520end:17500-17519 | MsG0080048896.01.T01:intron | 55.0% | |
CTGATGGCCTCAACCTTGCT+GGG | + | contig520end:15007-15026 | MsG0080048896.01.T01:intergenic | 55.0% | |
CTGGTTCACCTGTTGCTGGA+GGG | - | contig520end:18318-18337 | MsG0080048896.01.T01:intron | 55.0% | |
CTTCAACCTCTGACTTCCGG+TGG | + | contig520end:12077-12096 | MsG0080048896.01.T01:intergenic | 55.0% | |
GACACGTGGCGGTAAGTGAT+TGG | + | contig520end:12144-12163 | MsG0080048896.01.T01:intergenic | 55.0% | |
GACTGCTGTATCATCCTCCC+CGG | + | contig520end:16883-16902 | MsG0080048896.01.T01:intergenic | 55.0% | |
GCTAACTGGGGTCAGCTACA+TGG | + | contig520end:10786-10805 | MsG0080048896.01.T01:intergenic | 55.0% | |
GCTGAGACACCATAGGTACC+TGG | + | contig520end:16783-16802 | MsG0080048896.01.T01:intergenic | 55.0% | |
GCTTACCTGGGATATGGCCA+TGG | + | contig520end:19959-19978 | MsG0080048896.01.T01:intergenic | 55.0% | |
GGAAGCCGAGTTTACGAAGC+TGG | + | contig520end:11247-11266 | MsG0080048896.01.T01:intergenic | 55.0% | |
GGATGATGCAAGGTAGGTGG+TGG | + | contig520end:11570-11589 | MsG0080048896.01.T01:intergenic | 55.0% | |
GGCACGACGATCATATTGCC+AGG | + | contig520end:14015-14034 | MsG0080048896.01.T01:intergenic | 55.0% | |
GGCGCGGTTCTATGTCAAGA+AGG | - | contig520end:15289-15308 | MsG0080048896.01.T01:intron | 55.0% | |
GGCTTAGGCCAGGAGATGAA+TGG | - | contig520end:14666-14685 | MsG0080048896.01.T01:intron | 55.0% | |
GTTGCTGGAGGGAAATCTGG+AGG | - | contig520end:18329-18348 | MsG0080048896.01.T01:intron | 55.0% | |
TCAACCTGACACATCACCCC+TGG | - | contig520end:12162-12181 | MsG0080048896.01.T01:intron | 55.0% | |
TCAATCGCAGACATGCCGCT+TGG | - | contig520end:15494-15513 | MsG0080048896.01.T01:intron | 55.0% | |
TCCCTGTCCAAGTCGTGTCT+GGG | - | contig520end:19571-19590 | MsG0080048896.01.T01:intron | 55.0% | |
TGATGGCCTCAACCTTGCTG+GGG | + | contig520end:15006-15025 | MsG0080048896.01.T01:intergenic | 55.0% | |
TGTAGCTGACCCCAGTTAGC+GGG | - | contig520end:10786-10805 | MsG0080048896.01.T01:intron | 55.0% | |
TTCCCTGTCCAAGTCGTGTC+TGG | - | contig520end:19570-19589 | MsG0080048896.01.T01:intron | 55.0% | |
TTTCGGCCTTCCGAACGCAA+TGG | + | contig520end:11965-11984 | MsG0080048896.01.T01:intergenic | 55.0% | |
! | AAGTTGGGAAGGGCTAGCAC+TGG | + | contig520end:15223-15242 | MsG0080048896.01.T01:intergenic | 55.0% |
! | CGGGGTGGAGCTCTAATCAA+TGG | + | contig520end:17490-17509 | MsG0080048896.01.T01:intergenic | 55.0% |
! | GATTGGCTGGAAGTGACACG+TGG | + | contig520end:12127-12146 | MsG0080048896.01.T01:intergenic | 55.0% |
! | GCACTGCCTTAACTTGACCG+AGG | - | contig520end:21145-21164 | MsG0080048896.01.T01:intron | 55.0% |
! | GCCCATGATGGAGGATTAGC+AGG | - | contig520end:15808-15827 | MsG0080048896.01.T01:intron | 55.0% |
! | GCCGAAAAACCTTGGACTGG+AGG | - | contig520end:11978-11997 | MsG0080048896.01.T01:intron | 55.0% |
! | GGCCTTTGGCCTTTGCCAAA+TGG | + | contig520end:15936-15955 | MsG0080048896.01.T01:intergenic | 55.0% |
! | TGACGTGTCGATGACTGGAC+AGG | + | contig520end:12188-12207 | MsG0080048896.01.T01:intergenic | 55.0% |
!! | CCCAAGGTGCTTCTGGAACA+GGG | + | contig520end:15984-16003 | MsG0080048896.01.T01:intergenic | 55.0% |
!! | CCCTGTTCCAGAAGCACCTT+GGG | - | contig520end:15981-16000 | MsG0080048896.01.T01:intron | 55.0% |
!! | GCTTCTCGTAGAGAGCACTG+AGG | + | contig520end:15775-15794 | MsG0080048896.01.T01:intergenic | 55.0% |
!! | TCCCAAGGTGCTTCTGGAAC+AGG | + | contig520end:15985-16004 | MsG0080048896.01.T01:intergenic | 55.0% |
!! | TCCCTGTTCCAGAAGCACCT+TGG | - | contig520end:15980-15999 | MsG0080048896.01.T01:intron | 55.0% |
!! | TGTGTCAGGTTGACACGTGG+CGG | + | contig520end:12155-12174 | MsG0080048896.01.T01:intergenic | 55.0% |
ACCTCGGACTCAACGCCAGA+AGG | - | contig520end:16035-16054 | MsG0080048896.01.T01:intron | 60.0% | |
ACGCCTGGTTCACCTGTTGC+TGG | - | contig520end:18314-18333 | MsG0080048896.01.T01:intron | 60.0% | |
CAACCTCTGACTTCCGGTGG+CGG | + | contig520end:12074-12093 | MsG0080048896.01.T01:intergenic | 60.0% | |
CAGCTGAGATGGCTGCTGAC+TGG | + | contig520end:12104-12123 | MsG0080048896.01.T01:intergenic | 60.0% | |
CCTCCAGCAACAGGTGAACC+AGG | + | contig520end:18320-18339 | MsG0080048896.01.T01:intergenic | 60.0% | |
CCTCTTCCCTTAGGGCCATC+GGG | + | contig520end:21224-21243 | MsG0080048896.01.T01:intergenic | 60.0% | |
CCTGGTTCACCTGTTGCTGG+AGG | - | contig520end:18317-18336 | MsG0080048896.01.T01:intron | 60.0% | |
CGATCCCACAGCTCTCTCAC+AGG | + | contig520end:17669-17688 | MsG0080048896.01.T01:intergenic | 60.0% | |
CGTGGCGGTAAGTGATTGGC+TGG | + | contig520end:12140-12159 | MsG0080048896.01.T01:intergenic | 60.0% | |
CTCTTCCCTTAGGGCCATCG+GGG | + | contig520end:21223-21242 | MsG0080048896.01.T01:intergenic | 60.0% | |
GACAGCCATGGCCATATCCC+AGG | - | contig520end:19951-19970 | MsG0080048896.01.T01:intron | 60.0% | |
GACTTCCCCGATGGCCCTAA+GGG | - | contig520end:21215-21234 | MsG0080048896.01.T01:exon | 60.0% | |
GAGAGCTGTGGGATCGTGCT+AGG | - | contig520end:17673-17692 | MsG0080048896.01.T01:intron | 60.0% | |
GAGTTCTGTTCAACCCGGGG+AGG | - | contig520end:16866-16885 | MsG0080048896.01.T01:intron | 60.0% | |
GATTTCACCCCGAGACCGGA+CGG | - | contig520end:17949-17968 | MsG0080048896.01.T01:intron | 60.0% | |
GCCTCTTCCCTTAGGGCCAT+CGG | + | contig520end:21225-21244 | MsG0080048896.01.T01:intergenic | 60.0% | |
GCTAGTCACCCCCAGACAGA+TGG | - | contig520end:16279-16298 | MsG0080048896.01.T01:intron | 60.0% | |
GCTCCACCCCGTTCTCTCTT+AGG | - | contig520end:17499-17518 | MsG0080048896.01.T01:intron | 60.0% | |
GCTGATGGCCTCAACCTTGC+TGG | + | contig520end:15008-15027 | MsG0080048896.01.T01:intergenic | 60.0% | |
GCTGGATTTCACCCCGAGAC+CGG | - | contig520end:17945-17964 | MsG0080048896.01.T01:intron | 60.0% | |
GGCGAGTTCTGTTCAACCCG+GGG | - | contig520end:16863-16882 | MsG0080048896.01.T01:intron | 60.0% | |
GGGCGAGTTCTGTTCAACCC+GGG | - | contig520end:16862-16881 | MsG0080048896.01.T01:intron | 60.0% | |
GTCCCTAAGAGAGAACGGGG+TGG | + | contig520end:17505-17524 | MsG0080048896.01.T01:intergenic | 60.0% | |
GTCGATGACTGGACAGGCCA+GGG | + | contig520end:12182-12201 | MsG0080048896.01.T01:intergenic | 60.0% | |
GTGACACGTGGCAGCTGAGA+TGG | + | contig520end:12115-12134 | MsG0080048896.01.T01:intergenic | 60.0% | |
TCGATGACTGGACAGGCCAG+GGG | + | contig520end:12181-12200 | MsG0080048896.01.T01:intergenic | 60.0% | |
TGTCGATGACTGGACAGGCC+AGG | + | contig520end:12183-12202 | MsG0080048896.01.T01:intergenic | 60.0% | |
! | AACTCCGGCGAGGCGTTTGA+CGG | + | contig520end:12032-12051 | MsG0080048896.01.T01:intergenic | 60.0% |
! | ACTGGGTGATGACGTGGCAC+AGG | + | contig520end:12237-12256 | MsG0080048896.01.T01:intergenic | 60.0% |
! | AGCCCAGACACGACTTGGAC+AGG | + | contig520end:19576-19595 | MsG0080048896.01.T01:intergenic | 60.0% |
! | CGCATTGGCGGCAATCCTTG+TGG | + | contig520end:14308-14327 | MsG0080048896.01.T01:intergenic | 60.0% |
! | CTGGGTGATGACGTGGCACA+GGG | + | contig520end:12236-12255 | MsG0080048896.01.T01:intergenic | 60.0% |
! | GCCCAGACACGACTTGGACA+GGG | + | contig520end:19575-19594 | MsG0080048896.01.T01:intergenic | 60.0% |
! | GTGGCTGACGTGTCGATGAC+TGG | + | contig520end:12193-12212 | MsG0080048896.01.T01:intergenic | 60.0% |
! | TCCTTCTGGCGTTGAGTCCG+AGG | + | contig520end:16039-16058 | MsG0080048896.01.T01:intergenic | 60.0% |
! | TGGGTGACTGGGTGATGACG+TGG | + | contig520end:12243-12262 | MsG0080048896.01.T01:intergenic | 60.0% |
!! | GGTGCTTCTGGAACAGGGAG+TGG | + | contig520end:15979-15998 | MsG0080048896.01.T01:intergenic | 60.0% |
ACGCCGCCATTGCGTTCGGA+AGG | - | contig520end:11956-11975 | MsG0080048896.01.T01:intron | 65.0% | |
ACGTGGCACAGGGTGACACG+TGG | + | contig520end:12226-12245 | MsG0080048896.01.T01:intergenic | 65.0% | |
AGAACCACCGTCCGGTCTCG+GGG | + | contig520end:17959-17978 | MsG0080048896.01.T01:intergenic | 65.0% | |
AGCGTCCTCGACTTCCCCGA+TGG | - | contig520end:21206-21225 | MsG0080048896.01.T01:exon | 65.0% | |
AGGCGTTTGACGGCTCGTGG+AGG | + | contig520end:12022-12041 | MsG0080048896.01.T01:intergenic | 65.0% | |
CAGGCCAGGGGTGATGTGTC+AGG | + | contig520end:12169-12188 | MsG0080048896.01.T01:intergenic | 65.0% | |
CCCGATGGCCCTAAGGGAAG+AGG | - | contig520end:21221-21240 | MsG0080048896.01.T01:exon | 65.0% | |
CGACTTCCCCGATGGCCCTA+AGG | - | contig520end:21214-21233 | MsG0080048896.01.T01:exon | 65.0% | |
CGGCCTTCCGAACGCAATGG+CGG | + | contig520end:11962-11981 | MsG0080048896.01.T01:intergenic | 65.0% | |
GACACGTGGCAGCGATGTGG+TGG | + | contig520end:12212-12231 | MsG0080048896.01.T01:intergenic | 65.0% | |
GAGAACCACCGTCCGGTCTC+GGG | + | contig520end:17960-17979 | MsG0080048896.01.T01:intergenic | 65.0% | |
GGAGAACCACCGTCCGGTCT+CGG | + | contig520end:17961-17980 | MsG0080048896.01.T01:intergenic | 65.0% | |
GGGATCGTGCTAGGAGCTGC+TGG | - | contig520end:17682-17701 | MsG0080048896.01.T01:intron | 65.0% | |
GGTGACACGTGGCAGCGATG+TGG | + | contig520end:12215-12234 | MsG0080048896.01.T01:intergenic | 65.0% | |
TAGGGCCATCGGGGAAGTCG+AGG | + | contig520end:21214-21233 | MsG0080048896.01.T01:intergenic | 65.0% | |
TGGTGGTCCGGCGAGAACTC+CGG | + | contig520end:12047-12066 | MsG0080048896.01.T01:intergenic | 65.0% | |
ACGGCTCGTGGAGGCTCCGT+TGG | + | contig520end:12013-12032 | MsG0080048896.01.T01:intergenic | 70.0% | |
CGAGCCGTCAAACGCCTCGC+CGG | - | contig520end:12025-12044 | MsG0080048896.01.T01:intron | 70.0% | |
TTCACCCCGAGACCGGACGG+TGG | - | contig520end:17952-17971 | MsG0080048896.01.T01:intron | 70.0% | |
! | CCTCTGACTTCCGGTGGCGG+CGG | + | contig520end:12071-12090 | MsG0080048896.01.T01:intergenic | 70.0% |
! | CTCTGACTTCCGGTGGCGGC+GGG | + | contig520end:12070-12089 | MsG0080048896.01.T01:intergenic | 70.0% |
! | GCGAGGCGTTTGACGGCTCG+TGG | + | contig520end:12025-12044 | MsG0080048896.01.T01:intergenic | 70.0% |
CCGCCGCCACCGGAAGTCAG+AGG | - | contig520end:12068-12087 | MsG0080048896.01.T01:intron | 75.0% | |
CGCCTCGCCGGAGTTCTCGC+CGG | - | contig520end:12037-12056 | MsG0080048896.01.T01:intron | 75.0% | |
GTCCGGCGAGAACTCCGGCG+AGG | + | contig520end:12042-12061 | MsG0080048896.01.T01:intergenic | 75.0% | |
! | TGACTTCCGGTGGCGGCGGG+TGG | + | contig520end:12067-12086 | MsG0080048896.01.T01:intergenic | 75.0% |
! | GGACCACCACCCGCCGCCAC+CGG | - | contig520end:12058-12077 | MsG0080048896.01.T01:intron | 80.0% |
!! | CTTCCGGTGGCGGCGGGTGG+TGG | + | contig520end:12064-12083 | MsG0080048896.01.T01:intergenic | 80.0% |
!! | GGTGGCGGCGGGTGGTGGTC+CGG | + | contig520end:12059-12078 | MsG0080048896.01.T01:intergenic | 80.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
contig520end | gene | 10001 | 21551 | 10001 | ID=MsG0080048896.01; |
contig520end | mRNA | 10001 | 21551 | 10001 | ID=MsG0080048896.01.T01;Parent=MsG0080048896.01 |
contig520end | exon | 10001 | 10595 | 10001 | ID=MsG0080048896.01.T01.exon;Parent=MsG0080048896.01.T01 |
contig520end | CDS | 10221 | 10595 | 10221 | ID=MsG0080048896.01.T01.cds;Parent=MsG0080048896.01.T01 |
contig520end | CDS | 11082 | 11189 | 11082 | ID=MsG0080048896.01.T01.cds;Parent=MsG0080048896.01.T01 |
contig520end | exon | 11082 | 11189 | 11082 | ID=MsG0080048896.01.T01.exon;Parent=MsG0080048896.01.T01 |
contig520end | CDS | 11580 | 11678 | 11580 | ID=MsG0080048896.01.T01.cds;Parent=MsG0080048896.01.T01 |
contig520end | exon | 11580 | 11678 | 11580 | ID=MsG0080048896.01.T01.exon;Parent=MsG0080048896.01.T01 |
contig520end | CDS | 11752 | 11805 | 11752 | ID=MsG0080048896.01.T01.cds;Parent=MsG0080048896.01.T01 |
contig520end | exon | 11752 | 11805 | 11752 | ID=MsG0080048896.01.T01.exon;Parent=MsG0080048896.01.T01 |
contig520end | CDS | 13140 | 13238 | 13140 | ID=MsG0080048896.01.T01.cds;Parent=MsG0080048896.01.T01 |
contig520end | exon | 13140 | 13238 | 13140 | ID=MsG0080048896.01.T01.exon;Parent=MsG0080048896.01.T01 |
contig520end | CDS | 13544 | 13662 | 13544 | ID=MsG0080048896.01.T01.cds;Parent=MsG0080048896.01.T01 |
contig520end | exon | 13544 | 13662 | 13544 | ID=MsG0080048896.01.T01.exon;Parent=MsG0080048896.01.T01 |
contig520end | CDS | 13763 | 13979 | 13763 | ID=MsG0080048896.01.T01.cds;Parent=MsG0080048896.01.T01 |
contig520end | exon | 13763 | 13979 | 13763 | ID=MsG0080048896.01.T01.exon;Parent=MsG0080048896.01.T01 |
contig520end | CDS | 20336 | 20441 | 20336 | ID=MsG0080048896.01.T01.cds;Parent=MsG0080048896.01.T01 |
contig520end | exon | 20336 | 20441 | 20336 | ID=MsG0080048896.01.T01.exon;Parent=MsG0080048896.01.T01 |
contig520end | CDS | 21205 | 21449 | 21205 | ID=MsG0080048896.01.T01.cds;Parent=MsG0080048896.01.T01 |
contig520end | exon | 21205 | 21551 | 21205 | ID=MsG0080048896.01.T01.exon;Parent=MsG0080048896.01.T01 |
Gene Sequence |
Protein sequence |