Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048876.01.T01 | XP_013443987.1 | 97.884 | 567 | 12 | 0 | 2 | 568 | 1 | 567 | 0 | 1152 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048876.01.T01 | Q9FEA2 | 74.431 | 571 | 138 | 5 | 3 | 568 | 1 | 568 | 0 | 886 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048876.01.T01 | A0A072TKH0 | 97.884 | 567 | 12 | 0 | 2 | 568 | 1 | 567 | 0.0 | 1152 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080047910.01 | MsG0080048876.01 | 0.804410 | 2.189758e-49 | 1.128189e-46 |
MsG0080047945.01 | MsG0080048876.01 | 0.826008 | 3.432842e-54 | 3.180371e-51 |
MsG0080047955.01 | MsG0080048876.01 | 0.825187 | 5.375020e-54 | 4.864688e-51 |
MsG0080047956.01 | MsG0080048876.01 | 0.804431 | 2.167797e-49 | 1.117479e-46 |
MsG0080048068.01 | MsG0080048876.01 | 0.817882 | 2.618475e-52 | 1.930252e-49 |
MsG0080048528.01 | MsG0080048876.01 | 0.826649 | 2.415990e-54 | 2.279363e-51 |
MsG0080048727.01 | MsG0080048876.01 | 0.826369 | 2.817545e-54 | 2.637285e-51 |
MsG0080048773.01 | MsG0080048876.01 | 0.856984 | 2.222577e-62 | 5.401854e-59 |
MsG0080048776.01 | MsG0080048876.01 | 0.807416 | 5.108110e-50 | 2.843554e-47 |
MsG0080048777.01 | MsG0080048876.01 | 0.903990 | 1.956858e-79 | 2.964911e-75 |
MsG0080048780.01 | MsG0080048876.01 | 0.897149 | 1.860804e-76 | 2.075072e-72 |
MsG0080048801.01 | MsG0080048876.01 | 0.905796 | 2.937355e-80 | 4.828083e-76 |
MsG0080048820.01 | MsG0080048876.01 | 0.840757 | 7.174963e-58 | 1.032175e-54 |
MsG0080048845.01 | MsG0080048876.01 | 0.861795 | 7.982119e-64 | 2.285443e-60 |
MsG0080048876.01 | MsG0080049004.01 | 0.843149 | 1.673615e-58 | 2.594442e-55 |
MsG0080048876.01 | MsG0080049029.01 | 0.864977 | 8.242644e-65 | 2.638070e-61 |
MsG0080048876.01 | MsG0080049039.01 | 0.894430 | 2.485089e-75 | 2.469713e-71 |
MsG0080048876.01 | MsG0080049040.01 | 0.902609 | 8.134517e-79 | 1.161438e-74 |
MsG0080048876.01 | MsG0080049053.01 | 0.803497 | 3.389576e-49 | 1.705953e-46 |
MsG0080048876.01 | MsG0080049054.01 | 0.841268 | 5.268321e-58 | 7.699690e-55 |
MsG0080048876.01 | MsG0080049063.01 | 0.821100 | 4.830540e-53 | 3.893325e-50 |
MsG0080048876.01 | MsG0080049068.01 | 0.894273 | 2.879732e-75 | 2.842922e-71 |
MsG0080048876.01 | MsG0080049078.01 | 0.830713 | 2.515311e-55 | 2.671682e-52 |
MsG0080048876.01 | MsG0080049130.01 | 0.843707 | 1.187621e-58 | 1.873857e-55 |
MsG0080048876.01 | MsG0180000120.01 | 0.804686 | 1.917693e-49 | 9.951180e-47 |
MsG0080048876.01 | MsG0180000188.01 | -0.801555 | 8.520592e-49 | 4.081059e-46 |
MsG0080048876.01 | MsG0180000193.01 | 0.822506 | 2.284176e-53 | 1.915611e-50 |
MsG0080048876.01 | MsG0180000292.01 | 0.823726 | 1.186304e-53 | 1.029953e-50 |
MsG0080048876.01 | MsG0180000354.01 | 0.880093 | 7.287085e-70 | 4.052850e-66 |
MsG0080048876.01 | MsG0180000355.01 | 0.834818 | 2.404770e-56 | 2.886360e-53 |
MsG0080048876.01 | MsG0180000356.01 | 0.820126 | 8.088398e-53 | 6.345453e-50 |
MsG0080048876.01 | MsG0180000366.01 | 0.820347 | 7.195649e-53 | 5.679251e-50 |
MsG0080048876.01 | MsG0180000638.01 | 0.861532 | 9.603655e-64 | 2.726400e-60 |
MsG0080048876.01 | MsG0180000670.01 | 0.846122 | 2.648897e-59 | 4.512474e-56 |
MsG0080048876.01 | MsG0180000671.01 | 0.886464 | 3.344750e-72 | 2.391717e-68 |
MsG0080048876.01 | MsG0180000677.01 | 0.868438 | 6.527027e-66 | 2.360680e-62 |
MsG0080048876.01 | MsG0180000678.01 | 0.856336 | 3.446567e-62 | 8.198460e-59 |
MsG0080048876.01 | MsG0180000730.01 | 0.820837 | 5.553389e-53 | 4.443225e-50 |
MsG0080048876.01 | MsG0180000792.01 | 0.807048 | 6.112575e-50 | 3.370260e-47 |
MsG0080048876.01 | MsG0180000843.01 | 0.802895 | 4.515263e-49 | 2.237717e-46 |
MsG0080048876.01 | MsG0180000878.01 | 0.853991 | 1.656810e-61 | 3.646439e-58 |
MsG0080048876.01 | MsG0180000989.01 | 0.876622 | 1.205854e-68 | 5.886042e-65 |
MsG0080048876.01 | MsG0180001064.01 | 0.801020 | 1.096578e-48 | 5.182232e-46 |
MsG0080048876.01 | MsG0180001085.01 | 0.897619 | 1.179824e-76 | 1.344052e-72 |
MsG0080048876.01 | MsG0180001105.01 | 0.808991 | 2.359506e-50 | 1.368842e-47 |
MsG0080048876.01 | MsG0180001170.01 | 0.805178 | 1.513159e-49 | 7.952147e-47 |
MsG0080048876.01 | MsG0180001175.01 | 0.878747 | 2.185911e-69 | 1.154701e-65 |
MsG0080048876.01 | MsG0180001270.01 | 0.883942 | 2.925541e-71 | 1.892894e-67 |
MsG0080048876.01 | MsG0180001371.01 | 0.862994 | 3.414723e-64 | 1.019433e-60 |
MsG0080048876.01 | MsG0180001609.01 | 0.849887 | 2.423550e-60 | 4.662338e-57 |
MsG0080048876.01 | MsG0180001610.01 | 0.831783 | 1.372362e-55 | 1.504816e-52 |
MsG0080048876.01 | MsG0180001685.01 | 0.805036 | 1.620342e-49 | 8.484301e-47 |
MsG0080048876.01 | MsG0180001772.01 | 0.845054 | 5.159288e-59 | 8.493235e-56 |
MsG0080048876.01 | MsG0180001880.01 | 0.824481 | 7.886435e-54 | 6.993923e-51 |
MsG0080048876.01 | MsG0180001929.01 | 0.831907 | 1.279399e-55 | 1.407961e-52 |
MsG0080048876.01 | MsG0180002399.01 | 0.817510 | 3.176899e-52 | 2.318259e-49 |
MsG0080048876.01 | MsG0180002671.01 | 0.852110 | 5.724244e-61 | 1.183722e-57 |
MsG0080048876.01 | MsG0180003353.01 | 0.850098 | 2.114291e-60 | 4.095828e-57 |
MsG0080048876.01 | MsG0180003453.01 | 0.812925 | 3.316960e-51 | 2.136113e-48 |
MsG0080048876.01 | MsG0180003526.01 | 0.870589 | 1.301565e-66 | 5.090318e-63 |
MsG0080048876.01 | MsG0180003531.01 | 0.883633 | 3.805211e-71 | 2.432222e-67 |
MsG0080048876.01 | MsG0180003633.01 | 0.819254 | 1.279081e-52 | 9.792724e-50 |
MsG0080048876.01 | MsG0180003821.01 | 0.820626 | 6.211428e-53 | 4.939945e-50 |
MsG0080048876.01 | MsG0180003906.01 | 0.813744 | 2.192073e-51 | 1.443389e-48 |
MsG0080048876.01 | MsG0180003933.01 | 0.819903 | 9.096476e-53 | 7.091392e-50 |
MsG0080048876.01 | MsG0180004103.01 | 0.885518 | 7.589497e-72 | 5.225812e-68 |
MsG0080048876.01 | MsG0180004163.01 | 0.827498 | 1.513049e-54 | 1.463268e-51 |
MsG0080048876.01 | MsG0180004192.01 | 0.886451 | 3.381774e-72 | 2.417022e-68 |
MsG0080048876.01 | MsG0180004246.01 | 0.802824 | 4.670085e-49 | 2.310439e-46 |
MsG0080048876.01 | MsG0180004276.01 | 0.868290 | 7.290024e-66 | 2.622991e-62 |
MsG0080048876.01 | MsG0180004428.01 | 0.858310 | 8.995240e-63 | 2.285941e-59 |
MsG0080048876.01 | MsG0180004448.01 | 0.861993 | 6.939162e-64 | 2.000693e-60 |
MsG0080048876.01 | MsG0180004466.01 | 0.829481 | 5.025594e-55 | 5.149870e-52 |
MsG0080048876.01 | MsG0180004493.01 | 0.809641 | 1.711756e-50 | 1.010519e-47 |
MsG0080048876.01 | MsG0180004542.01 | 0.861166 | 1.241450e-63 | 3.479664e-60 |
MsG0080048876.01 | MsG0180004554.01 | 0.833099 | 6.476374e-56 | 7.383672e-53 |
MsG0080048876.01 | MsG0180004672.01 | 0.824075 | 9.821501e-54 | 8.610112e-51 |
MsG0080048876.01 | MsG0180004733.01 | 0.883693 | 3.615468e-71 | 2.316670e-67 |
MsG0080048876.01 | MsG0180004735.01 | 0.880795 | 4.088151e-70 | 2.336888e-66 |
MsG0080048876.01 | MsG0180004739.01 | 0.862958 | 3.502935e-64 | 1.044534e-60 |
MsG0080048876.01 | MsG0180004759.01 | -0.817753 | 2.800458e-52 | 2.057208e-49 |
MsG0080048876.01 | MsG0180004934.01 | 0.834937 | 2.245226e-56 | 2.704588e-53 |
MsG0080048876.01 | MsG0180004987.01 | 0.855343 | 6.725732e-62 | 1.548087e-58 |
MsG0080048876.01 | MsG0180005039.01 | 0.870358 | 1.550459e-66 | 6.012906e-63 |
MsG0080048876.01 | MsG0180005064.01 | 0.844151 | 9.028552e-59 | 1.444593e-55 |
MsG0080048876.01 | MsG0180005087.01 | 0.846584 | 1.981204e-59 | 3.426269e-56 |
MsG0080048876.01 | MsG0180005135.01 | 0.809546 | 1.793634e-50 | 1.056137e-47 |
MsG0080048876.01 | MsG0180005137.01 | 0.806203 | 9.217721e-50 | 4.973519e-47 |
MsG0080048876.01 | MsG0180005269.01 | 0.826822 | 2.196658e-54 | 2.082817e-51 |
MsG0080048876.01 | MsG0180005276.01 | 0.852884 | 3.443396e-61 | 7.301465e-58 |
MsG0080048876.01 | MsG0180005349.01 | 0.887629 | 1.206790e-72 | 9.042012e-69 |
MsG0080048876.01 | MsG0180005395.01 | -0.814272 | 1.676719e-51 | 1.120009e-48 |
MsG0080048876.01 | MsG0180005492.01 | 0.877031 | 8.701754e-69 | 4.311037e-65 |
MsG0080048876.01 | MsG0180005750.01 | 0.857266 | 1.834350e-62 | 4.501143e-59 |
MsG0080048876.01 | MsG0180005755.01 | 0.872291 | 3.559668e-67 | 1.481366e-63 |
MsG0080048876.01 | MsG0180005803.01 | 0.831734 | 1.411340e-55 | 1.545243e-52 |
MsG0080048876.01 | MsG0180005807.01 | 0.869279 | 3.486691e-66 | 1.300988e-62 |
MsG0080048876.01 | MsG0180005821.01 | 0.801122 | 1.045160e-48 | 4.951789e-46 |
MsG0080048876.01 | MsG0180005871.01 | -0.830099 | 3.553084e-55 | 3.706771e-52 |
MsG0080048876.01 | MsG0180005879.01 | 0.800122 | 1.671513e-48 | 7.720724e-46 |
MsG0080048876.01 | MsG0180005961.01 | 0.917365 | 5.805930e-86 | 1.670559e-81 |
MsG0080048876.01 | MsG0180005969.01 | 0.809271 | 2.054479e-50 | 1.200914e-47 |
MsG0080048876.01 | MsG0180006030.01 | 0.856705 | 2.685687e-62 | 6.465654e-59 |
MsG0080048876.01 | MsG0180006031.01 | 0.835320 | 1.797548e-56 | 2.190613e-53 |
MsG0080048876.01 | MsG0180006042.01 | 0.848979 | 4.338003e-60 | 8.102641e-57 |
MsG0080048876.01 | MsG0180006136.01 | 0.860610 | 1.832504e-63 | 5.038794e-60 |
MsG0080048876.01 | MsG0180006176.01 | 0.826181 | 3.123072e-54 | 2.907564e-51 |
MsG0080048876.01 | MsG0180006200.01 | 0.834307 | 3.232741e-56 | 3.821500e-53 |
MsG0080048876.01 | MsG0180006223.01 | 0.803028 | 4.238634e-49 | 2.107664e-46 |
MsG0080048876.01 | MsG0280006328.01 | 0.814967 | 1.176391e-51 | 8.006731e-49 |
MsG0080048876.01 | MsG0280006607.01 | 0.801947 | 7.077868e-49 | 3.423929e-46 |
MsG0080048876.01 | MsG0280006718.01 | 0.846714 | 1.826227e-59 | 3.171762e-56 |
MsG0080048876.01 | MsG0280006764.01 | 0.813006 | 3.184656e-51 | 2.055435e-48 |
MsG0080048876.01 | MsG0280006805.01 | 0.900567 | 6.437312e-78 | 8.374018e-74 |
MsG0080048876.01 | MsG0280006825.01 | 0.844073 | 9.474776e-59 | 1.512285e-55 |
MsG0080048876.01 | MsG0280006848.01 | 0.802752 | 4.831998e-49 | 2.386062e-46 |
MsG0080048876.01 | MsG0280006991.01 | 0.832326 | 1.007653e-55 | 1.122402e-52 |
MsG0080048876.01 | MsG0280006996.01 | 0.863822 | 1.891221e-64 | 5.810881e-61 |
MsG0080048876.01 | MsG0280007075.01 | 0.860915 | 1.480373e-63 | 4.113473e-60 |
MsG0080048876.01 | MsG0280007502.01 | 0.907477 | 4.859098e-81 | 8.635077e-77 |
MsG0080048876.01 | MsG0280007628.01 | 0.821833 | 3.271228e-53 | 2.691276e-50 |
MsG0080048876.01 | MsG0280007771.01 | 0.817828 | 2.692640e-52 | 1.982036e-49 |
MsG0080048876.01 | MsG0280007800.01 | 0.816681 | 4.878533e-52 | 3.479784e-49 |
MsG0080048876.01 | MsG0280007814.01 | 0.856963 | 2.253728e-62 | 5.473731e-59 |
MsG0080048876.01 | MsG0280007831.01 | 0.889260 | 2.840898e-73 | 2.275166e-69 |
MsG0080048876.01 | MsG0280007976.01 | 0.824402 | 8.228428e-54 | 7.280459e-51 |
MsG0080048876.01 | MsG0280008081.01 | 0.844122 | 9.190100e-59 | 1.469113e-55 |
MsG0080048876.01 | MsG0280008223.01 | 0.837588 | 4.757469e-57 | 6.208576e-54 |
MsG0080048876.01 | MsG0280008388.01 | 0.864361 | 1.284841e-64 | 4.023168e-61 |
MsG0080048876.01 | MsG0280008394.01 | 0.841538 | 4.472867e-58 | 6.592787e-55 |
MsG0080048876.01 | MsG0280008451.01 | 0.902420 | 9.876154e-79 | 1.397195e-74 |
MsG0080048876.01 | MsG0280008591.01 | 0.901334 | 2.975888e-78 | 4.001999e-74 |
MsG0080048876.01 | MsG0280008709.01 | 0.829196 | 5.892129e-55 | 5.988520e-52 |
MsG0080048876.01 | MsG0280008922.01 | 0.867629 | 1.189090e-65 | 4.179705e-62 |
MsG0080048876.01 | MsG0280008935.01 | 0.806987 | 6.299565e-50 | 3.467791e-47 |
MsG0080048876.01 | MsG0280008942.01 | 0.843650 | 1.230011e-58 | 1.937521e-55 |
MsG0080048876.01 | MsG0280009256.01 | 0.805364 | 1.383275e-49 | 7.304429e-47 |
MsG0080048876.01 | MsG0280009430.01 | 0.847501 | 1.110885e-59 | 1.978576e-56 |
MsG0080048876.01 | MsG0280009431.01 | 0.825845 | 3.753832e-54 | 3.461733e-51 |
MsG0080048876.01 | MsG0280009443.01 | 0.808989 | 2.360971e-50 | 1.369638e-47 |
MsG0080048876.01 | MsG0280009685.01 | 0.807793 | 4.249686e-50 | 2.388990e-47 |
MsG0080048876.01 | MsG0280009751.01 | 0.803012 | 4.270480e-49 | 2.122551e-46 |
MsG0080048876.01 | MsG0280009756.01 | 0.848656 | 5.334329e-60 | 9.858645e-57 |
MsG0080048876.01 | MsG0280010016.01 | 0.863540 | 2.313944e-64 | 7.039473e-61 |
MsG0080048876.01 | MsG0280010195.01 | 0.828331 | 9.540818e-55 | 9.453194e-52 |
MsG0080048876.01 | MsG0280010353.01 | 0.866671 | 2.405016e-65 | 8.173591e-62 |
MsG0080048876.01 | MsG0280010376.01 | 0.890977 | 6.044219e-74 | 5.199325e-70 |
MsG0080048876.01 | MsG0280010417.01 | -0.823323 | 1.473218e-53 | 1.264321e-50 |
MsG0080048876.01 | MsG0280010496.01 | 0.804204 | 2.417236e-49 | 1.238793e-46 |
MsG0080048876.01 | MsG0280010503.01 | 0.865260 | 6.717336e-65 | 2.171731e-61 |
MsG0080048876.01 | MsG0280010564.01 | 0.818865 | 1.568173e-52 | 1.187823e-49 |
MsG0080048876.01 | MsG0280010569.01 | 0.813340 | 2.689335e-51 | 1.751597e-48 |
MsG0080048876.01 | MsG0280010611.01 | 0.808698 | 2.725223e-50 | 1.568758e-47 |
MsG0080048876.01 | MsG0280010661.01 | 0.839069 | 1.974851e-57 | 2.696495e-54 |
MsG0080048876.01 | MsG0280010926.01 | 0.851818 | 6.925297e-61 | 1.418767e-57 |
MsG0080048876.01 | MsG0280010975.01 | 0.844346 | 8.001853e-59 | 1.288094e-55 |
MsG0080048876.01 | MsG0280011162.01 | 0.812849 | 3.446084e-51 | 2.214790e-48 |
MsG0080048876.01 | MsG0280011252.01 | 0.859227 | 4.783868e-63 | 1.254317e-59 |
MsG0080048876.01 | MsG0280011273.01 | 0.835826 | 1.338397e-56 | 1.655789e-53 |
MsG0080048876.01 | MsG0280011411.01 | 0.891427 | 4.011422e-74 | 3.515721e-70 |
MsG0080048876.01 | MsG0380011495.01 | 0.877027 | 8.732450e-69 | 4.325583e-65 |
MsG0080048876.01 | MsG0380011534.01 | 0.800745 | 1.247707e-48 | 5.854972e-46 |
MsG0080048876.01 | MsG0380011632.01 | 0.814195 | 1.742957e-51 | 1.161825e-48 |
MsG0080048876.01 | MsG0380011652.01 | 0.832569 | 8.771616e-56 | 9.842644e-53 |
MsG0080048876.01 | MsG0380011739.01 | 0.808303 | 3.308787e-50 | 1.885218e-47 |
MsG0080048876.01 | MsG0380011825.01 | 0.845473 | 3.972335e-59 | 6.627471e-56 |
MsG0080048876.01 | MsG0380012011.01 | 0.825660 | 4.152522e-54 | 3.809037e-51 |
MsG0080048876.01 | MsG0380012527.01 | 0.809724 | 1.642421e-50 | 9.717187e-48 |
MsG0080048876.01 | MsG0380012625.01 | 0.807826 | 4.180729e-50 | 2.352217e-47 |
MsG0080048876.01 | MsG0380012780.01 | 0.813977 | 1.947548e-51 | 1.290511e-48 |
MsG0080048876.01 | MsG0380012800.01 | 0.827384 | 1.611626e-54 | 1.553641e-51 |
MsG0080048876.01 | MsG0380012801.01 | 0.844884 | 5.731749e-59 | 9.384130e-56 |
MsG0080048876.01 | MsG0380012876.01 | 0.864432 | 1.220935e-64 | 3.832843e-61 |
MsG0080048876.01 | MsG0380013472.01 | 0.879790 | 9.344097e-70 | 5.135540e-66 |
MsG0080048876.01 | MsG0380013499.01 | 0.812370 | 4.386398e-51 | 2.783895e-48 |
MsG0080048876.01 | MsG0380013530.01 | 0.816027 | 6.833694e-52 | 4.788221e-49 |
MsG0080048876.01 | MsG0380013955.01 | 0.810336 | 1.212459e-50 | 7.288694e-48 |
MsG0080048876.01 | MsG0380013970.01 | 0.824069 | 9.852850e-54 | 8.636146e-51 |
MsG0080048876.01 | MsG0380014007.01 | 0.826023 | 3.405239e-54 | 3.156032e-51 |
MsG0080048876.01 | MsG0380014053.01 | 0.827211 | 1.773008e-54 | 1.700430e-51 |
MsG0080048876.01 | MsG0380014297.01 | -0.849997 | 2.256563e-60 | 4.356777e-57 |
MsG0080048876.01 | MsG0380014470.01 | 0.866513 | 2.699684e-65 | 9.122862e-62 |
MsG0080048876.01 | MsG0380014560.01 | 0.806753 | 7.059818e-50 | 3.862830e-47 |
MsG0080048876.01 | MsG0380014584.01 | 0.841228 | 5.397107e-58 | 7.877716e-55 |
MsG0080048876.01 | MsG0380014588.01 | 0.842217 | 2.958276e-58 | 4.454173e-55 |
MsG0080048876.01 | MsG0380014711.01 | 0.812683 | 3.746619e-51 | 2.397661e-48 |
MsG0080048876.01 | MsG0380014729.01 | 0.805225 | 1.479218e-49 | 7.783053e-47 |
MsG0080048876.01 | MsG0380014809.01 | 0.819396 | 1.187231e-52 | 9.125020e-50 |
MsG0080048876.01 | MsG0380014909.01 | 0.826962 | 2.033905e-54 | 1.936518e-51 |
MsG0080048876.01 | MsG0380014940.01 | 0.883668 | 3.693348e-71 | 2.364077e-67 |
MsG0080048876.01 | MsG0380015356.01 | 0.827028 | 1.961135e-54 | 1.870693e-51 |
MsG0080048876.01 | MsG0380015399.01 | 0.843268 | 1.555158e-58 | 2.420359e-55 |
MsG0080048876.01 | MsG0380015496.01 | 0.805400 | 1.359559e-49 | 7.185748e-47 |
MsG0080048876.01 | MsG0380015501.01 | 0.803091 | 4.112156e-49 | 2.048012e-46 |
MsG0080048876.01 | MsG0380015546.01 | 0.801397 | 9.177638e-49 | 4.378274e-46 |
MsG0080048876.01 | MsG0380015547.01 | 0.830699 | 2.535376e-55 | 2.691846e-52 |
MsG0080048876.01 | MsG0380015602.01 | 0.809479 | 1.853815e-50 | 1.089612e-47 |
MsG0080048876.01 | MsG0380015603.01 | 0.928996 | 1.307764e-92 | 7.123256e-88 |
MsG0080048876.01 | MsG0380015645.01 | 0.811604 | 6.442507e-51 | 4.005240e-48 |
MsG0080048876.01 | MsG0380015668.01 | 0.806993 | 6.279121e-50 | 3.457091e-47 |
MsG0080048876.01 | MsG0380015693.01 | 0.889154 | 3.121736e-73 | 2.489433e-69 |
MsG0080048876.01 | MsG0380015742.01 | 0.883670 | 3.686566e-71 | 2.360003e-67 |
MsG0080048876.01 | MsG0380015743.01 | 0.887295 | 1.618260e-72 | 1.196517e-68 |
MsG0080048876.01 | MsG0380015817.01 | 0.817798 | 2.736087e-52 | 2.012371e-49 |
MsG0080048876.01 | MsG0380015896.01 | 0.850692 | 1.441127e-60 | 2.846296e-57 |
MsG0080048876.01 | MsG0380015897.01 | 0.821962 | 3.055305e-53 | 2.522626e-50 |
MsG0080048876.01 | MsG0380015898.01 | 0.804667 | 1.935115e-49 | 1.003664e-46 |
MsG0080048876.01 | MsG0380015902.01 | 0.847310 | 1.254098e-59 | 2.219600e-56 |
MsG0080048876.01 | MsG0380016036.01 | 0.847249 | 1.302929e-59 | 2.301979e-56 |
MsG0080048876.01 | MsG0380016057.01 | 0.818048 | 2.402422e-52 | 1.778983e-49 |
MsG0080048876.01 | MsG0380016058.01 | 0.830280 | 3.209075e-55 | 3.365556e-52 |
MsG0080048876.01 | MsG0380016134.01 | 0.806532 | 7.858672e-50 | 4.275702e-47 |
MsG0080048876.01 | MsG0380016135.01 | 0.812222 | 4.726390e-51 | 2.987841e-48 |
MsG0080048876.01 | MsG0380016137.01 | 0.834757 | 2.491494e-56 | 2.984756e-53 |
MsG0080048876.01 | MsG0380016192.01 | 0.901699 | 2.056359e-78 | 2.811514e-74 |
MsG0080048876.01 | MsG0380016194.01 | 0.873523 | 1.376532e-67 | 5.992985e-64 |
MsG0080048876.01 | MsG0380016216.01 | 0.837336 | 5.519797e-57 | 7.147203e-54 |
MsG0080048876.01 | MsG0380016284.01 | 0.875577 | 2.761443e-68 | 1.296096e-64 |
MsG0080048876.01 | MsG0380016294.01 | 0.833768 | 4.411208e-56 | 5.130669e-53 |
MsG0080048876.01 | MsG0380016425.01 | -0.812483 | 4.144111e-51 | 2.638150e-48 |
MsG0080048876.01 | MsG0380016452.01 | 0.801445 | 8.972772e-49 | 4.285864e-46 |
MsG0080048876.01 | MsG0380016479.01 | 0.806167 | 9.379497e-50 | 5.056116e-47 |
MsG0080048876.01 | MsG0380016540.01 | 0.809060 | 2.280291e-50 | 1.325359e-47 |
MsG0080048876.01 | MsG0380016543.01 | 0.817992 | 2.472815e-52 | 1.828412e-49 |
MsG0080048876.01 | MsG0380016544.01 | 0.858506 | 7.860661e-63 | 2.010759e-59 |
MsG0080048876.01 | MsG0380016623.01 | 0.803653 | 3.145598e-49 | 1.589453e-46 |
MsG0080048876.01 | MsG0380016730.01 | 0.864644 | 1.047971e-64 | 3.314921e-61 |
MsG0080048876.01 | MsG0380016751.01 | 0.838969 | 2.096308e-57 | 2.853485e-54 |
MsG0080048876.01 | MsG0380016762.01 | 0.837618 | 4.673292e-57 | 6.104700e-54 |
MsG0080048876.01 | MsG0380016764.01 | 0.863005 | 3.389798e-64 | 1.012303e-60 |
MsG0080048876.01 | MsG0380016836.01 | 0.879629 | 1.066369e-69 | 5.822821e-66 |
MsG0080048876.01 | MsG0380016864.01 | 0.820724 | 5.896844e-53 | 4.702839e-50 |
MsG0080048876.01 | MsG0380016957.01 | 0.823701 | 1.201970e-53 | 1.042838e-50 |
MsG0080048876.01 | MsG0380017017.01 | 0.861576 | 9.310221e-64 | 2.646722e-60 |
MsG0080048876.01 | MsG0380017028.01 | 0.877940 | 4.198741e-69 | 2.151697e-65 |
MsG0080048876.01 | MsG0380017087.01 | 0.828387 | 9.248204e-55 | 9.179080e-52 |
MsG0080048876.01 | MsG0380017088.01 | 0.853970 | 1.680029e-61 | 3.694982e-58 |
MsG0080048876.01 | MsG0380017094.01 | -0.815690 | 8.124920e-52 | 5.640661e-49 |
MsG0080048876.01 | MsG0380017100.01 | 0.869372 | 3.254057e-66 | 1.218452e-62 |
MsG0080048876.01 | MsG0380017136.01 | 0.828986 | 6.625446e-55 | 6.690761e-52 |
MsG0080048876.01 | MsG0380017143.01 | 0.835000 | 2.164341e-56 | 2.612204e-53 |
MsG0080048876.01 | MsG0380017336.01 | 0.865207 | 6.983337e-65 | 2.253315e-61 |
MsG0080048876.01 | MsG0380017359.01 | 0.867080 | 1.781178e-65 | 6.139938e-62 |
MsG0080048876.01 | MsG0380017423.01 | 0.830654 | 2.600145e-55 | 2.756879e-52 |
MsG0080048876.01 | MsG0380017509.01 | 0.837072 | 6.447379e-57 | 8.281308e-54 |
MsG0080048876.01 | MsG0380017651.01 | 0.838602 | 2.608872e-57 | 3.511961e-54 |
MsG0080048876.01 | MsG0380017703.01 | 0.916184 | 2.415273e-85 | 6.561577e-81 |
MsG0080048876.01 | MsG0380017727.01 | 0.828216 | 1.016765e-54 | 1.004131e-51 |
MsG0080048876.01 | MsG0380017728.01 | 0.873079 | 1.940288e-67 | 8.311666e-64 |
MsG0080048876.01 | MsG0380017785.01 | 0.840784 | 7.055971e-58 | 1.015936e-54 |
MsG0080048876.01 | MsG0380017976.01 | 0.804459 | 2.138855e-49 | 1.103376e-46 |
MsG0080048876.01 | MsG0380018027.01 | 0.876145 | 1.762100e-68 | 8.450071e-65 |
MsG0080048876.01 | MsG0380018037.01 | 0.859489 | 3.993553e-63 | 1.056528e-59 |
MsG0080048876.01 | MsG0380018061.01 | 0.879746 | 9.689415e-70 | 5.314946e-66 |
MsG0080048876.01 | MsG0380018069.01 | 0.909130 | 8.004398e-82 | 1.534231e-77 |
MsG0080048876.01 | MsG0480018324.01 | 0.834915 | 2.273284e-56 | 2.736674e-53 |
MsG0080048876.01 | MsG0480018584.01 | 0.818005 | 2.456662e-52 | 1.817077e-49 |
MsG0080048876.01 | MsG0480018592.01 | 0.821841 | 3.257498e-53 | 2.680641e-50 |
MsG0080048876.01 | MsG0480018644.01 | 0.865606 | 5.227481e-65 | 1.711225e-61 |
MsG0080048876.01 | MsG0480018848.01 | 0.808236 | 3.419612e-50 | 1.944961e-47 |
MsG0080048876.01 | MsG0480018905.01 | 0.813066 | 3.089900e-51 | 1.997430e-48 |
MsG0080048876.01 | MsG0480019007.01 | 0.806842 | 6.758634e-50 | 3.706741e-47 |
MsG0080048876.01 | MsG0480019221.01 | 0.816097 | 6.592870e-52 | 4.628430e-49 |
MsG0080048876.01 | MsG0480019283.01 | 0.807902 | 4.029225e-50 | 2.271344e-47 |
MsG0080048876.01 | MsG0480019340.01 | 0.842490 | 2.504320e-58 | 3.803470e-55 |
MsG0080048876.01 | MsG0480019501.01 | 0.826737 | 2.302423e-54 | 2.177685e-51 |
MsG0080048876.01 | MsG0480019592.01 | 0.806665 | 7.365866e-50 | 4.021053e-47 |
MsG0080048876.01 | MsG0480019641.01 | 0.820627 | 6.208033e-53 | 4.937361e-50 |
MsG0080048876.01 | MsG0480019751.01 | 0.877682 | 5.166372e-69 | 2.621565e-65 |
MsG0080048876.01 | MsG0480019956.01 | 0.922177 | 1.379874e-88 | 5.140425e-84 |
MsG0080048876.01 | MsG0480019957.01 | 0.826700 | 2.349556e-54 | 2.219927e-51 |
MsG0080048876.01 | MsG0480019971.01 | 0.856209 | 3.755129e-62 | 8.894448e-59 |
MsG0080048876.01 | MsG0480020315.01 | 0.859047 | 5.420167e-63 | 1.412139e-59 |
MsG0080048876.01 | MsG0480020350.01 | 0.856224 | 3.717921e-62 | 8.810491e-59 |
MsG0080048876.01 | MsG0480020408.01 | 0.888878 | 3.992568e-73 | 3.148937e-69 |
MsG0080048876.01 | MsG0480020690.01 | 0.919114 | 6.739476e-87 | 2.127057e-82 |
MsG0080048876.01 | MsG0480020753.01 | 0.890388 | 1.030956e-73 | 8.651786e-70 |
MsG0080048876.01 | MsG0480020758.01 | 0.864414 | 1.236733e-64 | 3.880054e-61 |
MsG0080048876.01 | MsG0480020783.01 | 0.859925 | 2.951044e-63 | 7.925920e-60 |
MsG0080048876.01 | MsG0480020888.01 | 0.832532 | 8.957410e-56 | 1.003995e-52 |
MsG0080048876.01 | MsG0480020890.01 | 0.800221 | 1.595341e-48 | 7.387561e-46 |
MsG0080048876.01 | MsG0480021059.01 | 0.801745 | 7.788604e-49 | 3.748386e-46 |
MsG0080048876.01 | MsG0480021060.01 | 0.816931 | 4.287914e-52 | 3.079685e-49 |
MsG0080048876.01 | MsG0480021168.01 | 0.867919 | 9.590449e-66 | 3.405440e-62 |
MsG0080048876.01 | MsG0480021207.01 | 0.803052 | 4.189323e-49 | 2.084410e-46 |
MsG0080048876.01 | MsG0480021248.01 | 0.828933 | 6.824796e-55 | 6.881466e-52 |
MsG0080048876.01 | MsG0480021254.01 | 0.833123 | 6.388433e-56 | 7.289022e-53 |
MsG0080048876.01 | MsG0480021294.01 | 0.827105 | 1.880351e-54 | 1.797653e-51 |
MsG0080048876.01 | MsG0480021303.01 | 0.884751 | 1.467565e-71 | 9.802237e-68 |
MsG0080048876.01 | MsG0480021406.01 | 0.845409 | 4.135886e-59 | 6.885994e-56 |
MsG0080048876.01 | MsG0480021521.01 | 0.852672 | 3.958901e-61 | 8.334891e-58 |
MsG0080048876.01 | MsG0480021682.01 | 0.869940 | 2.124608e-66 | 8.116791e-63 |
MsG0080048876.01 | MsG0480021709.01 | 0.864181 | 1.462140e-64 | 4.549399e-61 |
MsG0080048876.01 | MsG0480021754.01 | 0.852187 | 5.441279e-61 | 1.128007e-57 |
MsG0080048876.01 | MsG0480021777.01 | 0.837707 | 4.433268e-57 | 5.807338e-54 |
MsG0080048876.01 | MsG0480021783.01 | 0.874357 | 7.195113e-68 | 3.229033e-64 |
MsG0080048876.01 | MsG0480021795.01 | 0.825672 | 4.125209e-54 | 3.785336e-51 |
MsG0080048876.01 | MsG0480021803.01 | 0.925805 | 1.113913e-90 | 5.068394e-86 |
MsG0080048876.01 | MsG0480021817.01 | 0.849179 | 3.817543e-60 | 7.178219e-57 |
MsG0080048876.01 | MsG0480021875.01 | 0.822391 | 2.428607e-53 | 2.030173e-50 |
MsG0080048876.01 | MsG0480022130.01 | 0.835823 | 1.340366e-56 | 1.658068e-53 |
MsG0080048876.01 | MsG0480022149.01 | 0.877601 | 5.512665e-69 | 2.787879e-65 |
MsG0080048876.01 | MsG0480022200.01 | 0.836681 | 8.112972e-57 | 1.029911e-53 |
MsG0080048876.01 | MsG0480022260.01 | 0.912152 | 2.702236e-83 | 5.991501e-79 |
MsG0080048876.01 | MsG0480022286.01 | 0.813497 | 2.483930e-51 | 1.624810e-48 |
MsG0080048876.01 | MsG0480022294.01 | 0.801260 | 9.791269e-49 | 4.655045e-46 |
MsG0080048876.01 | MsG0480022297.01 | 0.804167 | 2.459920e-49 | 1.259525e-46 |
MsG0080048876.01 | MsG0480022401.01 | 0.821388 | 4.147175e-53 | 3.369229e-50 |
MsG0080048876.01 | MsG0480022537.01 | 0.835005 | 2.158628e-56 | 2.605586e-53 |
MsG0080048876.01 | MsG0480022624.01 | 0.822448 | 2.356092e-53 | 1.972678e-50 |
MsG0080048876.01 | MsG0480022643.01 | 0.816442 | 5.519433e-52 | 3.911112e-49 |
MsG0080048876.01 | MsG0480022646.01 | 0.869854 | 2.266647e-66 | 8.633237e-63 |
MsG0080048876.01 | MsG0480022647.01 | 0.866323 | 3.101733e-65 | 1.041202e-61 |
MsG0080048876.01 | MsG0480022665.01 | 0.804226 | 2.391111e-49 | 1.226113e-46 |
MsG0080048876.01 | MsG0480022804.01 | 0.814899 | 1.217970e-51 | 8.274309e-49 |
MsG0080048876.01 | MsG0480022994.01 | 0.830226 | 3.307920e-55 | 3.464075e-52 |
MsG0080048876.01 | MsG0480023054.01 | 0.843119 | 1.704839e-58 | 2.640396e-55 |
MsG0080048876.01 | MsG0480023098.01 | 0.877458 | 6.185857e-69 | 3.112651e-65 |
MsG0080048876.01 | MsG0480023153.01 | 0.812602 | 3.903316e-51 | 2.492526e-48 |
MsG0080048876.01 | MsG0480023166.01 | 0.815529 | 8.824450e-52 | 6.099266e-49 |
MsG0080048876.01 | MsG0480023216.01 | 0.872403 | 3.266508e-67 | 1.365242e-63 |
MsG0080048876.01 | MsG0480023314.01 | 0.924545 | 6.108250e-90 | 2.596646e-85 |
MsG0080048876.01 | MsG0480023351.01 | 0.844241 | 8.539379e-59 | 1.370090e-55 |
MsG0080048876.01 | MsG0480023367.01 | 0.892561 | 1.417016e-74 | 1.302479e-70 |
MsG0080048876.01 | MsG0480023384.01 | 0.823715 | 1.193024e-53 | 1.035462e-50 |
MsG0080048876.01 | MsG0480023389.01 | 0.890979 | 6.034356e-74 | 5.191431e-70 |
MsG0080048876.01 | MsG0480023395.01 | 0.803196 | 3.912393e-49 | 1.953899e-46 |
MsG0080048876.01 | MsG0480023422.01 | 0.822482 | 2.313460e-53 | 1.938851e-50 |
MsG0080048876.01 | MsG0480023444.01 | 0.848515 | 5.836800e-60 | 1.073912e-56 |
MsG0080048876.01 | MsG0480023452.01 | 0.815039 | 1.134023e-51 | 7.733568e-49 |
MsG0080048876.01 | MsG0480023553.01 | 0.811440 | 6.993345e-51 | 4.329355e-48 |
MsG0080048876.01 | MsG0480023565.01 | 0.870229 | 1.708135e-66 | 6.595053e-63 |
MsG0080048876.01 | MsG0480023569.01 | 0.843886 | 1.063435e-58 | 1.687579e-55 |
MsG0080048876.01 | MsG0480023590.01 | 0.842021 | 3.334554e-58 | 4.989746e-55 |
MsG0080048876.01 | MsG0480023650.01 | 0.809155 | 2.175433e-50 | 1.267693e-47 |
MsG0080048876.01 | MsG0480023656.01 | 0.816830 | 4.516190e-52 | 3.234593e-49 |
MsG0080048876.01 | MsG0480023661.01 | 0.888994 | 3.600766e-73 | 2.853330e-69 |
MsG0080048876.01 | MsG0480023703.01 | 0.871979 | 4.522585e-67 | 1.860021e-63 |
MsG0080048876.01 | MsG0480023845.01 | 0.887472 | 1.384817e-72 | 1.031259e-68 |
MsG0080048876.01 | MsG0480023989.01 | 0.836100 | 1.140680e-56 | 1.423012e-53 |
MsG0080048876.01 | MsG0480023990.01 | 0.860537 | 1.928281e-63 | 5.288865e-60 |
MsG0080048876.01 | MsG0480023991.01 | 0.852822 | 3.586392e-61 | 7.590188e-58 |
MsG0080048876.01 | MsG0480023992.01 | 0.842938 | 1.905072e-58 | 2.933648e-55 |
MsG0080048876.01 | MsG0580024327.01 | 0.889452 | 2.391086e-73 | 1.930187e-69 |
MsG0080048876.01 | MsG0580024385.01 | 0.839257 | 1.765796e-57 | 2.424907e-54 |
MsG0080048876.01 | MsG0580024487.01 | 0.826369 | 2.817811e-54 | 2.637495e-51 |
MsG0080048876.01 | MsG0580024679.01 | 0.908270 | 2.054559e-81 | 3.784910e-77 |
MsG0080048876.01 | MsG0580024759.01 | 0.821562 | 3.780640e-53 | 3.086480e-50 |
MsG0080048876.01 | MsG0580024836.01 | 0.821747 | 3.426240e-53 | 2.811599e-50 |
MsG0080048876.01 | MsG0580024873.01 | 0.888989 | 3.618704e-73 | 2.866942e-69 |
MsG0080048876.01 | MsG0580024944.01 | 0.828152 | 1.053657e-54 | 1.038659e-51 |
MsG0080048876.01 | MsG0580024950.01 | 0.816570 | 5.166964e-52 | 3.674433e-49 |
MsG0080048876.01 | MsG0580024982.01 | 0.831151 | 1.963917e-55 | 2.113065e-52 |
MsG0080048876.01 | MsG0580025054.01 | 0.808629 | 2.819451e-50 | 1.620070e-47 |
MsG0080048876.01 | MsG0580025097.01 | 0.821870 | 3.208166e-53 | 2.642115e-50 |
MsG0080048876.01 | MsG0580025119.01 | 0.827211 | 1.773624e-54 | 1.700996e-51 |
MsG0080048876.01 | MsG0580025256.01 | 0.828675 | 7.878510e-55 | 7.884976e-52 |
MsG0080048876.01 | MsG0580025295.01 | 0.815022 | 1.143551e-51 | 7.795097e-49 |
MsG0080048876.01 | MsG0580025366.01 | 0.836551 | 8.757729e-57 | 1.107371e-53 |
MsG0080048876.01 | MsG0580025411.01 | 0.837722 | 4.394322e-57 | 5.758906e-54 |
MsG0080048876.01 | MsG0580025502.01 | 0.864631 | 1.058337e-64 | 3.346183e-61 |
MsG0080048876.01 | MsG0580025513.01 | 0.831767 | 1.385184e-55 | 1.518100e-52 |
MsG0080048876.01 | MsG0580025561.01 | -0.803720 | 3.046842e-49 | 1.542203e-46 |
MsG0080048876.01 | MsG0580025588.01 | 0.809846 | 1.546328e-50 | 9.177657e-48 |
MsG0080048876.01 | MsG0580025589.01 | 0.825447 | 4.664986e-54 | 4.252807e-51 |
MsG0080048876.01 | MsG0580025607.01 | 0.813176 | 2.921801e-51 | 1.894389e-48 |
MsG0080048876.01 | MsG0580025627.01 | 0.819761 | 9.800971e-53 | 7.610665e-50 |
MsG0080048876.01 | MsG0580025668.01 | 0.846091 | 2.699960e-59 | 4.595178e-56 |
MsG0080048876.01 | MsG0580025738.01 | 0.813243 | 2.825299e-51 | 1.835129e-48 |
MsG0080048876.01 | MsG0580025828.01 | 0.834754 | 2.496047e-56 | 2.989925e-53 |
MsG0080048876.01 | MsG0580025845.01 | 0.880585 | 4.860907e-70 | 2.756250e-66 |
MsG0080048876.01 | MsG0580025859.01 | 0.880563 | 4.951180e-70 | 2.804887e-66 |
MsG0080048876.01 | MsG0580025906.01 | 0.829456 | 5.096925e-55 | 5.219196e-52 |
MsG0080048876.01 | MsG0580025971.01 | 0.872130 | 4.028480e-67 | 1.666355e-63 |
MsG0080048876.01 | MsG0580025992.01 | 0.817128 | 3.871880e-52 | 2.795798e-49 |
MsG0080048876.01 | MsG0580025997.01 | 0.803827 | 2.895160e-49 | 1.469500e-46 |
MsG0080048876.01 | MsG0580026206.01 | 0.816387 | 5.676735e-52 | 4.016821e-49 |
MsG0080048876.01 | MsG0580026271.01 | 0.863748 | 1.994760e-64 | 6.114447e-61 |
MsG0080048876.01 | MsG0580027082.01 | 0.804027 | 2.630426e-49 | 1.342049e-46 |
MsG0080048876.01 | MsG0580027236.01 | 0.811015 | 8.647533e-51 | 5.294050e-48 |
MsG0080048876.01 | MsG0580027394.01 | 0.894489 | 2.349888e-75 | 2.341030e-71 |
MsG0080048876.01 | MsG0580027725.01 | 0.826141 | 3.192127e-54 | 2.968473e-51 |
MsG0080048876.01 | MsG0580027763.01 | 0.826280 | 2.959021e-54 | 2.762589e-51 |
MsG0080048876.01 | MsG0580027887.01 | 0.856386 | 3.331424e-62 | 7.938315e-59 |
MsG0080048876.01 | MsG0580027979.01 | 0.829402 | 5.252199e-55 | 5.370171e-52 |
MsG0080048876.01 | MsG0580027983.01 | 0.859568 | 3.780074e-63 | 1.002703e-59 |
MsG0080048876.01 | MsG0580028024.01 | 0.858277 | 9.198613e-63 | 2.335057e-59 |
MsG0080048876.01 | MsG0580028033.01 | 0.815568 | 8.650293e-52 | 5.985270e-49 |
MsG0080048876.01 | MsG0580028059.01 | 0.888682 | 4.755627e-73 | 3.720546e-69 |
MsG0080048876.01 | MsG0580028073.01 | 0.855353 | 6.679246e-62 | 1.537960e-58 |
MsG0080048876.01 | MsG0580028111.01 | 0.870568 | 1.322539e-66 | 5.168837e-63 |
MsG0080048876.01 | MsG0580028306.01 | 0.836369 | 9.743026e-57 | 1.225345e-53 |
MsG0080048876.01 | MsG0580028310.01 | 0.810850 | 9.389946e-51 | 5.722970e-48 |
MsG0080048876.01 | MsG0580028335.01 | 0.883478 | 4.336863e-71 | 2.753971e-67 |
MsG0080048876.01 | MsG0580028461.01 | 0.840102 | 1.064350e-57 | 1.500528e-54 |
MsG0080048876.01 | MsG0580028598.01 | 0.829203 | 5.871742e-55 | 5.968924e-52 |
MsG0080048876.01 | MsG0580028723.01 | 0.834519 | 2.860743e-56 | 3.403329e-53 |
MsG0080048876.01 | MsG0580028800.01 | 0.820802 | 5.658618e-53 | 4.522846e-50 |
MsG0080048876.01 | MsG0580028846.01 | 0.819139 | 1.358897e-52 | 1.036987e-49 |
MsG0080048876.01 | MsG0580028853.01 | 0.807561 | 4.760022e-50 | 2.659639e-47 |
MsG0080048876.01 | MsG0580028925.01 | 0.802114 | 6.540986e-49 | 3.177690e-46 |
MsG0080048876.01 | MsG0580029325.01 | 0.812262 | 4.631321e-51 | 2.930879e-48 |
MsG0080048876.01 | MsG0580029354.01 | 0.852373 | 4.817770e-61 | 1.004633e-57 |
MsG0080048876.01 | MsG0580029414.01 | 0.823495 | 1.343540e-53 | 1.158713e-50 |
MsG0080048876.01 | MsG0580029529.01 | 0.848069 | 7.749694e-60 | 1.405116e-56 |
MsG0080048876.01 | MsG0580029605.01 | 0.871184 | 8.291180e-67 | 3.313642e-63 |
MsG0080048876.01 | MsG0580029734.01 | 0.803923 | 2.764982e-49 | 1.406991e-46 |
MsG0080048876.01 | MsG0580029753.01 | 0.845011 | 5.296992e-59 | 8.707842e-56 |
MsG0080048876.01 | MsG0580029862.01 | 0.859917 | 2.968355e-63 | 7.970241e-60 |
MsG0080048876.01 | MsG0580029878.01 | 0.841253 | 5.315411e-58 | 7.764574e-55 |
MsG0080048876.01 | MsG0580029967.01 | 0.863507 | 2.370488e-64 | 7.203465e-61 |
MsG0080048876.01 | MsG0680030286.01 | 0.812056 | 5.135985e-51 | 3.231873e-48 |
MsG0080048876.01 | MsG0680030290.01 | 0.808470 | 3.049358e-50 | 1.745062e-47 |
MsG0080048876.01 | MsG0680030464.01 | 0.805347 | 1.394710e-49 | 7.361511e-47 |
MsG0080048876.01 | MsG0680030477.01 | 0.806438 | 8.227443e-50 | 4.465577e-47 |
MsG0080048876.01 | MsG0680030516.01 | 0.872171 | 3.902077e-67 | 1.616528e-63 |
MsG0080048876.01 | MsG0680030627.01 | 0.900999 | 4.171711e-78 | 5.523397e-74 |
MsG0080048876.01 | MsG0680030858.01 | 0.877045 | 8.604549e-69 | 4.265055e-65 |
MsG0080048876.01 | MsG0680030957.01 | 0.858420 | 8.338483e-63 | 2.126944e-59 |
MsG0080048876.01 | MsG0680031010.01 | 0.847745 | 9.519124e-60 | 1.708592e-56 |
MsG0080048876.01 | MsG0680031115.01 | 0.864112 | 1.536668e-64 | 4.769396e-61 |
MsG0080048876.01 | MsG0680031146.01 | 0.800606 | 1.331755e-48 | 6.227534e-46 |
MsG0080048876.01 | MsG0680031469.01 | 0.839752 | 1.312800e-57 | 1.830415e-54 |
MsG0080048876.01 | MsG0680031689.01 | 0.876510 | 1.318367e-68 | 6.409245e-65 |
MsG0080048876.01 | MsG0680031715.01 | 0.860925 | 1.470060e-63 | 4.086138e-60 |
MsG0080048876.01 | MsG0680032006.01 | 0.837038 | 6.580652e-57 | 8.444209e-54 |
MsG0080048876.01 | MsG0680032055.01 | 0.825881 | 3.680230e-54 | 3.397277e-51 |
MsG0080048876.01 | MsG0680032057.01 | 0.894646 | 2.027044e-75 | 2.033167e-71 |
MsG0080048876.01 | MsG0680032238.01 | 0.888030 | 8.472875e-73 | 6.454175e-69 |
MsG0080048876.01 | MsG0680032515.01 | 0.840103 | 1.063558e-57 | 1.499455e-54 |
MsG0080048876.01 | MsG0680032520.01 | 0.856928 | 2.308568e-62 | 5.599980e-59 |
MsG0080048876.01 | MsG0680032554.01 | 0.838883 | 2.207297e-57 | 2.996781e-54 |
MsG0080048876.01 | MsG0680032559.01 | 0.854610 | 1.097255e-61 | 2.464547e-58 |
MsG0080048876.01 | MsG0680032651.01 | 0.829089 | 6.256245e-55 | 6.337709e-52 |
MsG0080048876.01 | MsG0680032830.01 | 0.832064 | 1.170104e-55 | 1.293500e-52 |
MsG0080048876.01 | MsG0680032954.01 | 0.810581 | 1.073623e-50 | 6.496300e-48 |
MsG0080048876.01 | MsG0680033377.01 | 0.902543 | 8.709144e-79 | 1.239551e-74 |
MsG0080048876.01 | MsG0680034040.01 | 0.805542 | 1.269621e-49 | 6.734665e-47 |
MsG0080048876.01 | MsG0680034064.01 | 0.890957 | 6.157830e-74 | 5.292233e-70 |
MsG0080048876.01 | MsG0680034766.01 | 0.812786 | 3.558854e-51 | 2.283444e-48 |
MsG0080048876.01 | MsG0680034767.01 | 0.825434 | 4.697128e-54 | 4.280610e-51 |
MsG0080048876.01 | MsG0680035307.01 | 0.805979 | 1.027673e-49 | 5.513188e-47 |
MsG0080048876.01 | MsG0680035308.01 | 0.802164 | 6.389089e-49 | 3.107910e-46 |
MsG0080048876.01 | MsG0680035731.01 | 0.917222 | 6.902747e-86 | 1.970058e-81 |
MsG0080048876.01 | MsG0680035789.01 | 0.841943 | 3.496106e-58 | 5.218693e-55 |
MsG0080048876.01 | MsG0680035791.01 | 0.896594 | 3.177021e-76 | 3.460594e-72 |
MsG0080048876.01 | MsG0680035859.01 | 0.822574 | 2.202435e-53 | 1.850810e-50 |
MsG0080048876.01 | MsG0780035992.01 | 0.852850 | 3.520530e-61 | 7.457577e-58 |
MsG0080048876.01 | MsG0780036243.01 | 0.824596 | 7.407198e-54 | 6.591860e-51 |
MsG0080048876.01 | MsG0780036385.01 | 0.846691 | 1.852421e-59 | 3.214832e-56 |
MsG0080048876.01 | MsG0780036443.01 | 0.819826 | 9.470949e-53 | 7.367734e-50 |
MsG0080048876.01 | MsG0780036517.01 | 0.802957 | 4.384612e-49 | 2.176328e-46 |
MsG0080048876.01 | MsG0780036660.01 | 0.809923 | 1.488569e-50 | 8.852775e-48 |
MsG0080048876.01 | MsG0780036711.01 | 0.819586 | 1.074488e-52 | 8.303004e-50 |
MsG0080048876.01 | MsG0780036715.01 | 0.858779 | 6.519000e-63 | 1.683046e-59 |
MsG0080048876.01 | MsG0780037119.01 | 0.849473 | 3.162553e-60 | 6.001737e-57 |
MsG0080048876.01 | MsG0780037157.01 | 0.820732 | 5.871914e-53 | 4.683990e-50 |
MsG0080048876.01 | MsG0780037184.01 | 0.893653 | 5.145618e-75 | 4.947224e-71 |
MsG0080048876.01 | MsG0780037395.01 | 0.801783 | 7.652092e-49 | 3.686266e-46 |
MsG0080048876.01 | MsG0780037638.01 | 0.852467 | 4.528680e-61 | 9.471211e-58 |
MsG0080048876.01 | MsG0780037662.01 | 0.818142 | 2.286778e-52 | 1.697813e-49 |
MsG0080048876.01 | MsG0780037705.01 | 0.822101 | 2.835911e-53 | 2.350839e-50 |
MsG0080048876.01 | MsG0780038341.01 | 0.815221 | 1.033307e-51 | 7.081336e-49 |
MsG0080048876.01 | MsG0780038351.01 | 0.841764 | 3.899396e-58 | 5.787989e-55 |
MsG0080048876.01 | MsG0780038571.01 | 0.869015 | 4.248319e-66 | 1.569582e-62 |
MsG0080048876.01 | MsG0780038616.01 | 0.899779 | 1.413550e-77 | 1.773433e-73 |
MsG0080048876.01 | MsG0780038784.01 | 0.903447 | 3.437247e-79 | 5.091370e-75 |
MsG0080048876.01 | MsG0780038807.01 | 0.851170 | 1.056558e-60 | 2.119907e-57 |
MsG0080048876.01 | MsG0780038839.01 | 0.806910 | 6.538904e-50 | 3.592407e-47 |
MsG0080048876.01 | MsG0780039186.01 | 0.834209 | 3.420573e-56 | 4.031231e-53 |
MsG0080048876.01 | MsG0780039675.01 | 0.886699 | 2.724719e-72 | 1.967099e-68 |
MsG0080048876.01 | MsG0780039707.01 | 0.845951 | 2.947931e-59 | 4.995065e-56 |
MsG0080048876.01 | MsG0780039746.01 | 0.916919 | 9.973497e-86 | 2.806282e-81 |
MsG0080048876.01 | MsG0780039853.01 | 0.882719 | 8.225456e-71 | 5.064752e-67 |
MsG0080048876.01 | MsG0780039975.01 | 0.869125 | 3.912715e-66 | 1.451743e-62 |
MsG0080048876.01 | MsG0780039988.01 | 0.874680 | 5.587807e-68 | 2.537691e-64 |
MsG0080048876.01 | MsG0780040061.01 | 0.859427 | 4.166960e-63 | 1.100148e-59 |
MsG0080048876.01 | MsG0780040080.01 | 0.800915 | 1.151839e-48 | 5.428855e-46 |
MsG0080048876.01 | MsG0780040251.01 | 0.840243 | 9.778266e-58 | 1.384464e-54 |
MsG0080048876.01 | MsG0780040284.01 | 0.918601 | 1.273622e-86 | 3.910943e-82 |
MsG0080048876.01 | MsG0780040315.01 | 0.802372 | 5.788495e-49 | 2.830876e-46 |
MsG0080048876.01 | MsG0780040331.01 | 0.869042 | 4.164705e-66 | 1.540364e-62 |
MsG0080048876.01 | MsG0780040343.01 | 0.823794 | 1.143067e-53 | 9.942620e-51 |
MsG0080048876.01 | MsG0780040388.01 | 0.854565 | 1.130883e-61 | 2.536248e-58 |
MsG0080048876.01 | MsG0780040443.01 | 0.819359 | 1.210816e-52 | 9.296313e-50 |
MsG0080048876.01 | MsG0780040484.01 | 0.810049 | 1.398461e-50 | 8.344258e-48 |
MsG0080048876.01 | MsG0780040567.01 | 0.834168 | 3.502171e-56 | 4.122101e-53 |
MsG0080048876.01 | MsG0780040825.01 | -0.807518 | 4.859792e-50 | 2.712543e-47 |
MsG0080048876.01 | MsG0780040884.01 | 0.839346 | 1.673941e-57 | 2.305222e-54 |
MsG0080048876.01 | MsG0780040972.01 | 0.865292 | 6.563050e-65 | 2.124073e-61 |
MsG0080048876.01 | MsG0780041091.01 | 0.802960 | 4.376735e-49 | 2.172639e-46 |
MsG0080048876.01 | MsG0780041138.01 | 0.894658 | 2.005143e-75 | 2.012269e-71 |
MsG0080048876.01 | MsG0780041159.01 | 0.810071 | 1.382824e-50 | 8.255758e-48 |
MsG0080048876.01 | MsG0780041174.01 | 0.871150 | 8.508258e-67 | 3.395728e-63 |
MsG0080048876.01 | MsG0780041175.01 | 0.821815 | 3.304216e-53 | 2.717044e-50 |
MsG0080048876.01 | MsG0780041272.01 | 0.802972 | 4.353190e-49 | 2.161491e-46 |
MsG0080048876.01 | MsG0780041289.01 | 0.835102 | 2.040198e-56 | 2.469531e-53 |
MsG0080048876.01 | MsG0780041302.01 | 0.800437 | 1.442155e-48 | 6.714941e-46 |
MsG0080048876.01 | MsG0780041442.01 | 0.818990 | 1.469200e-52 | 1.116770e-49 |
MsG0080048876.01 | MsG0780041480.01 | 0.879431 | 1.253297e-69 | 6.793598e-66 |
MsG0080048876.01 | MsG0880041931.01 | 0.871569 | 6.182778e-67 | 2.505946e-63 |
MsG0080048876.01 | MsG0880041946.01 | 0.858761 | 6.600264e-63 | 1.702967e-59 |
MsG0080048876.01 | MsG0880041947.01 | 0.889672 | 1.964675e-73 | 1.600489e-69 |
MsG0080048876.01 | MsG0880041954.01 | 0.802008 | 6.876942e-49 | 3.331920e-46 |
MsG0080048876.01 | MsG0880042044.01 | 0.811831 | 5.750895e-51 | 3.596915e-48 |
MsG0080048876.01 | MsG0880042290.01 | 0.848660 | 5.320512e-60 | 9.834472e-57 |
MsG0080048876.01 | MsG0880042475.01 | 0.872337 | 3.437528e-67 | 1.432959e-63 |
MsG0080048876.01 | MsG0880042555.01 | 0.862100 | 6.437014e-64 | 1.862827e-60 |
MsG0080048876.01 | MsG0880042890.01 | 0.899542 | 1.787095e-77 | 2.220323e-73 |
MsG0080048876.01 | MsG0880042894.01 | 0.866703 | 2.348828e-65 | 7.991903e-62 |
MsG0080048876.01 | MsG0880042931.01 | 0.824808 | 6.602968e-54 | 5.911857e-51 |
MsG0080048876.01 | MsG0880043009.01 | 0.816861 | 4.445214e-52 | 3.186501e-49 |
MsG0080048876.01 | MsG0880043032.01 | 0.829839 | 4.113042e-55 | 4.259833e-52 |
MsG0080048876.01 | MsG0880043075.01 | 0.832169 | 1.102222e-55 | 1.222086e-52 |
MsG0080048876.01 | MsG0880043249.01 | 0.836341 | 9.902468e-57 | 1.244431e-53 |
MsG0080048876.01 | MsG0880043250.01 | 0.812711 | 3.694674e-51 | 2.366091e-48 |
MsG0080048876.01 | MsG0880043277.01 | 0.880911 | 3.715838e-70 | 2.133050e-66 |
MsG0080048876.01 | MsG0880043278.01 | 0.860477 | 2.009610e-63 | 5.501059e-60 |
MsG0080048876.01 | MsG0880043417.01 | 0.808906 | 2.459686e-50 | 1.423716e-47 |
MsG0080048876.01 | MsG0880043814.01 | 0.850517 | 1.613300e-60 | 3.168021e-57 |
MsG0080048876.01 | MsG0880043965.01 | 0.821778 | 3.368581e-53 | 2.767045e-50 |
MsG0080048876.01 | MsG0880044005.01 | 0.808809 | 2.580869e-50 | 1.489999e-47 |
MsG0080048876.01 | MsG0880044142.01 | 0.801031 | 1.090937e-48 | 5.157003e-46 |
MsG0080048876.01 | MsG0880044228.01 | 0.900373 | 7.816402e-78 | 1.008266e-73 |
MsG0080048876.01 | MsG0880044314.01 | 0.830304 | 3.167564e-55 | 3.324190e-52 |
MsG0080048876.01 | MsG0880044352.01 | 0.805397 | 1.361493e-49 | 7.195379e-47 |
MsG0080048876.01 | MsG0880044392.01 | 0.909955 | 3.211157e-82 | 6.405238e-78 |
MsG0080048876.01 | MsG0880044414.01 | 0.903471 | 3.350956e-79 | 4.968099e-75 |
MsG0080048876.01 | MsG0880044487.01 | 0.850118 | 2.088247e-60 | 4.047578e-57 |
MsG0080048876.01 | MsG0880044604.01 | 0.805570 | 1.252557e-49 | 6.649025e-47 |
MsG0080048876.01 | MsG0880044691.01 | 0.818871 | 1.563112e-52 | 1.184161e-49 |
MsG0080048876.01 | MsG0880044884.01 | 0.833551 | 4.997273e-56 | 5.774619e-53 |
MsG0080048876.01 | MsG0880044985.01 | 0.829139 | 6.083155e-55 | 6.171415e-52 |
MsG0080048876.01 | MsG0880045101.01 | 0.892141 | 2.086984e-74 | 1.883156e-70 |
MsG0080048876.01 | MsG0880045158.01 | 0.848666 | 5.298655e-60 | 9.796201e-57 |
MsG0080048876.01 | MsG0880045361.01 | 0.870320 | 1.595190e-66 | 6.179085e-63 |
MsG0080048876.01 | MsG0880045558.01 | 0.860615 | 1.825507e-63 | 5.020409e-60 |
MsG0080048876.01 | MsG0880045662.01 | 0.800240 | 1.581349e-48 | 7.326148e-46 |
MsG0080048876.01 | MsG0880045668.01 | 0.816219 | 6.191699e-52 | 4.361242e-49 |
MsG0080048876.01 | MsG0880046054.01 | 0.882625 | 8.906040e-71 | 5.461999e-67 |
MsG0080048876.01 | MsG0880046104.01 | 0.818473 | 1.924451e-52 | 1.441996e-49 |
MsG0080048876.01 | MsG0880046255.01 | 0.826174 | 3.135899e-54 | 2.918907e-51 |
MsG0080048876.01 | MsG0880046267.01 | 0.891840 | 2.749305e-74 | 2.450285e-70 |
MsG0080048876.01 | MsG0880046382.01 | 0.866378 | 2.979204e-65 | 1.001927e-61 |
MsG0080048876.01 | MsG0880046583.01 | 0.803307 | 3.711063e-49 | 1.858559e-46 |
MsG0080048876.01 | MsG0880046764.01 | 0.867852 | 1.008475e-65 | 3.572394e-62 |
MsG0080048876.01 | MsG0880046765.01 | 0.890536 | 9.020076e-74 | 7.615334e-70 |
MsG0080048876.01 | MsG0880046791.01 | 0.879860 | 8.826805e-70 | 4.863675e-66 |
MsG0080048876.01 | MsG0880046866.01 | 0.824472 | 7.923908e-54 | 7.025295e-51 |
MsG0080048876.01 | MsG0880046867.01 | 0.857203 | 1.915834e-62 | 4.691047e-59 |
MsG0080048876.01 | MsG0880047156.01 | 0.849339 | 3.446246e-60 | 6.512918e-57 |
MsG0080048876.01 | MsG0880047157.01 | 0.808071 | 3.707615e-50 | 2.099509e-47 |
MsG0080048876.01 | MsG0880047160.01 | 0.810625 | 1.050258e-50 | 6.362504e-48 |
MsG0080048876.01 | MsG0880047168.01 | 0.801747 | 7.782316e-49 | 3.745602e-46 |
MsG0080048876.01 | MsG0880047234.01 | 0.893468 | 6.114847e-75 | 5.831824e-71 |
MsG0080048876.01 | MsG0880047325.01 | 0.827627 | 1.409353e-54 | 1.367898e-51 |
MsG0080048876.01 | MsG0880047394.01 | 0.806451 | 8.172281e-50 | 4.437316e-47 |
MsG0080048876.01 | MsG0880047407.01 | 0.807894 | 4.044075e-50 | 2.279304e-47 |
MsG0080048876.01 | MsG0880047422.01 | -0.841511 | 4.545408e-58 | 6.694222e-55 |
MsG0080048876.01 | MsG0880047442.01 | 0.808642 | 2.802062e-50 | 1.610618e-47 |
MsG0080048876.01 | MsG0880047451.01 | 0.853218 | 2.762905e-61 | 5.926354e-58 |
MsG0080048876.01 | MsG0880047567.01 | 0.864865 | 8.936796e-65 | 2.847939e-61 |
MsG0080048876.01 | MsG0880047587.01 | 0.864437 | 1.216729e-64 | 3.820311e-61 |
MsG0080048876.01 | MsG0880047616.01 | 0.875794 | 2.327201e-68 | 1.101354e-64 |
MsG0080048876.01 | MsG0880047656.01 | 0.875397 | 3.182076e-68 | 1.483272e-64 |
MsG0080048876.01 | MsG0880047669.01 | 0.800632 | 1.315786e-48 | 6.156982e-46 |
MsG0080048876.01 | MsG0880047670.01 | 0.838509 | 2.757055e-57 | 3.700785e-54 |
MsG0080048876.01 | MsG0880047703.01 | 0.835806 | 1.354250e-56 | 1.674337e-53 |
MsG0080048876.01 | MsG0880047719.01 | 0.860641 | 1.792665e-63 | 4.934538e-60 |
MsG0080048876.01 | MsG0880047770.01 | 0.816634 | 4.997287e-52 | 3.560011e-49 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048876.01.T01 | MTR_8g009900 | 97.884 | 567 | 12 | 0 | 2 | 568 | 1 | 567 | 0.0 | 1152 |
MsG0080048876.01.T01 | MTR_8g009900 | 96.512 | 430 | 15 | 0 | 2 | 431 | 1 | 430 | 0.0 | 868 |
MsG0080048876.01.T01 | MTR_1g085150 | 26.457 | 223 | 133 | 7 | 56 | 268 | 227 | 428 | 2.56e-13 | 73.6 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048876.01.T01 | AT5G64050 | 74.431 | 571 | 138 | 5 | 3 | 568 | 1 | 568 | 0.0 | 886 |
MsG0080048876.01.T01 | AT5G26710 | 26.724 | 232 | 148 | 7 | 56 | 283 | 214 | 427 | 5.16e-13 | 72.4 |
Find 22 sgRNAs with CRISPR-Local
Find 399 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
AAATGCTTAGAGAAATTAAT+TGG | 0.191605 | contig503end:+15287 | MsG0080048876.01.T01:exon |
CTCCTTCACAACATGATCTT+TGG | 0.266362 | contig503end:-15320 | MsG0080048876.01.T01:intergenic |
AAACTCCATGGACCAGATAT+TGG | 0.289795 | contig503end:+15178 | MsG0080048876.01.T01:exon |
AACTCCATGGACCAGATATT+GGG | 0.299502 | contig503end:+15179 | MsG0080048876.01.T01:exon |
CATTATTACTAAACATTCCT+TGG | 0.373898 | contig503end:-15483 | MsG0080048876.01.T01:intergenic |
ACAACAGCTGCCCCAATATC+TGG | 0.383804 | contig503end:-15190 | MsG0080048876.01.T01:intergenic |
GTTGTCTTGCTTTATCAAGC+TGG | 0.384143 | contig503end:+15208 | MsG0080048876.01.T01:exon |
CTTTATCAAGCTGGGACTAC+TGG | 0.394232 | contig503end:+15217 | MsG0080048876.01.T01:exon |
TTGTCTTGCTTTATCAAGCT+GGG | 0.434211 | contig503end:+15209 | MsG0080048876.01.T01:exon |
AATGCTTAGAGAAATTAATT+GGG | 0.440402 | contig503end:+15288 | MsG0080048876.01.T01:exon |
ATTGTCACAAAGCTAACTTC+AGG | 0.482993 | contig503end:-15250 | MsG0080048876.01.T01:intergenic |
CTGCCCCAATATCTGGTCCA+TGG | 0.542521 | contig503end:-15183 | MsG0080048876.01.T01:intergenic |
CCACTTCGGCTCCTACTGAC+CGG | 0.557406 | contig503end:+15154 | MsG0080048876.01.T01:exon |
AATCACTCTTCATGCCACTT+CGG | 0.560806 | contig503end:+15140 | MsG0080048876.01.T01:exon |
CTACTGACCGGAAAACTCCA+TGG | 0.570865 | contig503end:+15166 | MsG0080048876.01.T01:exon |
GTCCAAAGATCATGTTGTGA+AGG | 0.579139 | contig503end:+15318 | MsG0080048876.01.T01:exon |
CCGGTCAGTAGGAGCCGAAG+TGG | 0.598440 | contig503end:-15154 | MsG0080048876.01.T01:intergenic |
TCGTGTTATCAGATAGACCT+TGG | 0.607713 | contig503end:-15375 | MsG0080048876.01.T01:intergenic |
TGTTATCAGATAGACCTTGG+AGG | 0.624886 | contig503end:-15372 | MsG0080048876.01.T01:intergenic |
TAATTGAGAATTCACCTCCA+AGG | 0.626877 | contig503end:+15358 | MsG0080048876.01.T01:exon |
ACTCCATGGACCAGATATTG+GGG | 0.653253 | contig503end:+15180 | MsG0080048876.01.T01:exon |
AGGTCTATCTGATAACACGA+TGG | 0.724651 | contig503end:+15378 | MsG0080048876.01.T01:exon |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!! | ATAAAAAAAAAAATGGATAA+GGG | - | contig503end:12357-12376 | MsG0080048876.01.T01:intergenic | 10.0% |
!! | ATTATTATTTATTTATTGGA+AGG | - | contig503end:14088-14107 | MsG0080048876.01.T01:intergenic | 10.0% |
!! | TGTAAAAAGTTATTAATATA+GGG | + | contig503end:13323-13342 | MsG0080048876.01.T01:intron | 10.0% |
!!! | AAAAAATCAATTTTTTATTC+TGG | + | contig503end:10634-10653 | MsG0080048876.01.T01:intron | 10.0% |
!!! | AAAAATCAATTTTTTATTCT+GGG | + | contig503end:10635-10654 | MsG0080048876.01.T01:intron | 10.0% |
!!! | AAAAATTCAATTTTTAATTC+TGG | + | contig503end:10521-10540 | MsG0080048876.01.T01:intron | 10.0% |
!!! | AAAAATTCAATTTTTATTTC+TGG | + | contig503end:10378-10397 | MsG0080048876.01.T01:intron | 10.0% |
!!! | AAAATTCAATTTTTAATTCT+GGG | + | contig503end:10522-10541 | MsG0080048876.01.T01:intron | 10.0% |
!!! | AAAATTCAATTTTTATTTCT+GGG | + | contig503end:10379-10398 | MsG0080048876.01.T01:intron | 10.0% |
!!! | AATATATATTTTCAATTTTG+AGG | + | contig503end:11438-11457 | MsG0080048876.01.T01:intron | 10.0% |
!!! | ATTTTTTTTTTTTGATCTTA+GGG | + | contig503end:13175-13194 | MsG0080048876.01.T01:intron | 10.0% |
!!! | GCTTTTTTTTTTTTAAATTT+CGG | + | contig503end:14616-14635 | MsG0080048876.01.T01:intron | 10.0% |
!!! | TATGTATATATTAATCTTTT+TGG | + | contig503end:14523-14542 | MsG0080048876.01.T01:intron | 10.0% |
!!! | TATTTTTTTTTTTTGATCTT+AGG | + | contig503end:13174-13193 | MsG0080048876.01.T01:intron | 10.0% |
!!! | TTTCTTTATACTTTTTAATT+AGG | + | contig503end:14123-14142 | MsG0080048876.01.T01:intron | 10.0% |
!! | AAAAAACAGAATTTGATTAT+GGG | + | contig503end:10738-10757 | MsG0080048876.01.T01:intron | 15.0% |
!! | CTGTAAAAAGTTATTAATAT+AGG | + | contig503end:13322-13341 | MsG0080048876.01.T01:intron | 15.0% |
!! | GATAAAAAAAAAAATGGATA+AGG | - | contig503end:12358-12377 | MsG0080048876.01.T01:intergenic | 15.0% |
!! | TACCAAGATAAAAAAAAAAA+TGG | - | contig503end:12364-12383 | MsG0080048876.01.T01:intergenic | 15.0% |
!! | TCTGAATTACAAATAATTTA+CGG | - | contig503end:12847-12866 | MsG0080048876.01.T01:intergenic | 15.0% |
!! | TTATTTATTCATAGAAAGTA+GGG | - | contig503end:13899-13918 | MsG0080048876.01.T01:intergenic | 15.0% |
!! | TTTATTTATTCATAGAAAGT+AGG | - | contig503end:13900-13919 | MsG0080048876.01.T01:intergenic | 15.0% |
!!! | AAATATGTTGATAATCTTAT+AGG | + | contig503end:15114-15133 | MsG0080048876.01.T01:intron | 15.0% |
!!! | AATATGTTGATAATCTTATA+GGG | + | contig503end:15115-15134 | MsG0080048876.01.T01:intron | 15.0% |
!!! | ATCCATTTTTTTTTTTATCT+TGG | + | contig503end:12359-12378 | MsG0080048876.01.T01:intron | 15.0% |
!!! | GGTTTTCTATTTTTAATATT+GGG | + | contig503end:10432-10451 | MsG0080048876.01.T01:intron | 15.0% |
!!! | TGCAATACATTTTTTTTTTA+TGG | - | contig503end:13872-13891 | MsG0080048876.01.T01:intergenic | 15.0% |
!!! | TTGGGTTTTATTTATATATT+TGG | + | contig503end:10973-10992 | MsG0080048876.01.T01:intron | 15.0% |
!!! | TTTCCTTTATACTTTTAATT+AGG | + | contig503end:14292-14311 | MsG0080048876.01.T01:intron | 15.0% |
!! | AAAAAGCAAAAAGAAATTGA+GGG | - | contig503end:10351-10370 | MsG0080048876.01.T01:intergenic | 20.0% |
!! | AAAGAAAATATAAACGAACA+AGG | - | contig503end:14909-14928 | MsG0080048876.01.T01:intergenic | 20.0% |
!! | AAATGCTTAGAGAAATTAAT+TGG | + | contig503end:15287-15306 | MsG0080048876.01.T01:exon | 20.0% |
!! | AAGAAAATATAAACGAACAA+GGG | - | contig503end:14908-14927 | MsG0080048876.01.T01:intergenic | 20.0% |
!! | AATGCTTAGAGAAATTAATT+GGG | + | contig503end:15288-15307 | MsG0080048876.01.T01:exon | 20.0% |
!! | ATTAATATAGGGACTAAAAT+TGG | + | contig503end:13334-13353 | MsG0080048876.01.T01:intron | 20.0% |
!! | CATATATTGAAAATAGAAAC+AGG | + | contig503end:11606-11625 | MsG0080048876.01.T01:intron | 20.0% |
!! | GAAAAAACAGAATTTGATTA+TGG | + | contig503end:10737-10756 | MsG0080048876.01.T01:intron | 20.0% |
!! | GAGCTTACATTATAAATTAA+AGG | - | contig503end:13496-13515 | MsG0080048876.01.T01:intergenic | 20.0% |
!! | GATATTATAACAACATACAT+TGG | + | contig503end:11460-11479 | MsG0080048876.01.T01:intron | 20.0% |
!! | TACTATATTGAAGATAAAGT+GGG | + | contig503end:13943-13962 | MsG0080048876.01.T01:intron | 20.0% |
!! | TTACTATATTGAAGATAAAG+TGG | + | contig503end:13942-13961 | MsG0080048876.01.T01:intron | 20.0% |
!! | TTTACAATATATTTGACCTA+TGG | + | contig503end:11683-11702 | MsG0080048876.01.T01:intron | 20.0% |
!!! | AATTTTATTTGTCTTTACAC+AGG | + | contig503end:12129-12148 | MsG0080048876.01.T01:intron | 20.0% |
!!! | AGTAATTTTTAAACTTCCTT+TGG | - | contig503end:12293-12312 | MsG0080048876.01.T01:intergenic | 20.0% |
!!! | ATATTTGGTGATATTTGTTT+TGG | + | contig503end:10988-11007 | MsG0080048876.01.T01:intron | 20.0% |
!!! | CTAATTTTGTAATTTTACCA+AGG | + | contig503end:15466-15485 | MsG0080048876.01.T01:exon | 20.0% |
!!! | CTGTTTCTATTTTCAATATA+TGG | - | contig503end:11608-11627 | MsG0080048876.01.T01:intergenic | 20.0% |
!!! | CTTTATACTTTTTAATTAGG+TGG | + | contig503end:14126-14145 | MsG0080048876.01.T01:intron | 20.0% |
!!! | GGGTTTTCTATTTTTAATAT+TGG | + | contig503end:10431-10450 | MsG0080048876.01.T01:intron | 20.0% |
!!! | GTAATTTTTAAACTTCCTTT+GGG | - | contig503end:12292-12311 | MsG0080048876.01.T01:intergenic | 20.0% |
!!! | GTTATGATTTTTTATGTTCT+GGG | + | contig503end:10553-10572 | MsG0080048876.01.T01:intron | 20.0% |
!!! | GTTTTAATTTTGTATGTTCT+GGG | + | contig503end:10769-10788 | MsG0080048876.01.T01:intron | 20.0% |
!!! | TAATTTTTAAACTTCCTTTG+GGG | - | contig503end:12291-12310 | MsG0080048876.01.T01:intergenic | 20.0% |
!!! | TATAATCTTTTATAGCATCT+TGG | + | contig503end:12937-12956 | MsG0080048876.01.T01:intron | 20.0% |
!!! | TCTATTTTTAATATTGGGTT+TGG | + | contig503end:10437-10456 | MsG0080048876.01.T01:intron | 20.0% |
!!! | TGTTTCTTTAATCGAATTTT+TGG | + | contig503end:14928-14947 | MsG0080048876.01.T01:intron | 20.0% |
!!! | TTCTATTTTCAATATATGGA+GGG | - | contig503end:11604-11623 | MsG0080048876.01.T01:intergenic | 20.0% |
!!! | TTTAGTTCCTATATAAATCT+TGG | + | contig503end:13244-13263 | MsG0080048876.01.T01:intron | 20.0% |
!!! | TTTCTATTTTCAATATATGG+AGG | - | contig503end:11605-11624 | MsG0080048876.01.T01:intergenic | 20.0% |
! | AAAAAAAAAATGGATAAGGG+CGG | - | contig503end:12354-12373 | MsG0080048876.01.T01:intergenic | 25.0% |
! | AATAACTACCTAGCATTATT+AGG | + | contig503end:13613-13632 | MsG0080048876.01.T01:CDS | 25.0% |
! | ACAATCAATAAAAGGAGATA+TGG | - | contig503end:14653-14672 | MsG0080048876.01.T01:intergenic | 25.0% |
! | ATAAGGACCAAGATTTATAT+AGG | - | contig503end:13254-13273 | MsG0080048876.01.T01:intergenic | 25.0% |
! | ATCTCATACTTATTCCTAAA+AGG | - | contig503end:12014-12033 | MsG0080048876.01.T01:intergenic | 25.0% |
! | ATCTTAAAGTTGCTTATAAC+AGG | + | contig503end:13975-13994 | MsG0080048876.01.T01:intron | 25.0% |
! | CAATTGTGATTTATTTAGTG+TGG | + | contig503end:14368-14387 | MsG0080048876.01.T01:intron | 25.0% |
! | CACACTAAATAAATCACAAT+TGG | - | contig503end:14370-14389 | MsG0080048876.01.T01:intergenic | 25.0% |
! | CATTATTACTAAACATTCCT+TGG | - | contig503end:15486-15505 | MsG0080048876.01.T01:intergenic | 25.0% |
! | GAAAAAGCAAAAAGAAATTG+AGG | - | contig503end:10352-10371 | MsG0080048876.01.T01:intergenic | 25.0% |
! | GATATTCCTAATTGTATCAT+TGG | + | contig503end:14545-14564 | MsG0080048876.01.T01:intron | 25.0% |
! | GGAATTAATAAACCTACTTA+AGG | + | contig503end:14411-14430 | MsG0080048876.01.T01:intron | 25.0% |
! | TAAACTTGGTTAGTAAATTC+TGG | + | contig503end:13675-13694 | MsG0080048876.01.T01:intron | 25.0% |
! | TAATAAACCTACTTAAGGAT+GGG | + | contig503end:14416-14435 | MsG0080048876.01.T01:CDS | 25.0% |
! | TGGAAAAAGAAAAAACCTTA+AGG | + | contig503end:11314-11333 | MsG0080048876.01.T01:intron | 25.0% |
! | TTAATAAACCTACTTAAGGA+TGG | + | contig503end:14415-14434 | MsG0080048876.01.T01:CDS | 25.0% |
! | TTACTAACCAAGTTTATCAA+GGG | - | contig503end:13671-13690 | MsG0080048876.01.T01:intergenic | 25.0% |
! | TTCAATATAGTAAAACCATG+AGG | - | contig503end:13935-13954 | MsG0080048876.01.T01:intergenic | 25.0% |
! | TTTACTAACCAAGTTTATCA+AGG | - | contig503end:13672-13691 | MsG0080048876.01.T01:intergenic | 25.0% |
!! | AAGTTGTGAAAACATTTTTC+TGG | - | contig503end:13728-13747 | MsG0080048876.01.T01:intergenic | 25.0% |
!! | AGTTTATAACTTTTGTGTGA+CGG | + | contig503end:12719-12738 | MsG0080048876.01.T01:CDS | 25.0% |
!! | ATACAAAATCCCTCTAATTT+TGG | - | contig503end:11544-11563 | MsG0080048876.01.T01:intergenic | 25.0% |
!! | CCACCTAATTAAAAGTATAA+AGG | - | contig503end:14298-14317 | MsG0080048876.01.T01:intergenic | 25.0% |
!! | TACAAAATCCCTCTAATTTT+GGG | - | contig503end:11543-11562 | MsG0080048876.01.T01:intergenic | 25.0% |
!! | TATCTTGGTATTCTTTTTGA+AGG | + | contig503end:12374-12393 | MsG0080048876.01.T01:intron | 25.0% |
!! | TTGTTGTTGTTGTTGTTATT+GGG | + | contig503end:10955-10974 | MsG0080048876.01.T01:intron | 25.0% |
!! | TTTTTGAATGTGTACCTTTT+AGG | + | contig503end:11997-12016 | MsG0080048876.01.T01:intron | 25.0% |
!!! | AAAATTACTGACTTAATACG+AGG | + | contig503end:12304-12323 | MsG0080048876.01.T01:CDS | 25.0% |
!!! | ATATTTGTTTTGGTTGATGA+TGG | + | contig503end:10998-11017 | MsG0080048876.01.T01:intron | 25.0% |
!!! | ATCAAACAGATTGATTTGAT+TGG | - | contig503end:12802-12821 | MsG0080048876.01.T01:intergenic | 25.0% |
!!! | ATCGTTCTTAAAGTTTTATG+AGG | + | contig503end:13138-13157 | MsG0080048876.01.T01:intron | 25.0% |
!!! | ATTCTTTTTGAAGGTATGAT+CGG | + | contig503end:12383-12402 | MsG0080048876.01.T01:intron | 25.0% |
!!! | CAATCATGTTCATTTTTAGA+AGG | - | contig503end:14571-14590 | MsG0080048876.01.T01:intergenic | 25.0% |
!!! | CAATTTTTATTTCTGGGTTT+TGG | + | contig503end:10385-10404 | MsG0080048876.01.T01:intron | 25.0% |
!!! | CCTTTATACTTTTAATTAGG+TGG | + | contig503end:14295-14314 | MsG0080048876.01.T01:intron | 25.0% |
!!! | GGTTATGATTTTTTATGTTC+TGG | + | contig503end:10552-10571 | MsG0080048876.01.T01:intron | 25.0% |
!!! | GGTTTTAATTTTGTATGTTC+TGG | + | contig503end:10768-10787 | MsG0080048876.01.T01:intron | 25.0% |
!!! | GGTTTTCAATTGTTGATTAT+GGG | + | contig503end:10574-10593 | MsG0080048876.01.T01:intron | 25.0% |
!!! | GTTTTGAGTTTTTATGTCAT+GGG | + | contig503end:10411-10430 | MsG0080048876.01.T01:intron | 25.0% |
!!! | TACTTCATTTTTGAACTACA+TGG | - | contig503end:12421-12440 | MsG0080048876.01.T01:intergenic | 25.0% |
!!! | TGTTTTGAGTTTTTATGTCA+TGG | + | contig503end:10410-10429 | MsG0080048876.01.T01:intron | 25.0% |
!!! | TGTTTTGATTTTTTGTGTTC+TGG | + | contig503end:10461-10480 | MsG0080048876.01.T01:intron | 25.0% |
!!! | TTATACTTTTAATTAGGTGG+AGG | + | contig503end:14298-14317 | MsG0080048876.01.T01:intron | 25.0% |
!!! | TTTTTAATTAGGTGGATGAA+TGG | + | contig503end:14134-14153 | MsG0080048876.01.T01:intron | 25.0% |
!!! | TTTTTGATTCCACAAAGTTA+AGG | + | contig503end:13824-13843 | MsG0080048876.01.T01:CDS | 25.0% |
!!! | TTTTTTATTCTGGGTTTGAA+TGG | + | contig503end:10644-10663 | MsG0080048876.01.T01:intron | 25.0% |
AAAAGTAAAATGACATGCAC+AGG | - | contig503end:15027-15046 | MsG0080048876.01.T01:intergenic | 30.0% | |
AAGGCAGGCATTAATATATA+AGG | + | contig503end:12893-12912 | MsG0080048876.01.T01:CDS | 30.0% | |
AAGTTGGCACAATCAATAAA+AGG | - | contig503end:14661-14680 | MsG0080048876.01.T01:intergenic | 30.0% | |
AATAAGCTGTTTATCCAAAC+AGG | + | contig503end:11893-11912 | MsG0080048876.01.T01:intron | 30.0% | |
AATTTGATTATGGGATTGTC+TGG | + | contig503end:10747-10766 | MsG0080048876.01.T01:intron | 30.0% | |
ACATTAATCCACTGTTTCAA+AGG | - | contig503end:12531-12550 | MsG0080048876.01.T01:intergenic | 30.0% | |
AGCAAACAAATAGTTGAAGA+GGG | - | contig503end:10310-10329 | MsG0080048876.01.T01:intergenic | 30.0% | |
AGTAAATTATCAAAGCGACA+TGG | + | contig503end:13067-13086 | MsG0080048876.01.T01:CDS | 30.0% | |
AGTTGCTTATAACAGGTAAT+AGG | + | contig503end:13982-14001 | MsG0080048876.01.T01:intron | 30.0% | |
ATAAAGCTTCTTCTCTTCTA+AGG | + | contig503end:13518-13537 | MsG0080048876.01.T01:intron | 30.0% | |
ATAACAGGTAATAGGATGTA+TGG | + | contig503end:13990-14009 | MsG0080048876.01.T01:intron | 30.0% | |
ATAAGCTGTTTATCCAAACA+GGG | + | contig503end:11894-11913 | MsG0080048876.01.T01:intron | 30.0% | |
ATATACATGCTTCAAACTAG+AGG | - | contig503end:12082-12101 | MsG0080048876.01.T01:intergenic | 30.0% | |
ATGTCACATAAGCTCAAATA+AGG | - | contig503end:11722-11741 | MsG0080048876.01.T01:intergenic | 30.0% | |
ATTGGATCTTACATCAACAA+AGG | - | contig503end:14252-14271 | MsG0080048876.01.T01:intergenic | 30.0% | |
CACTCGGTTTAAAAATAAGT+GGG | - | contig503end:11290-11309 | MsG0080048876.01.T01:intergenic | 30.0% | |
CATTAATCCACTGTTTCAAA+GGG | - | contig503end:12530-12549 | MsG0080048876.01.T01:intergenic | 30.0% | |
CATTCAAAAAACCAGTTGAA+TGG | - | contig503end:11987-12006 | MsG0080048876.01.T01:intergenic | 30.0% | |
CTCTACATTCTACTTTACAA+AGG | + | contig503end:14491-14510 | MsG0080048876.01.T01:CDS | 30.0% | |
CTTTGTAAAGTAGAATGTAG+AGG | - | contig503end:14493-14512 | MsG0080048876.01.T01:intergenic | 30.0% | |
GAAATTTGTCTTGAGAATTG+AGG | + | contig503end:10819-10838 | MsG0080048876.01.T01:CDS | 30.0% | |
GAATCAAGTATGCAAGTAAT+TGG | - | contig503end:14270-14289 | MsG0080048876.01.T01:intergenic | 30.0% | |
GAGTAAGATTGATGAAGAAA+TGG | - | contig503end:10150-10169 | MsG0080048876.01.T01:intergenic | 30.0% | |
GATTGATGAAGAAATGGAAA+TGG | - | contig503end:10144-10163 | MsG0080048876.01.T01:intergenic | 30.0% | |
GTCACACAAAAGTTATAAAC+TGG | - | contig503end:12720-12739 | MsG0080048876.01.T01:intergenic | 30.0% | |
GTTACATGACATGATTACAA+AGG | - | contig503end:11215-11234 | MsG0080048876.01.T01:intergenic | 30.0% | |
GTTCCTATTAAAGCAGAATA+AGG | - | contig503end:13271-13290 | MsG0080048876.01.T01:intergenic | 30.0% | |
TAAAGCTTCTTCTCTTCTAA+GGG | + | contig503end:13519-13538 | MsG0080048876.01.T01:intron | 30.0% | |
TAGCAAACAAATAGTTGAAG+AGG | - | contig503end:10311-10330 | MsG0080048876.01.T01:intergenic | 30.0% | |
TCTACCAAATCACTCAAATA+AGG | - | contig503end:11397-11416 | MsG0080048876.01.T01:intergenic | 30.0% | |
TCTTCAACTATTTGTTTGCT+AGG | + | contig503end:10310-10329 | MsG0080048876.01.T01:CDS | 30.0% | |
TGACAATCTCTTACTTGTAA+TGG | + | contig503end:11172-11191 | MsG0080048876.01.T01:intron | 30.0% | |
TGCTAACATAGTTGGAATAT+CGG | + | contig503end:14979-14998 | MsG0080048876.01.T01:intron | 30.0% | |
TTATTTGTAATTCAGAGCAG+AGG | + | contig503end:12851-12870 | MsG0080048876.01.T01:intron | 30.0% | |
TTGGATCTTACATCAACAAA+GGG | - | contig503end:14251-14270 | MsG0080048876.01.T01:intergenic | 30.0% | |
TTTCTCATACCTTAACTTTG+TGG | - | contig503end:13836-13855 | MsG0080048876.01.T01:intergenic | 30.0% | |
TTTCTTTGTTAGTGTCTTGA+AGG | + | contig503end:12638-12657 | MsG0080048876.01.T01:intron | 30.0% | |
! | ACAAAATCCCTCTAATTTTG+GGG | - | contig503end:11542-11561 | MsG0080048876.01.T01:intergenic | 30.0% |
! | ACTTTAAGAACGATGTAATC+AGG | - | contig503end:13132-13151 | MsG0080048876.01.T01:intergenic | 30.0% |
! | ATTTTTAAACCGAGTGCATT+TGG | + | contig503end:11294-11313 | MsG0080048876.01.T01:intron | 30.0% |
! | ATTTTTGAACTACATGGAGT+AGG | - | contig503end:12415-12434 | MsG0080048876.01.T01:intergenic | 30.0% |
! | CAGTTGACTTATGAATATGA+AGG | - | contig503end:12466-12485 | MsG0080048876.01.T01:intergenic | 30.0% |
! | GTTGTTGTTGTTGTTGTTAT+TGG | + | contig503end:10954-10973 | MsG0080048876.01.T01:intron | 30.0% |
! | TCAATTGTTGATTATGGGTT+TGG | + | contig503end:10579-10598 | MsG0080048876.01.T01:intron | 30.0% |
! | TTCAATATATGGAGGGTTTT+AGG | - | contig503end:11597-11616 | MsG0080048876.01.T01:intergenic | 30.0% |
! | TTTCTTTTTCCAAATGCACT+CGG | - | contig503end:11306-11325 | MsG0080048876.01.T01:intergenic | 30.0% |
! | TTTGATAATTTACTCCGATC+AGG | - | contig503end:13061-13080 | MsG0080048876.01.T01:intergenic | 30.0% |
! | TTTGTGATAATGAGGAGTAA+CGG | + | contig503end:12690-12709 | MsG0080048876.01.T01:CDS | 30.0% |
!! | AAAAACCTTAAGGCTTTGTT+TGG | + | contig503end:11324-11343 | MsG0080048876.01.T01:intron | 30.0% |
!! | AAAACCTTAAGGCTTTGTTT+GGG | + | contig503end:11325-11344 | MsG0080048876.01.T01:intron | 30.0% |
!! | GGGTTTTCAATTGTTGATTA+TGG | + | contig503end:10573-10592 | MsG0080048876.01.T01:intron | 30.0% |
!! | TTATTTTGCATCCATTCAAC+TGG | + | contig503end:11973-11992 | MsG0080048876.01.T01:intron | 30.0% |
!! | TTGGAGATTTTGTGATAATG+AGG | + | contig503end:12682-12701 | MsG0080048876.01.T01:CDS | 30.0% |
!! | TTTTAGTTAGGGAAGCTTAA+GGG | + | contig503end:11248-11267 | MsG0080048876.01.T01:intron | 30.0% |
!! | TTTTTAATTCTGGGTATTGC+TGG | + | contig503end:10531-10550 | MsG0080048876.01.T01:intron | 30.0% |
!!! | ATGTGTGATGTGTTTTAGTT+AGG | + | contig503end:11236-11255 | MsG0080048876.01.T01:intron | 30.0% |
!!! | ATGTTTTTTTTCAGGTCCAA+AGG | + | contig503end:10793-10812 | MsG0080048876.01.T01:intron | 30.0% |
!!! | TGTGTGATGTGTTTTAGTTA+GGG | + | contig503end:11237-11256 | MsG0080048876.01.T01:intron | 30.0% |
!!! | TGTTTTGAGTTTTCATGTTC+TGG | + | contig503end:10680-10699 | MsG0080048876.01.T01:intron | 30.0% |
!!! | TTCTGGGAATGTTTTTTTTC+AGG | + | contig503end:10785-10804 | MsG0080048876.01.T01:intron | 30.0% |
AAAAATTGGGTCAAAGGCTT+CGG | + | contig503end:14814-14833 | MsG0080048876.01.T01:CDS | 35.0% | |
AAACTGATATTGTCACCACT+TGG | + | contig503end:13359-13378 | MsG0080048876.01.T01:intron | 35.0% | |
AACTGATATTGTCACCACTT+GGG | + | contig503end:13360-13379 | MsG0080048876.01.T01:intron | 35.0% | |
AAGGAACTCCTTATACATTC+CGG | + | contig503end:12257-12276 | MsG0080048876.01.T01:CDS | 35.0% | |
AAGGGTGAAGAACTCATTAT+CGG | - | contig503end:13653-13672 | MsG0080048876.01.T01:intergenic | 35.0% | |
AAGTGGGATACAAATGCAAA+TGG | - | contig503end:11274-11293 | MsG0080048876.01.T01:intergenic | 35.0% | |
AATTTACCTCCAGTATACAC+AGG | + | contig503end:12187-12206 | MsG0080048876.01.T01:CDS | 35.0% | |
ACAGGAACTAGAGAAAATGA+AGG | + | contig503end:12147-12166 | MsG0080048876.01.T01:intron | 35.0% | |
ACGATGTAATCAGGAAATGA+TGG | - | contig503end:13123-13142 | MsG0080048876.01.T01:intergenic | 35.0% | |
AGAAATGGAAATGGAAGAGA+TGG | - | contig503end:10135-10154 | MsG0080048876.01.T01:intergenic | 35.0% | |
AGAAGGCCAATGATACAATT+AGG | - | contig503end:14554-14573 | MsG0080048876.01.T01:intergenic | 35.0% | |
AGCATTTACCAAACACTCTA+AGG | + | contig503end:12874-12893 | MsG0080048876.01.T01:CDS | 35.0% | |
AGGAACTGAATACAGATACA+GGG | + | contig503end:13285-13304 | MsG0080048876.01.T01:intron | 35.0% | |
AGTTGGAATTTGGATACACT+TGG | + | contig503end:12663-12682 | MsG0080048876.01.T01:CDS | 35.0% | |
ATTAGCAGCAAAACTTTGCA+AGG | - | contig503end:14061-14080 | MsG0080048876.01.T01:intergenic | 35.0% | |
ATTGAACGTGTGAACAAAAG+TGG | + | contig503end:13796-13815 | MsG0080048876.01.T01:CDS | 35.0% | |
ATTGTCACAAAGCTAACTTC+AGG | - | contig503end:15253-15272 | MsG0080048876.01.T01:intergenic | 35.0% | |
CAAAACTAGTCGACTGAAAT+TGG | - | contig503end:13459-13478 | MsG0080048876.01.T01:intergenic | 35.0% | |
CTCAAAAAATGTACAGGACA+AGG | - | contig503end:11517-11536 | MsG0080048876.01.T01:intergenic | 35.0% | |
CTCAGGAAGATTATCTTGTA+TGG | - | contig503end:14719-14738 | MsG0080048876.01.T01:intergenic | 35.0% | |
GAACATGATTGTGATATGCA+AGG | + | contig503end:14580-14599 | MsG0080048876.01.T01:intron | 35.0% | |
GAGACAAGGAAATATGATGA+TGG | + | contig503end:10068-10087 | MsG0080048876.01.T01:exon | 35.0% | |
GAGCTTATGTGACATTCTTT+CGG | + | contig503end:11727-11746 | MsG0080048876.01.T01:intron | 35.0% | |
GCACTCGGTTTAAAAATAAG+TGG | - | contig503end:11291-11310 | MsG0080048876.01.T01:intergenic | 35.0% | |
GGAAAGTCTCAAACATGATT+CGG | + | contig503end:14868-14887 | MsG0080048876.01.T01:intron | 35.0% | |
GGAATAAGTATGAGATTGTG+CGG | + | contig503end:12018-12037 | MsG0080048876.01.T01:intron | 35.0% | |
GGTCCTTATTCTGCTTTAAT+AGG | + | contig503end:13265-13284 | MsG0080048876.01.T01:intron | 35.0% | |
TAATTGAGAATTCACCTCCA+AGG | + | contig503end:15358-15377 | MsG0080048876.01.T01:exon | 35.0% | |
TAGGAACTGAATACAGATAC+AGG | + | contig503end:13284-13303 | MsG0080048876.01.T01:intron | 35.0% | |
TATTTCCTTGTCTCAGCTTT+CGG | - | contig503end:10062-10081 | MsG0080048876.01.T01:intergenic | 35.0% | |
TCCAGTATACACAGGTAAAT+GGG | + | contig503end:12195-12214 | MsG0080048876.01.T01:CDS | 35.0% | |
TTAGTGTCTTGAAGGTTAGT+TGG | + | contig503end:12646-12665 | MsG0080048876.01.T01:intron | 35.0% | |
TTAGTGTGTGCTAACATAGT+TGG | + | contig503end:14971-14990 | MsG0080048876.01.T01:intron | 35.0% | |
TTCCTCTCAGATTGTCTATA+TGG | - | contig503end:11063-11082 | MsG0080048876.01.T01:intergenic | 35.0% | |
TTCTTCACCCTTGATAAACT+TGG | + | contig503end:13661-13680 | MsG0080048876.01.T01:CDS | 35.0% | |
TTGAGTTCCCCAAAATTAGA+GGG | + | contig503end:11532-11551 | MsG0080048876.01.T01:intron | 35.0% | |
TTGTCTTGCTTTATCAAGCT+GGG | + | contig503end:15209-15228 | MsG0080048876.01.T01:exon | 35.0% | |
TTTCTCATGTCATCAGGTAA+TGG | + | contig503end:12763-12782 | MsG0080048876.01.T01:intron | 35.0% | |
! | AATGTACAGGACAAGGATTT+TGG | - | contig503end:11510-11529 | MsG0080048876.01.T01:intergenic | 35.0% |
! | ATTCTGGGTTTGAATGGTTT+TGG | + | contig503end:10650-10669 | MsG0080048876.01.T01:intron | 35.0% |
! | CACACCTTATTTGAGTGATT+TGG | + | contig503end:11390-11409 | MsG0080048876.01.T01:intron | 35.0% |
! | CTCAAACATGATTCGGATTT+AGG | + | contig503end:14875-14894 | MsG0080048876.01.T01:intron | 35.0% |
! | CTTGAAGGTTAGTTGGAATT+TGG | + | contig503end:12653-12672 | MsG0080048876.01.T01:intron | 35.0% |
! | GGTTTTGCACTTCTATTTAG+AGG | + | contig503end:15399-15418 | MsG0080048876.01.T01:exon | 35.0% |
! | GTGTTGTTACATCTTGTAAC+AGG | + | contig503end:14390-14409 | MsG0080048876.01.T01:intron | 35.0% |
! | TTCTGGGTTTGAATGGTTTT+GGG | + | contig503end:10651-10670 | MsG0080048876.01.T01:intron | 35.0% |
! | TTTGAGTTCCCCAAAATTAG+AGG | + | contig503end:11531-11550 | MsG0080048876.01.T01:intron | 35.0% |
!! | TTGAGTGATTTGGTAGAGAA+TGG | + | contig503end:11400-11419 | MsG0080048876.01.T01:intron | 35.0% |
!!! | AATATATGGAGGGTTTTAGG+AGG | - | contig503end:11594-11613 | MsG0080048876.01.T01:intergenic | 35.0% |
!!! | ATATATGGAGGGTTTTAGGA+GGG | - | contig503end:11593-11612 | MsG0080048876.01.T01:intergenic | 35.0% |
!!! | GAGTTTTCATGTTCTGGTTT+TGG | + | contig503end:10686-10705 | MsG0080048876.01.T01:intron | 35.0% |
!!! | GTTTTAGTTAGGGAAGCTTA+AGG | + | contig503end:11247-11266 | MsG0080048876.01.T01:intron | 35.0% |
!!! | TTTGTTTTGGTTGATGATGG+TGG | + | contig503end:11001-11020 | MsG0080048876.01.T01:intron | 35.0% |
!!! | TTTTGGTTTGCTGTGATTGT+CGG | + | contig503end:14945-14964 | MsG0080048876.01.T01:intron | 35.0% |
!!! | TTTTTTTCAGGTCCAAAGGT+GGG | + | contig503end:10797-10816 | MsG0080048876.01.T01:intron | 35.0% |
!!! | TTTTTTTTCAGGTCCAAAGG+TGG | + | contig503end:10796-10815 | MsG0080048876.01.T01:intron | 35.0% |
AAAACCATGAGGAAGAACAC+AGG | - | contig503end:13924-13943 | MsG0080048876.01.T01:intergenic | 40.0% | |
AAACTCCATGGACCAGATAT+TGG | + | contig503end:15178-15197 | MsG0080048876.01.T01:exon | 40.0% | |
AAATCCTGTGTTCTTCCTCA+TGG | + | contig503end:13917-13936 | MsG0080048876.01.T01:intron | 40.0% | |
AACTCCATGGACCAGATATT+GGG | + | contig503end:15179-15198 | MsG0080048876.01.T01:exon | 40.0% | |
AACTCCCAAACAAAGCCTTA+AGG | - | contig503end:11332-11351 | MsG0080048876.01.T01:intergenic | 40.0% | |
AAGCTATGCTAGAGAGCTTA+TGG | - | contig503end:11806-11825 | MsG0080048876.01.T01:intergenic | 40.0% | |
AAGGAAACGTGTGCAAAATG+AGG | - | contig503end:13028-13047 | MsG0080048876.01.T01:intergenic | 40.0% | |
ACACGAAACCGGAATGTATA+AGG | - | contig503end:12268-12287 | MsG0080048876.01.T01:intergenic | 40.0% | |
ACTACCTAGCATTATTAGGC+TGG | + | contig503end:13617-13636 | MsG0080048876.01.T01:CDS | 40.0% | |
AGGTAGTTATTCATTGCCTC+AGG | - | contig503end:13604-13623 | MsG0080048876.01.T01:intergenic | 40.0% | |
AGGTCTATCTGATAACACGA+TGG | + | contig503end:15378-15397 | MsG0080048876.01.T01:exon | 40.0% | |
AGTCAATCCCATCCTTAAGT+AGG | - | contig503end:14426-14445 | MsG0080048876.01.T01:intergenic | 40.0% | |
AGTTATTCATTGCCTCAGGT+AGG | - | contig503end:13600-13619 | MsG0080048876.01.T01:intergenic | 40.0% | |
ATTTGACCTATGGCCTGTTT+GGG | + | contig503end:11693-11712 | MsG0080048876.01.T01:intron | 40.0% | |
CAAGACAAATTTCCCACCTT+TGG | - | contig503end:10812-10831 | MsG0080048876.01.T01:intergenic | 40.0% | |
CATTTACCTGTGTATACTGG+AGG | - | contig503end:12196-12215 | MsG0080048876.01.T01:intergenic | 40.0% | |
CTACCTAGCATTATTAGGCT+GGG | + | contig503end:13618-13637 | MsG0080048876.01.T01:CDS | 40.0% | |
CTCCAGTATACACAGGTAAA+TGG | + | contig503end:12194-12213 | MsG0080048876.01.T01:CDS | 40.0% | |
CTCCTTCACAACATGATCTT+TGG | - | contig503end:15323-15342 | MsG0080048876.01.T01:intergenic | 40.0% | |
CTGTGGATGAATCTGTTTAC+AGG | + | contig503end:12985-13004 | MsG0080048876.01.T01:intron | 40.0% | |
GAAGAACAAAGCAGTAGCTA+AGG | - | contig503end:11938-11957 | MsG0080048876.01.T01:intergenic | 40.0% | |
GAGGAGATGACCAAACTTAT+CGG | + | contig503end:14182-14201 | MsG0080048876.01.T01:CDS | 40.0% | |
GATGACATGAGAAATAGCCA+TGG | - | contig503end:12757-12776 | MsG0080048876.01.T01:intergenic | 40.0% | |
GCTGAGAAACTACTTCAATC+CGG | + | contig503end:11102-11121 | MsG0080048876.01.T01:CDS | 40.0% | |
GCTTCCTCACAATATCAGAA+GGG | + | contig503end:14225-14244 | MsG0080048876.01.T01:CDS | 40.0% | |
GGGGAACTCAAAAAATGTAC+AGG | - | contig503end:11523-11542 | MsG0080048876.01.T01:intergenic | 40.0% | |
GTCCAAAGATCATGTTGTGA+AGG | + | contig503end:15318-15337 | MsG0080048876.01.T01:exon | 40.0% | |
GTCCATATAGACAATCTGAG+AGG | + | contig503end:11058-11077 | MsG0080048876.01.T01:CDS | 40.0% | |
GTGATCTGTGATGATAGGAT+CGG | + | contig503end:11633-11652 | MsG0080048876.01.T01:intron | 40.0% | |
GTTGTCTTGCTTTATCAAGC+TGG | + | contig503end:15208-15227 | MsG0080048876.01.T01:exon | 40.0% | |
TACCTAGCATTATTAGGCTG+GGG | + | contig503end:13619-13638 | MsG0080048876.01.T01:CDS | 40.0% | |
TAGTCGACTGAAATTGGTAC+CGG | - | contig503end:13453-13472 | MsG0080048876.01.T01:intergenic | 40.0% | |
TATAAACGAACAAGGGTGAC+CGG | - | contig503end:14901-14920 | MsG0080048876.01.T01:intergenic | 40.0% | |
TATGCAAGGCTGTATGAGTT+TGG | + | contig503end:14594-14613 | MsG0080048876.01.T01:intron | 40.0% | |
TATTTGACCTATGGCCTGTT+TGG | + | contig503end:11692-11711 | MsG0080048876.01.T01:intron | 40.0% | |
TCGTGTTATCAGATAGACCT+TGG | - | contig503end:15378-15397 | MsG0080048876.01.T01:intergenic | 40.0% | |
TGTTATCAGATAGACCTTGG+AGG | - | contig503end:15375-15394 | MsG0080048876.01.T01:intergenic | 40.0% | |
TTCTTGGCTGCATATGATAG+CGG | + | contig503end:14751-14770 | MsG0080048876.01.T01:CDS | 40.0% | |
TTGTACCTTCATCCCATTCA+AGG | - | contig503end:10912-10931 | MsG0080048876.01.T01:intergenic | 40.0% | |
! | AACATGATTCGGATTTAGGC+CGG | + | contig503end:14879-14898 | MsG0080048876.01.T01:intron | 40.0% |
! | AATCACTCTTCATGCCACTT+CGG | + | contig503end:15140-15159 | MsG0080048876.01.T01:exon | 40.0% |
! | CTTTGTTTGGGAGTTTGAAG+GGG | + | contig503end:11337-11356 | MsG0080048876.01.T01:intron | 40.0% |
! | GAGAATTGAGGACACTGATT+TGG | + | contig503end:10831-10850 | MsG0080048876.01.T01:CDS | 40.0% |
! | TACAGGACAAGGATTTTGGA+GGG | - | contig503end:11506-11525 | MsG0080048876.01.T01:intergenic | 40.0% |
! | TGATTTGGAGAGGTCTACTA+GGG | + | contig503end:10846-10865 | MsG0080048876.01.T01:CDS | 40.0% |
! | TTATCCAAACAGGGCATTAC+TGG | + | contig503end:11903-11922 | MsG0080048876.01.T01:intron | 40.0% |
! | TTTTCCAGTAATGCCCTGTT+TGG | - | contig503end:11910-11929 | MsG0080048876.01.T01:intergenic | 40.0% |
!! | GCTTTGTTTGGGAGTTTGAA+GGG | + | contig503end:11336-11355 | MsG0080048876.01.T01:intron | 40.0% |
!! | TATGATAGCGGTGATCTTGT+AGG | + | contig503end:14763-14782 | MsG0080048876.01.T01:CDS | 40.0% |
!! | TGGCTATTTCTCATGTCATC+AGG | + | contig503end:12757-12776 | MsG0080048876.01.T01:CDS | 40.0% |
!! | TTTACCAAACACTCTAAGGC+AGG | + | contig503end:12878-12897 | MsG0080048876.01.T01:CDS | 40.0% |
!! | TTTGGTTTGTTCTGCATCTG+TGG | + | contig503end:12968-12987 | MsG0080048876.01.T01:intron | 40.0% |
!!! | AGCATCTTGGTCACTGATTT+TGG | + | contig503end:12950-12969 | MsG0080048876.01.T01:intron | 40.0% |
!!! | CCTTGATTTTAGCTCCTGAT+CGG | + | contig503end:13044-13063 | MsG0080048876.01.T01:CDS | 40.0% |
AACGTGTGCAAAATGAGGCA+TGG | - | contig503end:13023-13042 | MsG0080048876.01.T01:intergenic | 45.0% | |
AAGAAGCTGGCACAAAACTC+AGG | - | contig503end:14736-14755 | MsG0080048876.01.T01:intergenic | 45.0% | |
AATGACATGCACAGGCAATC+AGG | - | contig503end:15019-15038 | MsG0080048876.01.T01:intergenic | 45.0% | |
ACCATAATCTCCACCAACAC+CGG | - | contig503end:11040-11059 | MsG0080048876.01.T01:intergenic | 45.0% | |
ACGTGTGCAAAATGAGGCAT+GGG | - | contig503end:13022-13041 | MsG0080048876.01.T01:intergenic | 45.0% | |
ACTCCATGGACCAGATATTG+GGG | + | contig503end:15180-15199 | MsG0080048876.01.T01:exon | 45.0% | |
ACTGGTAACCTTCATGTTGG+TGG | + | contig503end:10273-10292 | MsG0080048876.01.T01:CDS | 45.0% | |
AGTCGACTGAAATTGGTACC+GGG | - | contig503end:13452-13471 | MsG0080048876.01.T01:intergenic | 45.0% | |
AGTTTGGTCATCTCCTCTGA+TGG | - | contig503end:14179-14198 | MsG0080048876.01.T01:intergenic | 45.0% | |
ATAGTTGAAGAGGGCAGTTC+TGG | - | contig503end:10301-10320 | MsG0080048876.01.T01:intergenic | 45.0% | |
ATCATATGCAGCCAAGAAGC+TGG | - | contig503end:14749-14768 | MsG0080048876.01.T01:intergenic | 45.0% | |
ATCTGCTGTCTTGCAGTACA+GGG | + | contig503end:13564-13583 | MsG0080048876.01.T01:intron | 45.0% | |
ATGATGGCTGCGTTGAGTAA+CGG | + | contig503end:10084-10103 | MsG0080048876.01.T01:CDS | 45.0% | |
CAGTGCTTAGAGATCTTACC+TGG | + | contig503end:10881-10900 | MsG0080048876.01.T01:CDS | 45.0% | |
CCAACATGAAGGTTACCAGT+AGG | - | contig503end:10273-10292 | MsG0080048876.01.T01:intergenic | 45.0% | |
CCAAGCTGGCTGGAAAAATT+GGG | + | contig503end:14801-14820 | MsG0080048876.01.T01:CDS | 45.0% | |
CCACTGTTTCAAAGGGATCA+TGG | - | contig503end:12523-12542 | MsG0080048876.01.T01:intergenic | 45.0% | |
CCGATCAGGAGCTAAAATCA+AGG | - | contig503end:13047-13066 | MsG0080048876.01.T01:intergenic | 45.0% | |
CCTACTGGTAACCTTCATGT+TGG | + | contig503end:10270-10289 | MsG0080048876.01.T01:CDS | 45.0% | |
CTGCAAGACAGCAGATATTG+AGG | - | contig503end:13560-13579 | MsG0080048876.01.T01:intergenic | 45.0% | |
CTTAGAGATCTTACCTGGCT+TGG | + | contig503end:10886-10905 | MsG0080048876.01.T01:CDS | 45.0% | |
CTTTATCAAGCTGGGACTAC+TGG | + | contig503end:15217-15236 | MsG0080048876.01.T01:exon | 45.0% | |
GAAGCAGCGATAAACTTGAC+CGG | - | contig503end:11124-11143 | MsG0080048876.01.T01:intergenic | 45.0% | |
GACAGAGAATTTGCGTCGAA+AGG | - | contig503end:10196-10215 | MsG0080048876.01.T01:intergenic | 45.0% | |
GATATTGTCACCACTTGGGT+TGG | + | contig503end:13364-13383 | MsG0080048876.01.T01:intron | 45.0% | |
GCCAGCAACAAGTAGAAAGT+TGG | - | contig503end:14677-14696 | MsG0080048876.01.T01:intergenic | 45.0% | |
GCCCATTTACCTGTGTATAC+TGG | - | contig503end:12199-12218 | MsG0080048876.01.T01:intergenic | 45.0% | |
GGCTGGAAAAATTGGGTCAA+AGG | + | contig503end:14808-14827 | MsG0080048876.01.T01:CDS | 45.0% | |
GGCTTCCTCACAATATCAGA+AGG | + | contig503end:14224-14243 | MsG0080048876.01.T01:CDS | 45.0% | |
GTAGAAGAAGAGCTGGCAAA+AGG | + | contig503end:12238-12257 | MsG0080048876.01.T01:CDS | 45.0% | |
GTAGCGTGATCTGTGATGAT+AGG | + | contig503end:11628-11647 | MsG0080048876.01.T01:intron | 45.0% | |
GTCTTGCAGTACAGGGAAAT+GGG | + | contig503end:13571-13590 | MsG0080048876.01.T01:intron | 45.0% | |
TACTTCCGCATCTGTTGCAT+TGG | - | contig503end:12221-12240 | MsG0080048876.01.T01:intergenic | 45.0% | |
TATCTGCTGTCTTGCAGTAC+AGG | + | contig503end:13563-13582 | MsG0080048876.01.T01:intron | 45.0% | |
TCAAATAAGGCAGCCCAAAC+AGG | - | contig503end:11709-11728 | MsG0080048876.01.T01:intergenic | 45.0% | |
TCGCTGCTTCTGTTCTAATG+AGG | + | contig503end:11134-11153 | MsG0080048876.01.T01:CDS | 45.0% | |
TGAAGGTTACCAGTAGGAGA+AGG | - | contig503end:10267-10286 | MsG0080048876.01.T01:intergenic | 45.0% | |
TGTCTTGCAGTACAGGGAAA+TGG | + | contig503end:13570-13589 | MsG0080048876.01.T01:intron | 45.0% | |
! | AATGCCTGCCTTAGAGTGTT+TGG | - | contig503end:12885-12904 | MsG0080048876.01.T01:intergenic | 45.0% |
! | ATCTGGTCCATGGAGTTTTC+CGG | - | contig503end:15176-15195 | MsG0080048876.01.T01:intergenic | 45.0% |
! | GCCAACTTTCTACTTGTTGC+TGG | + | contig503end:14673-14692 | MsG0080048876.01.T01:intron | 45.0% |
! | GTACAGGACAAGGATTTTGG+AGG | - | contig503end:11507-11526 | MsG0080048876.01.T01:intergenic | 45.0% |
! | TTTAAGAGCACGTCCATCAG+AGG | + | contig503end:14163-14182 | MsG0080048876.01.T01:CDS | 45.0% |
!! | CCATGATCCCTTTGAAACAG+TGG | + | contig503end:12520-12539 | MsG0080048876.01.T01:intron | 45.0% |
!! | CTGATTTGGAGAGGTCTACT+AGG | + | contig503end:10845-10864 | MsG0080048876.01.T01:CDS | 45.0% |
!! | GATGATGGTGGTGATGGTTA+GGG | + | contig503end:11013-11032 | MsG0080048876.01.T01:intron | 45.0% |
!! | GGCTTTGTTTGGGAGTTTGA+AGG | + | contig503end:11335-11354 | MsG0080048876.01.T01:intron | 45.0% |
!! | TACTGACTTAATACGAGGCG+AGG | + | contig503end:12309-12328 | MsG0080048876.01.T01:CDS | 45.0% |
!! | TGAGTTTTGTGCCAGCTTCT+TGG | + | contig503end:14735-14754 | MsG0080048876.01.T01:CDS | 45.0% |
!! | TGATGATGGTGGTGATGGTT+AGG | + | contig503end:11012-11031 | MsG0080048876.01.T01:intron | 45.0% |
!! | TTGAGGACACTGATTTGGAG+AGG | + | contig503end:10836-10855 | MsG0080048876.01.T01:CDS | 45.0% |
!! | TTGGTTGATGATGGTGGTGA+TGG | + | contig503end:11007-11026 | MsG0080048876.01.T01:intron | 45.0% |
!! | ATACATTATTATTTATTTAT+TGG | - | contig503end:14092-14111 | MsG0080048876.01.T01:intergenic | 5.0% |
AAGCGCAAGGTGAGCTGAAT+GGG | + | contig503end:14847-14866 | MsG0080048876.01.T01:intron | 50.0% | |
ACAACAGCTGCCCCAATATC+TGG | - | contig503end:15193-15212 | MsG0080048876.01.T01:intergenic | 50.0% | |
AGGAGCGAAACGAACACGAA+CGG | - | contig503end:10247-10266 | MsG0080048876.01.T01:intergenic | 50.0% | |
AGGGCCCTTCTGATATTGTG+AGG | - | contig503end:14232-14251 | MsG0080048876.01.T01:intergenic | 50.0% | |
ATCGAACCTGAGACCTTGAG+AGG | - | contig503end:13425-13444 | MsG0080048876.01.T01:intergenic | 50.0% | |
ATGGGCCAATGCAACAGATG+CGG | + | contig503end:12213-12232 | MsG0080048876.01.T01:CDS | 50.0% | |
CATTATTAGGCTGGGGCGAT+GGG | + | contig503end:13626-13645 | MsG0080048876.01.T01:CDS | 50.0% | |
CCAACGCTCTCCGATAAGTT+TGG | - | contig503end:14195-14214 | MsG0080048876.01.T01:intergenic | 50.0% | |
CCATAATCTCCACCAACACC+GGG | - | contig503end:11039-11058 | MsG0080048876.01.T01:intergenic | 50.0% | |
CGACATGGAGCAACATCAGT+TGG | + | contig503end:13082-13101 | MsG0080048876.01.T01:CDS | 50.0% | |
CGGCAAATCAACTAAGCGCA+AGG | + | contig503end:14834-14853 | MsG0080048876.01.T01:CDS | 50.0% | |
CTACTGACCGGAAAACTCCA+TGG | + | contig503end:15166-15185 | MsG0080048876.01.T01:exon | 50.0% | |
CTGTTCCGAAAGCTGAGACA+AGG | + | contig503end:10054-10073 | MsG0080048876.01.T01:exon | 50.0% | |
CTTGTAGGTGCACTGGAAGA+AGG | + | contig503end:14778-14797 | MsG0080048876.01.T01:CDS | 50.0% | |
GAGGTCTACTAGGGAATCTG+AGG | + | contig503end:10855-10874 | MsG0080048876.01.T01:CDS | 50.0% | |
GCCAAGCTGGCTGGAAAAAT+TGG | + | contig503end:14800-14819 | MsG0080048876.01.T01:CDS | 50.0% | |
GGAAATGGGATACCTACCTG+AGG | + | contig503end:13585-13604 | MsG0080048876.01.T01:CDS | 50.0% | |
GTCTACTAGGGAATCTGAGG+AGG | + | contig503end:10858-10877 | MsG0080048876.01.T01:CDS | 50.0% | |
GTCTCAGGTTCGATTCTTCC+CGG | + | contig503end:13431-13450 | MsG0080048876.01.T01:intron | 50.0% | |
GTTTGGGAGTTTGAAGGGGA+GGG | + | contig503end:11341-11360 | MsG0080048876.01.T01:intron | 50.0% | |
TAAGCGCAAGGTGAGCTGAA+TGG | + | contig503end:14846-14865 | MsG0080048876.01.T01:intron | 50.0% | |
TGCGGAAGTAGAAGAAGAGC+TGG | + | contig503end:12231-12250 | MsG0080048876.01.T01:CDS | 50.0% | |
TGGAGCAACATCAGTTGGTC+AGG | + | contig503end:13087-13106 | MsG0080048876.01.T01:CDS | 50.0% | |
TGTTTGGGAGTTTGAAGGGG+AGG | + | contig503end:11340-11359 | MsG0080048876.01.T01:intron | 50.0% | |
TTCTGGCACCACCAACATGA+AGG | - | contig503end:10284-10303 | MsG0080048876.01.T01:intergenic | 50.0% | |
TTTGGGAGTTTGAAGGGGAG+GGG | + | contig503end:11342-11361 | MsG0080048876.01.T01:intron | 50.0% | |
! | CATGGAGTTTTCCGGTCAGT+AGG | - | contig503end:15168-15187 | MsG0080048876.01.T01:intergenic | 50.0% |
! | CCAAACTTATCGGAGAGCGT+TGG | + | contig503end:14192-14211 | MsG0080048876.01.T01:CDS | 50.0% |
! | CCCAATTTTTCCAGCCAGCT+TGG | - | contig503end:14804-14823 | MsG0080048876.01.T01:intergenic | 50.0% |
! | CGTTGAGTAACGGAAGTCCA+TGG | + | contig503end:10094-10113 | MsG0080048876.01.T01:CDS | 50.0% |
! | GGAGTAGCAAGCTTTGTCCA+TGG | - | contig503end:10114-10133 | MsG0080048876.01.T01:intergenic | 50.0% |
! | TTCCTTTGGGGACACGAAAC+CGG | - | contig503end:12279-12298 | MsG0080048876.01.T01:intergenic | 50.0% |
!! | CTTGGCCTTGAATGGGATGA+AGG | + | contig503end:10904-10923 | MsG0080048876.01.T01:CDS | 50.0% |
!! | GACGGTTGATGATGCTACCA+TGG | + | contig503end:12737-12756 | MsG0080048876.01.T01:CDS | 50.0% |
!! | TACCTGGCTTGGCCTTGAAT+GGG | + | contig503end:10897-10916 | MsG0080048876.01.T01:CDS | 50.0% |
!! | TTACCTGGCTTGGCCTTGAA+TGG | + | contig503end:10896-10915 | MsG0080048876.01.T01:CDS | 50.0% |
!!! | AGGGTTTTAGGAGGGCTTTG+GGG | - | contig503end:11585-11604 | MsG0080048876.01.T01:intergenic | 50.0% |
!!! | GAGGGTTTTAGGAGGGCTTT+GGG | - | contig503end:11586-11605 | MsG0080048876.01.T01:intergenic | 50.0% |
ATCCCATTCAAGGCCAAGCC+AGG | - | contig503end:10902-10921 | MsG0080048876.01.T01:intergenic | 55.0% | |
CGCCCCAGCCTAATAATGCT+AGG | - | contig503end:13624-13643 | MsG0080048876.01.T01:intergenic | 55.0% | |
CGGTGATCTTGTAGGTGCAC+TGG | + | contig503end:14771-14790 | MsG0080048876.01.T01:CDS | 55.0% | |
CGTTTCGCTCCTTCTCCTAC+TGG | + | contig503end:10255-10274 | MsG0080048876.01.T01:CDS | 55.0% | |
CTGCCCCAATATCTGGTCCA+TGG | - | contig503end:15186-15205 | MsG0080048876.01.T01:intergenic | 55.0% | |
GCATTATTAGGCTGGGGCGA+TGG | + | contig503end:13625-13644 | MsG0080048876.01.T01:CDS | 55.0% | |
GGAGCGAAACGAACACGAAC+GGG | - | contig503end:10246-10265 | MsG0080048876.01.T01:intergenic | 55.0% | |
TGTGCTCCTCTCAAGGTCTC+AGG | + | contig503end:13416-13435 | MsG0080048876.01.T01:intron | 55.0% | |
TTCCGGTTTCGTGTCCCCAA+AGG | + | contig503end:12274-12293 | MsG0080048876.01.T01:CDS | 55.0% | |
!! | CCCGGTGTTGGTGGAGATTA+TGG | + | contig503end:11036-11055 | MsG0080048876.01.T01:CDS | 55.0% |
!! | GGAGAGCGTTGGAAGACATC+TGG | + | contig503end:14203-14222 | MsG0080048876.01.T01:CDS | 55.0% |
!! | TGGTGTTGGCTTGGGACCTT+GGG | + | contig503end:13392-13411 | MsG0080048876.01.T01:intron | 55.0% |
!!! | GGAGGGTTTTAGGAGGGCTT+TGG | - | contig503end:11587-11606 | MsG0080048876.01.T01:intergenic | 55.0% |
AGGCAGCCCAAACAGGCCAT+AGG | - | contig503end:11702-11721 | MsG0080048876.01.T01:intergenic | 60.0% | |
CCACTTCGGCTCCTACTGAC+CGG | + | contig503end:15154-15173 | MsG0080048876.01.T01:exon | 60.0% | |
CTTGGGGTGTGCTCCTCTCA+AGG | + | contig503end:13409-13428 | MsG0080048876.01.T01:intron | 60.0% | |
GCACTGGAAGAAGGCCAAGC+TGG | + | contig503end:14787-14806 | MsG0080048876.01.T01:CDS | 60.0% | |
TGATGGTTAGGGCCCGGTGT+TGG | + | contig503end:11024-11043 | MsG0080048876.01.T01:intron | 60.0% | |
TGGAAGAAGGCCAAGCTGGC+TGG | + | contig503end:14791-14810 | MsG0080048876.01.T01:CDS | 60.0% | |
! | CTTGAGAGGAGCACACCCCA+AGG | - | contig503end:13411-13430 | MsG0080048876.01.T01:intergenic | 60.0% |
!! | GGTGTTGGCTTGGGACCTTG+GGG | + | contig503end:13393-13412 | MsG0080048876.01.T01:intron | 60.0% |
!! | GTGGTGTTGGCTTGGGACCT+TGG | + | contig503end:13391-13410 | MsG0080048876.01.T01:intron | 60.0% |
!! | TGGCCTGGTGGTGTTGGCTT+GGG | + | contig503end:13384-13403 | MsG0080048876.01.T01:intron | 60.0% |
!! | TGGTGGTGATGGTTAGGGCC+CGG | + | contig503end:11018-11037 | MsG0080048876.01.T01:intron | 60.0% |
!! | TGTCACCACTTGGGTTGGCC+TGG | + | contig503end:13369-13388 | MsG0080048876.01.T01:intron | 60.0% |
!! | TTGGCCTGGTGGTGTTGGCT+TGG | + | contig503end:13383-13402 | MsG0080048876.01.T01:intron | 60.0% |
!! | TTGGGTTGGCCTGGTGGTGT+TGG | + | contig503end:13378-13397 | MsG0080048876.01.T01:intron | 60.0% |
CACCACCAGGCCAACCCAAG+TGG | - | contig503end:13377-13396 | MsG0080048876.01.T01:intergenic | 65.0% | |
CCGGTCAGTAGGAGCCGAAG+TGG | - | contig503end:15157-15176 | MsG0080048876.01.T01:intergenic | 65.0% | |
GGGAGTTTGAAGGGGAGGGG+AGG | + | contig503end:11345-11364 | MsG0080048876.01.T01:intron | 65.0% | |
GGTCCCAAGCCAACACCACC+AGG | - | contig503end:13390-13409 | MsG0080048876.01.T01:intergenic | 65.0% | |
! | TGGTTAGGGCCCGGTGTTGG+TGG | + | contig503end:11027-11046 | MsG0080048876.01.T01:intron | 65.0% |
!! | CACCACTTGGGTTGGCCTGG+TGG | + | contig503end:13372-13391 | MsG0080048876.01.T01:intron | 65.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
contig503end | gene | 10036 | 15518 | 10036 | ID=MsG0080048876.01; |
contig503end | mRNA | 10036 | 15518 | 10036 | ID=MsG0080048876.01.T01;Parent=MsG0080048876.01 |
contig503end | exon | 10036 | 10331 | 10036 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 10081 | 10331 | 10081 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 10807 | 10925 | 10807 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | exon | 10807 | 10925 | 10807 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 11034 | 11155 | 11034 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | exon | 11034 | 11155 | 11034 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 12151 | 12330 | 12151 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | exon | 12151 | 12330 | 12151 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 12660 | 12778 | 12660 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | exon | 12660 | 12778 | 12660 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 12866 | 12914 | 12866 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | exon | 12866 | 12914 | 12866 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 13007 | 13108 | 13007 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | exon | 13007 | 13108 | 13007 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 13580 | 13682 | 13580 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | exon | 13580 | 13682 | 13580 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 13782 | 13845 | 13782 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | exon | 13782 | 13845 | 13782 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 14145 | 14259 | 14145 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | exon | 14145 | 14259 | 14145 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 14412 | 14512 | 14412 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | exon | 14412 | 14512 | 14412 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 14699 | 14855 | 14699 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | exon | 14699 | 14855 | 14699 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
contig503end | CDS | 15136 | 15360 | 15136 | ID=MsG0080048876.01.T01.cds;Parent=MsG0080048876.01.T01 |
contig503end | exon | 15136 | 15518 | 15136 | ID=MsG0080048876.01.T01.exon;Parent=MsG0080048876.01.T01 |
Gene Sequence |
Protein sequence |