Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048878.01.T01 | XP_003616470.1 | 91.917 | 532 | 37 | 2 | 67 | 596 | 94 | 621 | 0 | 918 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048878.01.T01 | G7KGV1 | 91.917 | 532 | 37 | 2 | 67 | 596 | 94 | 621 | 0.0 | 918 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080048065.01 | MsG0080048878.01 | 0.844356 | 7.951720e-59 | 1.280415e-55 |
MsG0080048152.01 | MsG0080048878.01 | 0.808547 | 2.935320e-50 | 1.683149e-47 |
MsG0080048660.01 | MsG0080048878.01 | 0.808441 | 3.092632e-50 | 1.768518e-47 |
MsG0080048727.01 | MsG0080048878.01 | 0.854552 | 1.141187e-61 | 2.558159e-58 |
MsG0080048748.01 | MsG0080048878.01 | 0.834136 | 3.569183e-56 | 4.196972e-53 |
MsG0080048761.01 | MsG0080048878.01 | -0.820944 | 5.247825e-53 | 4.211395e-50 |
MsG0080048773.01 | MsG0080048878.01 | 0.867779 | 1.064333e-65 | 3.760877e-62 |
MsG0080048802.01 | MsG0080048878.01 | 0.819257 | 1.277397e-52 | 9.780411e-50 |
MsG0080048826.01 | MsG0080048878.01 | 0.818413 | 1.986361e-52 | 1.485952e-49 |
MsG0080048849.01 | MsG0080048878.01 | 0.896345 | 4.032675e-76 | 4.344521e-72 |
MsG0080048865.01 | MsG0080048878.01 | 0.801070 | 1.071016e-48 | 5.067689e-46 |
MsG0080048878.01 | MsG0080048938.01 | 0.809096 | 2.239742e-50 | 1.303106e-47 |
MsG0080048878.01 | MsG0080049011.01 | 0.840923 | 6.490438e-58 | 9.385323e-55 |
MsG0080048878.01 | MsG0080049040.01 | 0.832505 | 9.096397e-56 | 1.018783e-52 |
MsG0080048878.01 | MsG0080049068.01 | 0.873444 | 1.463682e-67 | 6.354259e-64 |
MsG0080048878.01 | MsG0080049069.01 | 0.854541 | 1.148981e-61 | 2.574926e-58 |
MsG0080048878.01 | MsG0180000026.01 | 0.860657 | 1.772417e-63 | 4.881769e-60 |
MsG0080048878.01 | MsG0180000038.01 | 0.813323 | 2.712794e-51 | 1.766060e-48 |
MsG0080048878.01 | MsG0180000113.01 | 0.836923 | 7.040355e-57 | 9.002387e-54 |
MsG0080048878.01 | MsG0180000354.01 | 0.833549 | 5.004368e-56 | 5.782405e-53 |
MsG0080048878.01 | MsG0180000355.01 | 0.889250 | 2.866951e-73 | 2.294815e-69 |
MsG0080048878.01 | MsG0180000599.01 | 0.808651 | 2.789612e-50 | 1.603839e-47 |
MsG0080048878.01 | MsG0180000785.01 | 0.837147 | 6.169991e-57 | 7.943207e-54 |
MsG0080048878.01 | MsG0180001085.01 | 0.810960 | 8.887015e-51 | 5.432726e-48 |
MsG0080048878.01 | MsG0180001100.01 | 0.809980 | 1.446710e-50 | 8.616870e-48 |
MsG0080048878.01 | MsG0180001118.01 | 0.808911 | 2.454654e-50 | 1.420966e-47 |
MsG0080048878.01 | MsG0180001167.01 | 0.829760 | 4.297113e-55 | 4.440211e-52 |
MsG0080048878.01 | MsG0180001175.01 | 0.812708 | 3.700471e-51 | 2.369607e-48 |
MsG0080048878.01 | MsG0180001270.01 | 0.837414 | 5.271228e-57 | 6.841845e-54 |
MsG0080048878.01 | MsG0180001356.01 | 0.827472 | 1.535501e-54 | 1.483893e-51 |
MsG0080048878.01 | MsG0180001610.01 | 0.855890 | 4.655309e-62 | 1.091012e-58 |
MsG0080048878.01 | MsG0180001704.01 | 0.845249 | 4.568579e-59 | 7.567666e-56 |
MsG0080048878.01 | MsG0180001722.01 | 0.821022 | 5.035042e-53 | 4.049652e-50 |
MsG0080048878.01 | MsG0180002024.01 | 0.806868 | 6.672973e-50 | 3.662183e-47 |
MsG0080048878.01 | MsG0180002184.01 | 0.810168 | 1.318260e-50 | 7.890039e-48 |
MsG0080048878.01 | MsG0180002399.01 | 0.835283 | 1.835934e-56 | 2.234921e-53 |
MsG0080048878.01 | MsG0180002700.01 | 0.860372 | 2.162724e-63 | 5.898577e-60 |
MsG0080048878.01 | MsG0180003353.01 | 0.888922 | 3.840959e-73 | 3.034468e-69 |
MsG0080048878.01 | MsG0180003697.01 | 0.870773 | 1.132263e-66 | 4.457786e-63 |
MsG0080048878.01 | MsG0180003767.01 | -0.822590 | 2.183556e-53 | 1.835790e-50 |
MsG0080048878.01 | MsG0180003821.01 | 0.900012 | 1.121265e-77 | 1.422086e-73 |
MsG0080048878.01 | MsG0180003885.01 | 0.847899 | 8.634981e-60 | 1.557509e-56 |
MsG0080048878.01 | MsG0180003942.01 | -0.804288 | 2.321673e-49 | 1.192441e-46 |
MsG0080048878.01 | MsG0180004025.01 | 0.813050 | 3.113878e-51 | 2.012121e-48 |
MsG0080048878.01 | MsG0180004046.01 | 0.876684 | 1.148516e-68 | 5.619071e-65 |
MsG0080048878.01 | MsG0180004051.01 | 0.840456 | 8.603678e-58 | 1.226209e-54 |
MsG0080048878.01 | MsG0180004103.01 | 0.839733 | 1.328165e-57 | 1.850723e-54 |
MsG0080048878.01 | MsG0180004192.01 | 0.845854 | 3.131298e-59 | 5.289497e-56 |
MsG0080048878.01 | MsG0180004246.01 | 0.842676 | 2.235927e-58 | 3.415209e-55 |
MsG0080048878.01 | MsG0180004276.01 | 0.823397 | 1.415819e-53 | 1.217513e-50 |
MsG0080048878.01 | MsG0180004428.01 | 0.828073 | 1.101192e-54 | 1.082969e-51 |
MsG0080048878.01 | MsG0180004448.01 | 0.858597 | 7.385454e-63 | 1.894941e-59 |
MsG0080048878.01 | MsG0180004466.01 | 0.864811 | 9.294139e-65 | 2.956549e-61 |
MsG0080048878.01 | MsG0180004493.01 | 0.888608 | 5.075134e-73 | 3.959030e-69 |
MsG0080048878.01 | MsG0180004541.01 | 0.819038 | 1.432064e-52 | 1.089944e-49 |
MsG0080048878.01 | MsG0180004605.01 | -0.857540 | 1.522864e-62 | 3.771542e-59 |
MsG0080048878.01 | MsG0180004735.01 | 0.815380 | 9.524045e-52 | 6.555856e-49 |
MsG0080048878.01 | MsG0180004750.01 | 0.878982 | 1.807087e-69 | 9.630445e-66 |
MsG0080048878.01 | MsG0180004759.01 | -0.863543 | 2.310068e-64 | 7.027965e-61 |
MsG0080048878.01 | MsG0180005169.01 | 0.847723 | 9.656767e-60 | 1.732063e-56 |
MsG0080048878.01 | MsG0180005248.01 | -0.805320 | 1.412787e-49 | 7.451820e-47 |
MsG0080048878.01 | MsG0180005303.01 | -0.802202 | 6.274189e-49 | 3.054871e-46 |
MsG0080048878.01 | MsG0180005349.01 | 0.825154 | 5.471121e-54 | 4.947108e-51 |
MsG0080048878.01 | MsG0180005395.01 | -0.816248 | 6.100102e-52 | 4.300061e-49 |
MsG0080048878.01 | MsG0180005418.01 | 0.811147 | 8.097754e-51 | 4.974155e-48 |
MsG0080048878.01 | MsG0180005750.01 | 0.827374 | 1.621144e-54 | 1.562365e-51 |
MsG0080048878.01 | MsG0180005807.01 | 0.853832 | 1.840505e-61 | 4.029725e-58 |
MsG0080048878.01 | MsG0180005964.01 | 0.827665 | 1.379654e-54 | 1.340704e-51 |
MsG0080048878.01 | MsG0180006004.01 | 0.810729 | 9.971116e-51 | 6.057581e-48 |
MsG0080048878.01 | MsG0180006031.01 | 0.889014 | 3.537687e-73 | 2.805306e-69 |
MsG0080048878.01 | MsG0180006096.01 | 0.851852 | 6.772963e-61 | 1.389015e-57 |
MsG0080048878.01 | MsG0180006136.01 | 0.825527 | 4.464899e-54 | 4.079907e-51 |
MsG0080048878.01 | MsG0280006306.01 | -0.875660 | 2.586395e-68 | 1.217745e-64 |
MsG0080048878.01 | MsG0280006309.01 | 0.822594 | 2.179143e-53 | 1.832279e-50 |
MsG0080048878.01 | MsG0280006370.01 | 0.822478 | 2.318573e-53 | 1.942912e-50 |
MsG0080048878.01 | MsG0280006418.01 | -0.802776 | 4.777320e-49 | 2.360531e-46 |
MsG0080048878.01 | MsG0280006526.01 | -0.818983 | 1.474515e-52 | 1.120604e-49 |
MsG0080048878.01 | MsG0280006711.01 | -0.800008 | 1.762800e-48 | 8.118863e-46 |
MsG0080048878.01 | MsG0280006996.01 | 0.872911 | 2.210495e-67 | 9.408333e-64 |
MsG0080048878.01 | MsG0280007062.01 | 0.824076 | 9.815993e-54 | 8.605461e-51 |
MsG0080048878.01 | MsG0280007112.01 | 0.820143 | 8.015461e-53 | 6.291108e-50 |
MsG0080048878.01 | MsG0280007193.01 | -0.863063 | 3.252329e-64 | 9.732044e-61 |
MsG0080048878.01 | MsG0280007211.01 | -0.816680 | 4.882288e-52 | 3.482330e-49 |
MsG0080048878.01 | MsG0280007307.01 | 0.808708 | 2.711515e-50 | 1.561283e-47 |
MsG0080048878.01 | MsG0280007309.01 | 0.814593 | 1.423612e-51 | 9.592483e-49 |
MsG0080048878.01 | MsG0280007432.01 | 0.814380 | 1.586997e-51 | 1.063216e-48 |
MsG0080048878.01 | MsG0280007502.01 | 0.844340 | 8.033376e-59 | 1.292921e-55 |
MsG0080048878.01 | MsG0280007575.01 | 0.843746 | 1.159334e-58 | 1.831461e-55 |
MsG0080048878.01 | MsG0280007647.01 | 0.877408 | 6.436583e-69 | 3.233333e-65 |
MsG0080048878.01 | MsG0280007771.01 | 0.837799 | 4.198532e-57 | 5.515234e-54 |
MsG0080048878.01 | MsG0280007883.01 | 0.823440 | 1.383394e-53 | 1.191176e-50 |
MsG0080048878.01 | MsG0280007903.01 | 0.857342 | 1.742005e-62 | 4.285792e-59 |
MsG0080048878.01 | MsG0280007976.01 | 0.813487 | 2.496725e-51 | 1.632732e-48 |
MsG0080048878.01 | MsG0280008098.01 | 0.815193 | 1.048160e-51 | 7.177684e-49 |
MsG0080048878.01 | MsG0280008223.01 | 0.832600 | 8.616341e-56 | 9.677275e-53 |
MsG0080048878.01 | MsG0280008304.01 | -0.809217 | 2.110147e-50 | 1.231692e-47 |
MsG0080048878.01 | MsG0280008307.01 | -0.809258 | 2.068583e-50 | 1.208697e-47 |
MsG0080048878.01 | MsG0280008388.01 | 0.816169 | 6.351342e-52 | 4.467515e-49 |
MsG0080048878.01 | MsG0280008394.01 | 0.849843 | 2.493211e-60 | 4.789167e-57 |
MsG0080048878.01 | MsG0280008429.01 | 0.830245 | 3.273183e-55 | 3.429547e-52 |
MsG0080048878.01 | MsG0280008451.01 | 0.829988 | 3.781730e-55 | 3.932959e-52 |
MsG0080048878.01 | MsG0280008660.01 | -0.849631 | 2.857139e-60 | 5.450590e-57 |
MsG0080048878.01 | MsG0280008709.01 | 0.815050 | 1.127217e-51 | 7.689350e-49 |
MsG0080048878.01 | MsG0280008928.01 | 0.895413 | 9.811231e-76 | 1.017008e-71 |
MsG0080048878.01 | MsG0280008929.01 | 0.883722 | 3.527972e-71 | 2.263358e-67 |
MsG0080048878.01 | MsG0280008942.01 | 0.805726 | 1.161479e-49 | 6.190897e-47 |
MsG0080048878.01 | MsG0280009256.01 | 0.871336 | 7.383755e-67 | 2.967784e-63 |
MsG0080048878.01 | MsG0280009685.01 | 0.895892 | 6.221716e-76 | 6.573768e-72 |
MsG0080048878.01 | MsG0280009699.01 | 0.800584 | 1.345767e-48 | 6.289569e-46 |
MsG0080048878.01 | MsG0280009708.01 | 0.821389 | 4.144514e-53 | 3.367220e-50 |
MsG0080048878.01 | MsG0280009756.01 | 0.826646 | 2.419720e-54 | 2.282730e-51 |
MsG0080048878.01 | MsG0280010082.01 | 0.854934 | 8.839366e-62 | 2.006700e-58 |
MsG0080048878.01 | MsG0280010148.01 | 0.808370 | 3.202881e-50 | 1.828122e-47 |
MsG0080048878.01 | MsG0280010182.01 | 0.801320 | 9.518106e-49 | 4.532050e-46 |
MsG0080048878.01 | MsG0280010271.01 | 0.826473 | 2.661123e-54 | 2.498046e-51 |
MsG0080048878.01 | MsG0280010288.01 | 0.844022 | 9.775347e-59 | 1.557805e-55 |
MsG0080048878.01 | MsG0280010353.01 | 0.823358 | 1.445968e-53 | 1.242105e-50 |
MsG0080048878.01 | MsG0280010434.01 | 0.815096 | 1.101065e-51 | 7.520093e-49 |
MsG0080048878.01 | MsG0280010503.01 | 0.850069 | 2.154842e-60 | 4.170486e-57 |
MsG0080048878.01 | MsG0280010564.01 | 0.868490 | 6.280488e-66 | 2.276260e-62 |
MsG0080048878.01 | MsG0280010604.01 | -0.818033 | 2.420192e-52 | 1.791451e-49 |
MsG0080048878.01 | MsG0280010916.01 | 0.805154 | 1.530701e-49 | 8.039468e-47 |
MsG0080048878.01 | MsG0280011027.01 | 0.819783 | 9.688901e-53 | 7.528344e-50 |
MsG0080048878.01 | MsG0280011059.01 | -0.813566 | 2.398789e-51 | 1.571974e-48 |
MsG0080048878.01 | MsG0280011073.01 | 0.819312 | 1.240933e-52 | 9.514983e-50 |
MsG0080048878.01 | MsG0280011180.01 | 0.821015 | 5.055079e-53 | 4.064872e-50 |
MsG0080048878.01 | MsG0280011255.01 | 0.867335 | 1.476575e-65 | 5.136843e-62 |
MsG0080048878.01 | MsG0280011304.01 | 0.811544 | 6.638852e-51 | 4.121095e-48 |
MsG0080048878.01 | MsG0280011333.01 | 0.800446 | 1.435741e-48 | 6.686533e-46 |
MsG0080048878.01 | MsG0380011581.01 | 0.801550 | 8.541887e-49 | 4.090717e-46 |
MsG0080048878.01 | MsG0380011844.01 | 0.855477 | 6.144855e-62 | 1.420575e-58 |
MsG0080048878.01 | MsG0380012005.01 | 0.817009 | 4.118780e-52 | 2.964588e-49 |
MsG0080048878.01 | MsG0380012011.01 | 0.820229 | 7.659407e-53 | 6.025369e-50 |
MsG0080048878.01 | MsG0380012012.01 | 0.833227 | 6.019363e-56 | 6.888456e-53 |
MsG0080048878.01 | MsG0380012122.01 | 0.845954 | 2.942839e-59 | 4.986896e-56 |
MsG0080048878.01 | MsG0380012374.01 | 0.805689 | 1.182299e-49 | 6.295799e-47 |
MsG0080048878.01 | MsG0380012567.01 | 0.829537 | 4.869272e-55 | 4.997841e-52 |
MsG0080048878.01 | MsG0380012570.01 | 0.851415 | 9.010384e-61 | 1.822498e-57 |
MsG0080048878.01 | MsG0380012868.01 | 0.852431 | 4.637529e-61 | 9.688246e-58 |
MsG0080048878.01 | MsG0380013085.01 | 0.800366 | 1.490878e-48 | 6.929362e-46 |
MsG0080048878.01 | MsG0380013295.01 | -0.848665 | 5.304079e-60 | 9.805564e-57 |
MsG0080048878.01 | MsG0380013467.01 | 0.830875 | 2.295506e-55 | 2.449794e-52 |
MsG0080048878.01 | MsG0380014225.01 | -0.801540 | 8.582610e-49 | 4.109211e-46 |
MsG0080048878.01 | MsG0380014240.01 | 0.822821 | 1.929730e-53 | 1.632918e-50 |
MsG0080048878.01 | MsG0380014584.01 | 0.824258 | 8.899317e-54 | 7.841653e-51 |
MsG0080048878.01 | MsG0380014909.01 | 0.814648 | 1.384575e-51 | 9.343218e-49 |
MsG0080048878.01 | MsG0380015066.01 | -0.827770 | 1.301909e-54 | 1.269021e-51 |
MsG0080048878.01 | MsG0380015352.01 | 0.804760 | 1.850576e-49 | 9.621621e-47 |
MsG0080048878.01 | MsG0380015372.01 | 0.824705 | 6.984540e-54 | 6.235105e-51 |
MsG0080048878.01 | MsG0380015438.01 | 0.819160 | 1.343942e-52 | 1.026205e-49 |
MsG0080048878.01 | MsG0380015533.01 | 0.832879 | 7.348861e-56 | 8.322477e-53 |
MsG0080048878.01 | MsG0380015603.01 | 0.818061 | 2.385999e-52 | 1.767482e-49 |
MsG0080048878.01 | MsG0380015703.01 | 0.881913 | 1.615901e-70 | 9.644046e-67 |
MsG0080048878.01 | MsG0380015784.01 | 0.876487 | 1.342521e-68 | 6.521909e-65 |
MsG0080048878.01 | MsG0380015847.01 | -0.819445 | 1.156964e-52 | 8.905067e-50 |
MsG0080048878.01 | MsG0380015849.01 | -0.818444 | 1.953996e-52 | 1.463044e-49 |
MsG0080048878.01 | MsG0380015870.01 | 0.824237 | 9.000341e-54 | 7.926305e-51 |
MsG0080048878.01 | MsG0380015896.01 | 0.815110 | 1.093213e-51 | 7.469389e-49 |
MsG0080048878.01 | MsG0380016057.01 | 0.832843 | 7.500025e-56 | 8.484410e-53 |
MsG0080048878.01 | MsG0380016063.01 | 0.825966 | 3.512755e-54 | 3.250526e-51 |
MsG0080048878.01 | MsG0380016191.01 | -0.828837 | 7.199677e-55 | 7.238921e-52 |
MsG0080048878.01 | MsG0380016192.01 | 0.809629 | 1.721388e-50 | 1.015918e-47 |
MsG0080048878.01 | MsG0380016194.01 | 0.817251 | 3.633306e-52 | 2.632379e-49 |
MsG0080048878.01 | MsG0380016249.01 | 0.800594 | 1.339459e-48 | 6.261578e-46 |
MsG0080048878.01 | MsG0380016284.01 | 0.840947 | 6.397266e-58 | 9.257210e-55 |
MsG0080048878.01 | MsG0380016347.01 | -0.885180 | 1.015150e-71 | 6.898311e-68 |
MsG0080048878.01 | MsG0380016425.01 | -0.811055 | 8.477991e-51 | 5.195369e-48 |
MsG0080048878.01 | MsG0380016529.01 | 0.804333 | 2.271733e-49 | 1.168139e-46 |
MsG0080048878.01 | MsG0380016540.01 | 0.858676 | 6.994705e-63 | 1.799519e-59 |
MsG0080048878.01 | MsG0380016671.01 | 0.851828 | 6.879651e-61 | 1.409964e-57 |
MsG0080048878.01 | MsG0380016764.01 | 0.816320 | 5.876659e-52 | 4.150919e-49 |
MsG0080048878.01 | MsG0380016820.01 | 0.886862 | 2.364117e-72 | 1.717617e-68 |
MsG0080048878.01 | MsG0380016864.01 | 0.833651 | 4.719294e-56 | 5.469334e-53 |
MsG0080048878.01 | MsG0380017023.01 | 0.805120 | 1.556421e-49 | 8.167393e-47 |
MsG0080048878.01 | MsG0380017085.01 | 0.827329 | 1.661013e-54 | 1.598663e-51 |
MsG0080048878.01 | MsG0380017087.01 | 0.831890 | 1.291226e-55 | 1.420344e-52 |
MsG0080048878.01 | MsG0380017202.01 | 0.850740 | 1.396304e-60 | 2.762247e-57 |
MsG0080048878.01 | MsG0380017244.01 | 0.813318 | 2.719761e-51 | 1.770306e-48 |
MsG0080048878.01 | MsG0380017293.01 | 0.841315 | 5.121008e-58 | 7.494897e-55 |
MsG0080048878.01 | MsG0380017338.01 | 0.851435 | 8.893860e-61 | 1.800059e-57 |
MsG0080048878.01 | MsG0380017423.01 | 0.808578 | 2.890632e-50 | 1.658829e-47 |
MsG0080048878.01 | MsG0380017437.01 | -0.817507 | 3.181691e-52 | 2.321516e-49 |
MsG0080048878.01 | MsG0380017663.01 | 0.826001 | 3.447030e-54 | 3.192785e-51 |
MsG0080048878.01 | MsG0380017703.01 | 0.816785 | 4.622740e-52 | 3.306931e-49 |
MsG0080048878.01 | MsG0380017728.01 | 0.800192 | 1.617396e-48 | 7.484015e-46 |
MsG0080048878.01 | MsG0380017749.01 | 0.806101 | 9.687825e-50 | 5.213254e-47 |
MsG0080048878.01 | MsG0380017931.01 | 0.833348 | 5.615709e-56 | 6.450322e-53 |
MsG0080048878.01 | MsG0380018037.01 | 0.851213 | 1.027675e-60 | 2.064971e-57 |
MsG0080048878.01 | MsG0380018048.01 | 0.814493 | 1.497881e-51 | 1.006615e-48 |
MsG0080048878.01 | MsG0380018061.01 | 0.808392 | 3.167419e-50 | 1.808949e-47 |
MsG0080048878.01 | MsG0380018069.01 | 0.828457 | 8.896167e-55 | 8.847604e-52 |
MsG0080048878.01 | MsG0480018091.01 | -0.860143 | 2.535730e-63 | 6.861923e-60 |
MsG0080048878.01 | MsG0480018426.01 | 0.844498 | 7.286030e-59 | 1.178522e-55 |
MsG0080048878.01 | MsG0480018584.01 | 0.891485 | 3.805239e-74 | 3.342818e-70 |
MsG0080048878.01 | MsG0480018644.01 | 0.839513 | 1.514911e-57 | 2.096855e-54 |
MsG0080048878.01 | MsG0480018850.01 | 0.896760 | 2.707818e-76 | 2.969830e-72 |
MsG0080048878.01 | MsG0480018911.01 | 0.880772 | 4.167149e-70 | 2.380024e-66 |
MsG0080048878.01 | MsG0480019007.01 | 0.852101 | 5.758744e-61 | 1.190509e-57 |
MsG0080048878.01 | MsG0480019408.01 | 0.852275 | 5.138582e-61 | 1.068296e-57 |
MsG0080048878.01 | MsG0480019711.01 | 0.818091 | 2.348227e-52 | 1.740913e-49 |
MsG0080048878.01 | MsG0480020024.01 | 0.869231 | 3.615607e-66 | 1.346747e-62 |
MsG0080048878.01 | MsG0480020025.01 | 0.844799 | 6.043936e-59 | 9.869673e-56 |
MsG0080048878.01 | MsG0480020502.01 | 0.807444 | 5.040645e-50 | 2.807941e-47 |
MsG0080048878.01 | MsG0480020690.01 | 0.885368 | 8.637291e-72 | 5.913321e-68 |
MsG0080048878.01 | MsG0480020753.01 | 0.810835 | 9.460484e-51 | 5.763590e-48 |
MsG0080048878.01 | MsG0480020758.01 | 0.811307 | 7.475990e-51 | 4.611369e-48 |
MsG0080048878.01 | MsG0480020889.01 | 0.840248 | 9.746239e-58 | 1.380197e-54 |
MsG0080048878.01 | MsG0480020890.01 | 0.808189 | 3.500034e-50 | 1.988261e-47 |
MsG0080048878.01 | MsG0480020935.01 | -0.824872 | 6.377357e-54 | 5.720227e-51 |
MsG0080048878.01 | MsG0480021037.01 | 0.833435 | 5.341109e-56 | 6.150582e-53 |
MsG0080048878.01 | MsG0480021201.01 | 0.849322 | 3.483045e-60 | 6.578896e-57 |
MsG0080048878.01 | MsG0480021248.01 | 0.861737 | 8.315588e-64 | 2.376118e-60 |
MsG0080048878.01 | MsG0480021377.01 | 0.800721 | 1.261772e-48 | 5.917392e-46 |
MsG0080048878.01 | MsG0480021768.01 | 0.851002 | 1.178715e-60 | 2.352108e-57 |
MsG0080048878.01 | MsG0480021776.01 | -0.860318 | 2.244868e-63 | 6.110823e-60 |
MsG0080048878.01 | MsG0480021817.01 | 0.802701 | 4.952065e-49 | 2.442104e-46 |
MsG0080048878.01 | MsG0480022149.01 | 0.849754 | 2.639219e-60 | 5.054921e-57 |
MsG0080048878.01 | MsG0480022200.01 | 0.827850 | 1.245639e-54 | 1.217085e-51 |
MsG0080048878.01 | MsG0480022239.01 | 0.815468 | 9.102453e-52 | 6.281319e-49 |
MsG0080048878.01 | MsG0480022260.01 | 0.805963 | 1.035746e-49 | 5.554167e-47 |
MsG0080048878.01 | MsG0480022340.01 | -0.811104 | 8.272707e-51 | 5.075939e-48 |
MsG0080048878.01 | MsG0480022355.01 | 0.807319 | 5.358168e-50 | 2.975276e-47 |
MsG0080048878.01 | MsG0480022401.01 | 0.839331 | 1.689334e-57 | 2.325312e-54 |
MsG0080048878.01 | MsG0480022491.01 | -0.813339 | 2.690466e-51 | 1.752289e-48 |
MsG0080048878.01 | MsG0480022537.01 | 0.808439 | 3.095990e-50 | 1.770319e-47 |
MsG0080048878.01 | MsG0480022624.01 | 0.825930 | 3.582699e-54 | 3.311828e-51 |
MsG0080048878.01 | MsG0480022647.01 | 0.839124 | 1.910933e-57 | 2.613446e-54 |
MsG0080048878.01 | MsG0480022780.01 | 0.807288 | 5.439348e-50 | 3.017881e-47 |
MsG0080048878.01 | MsG0480022872.01 | -0.819255 | 1.278376e-52 | 9.787619e-50 |
MsG0080048878.01 | MsG0480022921.01 | 0.833153 | 6.279576e-56 | 7.170620e-53 |
MsG0080048878.01 | MsG0480022994.01 | 0.834945 | 2.234042e-56 | 2.691955e-53 |
MsG0080048878.01 | MsG0480023009.01 | 0.825385 | 4.825165e-54 | 4.391242e-51 |
MsG0080048878.01 | MsG0480023073.01 | 0.876276 | 1.587994e-68 | 7.652345e-65 |
MsG0080048878.01 | MsG0480023121.01 | 0.834007 | 3.844236e-56 | 4.503454e-53 |
MsG0080048878.01 | MsG0480023162.01 | 0.886201 | 4.201713e-72 | 2.972641e-68 |
MsG0080048878.01 | MsG0480023261.01 | 0.823887 | 1.087102e-53 | 9.480436e-51 |
MsG0080048878.01 | MsG0480023314.01 | 0.826976 | 2.018796e-54 | 1.922843e-51 |
MsG0080048878.01 | MsG0480023348.01 | -0.811113 | 8.236385e-51 | 5.054834e-48 |
MsG0080048878.01 | MsG0480023367.01 | 0.812079 | 5.078375e-51 | 3.197732e-48 |
MsG0080048878.01 | MsG0480023381.01 | 0.802762 | 4.809747e-49 | 2.375656e-46 |
MsG0080048878.01 | MsG0480023384.01 | 0.841643 | 4.195342e-58 | 6.203797e-55 |
MsG0080048878.01 | MsG0480023385.01 | 0.805346 | 1.395260e-49 | 7.364331e-47 |
MsG0080048878.01 | MsG0480023389.01 | 0.801866 | 7.356777e-49 | 3.551687e-46 |
MsG0080048878.01 | MsG0480023448.01 | 0.809844 | 1.547811e-50 | 9.186044e-48 |
MsG0080048878.01 | MsG0480023652.01 | 0.875566 | 2.785549e-68 | 1.306948e-64 |
MsG0080048878.01 | MsG0480023660.01 | 0.842185 | 3.017733e-58 | 4.538951e-55 |
MsG0080048878.01 | MsG0480023723.01 | 0.807767 | 4.303694e-50 | 2.417660e-47 |
MsG0080048878.01 | MsG0480023845.01 | 0.806371 | 8.497427e-50 | 4.604271e-47 |
MsG0080048878.01 | MsG0480023867.01 | 0.842686 | 2.222580e-58 | 3.395960e-55 |
MsG0080048878.01 | MsG0480023877.01 | 0.822877 | 1.872101e-53 | 1.586656e-50 |
MsG0080048878.01 | MsG0480023909.01 | 0.813186 | 2.907811e-51 | 1.885801e-48 |
MsG0080048878.01 | MsG0480024030.01 | 0.816866 | 4.434162e-52 | 3.179051e-49 |
MsG0080048878.01 | MsG0580024161.01 | 0.815679 | 8.170258e-52 | 5.670561e-49 |
MsG0080048878.01 | MsG0580024285.01 | 0.831018 | 2.116660e-55 | 2.268546e-52 |
MsG0080048878.01 | MsG0580024569.01 | 0.815892 | 7.323389e-52 | 5.112008e-49 |
MsG0080048878.01 | MsG0580024619.01 | 0.820478 | 6.715451e-53 | 5.319399e-50 |
MsG0080048878.01 | MsG0580024679.01 | 0.806879 | 6.637468e-50 | 3.643697e-47 |
MsG0080048878.01 | MsG0580024725.01 | 0.808081 | 3.689783e-50 | 2.090004e-47 |
MsG0080048878.01 | MsG0580024761.01 | 0.803970 | 2.702952e-49 | 1.377030e-46 |
MsG0080048878.01 | MsG0580024790.01 | -0.837050 | 6.532857e-57 | 8.385728e-54 |
MsG0080048878.01 | MsG0580024873.01 | 0.819442 | 1.158840e-52 | 8.918686e-50 |
MsG0080048878.01 | MsG0580024930.01 | -0.830041 | 3.671056e-55 | 3.823526e-52 |
MsG0080048878.01 | MsG0580025055.01 | 0.879732 | 9.802325e-70 | 5.374235e-66 |
MsG0080048878.01 | MsG0580025059.01 | 0.803595 | 3.234252e-49 | 1.631931e-46 |
MsG0080048878.01 | MsG0580025366.01 | 0.861206 | 1.207457e-63 | 3.389306e-60 |
MsG0080048878.01 | MsG0580025369.01 | -0.864991 | 8.160794e-65 | 2.613448e-61 |
MsG0080048878.01 | MsG0580025407.01 | -0.825447 | 4.665545e-54 | 4.253294e-51 |
MsG0080048878.01 | MsG0580025502.01 | 0.833859 | 4.186083e-56 | 4.882442e-53 |
MsG0080048878.01 | MsG0580025561.01 | -0.836734 | 7.866790e-57 | 1.000254e-53 |
MsG0080048878.01 | MsG0580025607.01 | 0.828949 | 6.765586e-55 | 6.825085e-52 |
MsG0080048878.01 | MsG0580025626.01 | 0.815135 | 1.079345e-51 | 7.379558e-49 |
MsG0080048878.01 | MsG0580025627.01 | 0.875692 | 2.522309e-68 | 1.189005e-64 |
MsG0080048878.01 | MsG0580025668.01 | 0.813867 | 2.059052e-51 | 1.360379e-48 |
MsG0080048878.01 | MsG0580025859.01 | 0.804790 | 1.823871e-49 | 9.490170e-47 |
MsG0080048878.01 | MsG0580025906.01 | 0.814439 | 1.539885e-51 | 1.033298e-48 |
MsG0080048878.01 | MsG0580025971.01 | 0.850079 | 2.141259e-60 | 4.145331e-57 |
MsG0080048878.01 | MsG0580026159.01 | -0.852732 | 3.806961e-61 | 8.030722e-58 |
MsG0080048878.01 | MsG0580026175.01 | 0.836636 | 8.331159e-57 | 1.056069e-53 |
MsG0080048878.01 | MsG0580026206.01 | 0.857040 | 2.139952e-62 | 5.211044e-59 |
MsG0080048878.01 | MsG0580026450.01 | 0.809001 | 2.348064e-50 | 1.362551e-47 |
MsG0080048878.01 | MsG0580026498.01 | 0.809292 | 2.034144e-50 | 1.189677e-47 |
MsG0080048878.01 | MsG0580026921.01 | 0.830375 | 3.042970e-55 | 3.200229e-52 |
MsG0080048878.01 | MsG0580027103.01 | 0.834732 | 2.528884e-56 | 3.027148e-53 |
MsG0080048878.01 | MsG0580027394.01 | 0.864687 | 1.016198e-64 | 3.218821e-61 |
MsG0080048878.01 | MsG0580027655.01 | 0.825533 | 4.451835e-54 | 4.068708e-51 |
MsG0080048878.01 | MsG0580027826.01 | 0.809880 | 1.520549e-50 | 9.032651e-48 |
MsG0080048878.01 | MsG0580027928.01 | -0.840516 | 8.296004e-58 | 1.184604e-54 |
MsG0080048878.01 | MsG0580028024.01 | 0.831110 | 2.010242e-55 | 2.160234e-52 |
MsG0080048878.01 | MsG0580028033.01 | 0.843409 | 1.426395e-58 | 2.229868e-55 |
MsG0080048878.01 | MsG0580028059.01 | 0.847666 | 1.000992e-59 | 1.792256e-56 |
MsG0080048878.01 | MsG0580028232.01 | -0.824855 | 6.438732e-54 | 5.772383e-51 |
MsG0080048878.01 | MsG0580028306.01 | 0.822737 | 2.018495e-53 | 1.704022e-50 |
MsG0080048878.01 | MsG0580028407.01 | 0.821247 | 4.469566e-53 | 3.616855e-50 |
MsG0080048878.01 | MsG0580028419.01 | 0.817968 | 2.504281e-52 | 1.850340e-49 |
MsG0080048878.01 | MsG0580028428.01 | 0.804679 | 1.924141e-49 | 9.982889e-47 |
MsG0080048878.01 | MsG0580028551.01 | 0.841025 | 6.100877e-58 | 8.849132e-55 |
MsG0080048878.01 | MsG0580028570.01 | 0.831406 | 1.699454e-55 | 1.842405e-52 |
MsG0080048878.01 | MsG0580028630.01 | 0.883993 | 2.801721e-71 | 1.816565e-67 |
MsG0080048878.01 | MsG0580028754.01 | 0.831444 | 1.663450e-55 | 1.805489e-52 |
MsG0080048878.01 | MsG0580029039.01 | 0.883429 | 4.519247e-71 | 2.863876e-67 |
MsG0080048878.01 | MsG0580029236.01 | 0.802379 | 5.769768e-49 | 2.822227e-46 |
MsG0080048878.01 | MsG0580029529.01 | 0.837411 | 5.281332e-57 | 6.854226e-54 |
MsG0080048878.01 | MsG0580029549.01 | 0.843937 | 1.030598e-58 | 1.638085e-55 |
MsG0080048878.01 | MsG0580029734.01 | 0.874707 | 5.470691e-68 | 2.487244e-64 |
MsG0080048878.01 | MsG0580029736.01 | 0.803430 | 3.499448e-49 | 1.758180e-46 |
MsG0080048878.01 | MsG0580029862.01 | 0.826896 | 2.109173e-54 | 2.004232e-51 |
MsG0080048878.01 | MsG0580029879.01 | 0.830799 | 2.395553e-55 | 2.550891e-52 |
MsG0080048878.01 | MsG0580029905.01 | 0.800699 | 1.275110e-48 | 5.976473e-46 |
MsG0080048878.01 | MsG0580029912.01 | 0.819294 | 1.252439e-52 | 9.598715e-50 |
MsG0080048878.01 | MsG0580029914.01 | 0.854390 | 1.270512e-61 | 2.832855e-58 |
MsG0080048878.01 | MsG0580029919.01 | 0.808134 | 3.595312e-50 | 2.039335e-47 |
MsG0080048878.01 | MsG0580029924.01 | 0.806906 | 6.552968e-50 | 3.599738e-47 |
MsG0080048878.01 | MsG0580029925.01 | 0.815141 | 1.076324e-51 | 7.360087e-49 |
MsG0080048878.01 | MsG0580030010.01 | 0.816885 | 4.391103e-52 | 3.149745e-49 |
MsG0080048878.01 | MsG0680030313.01 | 0.821222 | 4.527545e-53 | 3.661610e-50 |
MsG0080048878.01 | MsG0680030356.01 | -0.826821 | 2.198444e-54 | 2.084446e-51 |
MsG0080048878.01 | MsG0680030515.01 | 0.841835 | 3.733881e-58 | 5.554754e-55 |
MsG0080048878.01 | MsG0680030516.01 | 0.824258 | 8.899317e-54 | 7.841653e-51 |
MsG0080048878.01 | MsG0680030555.01 | 0.844950 | 5.504226e-59 | 9.030939e-56 |
MsG0080048878.01 | MsG0680030627.01 | 0.801307 | 9.579689e-49 | 4.559804e-46 |
MsG0080048878.01 | MsG0680030784.01 | 0.819374 | 1.201162e-52 | 9.226011e-50 |
MsG0080048878.01 | MsG0680030858.01 | 0.836012 | 1.200466e-56 | 1.493517e-53 |
MsG0080048878.01 | MsG0680031010.01 | 0.855823 | 4.871647e-62 | 1.139207e-58 |
MsG0080048878.01 | MsG0680031344.01 | 0.808234 | 3.423749e-50 | 1.947174e-47 |
MsG0080048878.01 | MsG0680031469.01 | 0.824959 | 6.082575e-54 | 5.469393e-51 |
MsG0080048878.01 | MsG0680031621.01 | 0.811731 | 6.046768e-51 | 3.772125e-48 |
MsG0080048878.01 | MsG0680031640.01 | 0.817012 | 4.111028e-52 | 2.959335e-49 |
MsG0080048878.01 | MsG0680031716.01 | -0.828808 | 7.316823e-55 | 7.350911e-52 |
MsG0080048878.01 | MsG0680031826.01 | 0.818123 | 2.310103e-52 | 1.714221e-49 |
MsG0080048878.01 | MsG0680031939.01 | 0.876962 | 9.201088e-69 | 4.547383e-65 |
MsG0080048878.01 | MsG0680032378.01 | 0.841053 | 6.000941e-58 | 8.711594e-55 |
MsG0080048878.01 | MsG0680032473.01 | -0.848530 | 5.780198e-60 | 1.063961e-56 |
MsG0080048878.01 | MsG0680032827.01 | 0.857026 | 2.159651e-62 | 5.256394e-59 |
MsG0080048878.01 | MsG0680032830.01 | 0.875873 | 2.185364e-68 | 1.037353e-64 |
MsG0080048878.01 | MsG0680032832.01 | 0.832592 | 8.658155e-56 | 9.721781e-53 |
MsG0080048878.01 | MsG0680033377.01 | 0.880002 | 7.856529e-70 | 4.354382e-66 |
MsG0080048878.01 | MsG0680033459.01 | 0.803347 | 3.640509e-49 | 1.825092e-46 |
MsG0080048878.01 | MsG0680034064.01 | 0.843737 | 1.165437e-58 | 1.840670e-55 |
MsG0080048878.01 | MsG0680034766.01 | 0.803800 | 2.932011e-49 | 1.487184e-46 |
MsG0080048878.01 | MsG0680034767.01 | 0.819606 | 1.063022e-52 | 8.218525e-50 |
MsG0080048878.01 | MsG0680035731.01 | 0.803399 | 3.552264e-49 | 1.783313e-46 |
MsG0080048878.01 | MsG0680035765.01 | 0.849819 | 2.530573e-60 | 4.857394e-57 |
MsG0080048878.01 | MsG0680035859.01 | 0.883736 | 3.484104e-71 | 2.236575e-67 |
MsG0080048878.01 | MsG0680035877.01 | 0.839490 | 1.536408e-57 | 2.125151e-54 |
MsG0080048878.01 | MsG0780035960.01 | 0.875792 | 2.330105e-68 | 1.102682e-64 |
MsG0080048878.01 | MsG0780035965.01 | 0.824316 | 8.622616e-54 | 7.610376e-51 |
MsG0080048878.01 | MsG0780035992.01 | 0.829635 | 4.609710e-55 | 4.745131e-52 |
MsG0080048878.01 | MsG0780036347.01 | -0.807061 | 6.075179e-50 | 3.350752e-47 |
MsG0080048878.01 | MsG0780036385.01 | 0.848799 | 4.867362e-60 | 9.037732e-57 |
MsG0080048878.01 | MsG0780036443.01 | 0.816652 | 4.952659e-52 | 3.530060e-49 |
MsG0080048878.01 | MsG0780036486.01 | 0.843059 | 1.767901e-58 | 2.732878e-55 |
MsG0080048878.01 | MsG0780036585.01 | 0.828496 | 8.705583e-55 | 8.667913e-52 |
MsG0080048878.01 | MsG0780036593.01 | 0.806102 | 9.680179e-50 | 5.209317e-47 |
MsG0080048878.01 | MsG0780036659.01 | 0.872238 | 3.707263e-67 | 1.539924e-63 |
MsG0080048878.01 | MsG0780036792.01 | 0.813121 | 3.004278e-51 | 1.944913e-48 |
MsG0080048878.01 | MsG0780036803.01 | 0.832741 | 7.952845e-56 | 8.969722e-53 |
MsG0080048878.01 | MsG0780036979.01 | 0.807868 | 4.096540e-50 | 2.307298e-47 |
MsG0080048878.01 | MsG0780037093.01 | 0.825225 | 5.264867e-54 | 4.769953e-51 |
MsG0080048878.01 | MsG0780037157.01 | 0.857508 | 1.556355e-62 | 3.850363e-59 |
MsG0080048878.01 | MsG0780037330.01 | 0.815319 | 9.825944e-52 | 6.752360e-49 |
MsG0080048878.01 | MsG0780037341.01 | 0.825504 | 4.521933e-54 | 4.129259e-51 |
MsG0080048878.01 | MsG0780037395.01 | 0.830922 | 2.235393e-55 | 2.389061e-52 |
MsG0080048878.01 | MsG0780037399.01 | 0.802587 | 5.226096e-49 | 2.569755e-46 |
MsG0080048878.01 | MsG0780037701.01 | 0.812329 | 4.477635e-51 | 2.838771e-48 |
MsG0080048878.01 | MsG0780038056.01 | 0.847297 | 1.264189e-59 | 2.236603e-56 |
MsG0080048878.01 | MsG0780038348.01 | 0.849099 | 4.017815e-60 | 7.534310e-57 |
MsG0080048878.01 | MsG0780038351.01 | 0.825180 | 5.393435e-54 | 4.880497e-51 |
MsG0080048878.01 | MsG0780038584.01 | -0.867844 | 1.014302e-65 | 3.592137e-62 |
MsG0080048878.01 | MsG0780038616.01 | 0.821075 | 4.895767e-53 | 3.943311e-50 |
MsG0080048878.01 | MsG0780038744.01 | 0.839139 | 1.894659e-57 | 2.592399e-54 |
MsG0080048878.01 | MsG0780038784.01 | 0.851014 | 1.169501e-60 | 2.334618e-57 |
MsG0080048878.01 | MsG0780038846.01 | 0.822251 | 2.617396e-53 | 2.179104e-50 |
MsG0080048878.01 | MsG0780038847.01 | 0.809589 | 1.755778e-50 | 1.035080e-47 |
MsG0080048878.01 | MsG0780039161.01 | 0.809129 | 2.203841e-50 | 1.283360e-47 |
MsG0080048878.01 | MsG0780039369.01 | 0.816626 | 5.017772e-52 | 3.573840e-49 |
MsG0080048878.01 | MsG0780039429.01 | 0.837424 | 5.240789e-57 | 6.804674e-54 |
MsG0080048878.01 | MsG0780039439.01 | 0.812289 | 4.569279e-51 | 2.893685e-48 |
MsG0080048878.01 | MsG0780039675.01 | 0.828242 | 1.002616e-54 | 9.908708e-52 |
MsG0080048878.01 | MsG0780040277.01 | 0.830597 | 2.685520e-55 | 2.842577e-52 |
MsG0080048878.01 | MsG0780040278.01 | 0.808797 | 2.595718e-50 | 1.498102e-47 |
MsG0080048878.01 | MsG0780040284.01 | 0.841189 | 5.526863e-58 | 8.057510e-55 |
MsG0080048878.01 | MsG0780040295.01 | -0.809202 | 2.125945e-50 | 1.240429e-47 |
MsG0080048878.01 | MsG0780040388.01 | 0.862198 | 6.004663e-64 | 1.743973e-60 |
MsG0080048878.01 | MsG0780040422.01 | 0.809813 | 1.571945e-50 | 9.321688e-48 |
MsG0080048878.01 | MsG0780040430.01 | 0.803460 | 3.449076e-49 | 1.734229e-46 |
MsG0080048878.01 | MsG0780040763.01 | 0.861965 | 7.080377e-64 | 2.039392e-60 |
MsG0080048878.01 | MsG0780041091.01 | 0.834869 | 2.335835e-56 | 2.807909e-53 |
MsG0080048878.01 | MsG0780041137.01 | 0.826369 | 2.818149e-54 | 2.637797e-51 |
MsG0080048878.01 | MsG0780041138.01 | 0.817804 | 2.726635e-52 | 2.005780e-49 |
MsG0080048878.01 | MsG0780041391.01 | 0.823926 | 1.064426e-53 | 9.292626e-51 |
MsG0080048878.01 | MsG0780041435.01 | 0.803376 | 3.590889e-49 | 1.801565e-46 |
MsG0080048878.01 | MsG0780041440.01 | 0.818239 | 2.174575e-52 | 1.618716e-49 |
MsG0080048878.01 | MsG0780041634.01 | 0.817399 | 3.365535e-52 | 2.448353e-49 |
MsG0080048878.01 | MsG0780041673.01 | 0.829811 | 4.176008e-55 | 4.321696e-52 |
MsG0080048878.01 | MsG0780041692.01 | 0.810663 | 1.030677e-50 | 6.250352e-48 |
MsG0080048878.01 | MsG0780041729.01 | -0.856240 | 3.676617e-62 | 8.717018e-59 |
MsG0080048878.01 | MsG0780041747.01 | 0.889852 | 1.670442e-73 | 1.370917e-69 |
MsG0080048878.01 | MsG0880041861.01 | 0.810416 | 1.165049e-50 | 7.018573e-48 |
MsG0080048878.01 | MsG0880041947.01 | 0.857700 | 1.365125e-62 | 3.399125e-59 |
MsG0080048878.01 | MsG0880041954.01 | 0.808632 | 2.815960e-50 | 1.618162e-47 |
MsG0080048878.01 | MsG0880042022.01 | 0.835070 | 2.078562e-56 | 2.513538e-53 |
MsG0080048878.01 | MsG0880042026.01 | 0.821707 | 3.499371e-53 | 2.868605e-50 |
MsG0080048878.01 | MsG0880042044.01 | 0.841952 | 3.477822e-58 | 5.192802e-55 |
MsG0080048878.01 | MsG0880042086.01 | 0.808786 | 2.610216e-50 | 1.506021e-47 |
MsG0080048878.01 | MsG0880042890.01 | 0.812374 | 4.377424e-51 | 2.778451e-48 |
MsG0080048878.01 | MsG0880043024.01 | 0.873932 | 1.002014e-67 | 4.425943e-64 |
MsG0080048878.01 | MsG0880043029.01 | 0.841120 | 5.761069e-58 | 8.380821e-55 |
MsG0080048878.01 | MsG0880043174.01 | 0.818225 | 2.190542e-52 | 1.630032e-49 |
MsG0080048878.01 | MsG0880043277.01 | 0.828977 | 6.659874e-55 | 6.723671e-52 |
MsG0080048878.01 | MsG0880043965.01 | 0.818552 | 1.846922e-52 | 1.386847e-49 |
MsG0080048878.01 | MsG0880044005.01 | 0.883891 | 3.055752e-71 | 1.973293e-67 |
MsG0080048878.01 | MsG0880044036.01 | 0.852656 | 4.001870e-61 | 8.421001e-58 |
MsG0080048878.01 | MsG0880044101.01 | 0.822893 | 1.855952e-53 | 1.573664e-50 |
MsG0080048878.01 | MsG0880044142.01 | 0.856517 | 3.049624e-62 | 7.299189e-59 |
MsG0080048878.01 | MsG0880044392.01 | 0.859001 | 5.593930e-63 | 1.455369e-59 |
MsG0080048878.01 | MsG0880044487.01 | 0.851374 | 9.251489e-61 | 1.868925e-57 |
MsG0080048878.01 | MsG0880044691.01 | 0.840677 | 7.527709e-58 | 1.080239e-54 |
MsG0080048878.01 | MsG0880044704.01 | 0.814153 | 1.781450e-51 | 1.186110e-48 |
MsG0080048878.01 | MsG0880044985.01 | 0.837567 | 4.817832e-57 | 6.283177e-54 |
MsG0080048878.01 | MsG0880045010.01 | -0.857502 | 1.562207e-62 | 3.864167e-59 |
MsG0080048878.01 | MsG0880045017.01 | 0.803176 | 3.949336e-49 | 1.971355e-46 |
MsG0080048878.01 | MsG0880045327.01 | 0.812058 | 5.132633e-51 | 3.229905e-48 |
MsG0080048878.01 | MsG0880045444.01 | 0.819395 | 1.187969e-52 | 9.130287e-50 |
MsG0080048878.01 | MsG0880045533.01 | 0.805770 | 1.136981e-49 | 6.067028e-47 |
MsG0080048878.01 | MsG0880045558.01 | 0.816500 | 5.356377e-52 | 3.801688e-49 |
MsG0080048878.01 | MsG0880045722.01 | 0.836527 | 8.880262e-57 | 1.122044e-53 |
MsG0080048878.01 | MsG0880045992.01 | 0.828874 | 7.051619e-55 | 7.097782e-52 |
MsG0080048878.01 | MsG0880046054.01 | 0.838008 | 3.710570e-57 | 4.905695e-54 |
MsG0080048878.01 | MsG0880046334.01 | -0.804429 | 2.169763e-49 | 1.118428e-46 |
MsG0080048878.01 | MsG0880046382.01 | 0.862812 | 3.886601e-64 | 1.153429e-60 |
MsG0080048878.01 | MsG0880046516.01 | 0.807433 | 5.067141e-50 | 2.821934e-47 |
MsG0080048878.01 | MsG0880046569.01 | -0.806113 | 9.632117e-50 | 5.184857e-47 |
MsG0080048878.01 | MsG0880046699.01 | 0.803888 | 2.810943e-49 | 1.429094e-46 |
MsG0080048878.01 | MsG0880046765.01 | 0.870929 | 1.005929e-66 | 3.983864e-63 |
MsG0080048878.01 | MsG0880046867.01 | 0.861026 | 1.369786e-63 | 3.820820e-60 |
MsG0080048878.01 | MsG0880047046.01 | 0.806257 | 8.982985e-50 | 4.853386e-47 |
MsG0080048878.01 | MsG0880047052.01 | 0.825668 | 4.134578e-54 | 3.793473e-51 |
MsG0080048878.01 | MsG0880047154.01 | 0.814783 | 1.292332e-51 | 8.752273e-49 |
MsG0080048878.01 | MsG0880047394.01 | 0.832883 | 7.328590e-56 | 8.300778e-53 |
MsG0080048878.01 | MsG0880047422.01 | -0.889028 | 3.494255e-73 | 2.772450e-69 |
MsG0080048878.01 | MsG0880047442.01 | 0.811789 | 5.873452e-51 | 3.669470e-48 |
MsG0080048878.01 | MsG0880047481.01 | -0.835889 | 1.290252e-56 | 1.599239e-53 |
MsG0080048878.01 | MsG0880047538.01 | 0.863511 | 2.363388e-64 | 7.182979e-61 |
MsG0080048878.01 | MsG0880047587.01 | 0.804892 | 1.736521e-49 | 9.060193e-47 |
MsG0080048878.01 | MsG0880047656.01 | 0.864927 | 8.546699e-65 | 2.730023e-61 |
MsG0080048878.01 | MsG0880047657.01 | 0.821626 | 3.654222e-53 | 2.988459e-50 |
MsG0080048878.01 | MsG0880047696.01 | 0.862057 | 6.635224e-64 | 1.917339e-60 |
MsG0080048878.01 | MsG0880047703.01 | 0.888355 | 6.355430e-73 | 4.907259e-69 |
MsG0080048878.01 | MsG0880047754.01 | 0.828335 | 9.519328e-55 | 9.433166e-52 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048878.01.T01 | MTR_5g080700 | 91.917 | 532 | 37 | 2 | 67 | 596 | 94 | 621 | 0.0 | 918 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048878.01.T01 | AT3G14900 | 59.259 | 540 | 200 | 9 | 67 | 596 | 82 | 611 | 0.0 | 603 |
Find 4 sgRNAs with CRISPR-Local
Find 408 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
AGATGCAAAATCTTCAACAT+AGG | 0.516127 | contig505end:-16051 | MsG0080048878.01.T01:exon |
ATGATGATGATGCTGTTATG+AGG | 0.516884 | contig505end:+16100 | MsG0080048878.01.T01:intergenic |
TGTCCCAACCAACCTCAAAA+CGG | 0.571177 | contig505end:-15995 | MsG0080048878.01.T01:exon |
ATAGGAAGATGAACATGAGA+AGG | 0.594517 | contig505end:-16033 | MsG0080048878.01.T01:exon |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!! | TCTTAAGATAATTTAATTAT+GGG | + | contig505end:12851-12870 | MsG0080048878.01.T01:intergenic | 10.0% |
!!! | AAAAAGTTTAAATATGTTTT+TGG | + | contig505end:12875-12894 | MsG0080048878.01.T01:intergenic | 10.0% |
!!! | AATTTTTTGGATTTTTTTTA+GGG | - | contig505end:12659-12678 | MsG0080048878.01.T01:intron | 10.0% |
!!! | ATTACAATGAATTAATTTTT+TGG | - | contig505end:12646-12665 | MsG0080048878.01.T01:intron | 10.0% |
!!! | TAATTTTTTGGATTTTTTTT+AGG | - | contig505end:12658-12677 | MsG0080048878.01.T01:intron | 10.0% |
!!! | TAGTTTTCTTTTTTAAATTA+CGG | - | contig505end:11862-11881 | MsG0080048878.01.T01:intron | 10.0% |
!!! | TATTTTTAATGTTTTATTTG+AGG | - | contig505end:13823-13842 | MsG0080048878.01.T01:intron | 10.0% |
!! | AAAAAGGAAAATTTATTGTA+AGG | + | contig505end:13931-13950 | MsG0080048878.01.T01:intergenic | 15.0% |
!! | ATTTGTCAAATCAATATTTA+TGG | + | contig505end:12745-12764 | MsG0080048878.01.T01:intergenic | 15.0% |
!! | CTCTTAAGATAATTTAATTA+TGG | + | contig505end:12852-12871 | MsG0080048878.01.T01:intergenic | 15.0% |
!! | CTTTAATTCCTATTAAAATA+TGG | + | contig505end:11529-11548 | MsG0080048878.01.T01:intergenic | 15.0% |
!! | GTAGATATTTATAATAATTG+AGG | + | contig505end:11463-11482 | MsG0080048878.01.T01:intergenic | 15.0% |
!! | TACACTAAAAAGTAATATTA+TGG | + | contig505end:12698-12717 | MsG0080048878.01.T01:intergenic | 15.0% |
!! | TTTATTGAAAGGTTTAAAAA+AGG | + | contig505end:13947-13966 | MsG0080048878.01.T01:intergenic | 15.0% |
!!! | ATTGATTTGACAAATAAAAT+GGG | - | contig505end:12750-12769 | MsG0080048878.01.T01:intron | 15.0% |
!!! | TATTGATTTGACAAATAAAA+TGG | - | contig505end:12749-12768 | MsG0080048878.01.T01:intron | 15.0% |
!!! | TATTTAATTTTATTGGTGAT+TGG | - | contig505end:12611-12630 | MsG0080048878.01.T01:intron | 15.0% |
!! | AATTTATTGTAAGGTGAAAA+TGG | + | contig505end:13922-13941 | MsG0080048878.01.T01:intergenic | 20.0% |
!! | ACTTGAAATCTTTAATCATT+TGG | - | contig505end:11003-11022 | MsG0080048878.01.T01:CDS | 20.0% |
!! | AGAATAATATATGTTTAGAG+AGG | - | contig505end:11057-11076 | MsG0080048878.01.T01:CDS | 20.0% |
!! | ATTCTAATCAATTCATTAAG+TGG | + | contig505end:10948-10967 | MsG0080048878.01.T01:intergenic | 20.0% |
!! | ATTTATTGTAAGGTGAAAAT+GGG | + | contig505end:13921-13940 | MsG0080048878.01.T01:intergenic | 20.0% |
!! | CAAAAAAAAGAGATCTAATA+TGG | + | contig505end:12253-12272 | MsG0080048878.01.T01:intergenic | 20.0% |
!! | CAAATTCACTAAAAACAAAA+AGG | + | contig505end:13388-13407 | MsG0080048878.01.T01:intergenic | 20.0% |
!! | CCTATTAAAATATGGTAAAT+AGG | + | contig505end:11521-11540 | MsG0080048878.01.T01:intergenic | 20.0% |
!! | CGGAGTATATTATATTTATA+TGG | - | contig505end:10660-10679 | MsG0080048878.01.T01:CDS | 20.0% |
!! | GTAGATATTTATAACAATTG+AGG | + | contig505end:11671-11690 | MsG0080048878.01.T01:intergenic | 20.0% |
!! | GTTAATATATATACTTAGAG+AGG | - | contig505end:10702-10721 | MsG0080048878.01.T01:CDS | 20.0% |
!! | TCATTTCTTATGTGTATTTA+GGG | - | contig505end:12213-12232 | MsG0080048878.01.T01:intron | 20.0% |
!! | TCTAATTAAAATCCATTTCA+AGG | + | contig505end:11096-11115 | MsG0080048878.01.T01:intergenic | 20.0% |
!! | TGAAAAAAAGTCAAAATGTT+TGG | - | contig505end:15000-15019 | MsG0080048878.01.T01:intron | 20.0% |
!! | TTCATTTCTTATGTGTATTT+AGG | - | contig505end:12212-12231 | MsG0080048878.01.T01:intron | 20.0% |
!!! | AAACTAAGTTAAGGTATTTT+TGG | - | contig505end:14561-14580 | MsG0080048878.01.T01:intron | 20.0% |
!!! | AAAGAGAATTTGTTTAGTTA+TGG | - | contig505end:10815-10834 | MsG0080048878.01.T01:CDS | 20.0% |
!!! | AACTAAGTTAAGGTATTTTT+GGG | - | contig505end:14562-14581 | MsG0080048878.01.T01:intron | 20.0% |
!!! | ATGGTTTTAAATGAGAATTT+GGG | - | contig505end:10679-10698 | MsG0080048878.01.T01:CDS | 20.0% |
!!! | ATTTTACTTACATTTGTGTT+AGG | - | contig505end:15785-15804 | MsG0080048878.01.T01:CDS | 20.0% |
!!! | ATTTTACTTACTTTTGTGTT+AGG | - | contig505end:15844-15863 | MsG0080048878.01.T01:intron | 20.0% |
!!! | CATAATCTTTTTCAGAAAAT+AGG | + | contig505end:15884-15903 | MsG0080048878.01.T01:intergenic | 20.0% |
!!! | CATATTAGATCTCTTTTTTT+TGG | - | contig505end:12251-12270 | MsG0080048878.01.T01:intron | 20.0% |
!!! | CCTATTTACCATATTTTAAT+AGG | - | contig505end:11518-11537 | MsG0080048878.01.T01:CDS | 20.0% |
!!! | TATCTCATTTTTAAGTTAGA+CGG | - | contig505end:11337-11356 | MsG0080048878.01.T01:CDS | 20.0% |
!!! | TATGGTTTTAAATGAGAATT+TGG | - | contig505end:10678-10697 | MsG0080048878.01.T01:CDS | 20.0% |
!!! | TTAAAGAGATTGTTTTAACT+AGG | - | contig505end:15668-15687 | MsG0080048878.01.T01:intron | 20.0% |
!!! | TTTAATTATGGGATTCATTT+TGG | + | contig505end:12840-12859 | MsG0080048878.01.T01:intergenic | 20.0% |
!!! | TTTGTTTTTCTTTTGTTTGA+TGG | + | contig505end:13565-13584 | MsG0080048878.01.T01:intergenic | 20.0% |
! | AATCAATTCATTAAGTGGTT+TGG | + | contig505end:10943-10962 | MsG0080048878.01.T01:intergenic | 25.0% |
! | AATGCGAAATCAACTATTTA+GGG | - | contig505end:11273-11292 | MsG0080048878.01.T01:CDS | 25.0% |
! | AATTAAAGCTCAAAAGATGT+TGG | - | contig505end:11541-11560 | MsG0080048878.01.T01:CDS | 25.0% |
! | AGATTTGCATTTAGCATATT+AGG | + | contig505end:12923-12942 | MsG0080048878.01.T01:intergenic | 25.0% |
! | ATATAAGCAATTACCTCATT+TGG | - | contig505end:10479-10498 | MsG0080048878.01.T01:CDS | 25.0% |
! | ATGATACTGAGATTATAGAT+TGG | - | contig505end:15152-15171 | MsG0080048878.01.T01:intron | 25.0% |
! | ATGTATGTAACATTTCTTTC+TGG | - | contig505end:15956-15975 | MsG0080048878.01.T01:intron | 25.0% |
! | CAAGAATTCAGTTGTAAAAT+GGG | + | contig505end:13884-13903 | MsG0080048878.01.T01:intergenic | 25.0% |
! | CATGATAGAACATAAATTAC+TGG | - | contig505end:16102-16121 | MsG0080048878.01.T01:exon | 25.0% |
! | GCATTAAAAAAGTTATCTTG+TGG | + | contig505end:14809-14828 | MsG0080048878.01.T01:intergenic | 25.0% |
! | TAACTCATTCTACTAAACTT+AGG | + | contig505end:15825-15844 | MsG0080048878.01.T01:intergenic | 25.0% |
! | TGTATGTAACATTTCTTTCT+GGG | - | contig505end:15957-15976 | MsG0080048878.01.T01:intron | 25.0% |
! | TTCTCAATTTATGACTCAAT+GGG | - | contig505end:16036-16055 | MsG0080048878.01.T01:exon | 25.0% |
! | TTGAAAAGAGAAAAACCTTA+TGG | + | contig505end:13716-13735 | MsG0080048878.01.T01:intergenic | 25.0% |
!! | AAATATGTGTGCAGATTTTA+TGG | + | contig505end:12371-12390 | MsG0080048878.01.T01:intergenic | 25.0% |
!! | AAATGCTCTTAAAGTTTGTT+CGG | - | contig505end:16061-16080 | MsG0080048878.01.T01:exon | 25.0% |
!! | AGAAATAACCCATTTAAAGT+TGG | - | contig505end:12991-13010 | MsG0080048878.01.T01:intron | 25.0% |
!! | CAAAAACTTAGAGAATTTTC+TGG | - | contig505end:12093-12112 | MsG0080048878.01.T01:intron | 25.0% |
!! | CTTTTAAACGATATAAAGAG+AGG | - | contig505end:10177-10196 | MsG0080048878.01.T01:exon | 25.0% |
!! | GATAAAGATTGTAGTGATTT+TGG | - | contig505end:10623-10642 | MsG0080048878.01.T01:CDS | 25.0% |
!! | GGAATTATCCGATAATTTTT+CGG | - | contig505end:14262-14281 | MsG0080048878.01.T01:intron | 25.0% |
!! | TTAGTTCTTGCAATTGTATA+TGG | - | contig505end:11116-11135 | MsG0080048878.01.T01:CDS | 25.0% |
!! | TTTCATGTTATTGATGGTTT+GGG | - | contig505end:12534-12553 | MsG0080048878.01.T01:intron | 25.0% |
!!! | AAAATGTTTGGAGTTTCTTT+TGG | - | contig505end:15012-15031 | MsG0080048878.01.T01:intron | 25.0% |
!!! | AAATGTTTGGAGTTTCTTTT+GGG | - | contig505end:15013-15032 | MsG0080048878.01.T01:intron | 25.0% |
!!! | ATATGACATTATTTTTGTGC+AGG | - | contig505end:12812-12831 | MsG0080048878.01.T01:intron | 25.0% |
!!! | CTGAATACTTTTTGTTGAAA+TGG | - | contig505end:13852-13871 | MsG0080048878.01.T01:intron | 25.0% |
!!! | CTTTTCAATTTTTAGTACAC+TGG | - | contig505end:13728-13747 | MsG0080048878.01.T01:intron | 25.0% |
!!! | TGGTTTTAAATGAGAATTTG+GGG | - | contig505end:10680-10699 | MsG0080048878.01.T01:CDS | 25.0% |
!!! | TTCTTAATCTTTTTTCTCCA+CGG | + | contig505end:15583-15602 | MsG0080048878.01.T01:intergenic | 25.0% |
!!! | TTTTGGAGAATCAAAGAAAA+CGG | - | contig505end:10640-10659 | MsG0080048878.01.T01:CDS | 25.0% |
AAAATCCCAAATTCACTATC+AGG | + | contig505end:14039-14058 | MsG0080048877.01.T01:intergenic | 30.0% | |
AAGCAATAGAAAATATGGCA+AGG | - | contig505end:15401-15420 | MsG0080048878.01.T01:intron | 30.0% | |
ACAAGATTTCTGTAACTGAA+AGG | + | contig505end:15649-15668 | MsG0080048878.01.T01:intergenic | 30.0% | |
ACAGTTAACCTGATTATTGA+TGG | + | contig505end:12496-12515 | MsG0080048878.01.T01:intergenic | 30.0% | |
AGAGTGATGTTGAGAAAATT+AGG | - | contig505end:15752-15771 | MsG0080048878.01.T01:CDS | 30.0% | |
AGATGCAAAATCTTCAACAT+AGG | - | contig505end:10059-10078 | MsG0080048878.01.T01:exon | 30.0% | |
AGTTGGATCAAACTAAGTTA+AGG | - | contig505end:14552-14571 | MsG0080048878.01.T01:intron | 30.0% | |
ATATCATCATCTTCTTCATC+AGG | + | contig505end:15121-15140 | MsG0080048878.01.T01:intergenic | 30.0% | |
ATATGTTTAGAGAGGTTAAG+TGG | - | contig505end:11065-11084 | MsG0080048878.01.T01:CDS | 30.0% | |
ATGCACTTTCATGTTATTGA+TGG | - | contig505end:12528-12547 | MsG0080048878.01.T01:intron | 30.0% | |
ATTATCTTTCCTTCAAACGA+TGG | + | contig505end:13273-13292 | MsG0080048878.01.T01:intergenic | 30.0% | |
CAAATCCTCCGAAAAATTAT+CGG | + | contig505end:14273-14292 | MsG0080048878.01.T01:intergenic | 30.0% | |
CAATGCGAAATCAACTATTT+AGG | - | contig505end:11272-11291 | MsG0080048878.01.T01:CDS | 30.0% | |
CATATTAGAGATGCTTTACA+TGG | + | contig505end:12433-12452 | MsG0080048878.01.T01:intergenic | 30.0% | |
CCATACTTATACCAATCATA+CGG | + | contig505end:14368-14387 | MsG0080048878.01.T01:intergenic | 30.0% | |
GAAGAAGATGATGATATTGT+TGG | - | contig505end:15124-15143 | MsG0080048878.01.T01:intron | 30.0% | |
GACAAATAAAATGGGTGAAA+GGG | - | contig505end:12758-12777 | MsG0080048878.01.T01:intron | 30.0% | |
GACGATAATTAATGAAGTGA+AGG | - | contig505end:14463-14482 | MsG0080048878.01.T01:intron | 30.0% | |
GCAAGAATTCAGTTGTAAAA+TGG | + | contig505end:13885-13904 | MsG0080048878.01.T01:intergenic | 30.0% | |
GGTATAAGTATGGTGAATAT+GGG | - | contig505end:14375-14394 | MsG0080048878.01.T01:intron | 30.0% | |
GTAAACAGAGATTAGATAAG+TGG | - | contig505end:14669-14688 | MsG0080048878.01.T01:intron | 30.0% | |
GTTCTCAATTTATGACTCAA+TGG | - | contig505end:16035-16054 | MsG0080048878.01.T01:exon | 30.0% | |
TAAGGTTGTGTTTGGATTAA+GGG | + | contig505end:12041-12060 | MsG0080048878.01.T01:intergenic | 30.0% | |
TAATCAGGTTAACTGTTAAC+TGG | - | contig505end:12500-12519 | MsG0080048878.01.T01:intron | 30.0% | |
TACATCCATATACTAAAGAG+TGG | - | contig505end:15056-15075 | MsG0080048878.01.T01:intron | 30.0% | |
TATGGATGTAAAATTTGCAC+TGG | + | contig505end:15046-15065 | MsG0080048878.01.T01:intergenic | 30.0% | |
TCTCAATTTATGACTCAATG+GGG | - | contig505end:16037-16056 | MsG0080048878.01.T01:exon | 30.0% | |
TGACAAATAAAATGGGTGAA+AGG | - | contig505end:12757-12776 | MsG0080048878.01.T01:intron | 30.0% | |
TGAGATTATAGATTGGATTG+AGG | - | contig505end:15159-15178 | MsG0080048878.01.T01:intron | 30.0% | |
TGCAGAAGCAATAGAAAATA+TGG | - | contig505end:15396-15415 | MsG0080048878.01.T01:intron | 30.0% | |
TGGAAATGGTAATACAACAT+TGG | + | contig505end:12413-12432 | MsG0080048878.01.T01:intergenic | 30.0% | |
TGGTATAAGTATGGTGAATA+TGG | - | contig505end:14374-14393 | MsG0080048878.01.T01:intron | 30.0% | |
TGTCAGTTAGAAAATGATGA+TGG | - | contig505end:14872-14891 | MsG0080048878.01.T01:intron | 30.0% | |
TTCTTTAGCACTTGTTTGAT+CGG | - | contig505end:10878-10897 | MsG0080048878.01.T01:CDS | 30.0% | |
TTGAAATTTGATCAGGGTTT+GGG | + | contig505end:13971-13990 | MsG0080048878.01.T01:intergenic | 30.0% | |
! | AAAGTTCTCTTTTGTTGGAA+AGG | - | contig505end:10346-10365 | MsG0080048878.01.T01:exon | 30.0% |
! | ATTAGATAAGTGGACTTTGA+TGG | - | contig505end:14679-14698 | MsG0080048878.01.T01:intron | 30.0% |
! | CATCATTTTCTAACTGACAA+AGG | + | contig505end:14871-14890 | MsG0080048878.01.T01:intergenic | 30.0% |
! | CTAAACCTGATAGTGAATTT+GGG | - | contig505end:14031-14050 | MsG0080048878.01.T01:intron | 30.0% |
! | CTTTCATGTTATTGATGGTT+TGG | - | contig505end:12533-12552 | MsG0080048878.01.T01:intron | 30.0% |
! | GAGAATTTGTTTAGTTATGG+AGG | - | contig505end:10818-10837 | MsG0080048878.01.T01:CDS | 30.0% |
! | GTTGTTGTTCTTCTTCTTTA+GGG | + | contig505end:10553-10572 | MsG0080048878.01.T01:intergenic | 30.0% |
! | TCAACAAAGTTCTCTTTTGT+TGG | - | contig505end:10341-10360 | MsG0080048878.01.T01:exon | 30.0% |
! | TGTGTAGTAGAAGAGATTTT+GGG | - | contig505end:14076-14095 | MsG0080048878.01.T01:intron | 30.0% |
! | TGTTGTTGTTCTTCTTCTTT+AGG | + | contig505end:10554-10573 | MsG0080048878.01.T01:intergenic | 30.0% |
! | TTAGATAAGTGGACTTTGAT+GGG | - | contig505end:14680-14699 | MsG0080048878.01.T01:intron | 30.0% |
! | TTATAGGTTGAAAAACCCTA+GGG | - | contig505end:14233-14252 | MsG0080048878.01.T01:intron | 30.0% |
! | TTTAACTAGGCATGCAATTT+TGG | - | contig505end:15681-15700 | MsG0080048878.01.T01:intron | 30.0% |
! | TTTATAGGTTGAAAAACCCT+AGG | - | contig505end:14232-14251 | MsG0080048878.01.T01:intron | 30.0% |
! | TTTTCAAAACCATCGTTTGA+AGG | - | contig505end:13261-13280 | MsG0080048878.01.T01:intron | 30.0% |
!! | ATTATCCGATAATTTTTCGG+AGG | - | contig505end:14265-14284 | MsG0080048878.01.T01:intron | 30.0% |
!! | TTTCTTTTGTTTGATGGAGA+TGG | + | contig505end:13559-13578 | MsG0080048878.01.T01:intergenic | 30.0% |
!!! | ATTTTGATTCCCTTTGAGAT+AGG | - | contig505end:10303-10322 | MsG0080048878.01.T01:exon | 30.0% |
!!! | GGTATTTTTGGGTTTTCATT+AGG | - | contig505end:14573-14592 | MsG0080048878.01.T01:intron | 30.0% |
!!! | TAGAAGGTAATGCTGATTTT+CGG | - | contig505end:14154-14173 | MsG0080048878.01.T01:intron | 30.0% |
!!! | TTGCTGAGAGTTTGTTTTAT+AGG | - | contig505end:14217-14236 | MsG0080048878.01.T01:intron | 30.0% |
AAAACTCGATATCCGATCTA+AGG | + | contig505end:13193-13212 | MsG0080048877.01.T01:intergenic | 35.0% | |
AAAGAACAACCGATTGAGAA+CGG | + | contig505end:11175-11194 | MsG0080048877.01.T01:intergenic | 35.0% | |
AAATTGCAACCGTTCTCAAT+CGG | - | contig505end:11163-11182 | MsG0080048878.01.T01:CDS | 35.0% | |
AACACACCCTAAGTGAATAT+CGG | + | contig505end:11804-11823 | MsG0080048878.01.T01:intergenic | 35.0% | |
AACATTGGTGCATGTTCTTA+GGG | + | contig505end:12398-12417 | MsG0080048878.01.T01:intergenic | 35.0% | |
AATCAGTAGGTTACCAAATG+AGG | + | contig505end:10495-10514 | MsG0080048878.01.T01:intergenic | 35.0% | |
ACCATTGGACCAACTTTAAA+TGG | + | contig505end:13003-13022 | MsG0080048878.01.T01:intergenic | 35.0% | |
ACTATTGAACTAACCAAGTG+AGG | - | contig505end:10236-10255 | MsG0080048878.01.T01:exon | 35.0% | |
ACTTGTGAAGGTGAATCAAA+AGG | - | contig505end:14934-14953 | MsG0080048878.01.T01:intron | 35.0% | |
ACTTTCAAATACAACGACGT+AGG | - | contig505end:13300-13319 | MsG0080048878.01.T01:intron | 35.0% | |
AGAAGGATGATCCGAATTTA+AGG | - | contig505end:14339-14358 | MsG0080048878.01.T01:intron | 35.0% | |
AGAGATGCTTTACATGGAAA+TGG | + | contig505end:12427-12446 | MsG0080048878.01.T01:intergenic | 35.0% | |
ATACAGAGAGAAAAGTGGAA+AGG | + | contig505end:10529-10548 | MsG0080048878.01.T01:intergenic | 35.0% | |
ATAGATTGGATTGAGGATGA+AGG | - | contig505end:15166-15185 | MsG0080048878.01.T01:intron | 35.0% | |
ATAGGAAGATGAACATGAGA+AGG | - | contig505end:10077-10096 | MsG0080048878.01.T01:exon | 35.0% | |
ATATTCACTTAGGGTGTGTT+TGG | - | contig505end:11804-11823 | MsG0080048878.01.T01:CDS | 35.0% | |
ATGCAAACCGATATTCACTT+AGG | - | contig505end:11794-11813 | MsG0080048878.01.T01:CDS | 35.0% | |
ATTCCTTATGGAGCCAATTT+CGG | - | contig505end:13081-13100 | MsG0080048878.01.T01:intron | 35.0% | |
CAACTGTTATATACCTCACT+TGG | + | contig505end:10252-10271 | MsG0080048878.01.T01:intergenic | 35.0% | |
CAGTAAGAAACTTCACCATA+AGG | - | contig505end:13698-13717 | MsG0080048878.01.T01:intron | 35.0% | |
CATGTTTGTCATTAACACTG+TGG | - | contig505end:15981-16000 | MsG0080048878.01.T01:exon | 35.0% | |
CCATTGGACCAACTTTAAAT+GGG | + | contig505end:13002-13021 | MsG0080048878.01.T01:intergenic | 35.0% | |
CCGTATGATTGGTATAAGTA+TGG | - | contig505end:14365-14384 | MsG0080048878.01.T01:intron | 35.0% | |
CTAAGGTTGTGTTTGGATTA+AGG | + | contig505end:12042-12061 | MsG0080048878.01.T01:intergenic | 35.0% | |
CTCAATTTATGACTCAATGG+GGG | - | contig505end:16038-16057 | MsG0080048878.01.T01:exon | 35.0% | |
GAATAGTGTCCTATCTCAAA+GGG | + | contig505end:10315-10334 | MsG0080048878.01.T01:intergenic | 35.0% | |
GAGATGGAAGAAACTCATTT+GGG | - | contig505end:12185-12204 | MsG0080048878.01.T01:intron | 35.0% | |
GAGGTATATAACAGTTGTTG+TGG | - | contig505end:10255-10274 | MsG0080048878.01.T01:exon | 35.0% | |
GATCATGACCATCAATAATC+AGG | - | contig505end:12485-12504 | MsG0080048878.01.T01:intron | 35.0% | |
GGAGATTGAGAAATCTGAAA+TGG | - | contig505end:14502-14521 | MsG0080048878.01.T01:intron | 35.0% | |
GTGAAGTTTCTTACTGTTTC+CGG | + | contig505end:13694-13713 | MsG0080048878.01.T01:intergenic | 35.0% | |
GTTCTTGCAATTGTATATGG+AGG | - | contig505end:11119-11138 | MsG0080048878.01.T01:CDS | 35.0% | |
GTTGAAATTTGATCAGGGTT+TGG | + | contig505end:13972-13991 | MsG0080048878.01.T01:intergenic | 35.0% | |
GTTGAGACGTGTACTTATTA+TGG | - | contig505end:14899-14918 | MsG0080048878.01.T01:intron | 35.0% | |
GTTTAGTTATGGAGGTAAAG+AGG | - | contig505end:10826-10845 | MsG0080048878.01.T01:CDS | 35.0% | |
TAAGAAGCAAATGATGACAG+CGG | - | contig505end:15453-15472 | MsG0080048878.01.T01:intron | 35.0% | |
TAAGTGGTTGATCCTTGAAA+TGG | - | contig505end:11081-11100 | MsG0080048878.01.T01:CDS | 35.0% | |
TCATACGGATGCCTTAAATT+CGG | + | contig505end:14353-14372 | MsG0080048878.01.T01:intergenic | 35.0% | |
TCCATATACTAAAGAGTGGA+AGG | - | contig505end:15060-15079 | MsG0080048878.01.T01:intron | 35.0% | |
TGAAATGAGCGAGTAAAACA+TGG | - | contig505end:10725-10744 | MsG0080048878.01.T01:CDS | 35.0% | |
TGAATAGTGTCCTATCTCAA+AGG | + | contig505end:10316-10335 | MsG0080048878.01.T01:intergenic | 35.0% | |
TGAGATGGAAGAAACTCATT+TGG | - | contig505end:12184-12203 | MsG0080048878.01.T01:intron | 35.0% | |
TGCAAACCGATATTCACTTA+GGG | - | contig505end:11795-11814 | MsG0080048878.01.T01:CDS | 35.0% | |
TGCTAAATGCAAATCTCCAA+TGG | - | contig505end:12927-12946 | MsG0080048878.01.T01:intron | 35.0% | |
TGGATTGTGTAAACTTGTGA+AGG | - | contig505end:14922-14941 | MsG0080048878.01.T01:intron | 35.0% | |
TGTGTTTGGATTAAGGGTTT+AGG | + | contig505end:12035-12054 | MsG0080048878.01.T01:intergenic | 35.0% | |
TTATGGACATGTTGACACTA+AGG | + | contig505end:12728-12747 | MsG0080048878.01.T01:intergenic | 35.0% | |
! | ACTTGTTGCAATAGCTTCTT+TGG | - | contig505end:10439-10458 | MsG0080048878.01.T01:CDS | 35.0% |
! | AGGGTTTGGGATTTATTGAA+AGG | + | contig505end:13958-13977 | MsG0080048878.01.T01:intergenic | 35.0% |
! | ATGATGATGATGCTGTTATG+AGG | + | contig505end:10013-10032 | MsG0080048878.01.T01:intergenic | 35.0% |
! | ATTTAAGGCATCCGTATGAT+TGG | - | contig505end:14354-14373 | MsG0080048878.01.T01:intron | 35.0% |
! | ATTTGGGAAATGAAGAGCAT+CGG | - | contig505end:10379-10398 | MsG0080048878.01.T01:exon | 35.0% |
! | CAACAAGTGTTTTGTCTCAT+AGG | + | contig505end:10427-10446 | MsG0080048878.01.T01:intergenic | 35.0% |
! | GAAAATGGGTTTAAGGTTCT+AGG | + | contig505end:13907-13926 | MsG0080048878.01.T01:intergenic | 35.0% |
! | GCTAAACCTGATAGTGAATT+TGG | - | contig505end:14030-14049 | MsG0080048878.01.T01:intron | 35.0% |
! | GGTTAGTTCAATAGTTTCCA+TGG | + | contig505end:10231-10250 | MsG0080048878.01.T01:intergenic | 35.0% |
! | GTAAGGTGAAAATGGGTTTA+AGG | + | contig505end:13914-13933 | MsG0080048878.01.T01:intergenic | 35.0% |
! | GTGTGTAGTAGAAGAGATTT+TGG | - | contig505end:14075-14094 | MsG0080048878.01.T01:intron | 35.0% |
! | GTGTTTTGCATGTAAAAAGC+TGG | - | contig505end:10141-10160 | MsG0080048878.01.T01:exon | 35.0% |
! | TATAGGTTGAAAAACCCTAG+GGG | - | contig505end:14234-14253 | MsG0080048878.01.T01:intron | 35.0% |
! | TCTCTTTTGTTGGAAAGGAA+GGG | - | contig505end:10351-10370 | MsG0080048878.01.T01:exon | 35.0% |
! | TTCTCTTTTGTTGGAAAGGA+AGG | - | contig505end:10350-10369 | MsG0080048878.01.T01:exon | 35.0% |
! | TTTTCATTAGGCATCCAAAG+TGG | - | contig505end:14585-14604 | MsG0080048878.01.T01:intron | 35.0% |
!! | AAGAGATTTTGGGTGTTATG+CGG | - | contig505end:14086-14105 | MsG0080048878.01.T01:intron | 35.0% |
!! | CGATTTTGTTATCGTTCCAT+TGG | + | contig505end:12946-12965 | MsG0080048878.01.T01:intergenic | 35.0% |
!!! | AAAGGCTTTTGTTGATGATG+TGG | - | contig505end:14952-14971 | MsG0080048878.01.T01:intron | 35.0% |
!!! | AACTTTTTGAGTAGTTGCCA+TGG | - | contig505end:10211-10230 | MsG0080048878.01.T01:exon | 35.0% |
AAAATCCCAAGTCAACCACT+AGG | + | contig505end:13035-13054 | MsG0080048877.01.T01:intergenic | 40.0% | |
AACAGTTGTTGTGGATAGAG+AGG | - | contig505end:10264-10283 | MsG0080048878.01.T01:exon | 40.0% | |
AACTAGTTGTGGGTTCACTA+AGG | + | contig505end:12059-12078 | MsG0080048878.01.T01:intergenic | 40.0% | |
AACTTGTGACTGATACTACG+AGG | + | contig505end:13612-13631 | MsG0080048878.01.T01:intergenic | 40.0% | |
AAGTGAAGGATCATGAAGAG+TGG | - | contig505end:14477-14496 | MsG0080048878.01.T01:intron | 40.0% | |
AATGGTGAGGTTTATGGAGA+AGG | - | contig505end:14322-14341 | MsG0080048878.01.T01:intron | 40.0% | |
ACAGTTGTTGTGGATAGAGA+GGG | - | contig505end:10265-10284 | MsG0080048878.01.T01:exon | 40.0% | |
ACTATCAGGTTTAGCGTTTC+GGG | + | contig505end:14025-14044 | MsG0080048878.01.T01:intergenic | 40.0% | |
ACTTGTGACTGATACTACGA+GGG | + | contig505end:13611-13630 | MsG0080048878.01.T01:intergenic | 40.0% | |
AGAATGAGAGATTCCATGTC+AGG | - | contig505end:12296-12315 | MsG0080048878.01.T01:intron | 40.0% | |
AGATGGTAAATTCCATGCCA+TGG | - | contig505end:15327-15346 | MsG0080048878.01.T01:CDS | 40.0% | |
AGTGAAGGATCATGAAGAGT+GGG | - | contig505end:14478-14497 | MsG0080048878.01.T01:intron | 40.0% | |
ATGGACATTAGTTAGTGAGG+TGG | - | contig505end:14634-14653 | MsG0080048878.01.T01:intron | 40.0% | |
ATTAAGGGTTTAGGAGAGGA+AGG | + | contig505end:12026-12045 | MsG0080048878.01.T01:intergenic | 40.0% | |
ATTGAGGATGAAGGTAGTGA+CGG | - | contig505end:15175-15194 | MsG0080048878.01.T01:intron | 40.0% | |
CAACATTGGTGCATGTTCTT+AGG | + | contig505end:12399-12418 | MsG0080048878.01.T01:intergenic | 40.0% | |
CAATAGCTTCTTTGGTTGGA+AGG | - | contig505end:10447-10466 | MsG0080048878.01.T01:CDS | 40.0% | |
CACTATCAGGTTTAGCGTTT+CGG | + | contig505end:14026-14045 | MsG0080048878.01.T01:intergenic | 40.0% | |
CGCTTGACATACACAATATC+AGG | + | contig505end:14761-14780 | MsG0080048878.01.T01:intergenic | 40.0% | |
CTTTGGTTGGAAGGAATGAA+AGG | - | contig505end:10456-10475 | MsG0080048878.01.T01:CDS | 40.0% | |
GAAAGGAAGGGCAATGATTT+GGG | - | contig505end:10363-10382 | MsG0080048878.01.T01:exon | 40.0% | |
GACATGGAAGAAAGCAAAGA+TGG | - | contig505end:15310-15329 | MsG0080048878.01.T01:intron | 40.0% | |
GAGACGTGTACTTATTATGG+TGG | - | contig505end:14902-14921 | MsG0080048878.01.T01:intron | 40.0% | |
GCAATGGACATTAGTTAGTG+AGG | - | contig505end:14631-14650 | MsG0080048878.01.T01:intron | 40.0% | |
GCACAGTTGTTCAAGATAGT+GGG | - | contig505end:10779-10798 | MsG0080048878.01.T01:CDS | 40.0% | |
GCCTTCCACTCTTTAGTATA+TGG | + | contig505end:15064-15083 | MsG0080048878.01.T01:intergenic | 40.0% | |
GGCAACTACTCAAAAAGTTG+AGG | + | contig505end:10210-10229 | MsG0080048878.01.T01:intergenic | 40.0% | |
GGTAGTGTTACAAAGTAACG+TGG | - | contig505end:12272-12291 | MsG0080048878.01.T01:intron | 40.0% | |
GTGGGGTTGAAATTTGATCA+GGG | + | contig505end:13977-13996 | MsG0080048878.01.T01:intergenic | 40.0% | |
GTTGCAATAGCTTCTTTGGT+TGG | - | contig505end:10443-10462 | MsG0080048878.01.T01:CDS | 40.0% | |
TAAAGAGTGGAAGGCTAAGT+TGG | - | contig505end:15069-15088 | MsG0080048878.01.T01:intron | 40.0% | |
TAGTGAACCCACAACTAGTT+GGG | - | contig505end:12059-12078 | MsG0080048878.01.T01:intron | 40.0% | |
TATTGTGTATGTCAAGCGTC+CGG | - | contig505end:14763-14782 | MsG0080048878.01.T01:intron | 40.0% | |
TCTTCTGGTGGTAGATTAGA+AGG | - | contig505end:14138-14157 | MsG0080048878.01.T01:intron | 40.0% | |
TGACGATGATGATCAAGAGA+TGG | - | contig505end:15228-15247 | MsG0080048878.01.T01:intron | 40.0% | |
TGATCGAATGGTGAGGTTTA+TGG | - | contig505end:14316-14335 | MsG0080048878.01.T01:intron | 40.0% | |
TGCACAGTTGTTCAAGATAG+TGG | - | contig505end:10778-10797 | MsG0080048878.01.T01:CDS | 40.0% | |
TGCAGACCAAGATCTAGTTA+CGG | - | contig505end:15288-15307 | MsG0080048878.01.T01:intron | 40.0% | |
TGGGAAAAAAGTGAAGCAGT+TGG | - | contig505end:14535-14554 | MsG0080048878.01.T01:intron | 40.0% | |
TGTGGGGTTGAAATTTGATC+AGG | + | contig505end:13978-13997 | MsG0080048878.01.T01:intergenic | 40.0% | |
TGTGTTTGGAAGGAGAGTTT+AGG | - | contig505end:11818-11837 | MsG0080048878.01.T01:CDS | 40.0% | |
TTAAGGGTTTAGGAGAGGAA+GGG | + | contig505end:12025-12044 | MsG0080048878.01.T01:intergenic | 40.0% | |
TTAGTGAACCCACAACTAGT+TGG | - | contig505end:12058-12077 | MsG0080048878.01.T01:intron | 40.0% | |
TTGCATGTAAAAAGCTGGTG+AGG | - | contig505end:10146-10165 | MsG0080048878.01.T01:exon | 40.0% | |
TTGGATATGATCGAATGGTG+AGG | - | contig505end:14309-14328 | MsG0080048878.01.T01:intron | 40.0% | |
TTGGATTAAGGGTTTAGGAG+AGG | + | contig505end:12030-12049 | MsG0080048878.01.T01:intergenic | 40.0% | |
TTGTTTGATGGAGATGGAAC+TGG | + | contig505end:13553-13572 | MsG0080048878.01.T01:intergenic | 40.0% | |
! | ACTAGGCATGCAATTTTGGA+TGG | - | contig505end:15685-15704 | MsG0080048878.01.T01:intron | 40.0% |
! | AGAAGAGTGGAAGTATGTTG+GGG | - | contig505end:15552-15571 | MsG0080048878.01.T01:intron | 40.0% |
! | CAAGTGTTTTGTCTCATAGG+TGG | + | contig505end:10424-10443 | MsG0080048878.01.T01:intergenic | 40.0% |
! | CAGAAGAGTGGAAGTATGTT+GGG | - | contig505end:15551-15570 | MsG0080048878.01.T01:intron | 40.0% |
! | CCCATTTAAAGTTGGTCCAA+TGG | - | contig505end:12999-13018 | MsG0080048878.01.T01:intron | 40.0% |
! | CTCATAGGTGGATTTCACTT+TGG | + | contig505end:10412-10431 | MsG0080048878.01.T01:intergenic | 40.0% |
! | GCAATTTTGGATGGTGACAT+TGG | - | contig505end:15694-15713 | MsG0080048878.01.T01:intron | 40.0% |
! | GCAGATTTTATGGCTAAGGA+AGG | + | contig505end:12361-12380 | MsG0080048878.01.T01:intergenic | 40.0% |
! | GTGTGCAGATTTTATGGCTA+AGG | + | contig505end:12365-12384 | MsG0080048878.01.T01:intergenic | 40.0% |
! | TGGTCTTGGATATGATCGAA+TGG | - | contig505end:14304-14323 | MsG0080048878.01.T01:intron | 40.0% |
! | TTAATGACCTAGTGCTGAGA+TGG | - | contig505end:12169-12188 | MsG0080048878.01.T01:intron | 40.0% |
! | TTTTGGATGGTGACATTGGT+AGG | - | contig505end:15698-15717 | MsG0080048878.01.T01:intron | 40.0% |
!! | AGAGATTTTGGGTGTTATGC+GGG | - | contig505end:14087-14106 | MsG0080048878.01.T01:intron | 40.0% |
!! | GGAGACGAAACTGTTTTAAG+AGG | - | contig505end:15508-15527 | MsG0080048878.01.T01:intron | 40.0% |
!! | GGATTAGTCGATCCTTAGAT+CGG | - | contig505end:13178-13197 | MsG0080048878.01.T01:intron | 40.0% |
!! | GGCAAGTTGATAGAATCAGT+AGG | + | contig505end:10508-10527 | MsG0080048878.01.T01:intergenic | 40.0% |
!! | TATTGATGGTTTGGGTTGTC+TGG | - | contig505end:12542-12561 | MsG0080048878.01.T01:intron | 40.0% |
!!! | CTGAAATGGCTGCTGATTTT+GGG | - | contig505end:14516-14535 | MsG0080048878.01.T01:intron | 40.0% |
!!! | GTAATGCTGATTTTCGGAGA+CGG | - | contig505end:14160-14179 | MsG0080048878.01.T01:intron | 40.0% |
!!! | TAGTGGTTGACTTGGGATTT+TGG | - | contig505end:13034-13053 | MsG0080048878.01.T01:intron | 40.0% |
!!! | TCTGAAATGGCTGCTGATTT+TGG | - | contig505end:14515-14534 | MsG0080048878.01.T01:intron | 40.0% |
AAGGAGAGTTTAGGAGAGGA+AGG | - | contig505end:11827-11846 | MsG0080048878.01.T01:CDS | 45.0% | |
AAGTTGGAAGAGATGGAGCT+TGG | - | contig505end:15085-15104 | MsG0080048878.01.T01:intron | 45.0% | |
ACAATCCCACGCCAAGAATA+CGG | + | contig505end:14401-14420 | MsG0080048878.01.T01:intergenic | 45.0% | |
ACTAATGTCCATTGCTGCCA+CGG | + | contig505end:14626-14645 | MsG0080048878.01.T01:intergenic | 45.0% | |
AGGAGAGTTTAGGAGAGGAA+GGG | - | contig505end:11828-11847 | MsG0080048878.01.T01:CDS | 45.0% | |
AGGGCATACAGAGAGAAAAG+TGG | + | contig505end:10534-10553 | MsG0080048878.01.T01:intergenic | 45.0% | |
AGTTCCGAAACTCTCCACTT+TGG | + | contig505end:14602-14621 | MsG0080048878.01.T01:intergenic | 45.0% | |
ATCCACGACTTGTGCTATAG+CGG | + | contig505end:10983-11002 | MsG0080048878.01.T01:intergenic | 45.0% | |
ATGAGAGATTCCATGTCAGG+TGG | - | contig505end:12299-12318 | MsG0080048878.01.T01:intron | 45.0% | |
CCAACATACTTCCACTCTTC+TGG | + | contig505end:15553-15572 | MsG0080048878.01.T01:intergenic | 45.0% | |
CCAAGATCTAGTTACGGACA+TGG | - | contig505end:15294-15313 | MsG0080048878.01.T01:intron | 45.0% | |
CCATGTCCGTAACTAGATCT+TGG | + | contig505end:15297-15316 | MsG0080048878.01.T01:intergenic | 45.0% | |
CGATGATGATCAAGAGATGG+AGG | - | contig505end:15231-15250 | MsG0080048878.01.T01:intron | 45.0% | |
CTAAGGAAGGATCACATGCA+AGG | + | contig505end:12348-12367 | MsG0080048878.01.T01:intergenic | 45.0% | |
CTGATACTACGAGGGAAAAG+TGG | + | contig505end:13603-13622 | MsG0080048878.01.T01:intergenic | 45.0% | |
CTTATGGAGCCAATTTCGGT+GGG | - | contig505end:13085-13104 | MsG0080048878.01.T01:intron | 45.0% | |
GAAACAACGCGTTCAGTAGA+CGG | - | contig505end:15487-15506 | MsG0080048878.01.T01:intron | 45.0% | |
GACGGTGATGCTGAATTTGA+TGG | - | contig505end:15193-15212 | MsG0080048878.01.T01:intron | 45.0% | |
GCATCCAAAGTGGAGAGTTT+CGG | - | contig505end:14595-14614 | MsG0080048878.01.T01:intron | 45.0% | |
GCCATGGAAGAAGATGTGAA+GGG | - | contig505end:15343-15362 | MsG0080048878.01.T01:intron | 45.0% | |
GGAAAGGAAGGGCAATGATT+TGG | - | contig505end:10362-10381 | MsG0080048878.01.T01:exon | 45.0% | |
GGGTTCACTAAGGTTGTGTT+TGG | + | contig505end:12049-12068 | MsG0080048878.01.T01:intergenic | 45.0% | |
GTGAATATGGGCCGTATTCT+TGG | - | contig505end:14387-14406 | MsG0080048878.01.T01:intron | 45.0% | |
GTTTCTTCCATCTCAGCACT+AGG | + | contig505end:12179-12198 | MsG0080048878.01.T01:intergenic | 45.0% | |
TCAAACCTACACTGGAACAC+CGG | + | contig505end:14785-14804 | MsG0080048878.01.T01:intergenic | 45.0% | |
TCACATCTTCTTCCATGGCA+TGG | + | contig505end:15342-15361 | MsG0080048878.01.T01:intergenic | 45.0% | |
TCACTTAGGGTGTGTTTGGA+AGG | - | contig505end:11808-11827 | MsG0080048878.01.T01:CDS | 45.0% | |
TCCATTTCTTGATCCTCGCA+CGG | - | contig505end:14835-14854 | MsG0080048878.01.T01:intron | 45.0% | |
TGATGATCAAGAGATGGAGG+AGG | - | contig505end:15234-15253 | MsG0080048878.01.T01:intron | 45.0% | |
TGCCATGGAAGAAGATGTGA+AGG | - | contig505end:15342-15361 | MsG0080048878.01.T01:intron | 45.0% | |
TGTCCCAACCAACCTCAAAA+CGG | - | contig505end:10115-10134 | MsG0080048878.01.T01:exon | 45.0% | |
TTGGAAGGAGAGTTTAGGAG+AGG | - | contig505end:11823-11842 | MsG0080048878.01.T01:CDS | 45.0% | |
TTTAAGAGGAAAGCGAGCGA+AGG | - | contig505end:15522-15541 | MsG0080048878.01.T01:intron | 45.0% | |
! | AGCTTTGCTCTGGCTTAGAA+CGG | - | contig505end:13121-13140 | MsG0080048878.01.T01:intron | 45.0% |
! | CCAGAAGAGTGGAAGTATGT+TGG | - | contig505end:15550-15569 | MsG0080048878.01.T01:intron | 45.0% |
! | GAAGGCTAAGTTGGAAGAGA+TGG | - | contig505end:15078-15097 | MsG0080048878.01.T01:intron | 45.0% |
! | GCAAAACACTCACCGTTTTG+AGG | + | contig505end:10130-10149 | MsG0080048878.01.T01:intergenic | 45.0% |
! | GGACTTTGATGGGTAGACTT+GGG | - | contig505end:14690-14709 | MsG0080048878.01.T01:intron | 45.0% |
! | TATTTCTGCGAGCAGCTGTT+CGG | - | contig505end:15623-15642 | MsG0080048878.01.T01:intron | 45.0% |
! | TCAAGGTGCTCGATTCCTTA+TGG | - | contig505end:13069-13088 | MsG0080048878.01.T01:intron | 45.0% |
! | TGAGTTGAGTTCAGTGTGAC+TGG | + | contig505end:13635-13654 | MsG0080048878.01.T01:intergenic | 45.0% |
! | TGGACTTTGATGGGTAGACT+TGG | - | contig505end:14689-14708 | MsG0080048878.01.T01:intron | 45.0% |
! | TTTGGAGTGTGTTCCTCTCA+AGG | - | contig505end:13052-13071 | MsG0080048878.01.T01:intron | 45.0% |
!! | CAGTTGTTCAAGATAGTGGG+CGG | - | contig505end:10782-10801 | MsG0080048878.01.T01:CDS | 45.0% |
!! | GAGGATTTGTTGCAGCAGAT+TGG | - | contig505end:14284-14303 | MsG0080048878.01.T01:intron | 45.0% |
!! | TTGTTGCAGCAGATTGGTCT+TGG | - | contig505end:14290-14309 | MsG0080048878.01.T01:intron | 45.0% |
!!! | AACACTCACCGTTTTGAGGT+TGG | + | contig505end:10126-10145 | MsG0080048878.01.T01:intergenic | 45.0% |
!!! | TCACCGTTTTGAGGTTGGTT+GGG | + | contig505end:10121-10140 | MsG0080048878.01.T01:intergenic | 45.0% |
!!! | TTTCAATTATTTAATTTTAT+TGG | - | contig505end:12604-12623 | MsG0080048878.01.T01:intron | 5.0% |
AAATGATGACAGCGGAGGCA+GGG | - | contig505end:15461-15480 | MsG0080048878.01.T01:intron | 50.0% | |
AAGGAATCGAGCACCTTGAG+AGG | + | contig505end:13068-13087 | MsG0080048878.01.T01:intergenic | 50.0% | |
AATCTCACCGCCCATTTGTC+GGG | + | contig505end:13149-13168 | MsG0080048878.01.T01:intergenic | 50.0% | |
ACTAGGCCAACGTCAACCAT+TGG | + | contig505end:13018-13037 | MsG0080048878.01.T01:intergenic | 50.0% | |
AGAAGATGTGAAGGGCTGGA+AGG | - | contig505end:15351-15370 | MsG0080048878.01.T01:intron | 50.0% | |
AGAGATTCCATGTCAGGTGG+AGG | - | contig505end:12302-12321 | MsG0080048878.01.T01:intron | 50.0% | |
AGAGTTTAGGAGAGGAAGGG+AGG | - | contig505end:11831-11850 | MsG0080048878.01.T01:CDS | 50.0% | |
AGCCAGAGCAAAGCTCTGTA+TGG | + | contig505end:13116-13135 | MsG0080048878.01.T01:intergenic | 50.0% | |
AGGTAATCTTGTTCCGTGCG+AGG | + | contig505end:14851-14870 | MsG0080048878.01.T01:intergenic | 50.0% | |
AGTGAGGTGGTACTTGAAGC+TGG | - | contig505end:14647-14666 | MsG0080048878.01.T01:intron | 50.0% | |
AGTTTAGGAGAGGAAGGGAG+GGG | - | contig505end:11833-11852 | MsG0080048878.01.T01:CDS | 50.0% | |
ATGGACTTGCCCACCGAAAT+TGG | + | contig505end:13097-13116 | MsG0080048878.01.T01:intergenic | 50.0% | |
CAATCTCACCGCCCATTTGT+CGG | + | contig505end:13150-13169 | MsG0080048878.01.T01:intergenic | 50.0% | |
CCTTATGGAGCCAATTTCGG+TGG | - | contig505end:13084-13103 | MsG0080048878.01.T01:intron | 50.0% | |
CTACGAGGGAAAAGTGGTAG+CGG | + | contig505end:13597-13616 | MsG0080048878.01.T01:intergenic | 50.0% | |
CTGAACTCAACTCAACTGCC+CGG | - | contig505end:13641-13660 | MsG0080048878.01.T01:intron | 50.0% | |
CTTGTGGCTCAAACCTACAC+TGG | + | contig505end:14793-14812 | MsG0080048878.01.T01:intergenic | 50.0% | |
GAAGCAAATGATGACAGCGG+AGG | - | contig505end:15456-15475 | MsG0080048878.01.T01:intron | 50.0% | |
GAAGGATCATGAAGAGTGGG+AGG | - | contig505end:14481-14500 | MsG0080048878.01.T01:intron | 50.0% | |
GAGATTCCATGTCAGGTGGA+GGG | - | contig505end:12303-12322 | MsG0080048878.01.T01:intron | 50.0% | |
GAGTTTAGGAGAGGAAGGGA+GGG | - | contig505end:11832-11851 | MsG0080048878.01.T01:CDS | 50.0% | |
GATAATTCCCACGTCCCCTA+GGG | + | contig505end:14251-14270 | MsG0080048878.01.T01:intergenic | 50.0% | |
GATGGGTAGACTTGGGAACA+AGG | - | contig505end:14697-14716 | MsG0080048878.01.T01:intron | 50.0% | |
GCCCTTCACATCTTCTTCCA+TGG | + | contig505end:15347-15366 | MsG0080048878.01.T01:intergenic | 50.0% | |
GCTCGCAGAAATAGATCTGG+AGG | + | contig505end:15616-15635 | MsG0080048878.01.T01:intergenic | 50.0% | |
GCTGCTCGCAGAAATAGATC+TGG | + | contig505end:15619-15638 | MsG0080048878.01.T01:intergenic | 50.0% | |
GGCGGTGAGATTGATCAACT+CGG | - | contig505end:13157-13176 | MsG0080048878.01.T01:intron | 50.0% | |
GTCCATACAGAGCTTTGCTC+TGG | - | contig505end:13111-13130 | MsG0080048878.01.T01:intron | 50.0% | |
GTTGGTCCAATGGTTGACGT+TGG | - | contig505end:13009-13028 | MsG0080048878.01.T01:intron | 50.0% | |
TACCGCTATAGCACAAGTCG+TGG | - | contig505end:10978-10997 | MsG0080048878.01.T01:CDS | 50.0% | |
TCCGTAATCCCACCACTAAC+CGG | + | contig505end:14434-14453 | MsG0080048878.01.T01:intergenic | 50.0% | |
TCCGTGCGAGGATCAAGAAA+TGG | + | contig505end:14839-14858 | MsG0080048878.01.T01:intergenic | 50.0% | |
TCTTGGCGTGGGATTGTTGT+TGG | - | contig505end:14404-14423 | MsG0080048878.01.T01:intron | 50.0% | |
TGAAAAACCCTAGGGGACGT+GGG | - | contig505end:14241-14260 | MsG0080048878.01.T01:intron | 50.0% | |
TGATCAAGAGATGGAGGAGG+AGG | - | contig505end:15237-15256 | MsG0080048878.01.T01:intron | 50.0% | |
TGCGGGTCGTAGTAAGAAGA+CGG | - | contig505end:14104-14123 | MsG0080048878.01.T01:intron | 50.0% | |
TGGAAGAAGATGTGAAGGGC+TGG | - | contig505end:15347-15366 | MsG0080048878.01.T01:intron | 50.0% | |
TTGAAAAACCCTAGGGGACG+TGG | - | contig505end:14240-14259 | MsG0080048878.01.T01:intron | 50.0% | |
! | AATGGTTGACGTTGGCCTAG+TGG | - | contig505end:13017-13036 | MsG0080048878.01.T01:intron | 50.0% |
! | CCACCGAAATTGGCTCCATA+AGG | + | contig505end:13087-13106 | MsG0080048878.01.T01:intergenic | 50.0% |
! | CGAAGGTTAGTCCAGAAGAG+TGG | - | contig505end:15539-15558 | MsG0080048878.01.T01:intron | 50.0% |
! | CTTTGCTCTGGCTTAGAACG+GGG | - | contig505end:13123-13142 | MsG0080048878.01.T01:intron | 50.0% |
! | GAGTGGAAGTATGTTGGGGT+CGG | - | contig505end:15556-15575 | MsG0080048878.01.T01:intron | 50.0% |
! | GCTTTGCTCTGGCTTAGAAC+GGG | - | contig505end:13122-13141 | MsG0080048878.01.T01:intron | 50.0% |
! | GTTGGCCTAGTGGTTGACTT+GGG | - | contig505end:13027-13046 | MsG0080048878.01.T01:intron | 50.0% |
! | TGGGATTGTTGTTGGTGAGC+CGG | - | contig505end:14412-14431 | MsG0080048878.01.T01:intron | 50.0% |
!!! | CTCACCGTTTTGAGGTTGGT+TGG | + | contig505end:10122-10141 | MsG0080048878.01.T01:intergenic | 50.0% |
AATGATGACAGCGGAGGCAG+GGG | - | contig505end:15462-15481 | MsG0080048878.01.T01:intron | 55.0% | |
AGAGATGGAGGAGGAGGATG+AGG | - | contig505end:15243-15262 | MsG0080048878.01.T01:intron | 55.0% | |
AGGGTTTAGGAGAGGAAGGG+AGG | + | contig505end:12022-12041 | MsG0080048878.01.T01:intergenic | 55.0% | |
ATGGGCCGTATTCTTGGCGT+GGG | - | contig505end:14393-14412 | MsG0080048878.01.T01:intron | 55.0% | |
CAAATGATGACAGCGGAGGC+AGG | - | contig505end:15460-15479 | MsG0080048878.01.T01:intron | 55.0% | |
CCGGAGTTTCTATCAGTCGC+CGG | - | contig505end:13672-13691 | MsG0080048878.01.T01:intron | 55.0% | |
CCGGCGACTGATAGAAACTC+CGG | + | contig505end:13675-13694 | MsG0080048878.01.T01:intergenic | 55.0% | |
GACGGATGAAGCGTAATGCG+AGG | - | contig505end:14178-14197 | MsG0080048878.01.T01:intron | 55.0% | |
GCGACTGATAGAAACTCCGG+CGG | + | contig505end:13672-13691 | MsG0080048878.01.T01:intergenic | 55.0% | |
GCGGGTCGTAGTAAGAAGAC+GGG | - | contig505end:14105-14124 | MsG0080048878.01.T01:intron | 55.0% | |
GCTCGCTCCCAACTAGTTGT+GGG | + | contig505end:12069-12088 | MsG0080048878.01.T01:intergenic | 55.0% | |
GGAGAGTTTCGGAACTTCCG+TGG | - | contig505end:14606-14625 | MsG0080048878.01.T01:intron | 55.0% | |
GGATAATTCCCACGTCCCCT+AGG | + | contig505end:14252-14271 | MsG0080048878.01.T01:intergenic | 55.0% | |
GGGTTTAGGAGAGGAAGGGA+GGG | + | contig505end:12021-12040 | MsG0080048878.01.T01:intergenic | 55.0% | |
GGTCGTAGTAAGAAGACGGG+TGG | - | contig505end:14108-14127 | MsG0080048878.01.T01:intron | 55.0% | |
GGTTTAGGAGAGGAAGGGAG+GGG | + | contig505end:12020-12039 | MsG0080048878.01.T01:intergenic | 55.0% | |
GTAGACTTGGGAACAAGGCG+AGG | - | contig505end:14702-14721 | MsG0080048878.01.T01:intron | 55.0% | |
TAGAACGGGGCCCGACAAAT+GGG | - | contig505end:13136-13155 | MsG0080048878.01.T01:intron | 55.0% | |
TATGGGCCGTATTCTTGGCG+TGG | - | contig505end:14392-14411 | MsG0080048878.01.T01:intron | 55.0% | |
TGCTCGCTCCCAACTAGTTG+TGG | + | contig505end:12070-12089 | MsG0080048878.01.T01:intergenic | 55.0% | |
TTAGAACGGGGCCCGACAAA+TGG | - | contig505end:13135-13154 | MsG0080048878.01.T01:intron | 55.0% | |
TTGGTGAGCCGGTTAGTGGT+GGG | - | contig505end:14423-14442 | MsG0080048878.01.T01:intron | 55.0% | |
! | CATGCAAGGCGTTTGCTCAC+TGG | + | contig505end:12334-12353 | MsG0080048878.01.T01:intergenic | 55.0% |
! | CGTTGGCCTAGTGGTTGACT+TGG | - | contig505end:13026-13045 | MsG0080048878.01.T01:intron | 55.0% |
! | GCCGGTTAGTGGTGGGATTA+CGG | - | contig505end:14430-14449 | MsG0080048878.01.T01:intron | 55.0% |
! | GTTGTTGGTGAGCCGGTTAG+TGG | - | contig505end:14419-14438 | MsG0080048878.01.T01:intron | 55.0% |
AGAAACTCCGGCGGCGTTTC+CGG | + | contig505end:13663-13682 | MsG0080048878.01.T01:intergenic | 60.0% | |
AGCGTCCGGTGTTCCAGTGT+AGG | - | contig505end:14777-14796 | MsG0080048878.01.T01:intron | 60.0% | |
AGTATGTTGGGGTCGGTCCG+TGG | - | contig505end:15563-15582 | MsG0080048878.01.T01:intron | 60.0% | |
CGGAACTTCCGTGGCAGCAA+TGG | - | contig505end:14615-14634 | MsG0080048878.01.T01:intron | 60.0% | |
GAACAAGGCGAGGTCGTTGG+TGG | - | contig505end:14712-14731 | MsG0080048878.01.T01:intron | 60.0% | |
GAACTGCCCTCCACCTGACA+TGG | + | contig505end:12312-12331 | MsG0080048878.01.T01:intergenic | 60.0% | |
TAGGAGAGGAAGGGAGGGGA+GGG | - | contig505end:11837-11856 | MsG0080048878.01.T01:CDS | 60.0% | |
TAGGAGAGGAAGGGAGGGGA+GGG | + | contig505end:11856-11837 | MsG0080048878.01.T01:intergenic | 60.0% | |
TGGGAACAAGGCGAGGTCGT+TGG | - | contig505end:14709-14728 | MsG0080048878.01.T01:intron | 60.0% | |
TTAGGAGAGGAAGGGAGGGG+AGG | - | contig505end:11836-11855 | MsG0080048878.01.T01:CDS | 60.0% | |
TTAGGAGAGGAAGGGAGGGG+AGG | + | contig505end:11855-11836 | MsG0080048878.01.T01:intergenic | 60.0% | |
! | GTTGGTGAGCCGGTTAGTGG+TGG | - | contig505end:14422-14441 | MsG0080048878.01.T01:intron | 60.0% |
AACGGGGCCCGACAAATGGG+CGG | - | contig505end:13139-13158 | MsG0080048878.01.T01:intron | 65.0% | |
ACGGGTGGTGCGTCGTCTTC+TGG | - | contig505end:14123-14142 | MsG0080048878.01.T01:intron | 65.0% | |
GAAACTCCGGCGGCGTTTCC+GGG | + | contig505end:13662-13681 | MsG0080048878.01.T01:intergenic | 65.0% | |
GGTGGTGCGTCGTCTTCTGG+TGG | - | contig505end:14126-14145 | MsG0080048878.01.T01:intron | 65.0% | |
! | TGGTGGCGCAATGTGCAGCG+TGG | - | contig505end:14729-14748 | MsG0080048878.01.T01:intron | 65.0% |
CAACTGCCCGGAAACGCCGC+CGG | - | contig505end:13653-13672 | MsG0080048878.01.T01:intron | 70.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
contig505end | gene | 10001 | 16131 | 10001 | ID=MsG0080048878.01; |
contig505end | mRNA | 10001 | 16131 | 10001 | ID=MsG0080048878.01.T01;Parent=MsG0080048878.01 |
contig505end | exon | 10001 | 11878 | 10001 | ID=MsG0080048878.01.T01.exon;Parent=MsG0080048878.01.T01 |
contig505end | CDS | 10403 | 11878 | 10403 | ID=MsG0080048878.01.T01.cds;Parent=MsG0080048878.01.T01 |
contig505end | CDS | 11985 | 12016 | 11985 | ID=MsG0080048878.01.T01.cds;Parent=MsG0080048878.01.T01 |
contig505end | exon | 11985 | 12016 | 11985 | ID=MsG0080048878.01.T01.exon;Parent=MsG0080048878.01.T01 |
contig505end | CDS | 12721 | 12732 | 12721 | ID=MsG0080048878.01.T01.cds;Parent=MsG0080048878.01.T01 |
contig505end | exon | 12721 | 12732 | 12721 | ID=MsG0080048878.01.T01.exon;Parent=MsG0080048878.01.T01 |
contig505end | CDS | 13780 | 13828 | 13780 | ID=MsG0080048878.01.T01.cds;Parent=MsG0080048878.01.T01 |
contig505end | exon | 13780 | 13828 | 13780 | ID=MsG0080048878.01.T01.exon;Parent=MsG0080048878.01.T01 |
contig505end | CDS | 14057 | 14070 | 14057 | ID=MsG0080048878.01.T01.cds;Parent=MsG0080048878.01.T01 |
contig505end | exon | 14057 | 14070 | 14057 | ID=MsG0080048878.01.T01.exon;Parent=MsG0080048878.01.T01 |
contig505end | CDS | 15046 | 15057 | 15046 | ID=MsG0080048878.01.T01.cds;Parent=MsG0080048878.01.T01 |
contig505end | exon | 15046 | 15057 | 15046 | ID=MsG0080048878.01.T01.exon;Parent=MsG0080048878.01.T01 |
contig505end | CDS | 15233 | 15246 | 15233 | ID=MsG0080048878.01.T01.cds;Parent=MsG0080048878.01.T01 |
contig505end | exon | 15233 | 15246 | 15233 | ID=MsG0080048878.01.T01.exon;Parent=MsG0080048878.01.T01 |
contig505end | CDS | 15320 | 15347 | 15320 | ID=MsG0080048878.01.T01.cds;Parent=MsG0080048878.01.T01 |
contig505end | exon | 15320 | 15347 | 15320 | ID=MsG0080048878.01.T01.exon;Parent=MsG0080048878.01.T01 |
contig505end | CDS | 15732 | 15807 | 15732 | ID=MsG0080048878.01.T01.cds;Parent=MsG0080048878.01.T01 |
contig505end | exon | 15732 | 15807 | 15732 | ID=MsG0080048878.01.T01.exon;Parent=MsG0080048878.01.T01 |
contig505end | CDS | 15970 | 16047 | 15970 | ID=MsG0080048878.01.T01.cds;Parent=MsG0080048878.01.T01 |
contig505end | exon | 15970 | 16131 | 15970 | ID=MsG0080048878.01.T01.exon;Parent=MsG0080048878.01.T01 |
Gene Sequence |
Protein sequence |