Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048058.01.T01 | XP_039691221.1 | 99.773 | 440 | 1 | 0 | 1 | 440 | 330 | 769 | 0 | 906 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048058.01.T01 | O22943 | 73.589 | 443 | 113 | 3 | 1 | 440 | 330 | 771 | 0 | 701 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048058.01.T01 | A0A396JLH9 | 99.773 | 440 | 1 | 0 | 1 | 440 | 330 | 769 | 0.0 | 906 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080047814.01 | MsG0080048058.01 | 0.876785 | 1.059434e-68 | 5.203087e-65 |
MsG0080048058.01 | MsG0080048383.01 | 0.835370 | 1.745638e-56 | 2.130419e-53 |
MsG0080048058.01 | MsG0080048461.01 | 0.836145 | 1.110702e-56 | 1.387517e-53 |
MsG0080048058.01 | MsG0080048700.01 | 0.801370 | 9.298457e-49 | 4.433049e-46 |
MsG0080048058.01 | MsG0080048765.01 | 0.802646 | 5.083523e-49 | 2.503297e-46 |
MsG0080048058.01 | MsG0080048855.01 | 0.800720 | 1.262562e-48 | 5.920808e-46 |
MsG0080048058.01 | MsG0080048952.01 | 0.807532 | 4.827003e-50 | 2.695122e-47 |
MsG0080048058.01 | MsG0080049081.01 | 0.801923 | 7.159962e-49 | 3.461588e-46 |
MsG0080048058.01 | MsG0180000001.01 | 0.927838 | 6.720899e-92 | 3.430219e-87 |
MsG0080048058.01 | MsG0180000024.01 | 0.813629 | 2.323604e-51 | 1.525318e-48 |
MsG0080048058.01 | MsG0180000065.01 | 0.808745 | 2.662897e-50 | 1.534798e-47 |
MsG0080048058.01 | MsG0180000101.01 | 0.883504 | 4.242978e-71 | 2.696872e-67 |
MsG0080048058.01 | MsG0180000123.01 | 0.816514 | 5.318481e-52 | 3.776317e-49 |
MsG0080048058.01 | MsG0180000144.01 | 0.840244 | 9.774472e-58 | 1.383971e-54 |
MsG0080048058.01 | MsG0180000195.01 | 0.843115 | 1.708382e-58 | 2.645600e-55 |
MsG0080048058.01 | MsG0180000197.01 | 0.856777 | 2.557406e-62 | 6.171752e-59 |
MsG0080048058.01 | MsG0180000235.01 | 0.849506 | 3.095023e-60 | 5.880017e-57 |
MsG0080048058.01 | MsG0180000295.01 | 0.852268 | 5.159869e-61 | 1.072439e-57 |
MsG0080048058.01 | MsG0180000300.01 | 0.801744 | 7.793241e-49 | 3.750491e-46 |
MsG0080048058.01 | MsG0180000332.01 | 0.807933 | 3.968059e-50 | 2.238754e-47 |
MsG0080048058.01 | MsG0180000334.01 | 0.805106 | 1.566691e-49 | 8.218213e-47 |
MsG0080048058.01 | MsG0180000364.01 | 0.851792 | 7.044849e-61 | 1.442121e-57 |
MsG0080048058.01 | MsG0180000402.01 | 0.810600 | 1.063239e-50 | 6.436846e-48 |
MsG0080048058.01 | MsG0180000494.01 | 0.823519 | 1.326276e-53 | 1.144579e-50 |
MsG0080048058.01 | MsG0180000555.01 | 0.863655 | 2.131988e-64 | 6.513061e-61 |
MsG0080048058.01 | MsG0180000585.01 | 0.834931 | 2.253443e-56 | 2.714000e-53 |
MsG0080048058.01 | MsG0180000680.01 | 0.803002 | 4.291011e-49 | 2.132244e-46 |
MsG0080048058.01 | MsG0180000702.01 | 0.809996 | 1.435456e-50 | 8.553623e-48 |
MsG0080048058.01 | MsG0180000703.01 | 0.800974 | 1.120295e-48 | 5.288151e-46 |
MsG0080048058.01 | MsG0180000741.01 | 0.873399 | 1.515008e-67 | 6.565839e-64 |
MsG0080048058.01 | MsG0180000797.01 | 0.866617 | 2.500867e-65 | 8.482849e-62 |
MsG0080048058.01 | MsG0180000821.01 | 0.842212 | 2.968303e-58 | 4.468460e-55 |
MsG0080048058.01 | MsG0180000822.01 | 0.827999 | 1.147000e-54 | 1.125620e-51 |
MsG0080048058.01 | MsG0180000824.01 | 0.800080 | 1.704356e-48 | 7.864164e-46 |
MsG0080048058.01 | MsG0180000836.01 | 0.815390 | 9.474361e-52 | 6.523473e-49 |
MsG0080048058.01 | MsG0180000855.01 | 0.800537 | 1.375609e-48 | 6.421239e-46 |
MsG0080048058.01 | MsG0180001117.01 | 0.852553 | 4.281122e-61 | 8.977832e-58 |
MsG0080048058.01 | MsG0180001173.01 | 0.892240 | 1.905530e-74 | 1.727058e-70 |
MsG0080048058.01 | MsG0180001178.01 | 0.812483 | 4.144732e-51 | 2.638521e-48 |
MsG0080048058.01 | MsG0180001237.01 | 0.905762 | 3.045207e-80 | 4.997382e-76 |
MsG0080048058.01 | MsG0180001260.01 | 0.857205 | 1.912298e-62 | 4.682777e-59 |
MsG0080048058.01 | MsG0180001294.01 | 0.907987 | 2.796233e-81 | 5.083722e-77 |
MsG0080048058.01 | MsG0180001315.01 | 0.842552 | 2.411983e-58 | 3.670292e-55 |
MsG0080048058.01 | MsG0180001565.01 | 0.824211 | 9.125443e-54 | 8.030788e-51 |
MsG0080048058.01 | MsG0180001566.01 | 0.897386 | 1.479074e-76 | 1.666802e-72 |
MsG0080048058.01 | MsG0180001570.01 | 0.822107 | 2.827513e-53 | 2.344258e-50 |
MsG0080048058.01 | MsG0180001599.01 | 0.824813 | 6.584929e-54 | 5.896476e-51 |
MsG0080048058.01 | MsG0180001662.01 | 0.835376 | 1.739254e-56 | 2.123017e-53 |
MsG0080048058.01 | MsG0180001911.01 | 0.851672 | 7.617006e-61 | 1.553341e-57 |
MsG0080048058.01 | MsG0180001922.01 | 0.802466 | 5.537329e-49 | 2.714363e-46 |
MsG0080048058.01 | MsG0180002071.01 | 0.842806 | 2.064962e-58 | 3.166895e-55 |
MsG0080048058.01 | MsG0180002074.01 | 0.817905 | 2.587170e-52 | 1.908330e-49 |
MsG0080048058.01 | MsG0180002075.01 | 0.801924 | 7.158378e-49 | 3.460839e-46 |
MsG0080048058.01 | MsG0180002273.01 | 0.807458 | 5.005465e-50 | 2.789482e-47 |
MsG0080048058.01 | MsG0180002300.01 | 0.824453 | 8.008030e-54 | 7.095703e-51 |
MsG0080048058.01 | MsG0180002709.01 | 0.812459 | 4.194313e-51 | 2.668462e-48 |
MsG0080048058.01 | MsG0180002796.01 | 0.811206 | 7.860980e-51 | 4.836364e-48 |
MsG0080048058.01 | MsG0180002952.01 | 0.848513 | 5.844830e-60 | 1.075284e-56 |
MsG0080048058.01 | MsG0180002992.01 | 0.802483 | 5.490736e-49 | 2.692724e-46 |
MsG0080048058.01 | MsG0180003031.01 | 0.890203 | 1.218013e-73 | 1.014182e-69 |
MsG0080048058.01 | MsG0180003034.01 | 0.848656 | 5.333356e-60 | 9.856927e-57 |
MsG0080048058.01 | MsG0180003181.01 | 0.851849 | 6.788869e-61 | 1.392155e-57 |
MsG0080048058.01 | MsG0180003190.01 | 0.864906 | 8.677950e-65 | 2.769605e-61 |
MsG0080048058.01 | MsG0180003303.01 | 0.879863 | 8.803273e-70 | 4.851141e-66 |
MsG0080048058.01 | MsG0180003337.01 | 0.839929 | 1.180531e-57 | 1.655276e-54 |
MsG0080048058.01 | MsG0180003444.01 | 0.845375 | 4.223271e-59 | 7.023692e-56 |
MsG0080048058.01 | MsG0180003586.01 | 0.812433 | 4.250905e-51 | 2.702585e-48 |
MsG0080048058.01 | MsG0180003627.01 | 0.808531 | 2.958630e-50 | 1.695785e-47 |
MsG0080048058.01 | MsG0180003652.01 | 0.868158 | 8.040357e-66 | 2.879493e-62 |
MsG0080048058.01 | MsG0180003744.01 | 0.879238 | 1.466543e-69 | 7.892251e-66 |
MsG0080048058.01 | MsG0180003807.01 | 0.856431 | 3.233009e-62 | 7.715544e-59 |
MsG0080048058.01 | MsG0180003810.01 | 0.826230 | 3.040150e-54 | 2.834316e-51 |
MsG0080048058.01 | MsG0180003860.01 | 0.826383 | 2.796482e-54 | 2.618558e-51 |
MsG0080048058.01 | MsG0180003948.01 | 0.800060 | 1.720509e-48 | 7.934677e-46 |
MsG0080048058.01 | MsG0180003977.01 | 0.901639 | 2.186236e-78 | 2.981411e-74 |
MsG0080048058.01 | MsG0180004005.01 | 0.840544 | 8.157659e-58 | 1.165824e-54 |
MsG0080048058.01 | MsG0180004008.01 | 0.816005 | 6.911821e-52 | 4.839920e-49 |
MsG0080048058.01 | MsG0180004050.01 | 0.809809 | 1.574558e-50 | 9.336428e-48 |
MsG0080048058.01 | MsG0180004056.01 | 0.848446 | 6.098850e-60 | 1.119572e-56 |
MsG0080048058.01 | MsG0180004060.01 | 0.830366 | 3.058072e-55 | 3.215359e-52 |
MsG0080048058.01 | MsG0180004091.01 | 0.806204 | 9.213053e-50 | 4.971150e-47 |
MsG0080048058.01 | MsG0180004128.01 | 0.811466 | 6.904969e-51 | 4.277351e-48 |
MsG0080048058.01 | MsG0180004139.01 | 0.835737 | 1.410070e-56 | 1.739864e-53 |
MsG0080048058.01 | MsG0180004272.01 | 0.833594 | 4.876202e-56 | 5.641649e-53 |
MsG0080048058.01 | MsG0180004294.01 | 0.814807 | 1.276646e-51 | 8.651877e-49 |
MsG0080048058.01 | MsG0180004295.01 | 0.808014 | 3.812505e-50 | 2.155686e-47 |
MsG0080048058.01 | MsG0180004331.01 | 0.827606 | 1.426134e-54 | 1.383376e-51 |
MsG0080048058.01 | MsG0180004357.01 | 0.806607 | 7.579140e-50 | 4.131409e-47 |
MsG0080048058.01 | MsG0180004372.01 | 0.820362 | 7.138456e-53 | 5.636401e-50 |
MsG0080048058.01 | MsG0180004388.01 | 0.824862 | 6.412357e-54 | 5.749989e-51 |
MsG0080048058.01 | MsG0180004437.01 | 0.855490 | 6.092729e-62 | 1.409037e-58 |
MsG0080048058.01 | MsG0180004486.01 | 0.826867 | 2.142546e-54 | 2.034125e-51 |
MsG0080048058.01 | MsG0180004598.01 | 0.880454 | 5.419020e-70 | 3.055739e-66 |
MsG0080048058.01 | MsG0180004645.01 | 0.866540 | 2.645512e-65 | 8.949172e-62 |
MsG0080048058.01 | MsG0180004689.01 | 0.834882 | 2.317700e-56 | 2.787188e-53 |
MsG0080048058.01 | MsG0180004730.01 | 0.850589 | 1.539678e-60 | 3.030804e-57 |
MsG0080048058.01 | MsG0180004754.01 | 0.827004 | 1.987156e-54 | 1.894180e-51 |
MsG0080048058.01 | MsG0180004767.01 | 0.870401 | 1.501015e-66 | 5.831035e-63 |
MsG0080048058.01 | MsG0180004802.01 | 0.847774 | 9.350393e-60 | 1.679686e-56 |
MsG0080048058.01 | MsG0180004843.01 | 0.831128 | 1.989264e-55 | 2.138948e-52 |
MsG0080048058.01 | MsG0180004943.01 | 0.802319 | 5.936971e-49 | 2.899598e-46 |
MsG0080048058.01 | MsG0180004989.01 | 0.839104 | 1.933993e-57 | 2.643469e-54 |
MsG0080048058.01 | MsG0180004991.01 | 0.852641 | 4.040261e-61 | 8.497367e-58 |
MsG0080048058.01 | MsG0180005049.01 | 0.850228 | 1.944795e-60 | 3.783652e-57 |
MsG0080048058.01 | MsG0180005050.01 | 0.818847 | 1.582803e-52 | 1.198319e-49 |
MsG0080048058.01 | MsG0180005125.01 | 0.833031 | 6.734094e-56 | 7.661628e-53 |
MsG0080048058.01 | MsG0180005188.01 | 0.832146 | 1.116480e-55 | 1.237079e-52 |
MsG0080048058.01 | MsG0180005228.01 | 0.828978 | 6.654398e-55 | 6.718382e-52 |
MsG0080048058.01 | MsG0180005233.01 | 0.801552 | 8.530730e-49 | 4.085659e-46 |
MsG0080048058.01 | MsG0180005304.01 | 0.846111 | 2.666950e-59 | 4.541738e-56 |
MsG0080048058.01 | MsG0180005398.01 | 0.815429 | 9.285093e-52 | 6.400207e-49 |
MsG0080048058.01 | MsG0180005407.01 | 0.873446 | 1.461296e-67 | 6.344343e-64 |
MsG0080048058.01 | MsG0180005419.01 | 0.806707 | 7.216603e-50 | 3.943976e-47 |
MsG0080048058.01 | MsG0180005443.01 | 0.897299 | 1.609464e-76 | 1.806674e-72 |
MsG0080048058.01 | MsG0180005445.01 | 0.861753 | 8.220172e-64 | 2.350336e-60 |
MsG0080048058.01 | MsG0180005451.01 | 0.916171 | 2.454649e-85 | 6.664023e-81 |
MsG0080048058.01 | MsG0180005493.01 | 0.911387 | 6.441218e-83 | 1.376888e-78 |
MsG0080048058.01 | MsG0180005504.01 | 0.829336 | 5.449649e-55 | 5.561692e-52 |
MsG0080048058.01 | MsG0180005559.01 | 0.800409 | 1.461067e-48 | 6.798186e-46 |
MsG0080048058.01 | MsG0180005614.01 | 0.852972 | 3.249204e-61 | 6.910733e-58 |
MsG0080048058.01 | MsG0180005708.01 | 0.801487 | 8.798531e-49 | 4.207068e-46 |
MsG0080048058.01 | MsG0180005765.01 | 0.888407 | 6.067991e-73 | 4.695449e-69 |
MsG0080048058.01 | MsG0180005786.01 | 0.829283 | 5.613180e-55 | 5.719999e-52 |
MsG0080048058.01 | MsG0180005846.01 | 0.806294 | 8.820188e-50 | 4.769842e-47 |
MsG0080048058.01 | MsG0180005944.01 | 0.864382 | 1.266203e-64 | 3.967732e-61 |
MsG0080048058.01 | MsG0180005949.01 | 0.823258 | 1.525629e-53 | 1.306942e-50 |
MsG0080048058.01 | MsG0180005985.01 | 0.832489 | 9.183293e-56 | 1.027998e-52 |
MsG0080048058.01 | MsG0180006016.01 | 0.801822 | 7.510840e-49 | 3.621947e-46 |
MsG0080048058.01 | MsG0180006023.01 | 0.861981 | 6.999169e-64 | 2.017070e-60 |
MsG0080048058.01 | MsG0180006098.01 | 0.875459 | 3.031687e-68 | 1.416351e-64 |
MsG0080048058.01 | MsG0180006128.01 | 0.852758 | 3.740871e-61 | 7.897874e-58 |
MsG0080048058.01 | MsG0180006155.01 | 0.834434 | 3.003626e-56 | 3.564212e-53 |
MsG0080048058.01 | MsG0180006235.01 | 0.897833 | 9.580662e-77 | 1.101877e-72 |
MsG0080048058.01 | MsG0180006260.01 | 0.806877 | 6.644825e-50 | 3.647504e-47 |
MsG0080048058.01 | MsG0280006305.01 | 0.828912 | 6.906753e-55 | 6.959706e-52 |
MsG0080048058.01 | MsG0280006313.01 | 0.802865 | 4.580650e-49 | 2.268370e-46 |
MsG0080048058.01 | MsG0280006365.01 | 0.811535 | 6.669779e-51 | 4.139253e-48 |
MsG0080048058.01 | MsG0280006367.01 | 0.863044 | 3.296533e-64 | 9.857677e-61 |
MsG0080048058.01 | MsG0280006368.01 | 0.846522 | 2.060571e-59 | 3.556479e-56 |
MsG0080048058.01 | MsG0280006462.01 | 0.830980 | 2.163622e-55 | 2.316223e-52 |
MsG0080048058.01 | MsG0280006519.01 | 0.810920 | 9.065927e-51 | 5.536089e-48 |
MsG0080048058.01 | MsG0280006679.01 | 0.803680 | 3.105176e-49 | 1.570126e-46 |
MsG0080048058.01 | MsG0280006692.01 | 0.851951 | 6.351305e-61 | 1.306502e-57 |
MsG0080048058.01 | MsG0280006728.01 | 0.849923 | 2.367213e-60 | 4.559689e-57 |
MsG0080048058.01 | MsG0280006759.01 | 0.807523 | 4.847843e-50 | 2.706191e-47 |
MsG0080048058.01 | MsG0280006832.01 | 0.802963 | 4.371492e-49 | 2.170171e-46 |
MsG0080048058.01 | MsG0280006906.01 | 0.809724 | 1.642766e-50 | 9.718945e-48 |
MsG0080048058.01 | MsG0280006935.01 | 0.837512 | 4.977204e-57 | 6.480480e-54 |
MsG0080048058.01 | MsG0280007035.01 | 0.820019 | 8.557915e-53 | 6.693557e-50 |
MsG0080048058.01 | MsG0280007048.01 | 0.906985 | 8.253697e-81 | 1.433485e-76 |
MsG0080048058.01 | MsG0280007071.01 | 0.817357 | 3.438423e-52 | 2.498490e-49 |
MsG0080048058.01 | MsG0280007087.01 | 0.833466 | 5.248549e-56 | 6.049158e-53 |
MsG0080048058.01 | MsG0280007089.01 | 0.833742 | 4.478868e-56 | 5.204947e-53 |
MsG0080048058.01 | MsG0280007109.01 | 0.828580 | 8.305891e-55 | 8.289935e-52 |
MsG0080048058.01 | MsG0280007321.01 | 0.822544 | 2.238448e-53 | 1.879346e-50 |
MsG0080048058.01 | MsG0280007484.01 | 0.855495 | 6.072163e-62 | 1.404539e-58 |
MsG0080048058.01 | MsG0280007491.01 | 0.819148 | 1.352011e-52 | 1.032014e-49 |
MsG0080048058.01 | MsG0280007529.01 | 0.832567 | 8.782927e-56 | 9.854946e-53 |
MsG0080048058.01 | MsG0280007549.01 | 0.801523 | 8.648172e-49 | 4.138972e-46 |
MsG0080048058.01 | MsG0280007564.01 | 0.856126 | 3.971709e-62 | 9.381391e-59 |
MsG0080048058.01 | MsG0280007585.01 | 0.852002 | 6.140227e-61 | 1.265168e-57 |
MsG0080048058.01 | MsG0280007609.01 | 0.840458 | 8.589597e-58 | 1.224312e-54 |
MsG0080048058.01 | MsG0280007636.01 | 0.801375 | 9.276286e-49 | 4.422957e-46 |
MsG0080048058.01 | MsG0280007645.01 | 0.811385 | 7.189829e-51 | 4.444221e-48 |
MsG0080048058.01 | MsG0280007648.01 | 0.852408 | 4.708006e-61 | 9.827868e-58 |
MsG0080048058.01 | MsG0280007706.01 | 0.801547 | 8.551041e-49 | 4.094847e-46 |
MsG0080048058.01 | MsG0280007710.01 | 0.869394 | 3.199281e-66 | 1.198972e-62 |
MsG0080048058.01 | MsG0280007740.01 | 0.817094 | 3.940625e-52 | 2.842814e-49 |
MsG0080048058.01 | MsG0280007745.01 | 0.801448 | 8.962115e-49 | 4.281044e-46 |
MsG0080048058.01 | MsG0280007764.01 | 0.848658 | 5.325562e-60 | 9.843406e-57 |
MsG0080048058.01 | MsG0280007775.01 | 0.803329 | 3.671820e-49 | 1.839960e-46 |
MsG0080048058.01 | MsG0280007790.01 | 0.889614 | 2.069474e-73 | 1.682354e-69 |
MsG0080048058.01 | MsG0280007819.01 | 0.814911 | 1.210162e-51 | 8.223995e-49 |
MsG0080048058.01 | MsG0280007876.01 | 0.802759 | 4.816961e-49 | 2.379001e-46 |
MsG0080048058.01 | MsG0280007984.01 | 0.817908 | 2.583783e-52 | 1.905960e-49 |
MsG0080048058.01 | MsG0280008030.01 | 0.824841 | 6.486586e-54 | 5.812855e-51 |
MsG0080048058.01 | MsG0280008039.01 | 0.809306 | 2.020037e-50 | 1.181837e-47 |
MsG0080048058.01 | MsG0280008134.01 | 0.813069 | 3.084697e-51 | 1.994226e-48 |
MsG0080048058.01 | MsG0280008234.01 | 0.856136 | 3.944812e-62 | 9.321001e-59 |
MsG0080048058.01 | MsG0280008286.01 | 0.855793 | 4.968643e-62 | 1.160795e-58 |
MsG0080048058.01 | MsG0280008327.01 | 0.810424 | 1.160690e-50 | 6.993591e-48 |
MsG0080048058.01 | MsG0280008363.01 | 0.828310 | 9.654943e-55 | 9.560433e-52 |
MsG0080048058.01 | MsG0280008502.01 | 0.847448 | 1.148914e-59 | 2.042834e-56 |
MsG0080048058.01 | MsG0280008518.01 | 0.839045 | 2.003509e-57 | 2.733517e-54 |
MsG0080048058.01 | MsG0280008614.01 | 0.875320 | 3.381287e-68 | 1.571777e-64 |
MsG0080048058.01 | MsG0280008615.01 | 0.816433 | 5.543728e-52 | 3.927517e-49 |
MsG0080048058.01 | MsG0280008720.01 | 0.801243 | 9.869694e-49 | 4.690464e-46 |
MsG0080048058.01 | MsG0280008758.01 | 0.807397 | 5.155815e-50 | 2.868767e-47 |
MsG0080048058.01 | MsG0280008885.01 | 0.831409 | 1.696826e-55 | 1.839682e-52 |
MsG0080048058.01 | MsG0280008907.01 | 0.820987 | 5.129448e-53 | 4.121495e-50 |
MsG0080048058.01 | MsG0280008909.01 | 0.879926 | 8.360493e-70 | 4.619424e-66 |
MsG0080048058.01 | MsG0280008970.01 | 0.823099 | 1.661891e-53 | 1.417392e-50 |
MsG0080048058.01 | MsG0280009255.01 | 0.801687 | 8.004754e-49 | 3.846802e-46 |
MsG0080048058.01 | MsG0280009417.01 | 0.822699 | 2.060235e-53 | 1.737296e-50 |
MsG0080048058.01 | MsG0280009509.01 | 0.801620 | 8.261132e-49 | 3.963289e-46 |
MsG0080048058.01 | MsG0280009514.01 | 0.819058 | 1.417795e-52 | 1.079598e-49 |
MsG0080048058.01 | MsG0280009748.01 | 0.831220 | 1.888430e-55 | 2.035995e-52 |
MsG0080048058.01 | MsG0280009774.01 | 0.826785 | 2.241901e-54 | 2.123381e-51 |
MsG0080048058.01 | MsG0280009996.01 | 0.825563 | 4.378623e-54 | 4.005221e-51 |
MsG0080048058.01 | MsG0280010001.01 | 0.808891 | 2.478716e-50 | 1.434106e-47 |
MsG0080048058.01 | MsG0280010002.01 | 0.810550 | 1.090226e-50 | 6.591126e-48 |
MsG0080048058.01 | MsG0280010022.01 | 0.851359 | 9.345192e-61 | 1.886895e-57 |
MsG0080048058.01 | MsG0280010109.01 | 0.850633 | 1.496367e-60 | 2.949895e-57 |
MsG0080048058.01 | MsG0280010153.01 | 0.853534 | 2.242667e-61 | 4.861290e-58 |
MsG0080048058.01 | MsG0280010239.01 | 0.844480 | 7.367079e-59 | 1.190934e-55 |
MsG0080048058.01 | MsG0280010389.01 | 0.842482 | 2.516908e-58 | 3.821854e-55 |
MsG0080048058.01 | MsG0280010447.01 | 0.890983 | 6.013672e-74 | 5.174488e-70 |
MsG0080048058.01 | MsG0280010448.01 | 0.844911 | 5.637654e-59 | 9.238041e-56 |
MsG0080048058.01 | MsG0280010459.01 | 0.826151 | 3.175207e-54 | 2.953514e-51 |
MsG0080048058.01 | MsG0280010491.01 | 0.816317 | 5.885374e-52 | 4.156768e-49 |
MsG0080048058.01 | MsG0280010560.01 | 0.815532 | 8.808095e-52 | 6.088581e-49 |
MsG0080048058.01 | MsG0280010567.01 | 0.803108 | 4.080215e-49 | 2.032999e-46 |
MsG0080048058.01 | MsG0280010614.01 | 0.849642 | 2.836054e-60 | 5.412008e-57 |
MsG0080048058.01 | MsG0280010632.01 | 0.812313 | 4.514957e-51 | 2.861077e-48 |
MsG0080048058.01 | MsG0280010633.01 | 0.839575 | 1.459472e-57 | 2.023897e-54 |
MsG0080048058.01 | MsG0280010735.01 | 0.871791 | 5.220383e-67 | 2.132827e-63 |
MsG0080048058.01 | MsG0280010816.01 | 0.858965 | 5.734420e-63 | 1.490055e-59 |
MsG0080048058.01 | MsG0280010866.01 | 0.805722 | 1.163466e-49 | 6.200940e-47 |
MsG0080048058.01 | MsG0280010901.01 | 0.823347 | 1.454375e-53 | 1.248969e-50 |
MsG0080048058.01 | MsG0280010907.01 | 0.802675 | 5.012221e-49 | 2.470085e-46 |
MsG0080048058.01 | MsG0280010932.01 | 0.800513 | 1.391145e-48 | 6.489911e-46 |
MsG0080048058.01 | MsG0280010976.01 | 0.825267 | 5.146013e-54 | 4.667796e-51 |
MsG0080048058.01 | MsG0280011014.01 | 0.800005 | 1.765712e-48 | 8.131555e-46 |
MsG0080048058.01 | MsG0280011043.01 | 0.809438 | 1.892291e-50 | 1.111016e-47 |
MsG0080048058.01 | MsG0280011070.01 | 0.807875 | 4.082085e-50 | 2.299577e-47 |
MsG0080048058.01 | MsG0280011075.01 | 0.835050 | 2.102741e-56 | 2.541430e-53 |
MsG0080048058.01 | MsG0280011085.01 | 0.817778 | 2.764043e-52 | 2.031809e-49 |
MsG0080048058.01 | MsG0280011105.01 | 0.828025 | 1.130665e-54 | 1.110454e-51 |
MsG0080048058.01 | MsG0280011129.01 | 0.804377 | 2.223935e-49 | 1.144883e-46 |
MsG0080048058.01 | MsG0280011182.01 | 0.831885 | 1.295067e-55 | 1.424343e-52 |
MsG0080048058.01 | MsG0280011201.01 | 0.819805 | 9.578213e-53 | 7.446935e-50 |
MsG0080048058.01 | MsG0280011220.01 | 0.804836 | 1.784314e-49 | 9.295453e-47 |
MsG0080048058.01 | MsG0280011235.01 | 0.815100 | 1.098809e-51 | 7.505494e-49 |
MsG0080048058.01 | MsG0280011293.01 | 0.906301 | 1.716594e-80 | 2.889261e-76 |
MsG0080048058.01 | MsG0280011334.01 | 0.865381 | 6.152890e-65 | 1.997700e-61 |
MsG0080048058.01 | MsG0280011336.01 | 0.879585 | 1.105493e-69 | 6.027062e-66 |
MsG0080048058.01 | MsG0280011340.01 | 0.802782 | 4.765330e-49 | 2.354912e-46 |
MsG0080048058.01 | MsG0280011410.01 | 0.821618 | 3.668775e-53 | 2.999722e-50 |
MsG0080048058.01 | MsG0280011423.01 | 0.842978 | 1.857856e-58 | 2.864670e-55 |
MsG0080048058.01 | MsG0280011444.01 | 0.805141 | 1.540240e-49 | 8.086943e-47 |
MsG0080048058.01 | MsG0380011648.01 | 0.803807 | 2.922817e-49 | 1.482755e-46 |
MsG0080048058.01 | MsG0380011663.01 | 0.807200 | 5.677726e-50 | 3.142872e-47 |
MsG0080048058.01 | MsG0380011721.01 | 0.830898 | 2.266032e-55 | 2.420057e-52 |
MsG0080048058.01 | MsG0380011729.01 | 0.870005 | 2.022439e-66 | 7.745534e-63 |
MsG0080048058.01 | MsG0380011840.01 | 0.818048 | 2.402516e-52 | 1.779029e-49 |
MsG0080048058.01 | MsG0380012017.01 | 0.801347 | 9.399953e-49 | 4.478780e-46 |
MsG0080048058.01 | MsG0380012020.01 | 0.884755 | 1.462628e-71 | 9.770792e-68 |
MsG0080048058.01 | MsG0380012033.01 | 0.800654 | 1.302329e-48 | 6.097379e-46 |
MsG0080048058.01 | MsG0380012057.01 | 0.821690 | 3.531837e-53 | 2.893771e-50 |
MsG0080048058.01 | MsG0380012124.01 | 0.873940 | 9.960175e-68 | 4.400570e-64 |
MsG0080048058.01 | MsG0380012458.01 | 0.828617 | 8.138812e-55 | 8.131761e-52 |
MsG0080048058.01 | MsG0380012471.01 | 0.802334 | 5.892787e-49 | 2.879040e-46 |
MsG0080048058.01 | MsG0380013176.01 | 0.805451 | 1.326732e-49 | 7.021485e-47 |
MsG0080048058.01 | MsG0380013548.01 | 0.834242 | 3.357565e-56 | 3.961075e-53 |
MsG0080048058.01 | MsG0380013579.01 | 0.824909 | 6.249837e-54 | 5.611888e-51 |
MsG0080048058.01 | MsG0380013834.01 | 0.812930 | 3.308146e-51 | 2.130732e-48 |
MsG0080048058.01 | MsG0380014118.01 | 0.830013 | 3.729176e-55 | 3.880927e-52 |
MsG0080048058.01 | MsG0380014128.01 | 0.813842 | 2.085525e-51 | 1.376909e-48 |
MsG0080048058.01 | MsG0380014365.01 | 0.837102 | 6.336553e-57 | 8.146377e-54 |
MsG0080048058.01 | MsG0380014489.01 | 0.869486 | 2.986328e-66 | 1.122898e-62 |
MsG0080048058.01 | MsG0380014537.01 | 0.803480 | 3.416381e-49 | 1.718711e-46 |
MsG0080048058.01 | MsG0380014539.01 | 0.816709 | 4.809250e-52 | 3.432951e-49 |
MsG0080048058.01 | MsG0380014541.01 | 0.858504 | 7.874270e-63 | 2.014043e-59 |
MsG0080048058.01 | MsG0380014576.01 | 0.886702 | 2.718003e-72 | 1.962376e-68 |
MsG0080048058.01 | MsG0380014579.01 | 0.801532 | 8.612261e-49 | 4.122698e-46 |
MsG0080048058.01 | MsG0380014880.01 | 0.838326 | 3.073373e-57 | 4.102036e-54 |
MsG0080048058.01 | MsG0380014885.01 | 0.800486 | 1.409350e-48 | 6.570237e-46 |
MsG0080048058.01 | MsG0380014903.01 | 0.806065 | 9.856942e-50 | 5.299528e-47 |
MsG0080048058.01 | MsG0380014908.01 | 0.803938 | 2.745016e-49 | 1.397383e-46 |
MsG0080048058.01 | MsG0380014949.01 | 0.804950 | 1.689052e-49 | 8.825094e-47 |
MsG0080048058.01 | MsG0380015289.01 | 0.805208 | 1.491165e-49 | 7.842672e-47 |
MsG0080048058.01 | MsG0380015436.01 | 0.845018 | 5.273767e-59 | 8.671591e-56 |
MsG0080048058.01 | MsG0380015512.01 | 0.868743 | 5.204546e-66 | 1.903903e-62 |
MsG0080048058.01 | MsG0380015564.01 | 0.815953 | 7.097721e-52 | 4.962963e-49 |
MsG0080048058.01 | MsG0380015607.01 | 0.839816 | 1.263589e-57 | 1.765426e-54 |
MsG0080048058.01 | MsG0380015614.01 | 0.829012 | 6.529366e-55 | 6.599077e-52 |
MsG0080048058.01 | MsG0380015702.01 | 0.875790 | 2.334162e-68 | 1.104441e-64 |
MsG0080048058.01 | MsG0380015713.01 | 0.902524 | 8.874964e-79 | 1.261884e-74 |
MsG0080048058.01 | MsG0380015831.01 | 0.810852 | 9.378954e-51 | 5.716624e-48 |
MsG0080048058.01 | MsG0380015893.01 | 0.812264 | 4.626945e-51 | 2.928224e-48 |
MsG0080048058.01 | MsG0380015944.01 | 0.807458 | 5.005957e-50 | 2.789752e-47 |
MsG0080048058.01 | MsG0380016055.01 | 0.800355 | 1.498646e-48 | 6.963466e-46 |
MsG0080048058.01 | MsG0380016102.01 | 0.814268 | 1.680034e-51 | 1.122119e-48 |
MsG0080048058.01 | MsG0380016214.01 | 0.813029 | 3.148136e-51 | 2.033088e-48 |
MsG0080048058.01 | MsG0380016227.01 | 0.879243 | 1.460536e-69 | 7.861977e-66 |
MsG0080048058.01 | MsG0380016236.01 | 0.864004 | 1.660800e-64 | 5.135277e-61 |
MsG0080048058.01 | MsG0380016247.01 | 0.804195 | 2.427472e-49 | 1.243776e-46 |
MsG0080048058.01 | MsG0380016273.01 | 0.808670 | 2.763779e-50 | 1.589788e-47 |
MsG0080048058.01 | MsG0380016397.01 | 0.828881 | 7.024116e-55 | 7.071471e-52 |
MsG0080048058.01 | MsG0380016483.01 | 0.889293 | 2.758261e-73 | 2.212008e-69 |
MsG0080048058.01 | MsG0380016510.01 | 0.833145 | 6.310630e-56 | 7.204483e-53 |
MsG0080048058.01 | MsG0380016513.01 | 0.819889 | 9.163070e-53 | 7.140564e-50 |
MsG0080048058.01 | MsG0380016517.01 | 0.807681 | 4.488726e-50 | 2.515937e-47 |
MsG0080048058.01 | MsG0380016561.01 | 0.869015 | 4.247767e-66 | 1.569395e-62 |
MsG0080048058.01 | MsG0380016752.01 | 0.840502 | 8.364526e-58 | 1.193889e-54 |
MsG0080048058.01 | MsG0380016765.01 | 0.831444 | 1.663156e-55 | 1.805220e-52 |
MsG0080048058.01 | MsG0380016859.01 | 0.829621 | 4.647276e-55 | 4.781795e-52 |
MsG0080048058.01 | MsG0380016882.01 | 0.831306 | 1.799055e-55 | 1.944589e-52 |
MsG0080048058.01 | MsG0380016905.01 | 0.804177 | 2.448072e-49 | 1.253777e-46 |
MsG0080048058.01 | MsG0380016941.01 | 0.823554 | 1.301193e-53 | 1.124014e-50 |
MsG0080048058.01 | MsG0380016971.01 | 0.881559 | 2.169796e-70 | 1.277397e-66 |
MsG0080048058.01 | MsG0380016985.01 | 0.868125 | 8.233689e-66 | 2.945411e-62 |
MsG0080048058.01 | MsG0380016994.01 | 0.809637 | 1.715215e-50 | 1.012457e-47 |
MsG0080048058.01 | MsG0380017003.01 | 0.812114 | 4.988754e-51 | 3.144248e-48 |
MsG0080048058.01 | MsG0380017055.01 | 0.810223 | 1.282901e-50 | 7.688962e-48 |
MsG0080048058.01 | MsG0380017195.01 | 0.833687 | 4.620626e-56 | 5.360779e-53 |
MsG0080048058.01 | MsG0380017210.01 | 0.842777 | 2.101902e-58 | 3.220612e-55 |
MsG0080048058.01 | MsG0380017232.01 | 0.843808 | 1.115780e-58 | 1.766050e-55 |
MsG0080048058.01 | MsG0380017233.01 | 0.810335 | 1.213147e-50 | 7.292639e-48 |
MsG0080048058.01 | MsG0380017285.01 | 0.822092 | 2.850416e-53 | 2.362201e-50 |
MsG0080048058.01 | MsG0380017330.01 | 0.811199 | 7.890701e-51 | 4.853636e-48 |
MsG0080048058.01 | MsG0380017375.01 | 0.856329 | 3.463723e-62 | 8.237109e-59 |
MsG0080048058.01 | MsG0380017401.01 | 0.800183 | 1.623897e-48 | 7.512462e-46 |
MsG0080048058.01 | MsG0380017403.01 | 0.823016 | 1.737757e-53 | 1.478632e-50 |
MsG0080048058.01 | MsG0380017410.01 | 0.848320 | 6.608217e-60 | 1.208073e-56 |
MsG0080048058.01 | MsG0380017431.01 | 0.834909 | 2.281956e-56 | 2.746525e-53 |
MsG0080048058.01 | MsG0380017476.01 | 0.813791 | 2.140877e-51 | 1.411505e-48 |
MsG0080048058.01 | MsG0380017604.01 | 0.834611 | 2.712366e-56 | 3.235473e-53 |
MsG0080048058.01 | MsG0380017631.01 | 0.807327 | 5.336054e-50 | 2.963594e-47 |
MsG0080048058.01 | MsG0380017643.01 | 0.852207 | 5.372738e-61 | 1.114458e-57 |
MsG0080048058.01 | MsG0380017719.01 | 0.902694 | 7.459394e-79 | 1.069266e-74 |
MsG0080048058.01 | MsG0380017797.01 | 0.823217 | 1.559683e-53 | 1.334558e-50 |
MsG0080048058.01 | MsG0380017939.01 | 0.859926 | 2.949894e-63 | 7.922926e-60 |
MsG0080048058.01 | MsG0480018117.01 | 0.818956 | 1.495589e-52 | 1.135717e-49 |
MsG0080048058.01 | MsG0480018126.01 | 0.809908 | 1.499761e-50 | 8.915682e-48 |
MsG0080048058.01 | MsG0480018230.01 | 0.808988 | 2.362694e-50 | 1.370585e-47 |
MsG0080048058.01 | MsG0480018235.01 | 0.853802 | 1.877722e-61 | 4.106529e-58 |
MsG0080048058.01 | MsG0480018238.01 | 0.800090 | 1.696177e-48 | 7.828491e-46 |
MsG0080048058.01 | MsG0480018256.01 | 0.877344 | 6.775781e-69 | 3.395620e-65 |
MsG0080048058.01 | MsG0480018289.01 | 0.810253 | 1.263790e-50 | 7.580865e-48 |
MsG0080048058.01 | MsG0480018460.01 | 0.840948 | 6.391625e-58 | 9.249480e-55 |
MsG0080048058.01 | MsG0480018462.01 | 0.898973 | 3.137854e-77 | 3.799244e-73 |
MsG0080048058.01 | MsG0480018479.01 | 0.859455 | 4.087858e-63 | 1.080283e-59 |
MsG0080048058.01 | MsG0480018640.01 | 0.862679 | 4.272373e-64 | 1.261681e-60 |
MsG0080048058.01 | MsG0480018641.01 | 0.843196 | 1.625442e-58 | 2.523603e-55 |
MsG0080048058.01 | MsG0480018846.01 | 0.888722 | 4.588267e-73 | 3.595032e-69 |
MsG0080048058.01 | MsG0480018970.01 | 0.813106 | 3.027924e-51 | 1.959408e-48 |
MsG0080048058.01 | MsG0480019170.01 | 0.891641 | 3.298695e-74 | 2.917054e-70 |
MsG0080048058.01 | MsG0480019289.01 | 0.825414 | 4.748597e-54 | 4.325178e-51 |
MsG0080048058.01 | MsG0480019404.01 | 0.840514 | 8.306960e-58 | 1.186116e-54 |
MsG0080048058.01 | MsG0480019772.01 | 0.807690 | 4.469412e-50 | 2.505679e-47 |
MsG0080048058.01 | MsG0480019816.01 | 0.816684 | 4.872194e-52 | 3.475478e-49 |
MsG0080048058.01 | MsG0480019970.01 | 0.810676 | 1.023992e-50 | 6.211940e-48 |
MsG0080048058.01 | MsG0480020135.01 | 0.802539 | 5.348635e-49 | 2.626744e-46 |
MsG0080048058.01 | MsG0480020144.01 | 0.812001 | 5.280828e-51 | 3.318131e-48 |
MsG0080048058.01 | MsG0480020242.01 | 0.869171 | 3.780281e-66 | 1.405070e-62 |
MsG0080048058.01 | MsG0480020331.01 | 0.910793 | 1.258804e-82 | 2.615112e-78 |
MsG0080048058.01 | MsG0480020416.01 | 0.867349 | 1.461315e-65 | 5.085967e-62 |
MsG0080048058.01 | MsG0480020445.01 | 0.802712 | 4.925382e-49 | 2.429646e-46 |
MsG0080048058.01 | MsG0480020530.01 | 0.827939 | 1.185620e-54 | 1.161441e-51 |
MsG0080048058.01 | MsG0480020540.01 | 0.850377 | 1.766884e-60 | 3.454029e-57 |
MsG0080048058.01 | MsG0480020591.01 | 0.841139 | 5.695365e-58 | 8.290666e-55 |
MsG0080048058.01 | MsG0480020675.01 | 0.825265 | 5.150581e-54 | 4.671690e-51 |
MsG0080048058.01 | MsG0480020720.01 | 0.815529 | 8.825170e-52 | 6.099658e-49 |
MsG0080048058.01 | MsG0480020780.01 | 0.810503 | 1.115999e-50 | 6.738639e-48 |
MsG0080048058.01 | MsG0480020791.01 | 0.835399 | 1.716464e-56 | 2.096643e-53 |
MsG0080048058.01 | MsG0480020917.01 | 0.844916 | 5.622016e-59 | 9.213971e-56 |
MsG0080048058.01 | MsG0480021152.01 | 0.862858 | 3.762967e-64 | 1.118325e-60 |
MsG0080048058.01 | MsG0480021216.01 | 0.836344 | 9.889400e-57 | 1.242859e-53 |
MsG0080048058.01 | MsG0480021240.01 | 0.862351 | 5.387982e-64 | 1.573045e-60 |
MsG0080048058.01 | MsG0480021409.01 | 0.836371 | 9.730220e-57 | 1.223795e-53 |
MsG0080048058.01 | MsG0480021432.01 | 0.833389 | 5.485296e-56 | 6.307913e-53 |
MsG0080048058.01 | MsG0480021534.01 | 0.802483 | 5.491189e-49 | 2.692905e-46 |
MsG0080048058.01 | MsG0480021772.01 | 0.890367 | 1.050683e-73 | 8.809178e-70 |
MsG0080048058.01 | MsG0480021778.01 | 0.860455 | 2.041626e-63 | 5.584210e-60 |
MsG0080048058.01 | MsG0480021784.01 | 0.844623 | 6.739897e-59 | 1.094478e-55 |
MsG0080048058.01 | MsG0480021812.01 | 0.868430 | 6.570389e-66 | 2.375567e-62 |
MsG0080048058.01 | MsG0480021819.01 | 0.802040 | 6.773915e-49 | 3.284707e-46 |
MsG0080048058.01 | MsG0480021896.01 | -0.804444 | 2.153827e-49 | 1.110659e-46 |
MsG0080048058.01 | MsG0480021900.01 | 0.885257 | 9.501127e-72 | 6.475900e-68 |
MsG0080048058.01 | MsG0480021914.01 | 0.853923 | 1.733071e-61 | 3.805475e-58 |
MsG0080048058.01 | MsG0480022026.01 | 0.825252 | 5.188540e-54 | 4.704306e-51 |
MsG0080048058.01 | MsG0480022094.01 | 0.872998 | 2.065989e-67 | 8.822560e-64 |
MsG0080048058.01 | MsG0480022104.01 | 0.808706 | 2.714557e-50 | 1.562952e-47 |
MsG0080048058.01 | MsG0480022108.01 | 0.822575 | 2.201034e-53 | 1.849679e-50 |
MsG0080048058.01 | MsG0480022115.01 | 0.870262 | 1.666151e-66 | 6.440893e-63 |
MsG0080048058.01 | MsG0480022146.01 | 0.815171 | 1.059887e-51 | 7.253493e-49 |
MsG0080048058.01 | MsG0480022228.01 | 0.919905 | 2.507431e-87 | 8.254023e-83 |
MsG0080048058.01 | MsG0480022318.01 | 0.861175 | 1.233800e-63 | 3.459521e-60 |
MsG0080048058.01 | MsG0480022451.01 | 0.823907 | 1.075854e-53 | 9.387322e-51 |
MsG0080048058.01 | MsG0480022453.01 | 0.822095 | 2.845013e-53 | 2.357965e-50 |
MsG0080048058.01 | MsG0480022464.01 | 0.825560 | 4.385319e-54 | 4.010968e-51 |
MsG0080048058.01 | MsG0480022467.01 | 0.812075 | 5.087509e-51 | 3.203137e-48 |
MsG0080048058.01 | MsG0480022480.01 | 0.805843 | 1.097373e-49 | 5.866593e-47 |
MsG0080048058.01 | MsG0480022552.01 | 0.861358 | 1.085563e-63 | 3.063759e-60 |
MsG0080048058.01 | MsG0480022597.01 | 0.851209 | 1.030077e-60 | 2.069546e-57 |
MsG0080048058.01 | MsG0480022598.01 | 0.856707 | 2.682577e-62 | 6.458532e-59 |
MsG0080048058.01 | MsG0480022620.01 | 0.834322 | 3.205755e-56 | 3.791515e-53 |
MsG0080048058.01 | MsG0480022678.01 | 0.867928 | 9.528091e-66 | 3.384429e-62 |
MsG0080048058.01 | MsG0480022710.01 | 0.809519 | 1.818240e-50 | 1.069839e-47 |
MsG0080048058.01 | MsG0480022717.01 | 0.923883 | 1.473718e-89 | 6.046313e-85 |
MsG0080048058.01 | MsG0480022719.01 | 0.899390 | 2.079151e-77 | 2.565969e-73 |
MsG0080048058.01 | MsG0480023013.01 | 0.809832 | 1.557362e-50 | 9.239747e-48 |
MsG0080048058.01 | MsG0480023025.01 | 0.822796 | 1.955886e-53 | 1.653783e-50 |
MsG0080048058.01 | MsG0480023053.01 | 0.869000 | 4.295965e-66 | 1.586254e-62 |
MsG0080048058.01 | MsG0480023165.01 | 0.807520 | 4.855330e-50 | 2.710184e-47 |
MsG0080048058.01 | MsG0480023224.01 | 0.855339 | 6.742790e-62 | 1.551761e-58 |
MsG0080048058.01 | MsG0480023240.01 | 0.843451 | 1.390239e-58 | 2.176067e-55 |
MsG0080048058.01 | MsG0480023245.01 | 0.875233 | 3.620632e-68 | 1.678227e-64 |
MsG0080048058.01 | MsG0480023272.01 | 0.815754 | 7.861271e-52 | 5.467485e-49 |
MsG0080048058.01 | MsG0480023307.01 | 0.816138 | 6.452356e-52 | 4.534833e-49 |
MsG0080048058.01 | MsG0480023412.01 | 0.892835 | 1.099745e-74 | 1.021823e-70 |
MsG0080048058.01 | MsG0480023415.01 | 0.812351 | 4.429164e-51 | 2.809654e-48 |
MsG0080048058.01 | MsG0480023421.01 | 0.812212 | 4.748703e-51 | 3.001106e-48 |
MsG0080048058.01 | MsG0480023427.01 | 0.823959 | 1.045956e-53 | 9.139915e-51 |
MsG0080048058.01 | MsG0480023447.01 | 0.840679 | 7.521083e-58 | 1.079356e-54 |
MsG0080048058.01 | MsG0480023451.01 | 0.801343 | 9.415038e-49 | 4.485568e-46 |
MsG0080048058.01 | MsG0480023460.01 | 0.807134 | 5.861975e-50 | 3.239250e-47 |
MsG0080048058.01 | MsG0480023500.01 | 0.850937 | 1.229146e-60 | 2.447625e-57 |
MsG0080048058.01 | MsG0480023517.01 | 0.811703 | 6.130120e-51 | 3.821120e-48 |
MsG0080048058.01 | MsG0480023554.01 | 0.841681 | 4.099675e-58 | 6.069183e-55 |
MsG0080048058.01 | MsG0480023559.01 | 0.826106 | 3.255028e-54 | 3.023835e-51 |
MsG0080048058.01 | MsG0480023600.01 | 0.826878 | 2.130701e-54 | 2.023547e-51 |
MsG0080048058.01 | MsG0480023620.01 | 0.813962 | 1.962646e-51 | 1.300005e-48 |
MsG0080048058.01 | MsG0480023659.01 | 0.815010 | 1.150536e-51 | 7.840337e-49 |
MsG0080048058.01 | MsG0480023670.01 | 0.803682 | 3.102359e-49 | 1.568782e-46 |
MsG0080048058.01 | MsG0480023718.01 | 0.863674 | 2.103385e-64 | 6.429755e-61 |
MsG0080048058.01 | MsG0480023755.01 | 0.850288 | 1.870429e-60 | 3.645940e-57 |
MsG0080048058.01 | MsG0480023808.01 | 0.835201 | 1.925619e-56 | 2.338143e-53 |
MsG0080048058.01 | MsG0480023873.01 | 0.889655 | 1.993748e-73 | 1.623200e-69 |
MsG0080048058.01 | MsG0480023874.01 | 0.801568 | 8.470083e-49 | 4.058168e-46 |
MsG0080048058.01 | MsG0480024010.01 | 0.801522 | 8.653315e-49 | 4.141302e-46 |
MsG0080048058.01 | MsG0480024014.01 | 0.806210 | 9.188677e-50 | 4.958659e-47 |
MsG0080048058.01 | MsG0580024157.01 | 0.870202 | 1.744198e-66 | 6.727718e-63 |
MsG0080048058.01 | MsG0580024205.01 | 0.848303 | 6.677451e-60 | 1.220123e-56 |
MsG0080048058.01 | MsG0580024251.01 | 0.807675 | 4.502572e-50 | 2.523315e-47 |
MsG0080048058.01 | MsG0580024311.01 | 0.805792 | 1.125133e-49 | 6.007086e-47 |
MsG0080048058.01 | MsG0580024323.01 | 0.855573 | 5.762026e-62 | 1.336193e-58 |
MsG0080048058.01 | MsG0580024353.01 | 0.836628 | 8.369740e-57 | 1.060724e-53 |
MsG0080048058.01 | MsG0580024374.01 | 0.825498 | 4.535461e-54 | 4.140973e-51 |
MsG0080048058.01 | MsG0580024405.01 | 0.819028 | 1.439963e-52 | 1.095667e-49 |
MsG0080048058.01 | MsG0580024418.01 | 0.809497 | 1.837945e-50 | 1.080779e-47 |
MsG0080048058.01 | MsG0580024421.01 | 0.810087 | 1.372485e-50 | 8.196961e-48 |
MsG0080048058.01 | MsG0580024438.01 | -0.820424 | 6.909544e-53 | 5.465336e-50 |
MsG0080048058.01 | MsG0580024536.01 | 0.826616 | 2.460762e-54 | 2.319417e-51 |
MsG0080048058.01 | MsG0580024583.01 | 0.804568 | 2.029803e-49 | 1.050067e-46 |
MsG0080048058.01 | MsG0580024586.01 | 0.823321 | 1.475216e-53 | 1.265952e-50 |
MsG0080048058.01 | MsG0580024618.01 | 0.903267 | 4.136778e-79 | 6.079062e-75 |
MsG0080048058.01 | MsG0580024682.01 | 0.851375 | 9.244878e-61 | 1.867611e-57 |
MsG0080048058.01 | MsG0580024721.01 | 0.842274 | 2.857264e-58 | 4.310006e-55 |
MsG0080048058.01 | MsG0580024733.01 | 0.834102 | 3.639457e-56 | 4.275650e-53 |
MsG0080048058.01 | MsG0580024781.01 | 0.833866 | 4.168629e-56 | 4.863078e-53 |
MsG0080048058.01 | MsG0580024792.01 | 0.805476 | 1.310857e-49 | 6.941762e-47 |
MsG0080048058.01 | MsG0580024793.01 | 0.863453 | 2.462071e-64 | 7.466848e-61 |
MsG0080048058.01 | MsG0580024819.01 | 0.877683 | 5.162875e-69 | 2.619888e-65 |
MsG0080048058.01 | MsG0580024960.01 | 0.903856 | 2.250907e-79 | 3.392215e-75 |
MsG0080048058.01 | MsG0580025008.01 | 0.845960 | 2.931709e-59 | 4.968977e-56 |
MsG0080048058.01 | MsG0580025009.01 | 0.803886 | 2.814790e-49 | 1.430935e-46 |
MsG0080048058.01 | MsG0580025025.01 | 0.849720 | 2.697520e-60 | 5.160857e-57 |
MsG0080048058.01 | MsG0580025026.01 | 0.810185 | 1.307192e-50 | 7.826909e-48 |
MsG0080048058.01 | MsG0580025072.01 | 0.857463 | 1.604122e-62 | 3.962742e-59 |
MsG0080048058.01 | MsG0580025184.01 | 0.845015 | 5.284883e-59 | 8.688840e-56 |
MsG0080048058.01 | MsG0580025237.01 | 0.811107 | 8.261332e-51 | 5.069294e-48 |
MsG0080048058.01 | MsG0580025352.01 | 0.812938 | 3.295555e-51 | 2.123069e-48 |
MsG0080048058.01 | MsG0580025414.01 | 0.800899 | 1.160762e-48 | 5.468625e-46 |
MsG0080048058.01 | MsG0580025532.01 | 0.817850 | 2.662805e-52 | 1.961244e-49 |
MsG0080048058.01 | MsG0580025555.01 | 0.813871 | 2.055095e-51 | 1.357913e-48 |
MsG0080048058.01 | MsG0580025651.01 | 0.802866 | 4.577907e-49 | 2.267086e-46 |
MsG0080048058.01 | MsG0580025807.01 | 0.807497 | 4.911027e-50 | 2.739622e-47 |
MsG0080048058.01 | MsG0580025900.01 | 0.849075 | 4.079339e-60 | 7.643589e-57 |
MsG0080048058.01 | MsG0580025907.01 | 0.835481 | 1.636595e-56 | 2.003912e-53 |
MsG0080048058.01 | MsG0580025922.01 | 0.810548 | 1.091168e-50 | 6.596546e-48 |
MsG0080048058.01 | MsG0580025986.01 | 0.812066 | 5.110074e-51 | 3.216480e-48 |
MsG0080048058.01 | MsG0580025989.01 | 0.857974 | 1.132466e-62 | 2.845848e-59 |
MsG0080048058.01 | MsG0580026225.01 | 0.804575 | 2.022907e-49 | 1.046691e-46 |
MsG0080048058.01 | MsG0580026595.01 | 0.812040 | 5.179305e-51 | 3.257568e-48 |
MsG0080048058.01 | MsG0580026664.01 | 0.827134 | 1.849881e-54 | 1.770046e-51 |
MsG0080048058.01 | MsG0580027129.01 | 0.807645 | 4.569399e-50 | 2.558717e-47 |
MsG0080048058.01 | MsG0580027261.01 | 0.813178 | 2.918590e-51 | 1.892414e-48 |
MsG0080048058.01 | MsG0580027319.01 | -0.804599 | 1.999425e-49 | 1.035182e-46 |
MsG0080048058.01 | MsG0580027441.01 | 0.824710 | 6.963656e-54 | 6.217556e-51 |
MsG0080048058.01 | MsG0580027476.01 | 0.812652 | 3.806523e-51 | 2.433894e-48 |
MsG0080048058.01 | MsG0580027628.01 | 0.836864 | 7.286760e-57 | 9.301662e-54 |
MsG0080048058.01 | MsG0580027891.01 | 0.811105 | 8.268915e-51 | 5.073722e-48 |
MsG0080048058.01 | MsG0580028060.01 | 0.832709 | 8.098321e-56 | 9.125230e-53 |
MsG0080048058.01 | MsG0580028346.01 | 0.803782 | 2.958267e-49 | 1.499781e-46 |
MsG0080048058.01 | MsG0580028605.01 | 0.800214 | 1.601066e-48 | 7.412638e-46 |
MsG0080048058.01 | MsG0580028888.01 | 0.844004 | 9.886396e-59 | 1.574623e-55 |
MsG0080048058.01 | MsG0580028897.01 | 0.807914 | 4.004359e-50 | 2.258104e-47 |
MsG0080048058.01 | MsG0580029009.01 | 0.802522 | 5.391005e-49 | 2.646300e-46 |
MsG0080048058.01 | MsG0580029148.01 | 0.828251 | 9.972603e-55 | 9.858241e-52 |
MsG0080048058.01 | MsG0580029189.01 | 0.837799 | 4.200749e-57 | 5.518041e-54 |
MsG0080048058.01 | MsG0580029208.01 | 0.837908 | 3.936756e-57 | 5.188231e-54 |
MsG0080048058.01 | MsG0580029371.01 | 0.833190 | 6.148713e-56 | 7.028933e-53 |
MsG0080048058.01 | MsG0580029588.01 | 0.803785 | 2.952928e-49 | 1.497246e-46 |
MsG0080048058.01 | MsG0580029592.01 | 0.812463 | 4.186844e-51 | 2.663985e-48 |
MsG0080048058.01 | MsG0580029622.01 | 0.806432 | 8.250459e-50 | 4.477394e-47 |
MsG0080048058.01 | MsG0580029628.01 | 0.801197 | 1.008869e-48 | 4.788753e-46 |
MsG0080048058.01 | MsG0580029629.01 | 0.840512 | 8.313905e-58 | 1.187028e-54 |
MsG0080048058.01 | MsG0580029630.01 | 0.802869 | 4.572426e-49 | 2.264515e-46 |
MsG0080048058.01 | MsG0580029639.01 | 0.832553 | 8.854003e-56 | 9.930338e-53 |
MsG0080048058.01 | MsG0580029640.01 | 0.817530 | 3.143361e-52 | 2.294928e-49 |
MsG0080048058.01 | MsG0580029647.01 | 0.817841 | 2.675281e-52 | 1.969942e-49 |
MsG0080048058.01 | MsG0580029650.01 | 0.813010 | 3.178153e-51 | 2.051476e-48 |
MsG0080048058.01 | MsG0580029651.01 | 0.803764 | 2.983034e-49 | 1.511680e-46 |
MsG0080048058.01 | MsG0580029658.01 | 0.882192 | 1.280435e-70 | 7.725468e-67 |
MsG0080048058.01 | MsG0580029762.01 | 0.845193 | 4.732104e-59 | 7.823859e-56 |
MsG0080048058.01 | MsG0580029801.01 | 0.830472 | 2.881798e-55 | 3.038964e-52 |
MsG0080048058.01 | MsG0580029926.01 | 0.806086 | 9.759224e-50 | 5.249698e-47 |
MsG0080048058.01 | MsG0580030003.01 | 0.884824 | 1.378361e-71 | 9.230087e-68 |
MsG0080048058.01 | MsG0580030100.01 | 0.813612 | 2.344041e-51 | 1.538042e-48 |
MsG0080048058.01 | MsG0580030204.01 | 0.805209 | 1.491083e-49 | 7.842259e-47 |
MsG0080048058.01 | MsG0580030235.01 | 0.860698 | 1.723101e-63 | 4.752696e-60 |
MsG0080048058.01 | MsG0680030321.01 | 0.857151 | 1.984012e-62 | 4.850125e-59 |
MsG0080048058.01 | MsG0680030436.01 | 0.842019 | 3.338949e-58 | 4.996015e-55 |
MsG0080048058.01 | MsG0680030447.01 | 0.852849 | 3.524237e-61 | 7.465011e-58 |
MsG0080048058.01 | MsG0680030684.01 | 0.886893 | 2.299684e-72 | 1.673218e-68 |
MsG0080048058.01 | MsG0680030685.01 | 0.849709 | 2.716924e-60 | 5.195801e-57 |
MsG0080048058.01 | MsG0680030740.01 | 0.845909 | 3.025709e-59 | 5.120141e-56 |
MsG0080048058.01 | MsG0680030841.01 | 0.826037 | 3.378896e-54 | 3.132848e-51 |
MsG0080048058.01 | MsG0680031063.01 | 0.842103 | 3.171700e-58 | 4.758877e-55 |
MsG0080048058.01 | MsG0680031133.01 | 0.836378 | 9.690172e-57 | 1.219034e-53 |
MsG0080048058.01 | MsG0680031301.01 | 0.850473 | 1.659749e-60 | 3.254823e-57 |
MsG0080048058.01 | MsG0680031506.01 | 0.824456 | 7.994808e-54 | 7.084579e-51 |
MsG0080048058.01 | MsG0680031507.01 | 0.800205 | 1.607692e-48 | 7.441532e-46 |
MsG0080048058.01 | MsG0680031508.01 | 0.853127 | 2.933860e-61 | 6.272722e-58 |
MsG0080048058.01 | MsG0680031651.01 | 0.828312 | 9.641447e-55 | 9.547875e-52 |
MsG0080048058.01 | MsG0680031699.01 | 0.853266 | 2.677593e-61 | 5.752384e-58 |
MsG0080048058.01 | MsG0680031719.01 | 0.838769 | 2.361401e-57 | 3.194991e-54 |
MsG0080048058.01 | MsG0680032075.01 | 0.820492 | 6.666142e-53 | 5.282441e-50 |
MsG0080048058.01 | MsG0680033302.01 | 0.816826 | 4.527013e-52 | 3.241924e-49 |
MsG0080048058.01 | MsG0680033392.01 | 0.818478 | 1.919802e-52 | 1.438668e-49 |
MsG0080048058.01 | MsG0680033460.01 | 0.804173 | 2.453233e-49 | 1.256297e-46 |
MsG0080048058.01 | MsG0680033793.01 | 0.850316 | 1.837256e-60 | 3.584587e-57 |
MsG0080048058.01 | MsG0680034037.01 | 0.812452 | 4.208874e-51 | 2.677293e-48 |
MsG0080048058.01 | MsG0680034061.01 | 0.806309 | 8.755750e-50 | 4.736796e-47 |
MsG0080048058.01 | MsG0680034067.01 | 0.813587 | 2.374145e-51 | 1.556666e-48 |
MsG0080048058.01 | MsG0680034617.01 | 0.800727 | 1.258087e-48 | 5.901066e-46 |
MsG0080048058.01 | MsG0680034757.01 | 0.895862 | 6.402166e-76 | 6.756657e-72 |
MsG0080048058.01 | MsG0680035048.01 | 0.809961 | 1.460575e-50 | 8.695186e-48 |
MsG0080048058.01 | MsG0680035306.01 | 0.848120 | 7.506006e-60 | 1.363147e-56 |
MsG0080048058.01 | MsG0680035340.01 | 0.829434 | 5.158342e-55 | 5.278819e-52 |
MsG0080048058.01 | MsG0680035389.01 | 0.810769 | 9.775046e-51 | 5.944745e-48 |
MsG0080048058.01 | MsG0680035476.01 | 0.820135 | 8.049790e-53 | 6.316710e-50 |
MsG0080048058.01 | MsG0680035574.01 | 0.811279 | 7.579313e-51 | 4.671782e-48 |
MsG0080048058.01 | MsG0680035656.01 | 0.819957 | 8.840712e-53 | 6.902635e-50 |
MsG0080048058.01 | MsG0680035764.01 | 0.822816 | 1.934867e-53 | 1.636980e-50 |
MsG0080048058.01 | MsG0780036235.01 | 0.810754 | 9.848131e-51 | 5.986900e-48 |
MsG0080048058.01 | MsG0780036430.01 | 0.843588 | 1.277718e-58 | 2.008714e-55 |
MsG0080048058.01 | MsG0780036548.01 | 0.824213 | 9.119228e-54 | 8.025567e-51 |
MsG0080048058.01 | MsG0780036609.01 | 0.813963 | 1.961392e-51 | 1.299211e-48 |
MsG0080048058.01 | MsG0780036630.01 | 0.833705 | 4.573302e-56 | 5.308691e-53 |
MsG0080048058.01 | MsG0780036633.01 | 0.839503 | 1.524042e-57 | 2.108865e-54 |
MsG0080048058.01 | MsG0780036635.01 | 0.818541 | 1.857707e-52 | 1.394540e-49 |
MsG0080048058.01 | MsG0780036663.01 | 0.886450 | 3.384960e-72 | 2.419147e-68 |
MsG0080048058.01 | MsG0780036719.01 | 0.820170 | 7.901140e-53 | 6.205910e-50 |
MsG0080048058.01 | MsG0780036773.01 | 0.870096 | 1.888952e-66 | 7.257528e-63 |
MsG0080048058.01 | MsG0780036789.01 | 0.806352 | 8.577408e-50 | 4.645264e-47 |
MsG0080048058.01 | MsG0780036836.01 | 0.827317 | 1.672397e-54 | 1.609006e-51 |
MsG0080048058.01 | MsG0780036845.01 | 0.808238 | 3.417297e-50 | 1.943726e-47 |
MsG0080048058.01 | MsG0780036950.01 | 0.826181 | 3.122833e-54 | 2.907382e-51 |
MsG0080048058.01 | MsG0780037142.01 | 0.822279 | 2.578583e-53 | 2.148580e-50 |
MsG0080048058.01 | MsG0780037144.01 | 0.807934 | 3.965612e-50 | 2.237455e-47 |
MsG0080048058.01 | MsG0780037240.01 | 0.803803 | 2.927870e-49 | 1.485196e-46 |
MsG0080048058.01 | MsG0780037287.01 | 0.800375 | 1.484111e-48 | 6.899679e-46 |
MsG0080048058.01 | MsG0780037630.01 | 0.809171 | 2.158978e-50 | 1.258623e-47 |
MsG0080048058.01 | MsG0780037755.01 | 0.833425 | 5.372590e-56 | 6.184843e-53 |
MsG0080048058.01 | MsG0780037975.01 | 0.853836 | 1.835873e-61 | 4.020034e-58 |
MsG0080048058.01 | MsG0780038005.01 | 0.801083 | 1.064267e-48 | 5.037512e-46 |
MsG0080048058.01 | MsG0780038051.01 | 0.805386 | 1.368584e-49 | 7.230802e-47 |
MsG0080048058.01 | MsG0780038422.01 | 0.840854 | 6.766958e-58 | 9.764574e-55 |
MsG0080048058.01 | MsG0780038565.01 | 0.814346 | 1.614817e-51 | 1.080833e-48 |
MsG0080048058.01 | MsG0780038602.01 | 0.812774 | 3.579249e-51 | 2.295856e-48 |
MsG0080048058.01 | MsG0780038603.01 | 0.835240 | 1.882416e-56 | 2.288505e-53 |
MsG0080048058.01 | MsG0780038630.01 | 0.868954 | 4.448005e-66 | 1.639410e-62 |
MsG0080048058.01 | MsG0780038649.01 | 0.802401 | 5.708673e-49 | 2.793869e-46 |
MsG0080048058.01 | MsG0780038837.01 | 0.823960 | 1.045558e-53 | 9.136705e-51 |
MsG0080048058.01 | MsG0780038937.01 | 0.823434 | 1.387925e-53 | 1.194864e-50 |
MsG0080048058.01 | MsG0780039243.01 | 0.812109 | 5.001390e-51 | 3.151799e-48 |
MsG0080048058.01 | MsG0780039252.01 | 0.803769 | 2.976135e-49 | 1.508353e-46 |
MsG0080048058.01 | MsG0780039257.01 | 0.802873 | 4.563649e-49 | 2.260415e-46 |
MsG0080048058.01 | MsG0780039443.01 | 0.813210 | 2.871762e-51 | 1.863700e-48 |
MsG0080048058.01 | MsG0780039452.01 | 0.810139 | 1.337419e-50 | 7.998587e-48 |
MsG0080048058.01 | MsG0780039570.01 | 0.846549 | 2.025615e-59 | 3.499140e-56 |
MsG0080048058.01 | MsG0780039587.01 | 0.852451 | 4.577594e-61 | 9.568651e-58 |
MsG0080048058.01 | MsG0780039654.01 | 0.804624 | 1.975491e-49 | 1.023434e-46 |
MsG0080048058.01 | MsG0780039655.01 | 0.834829 | 2.390766e-56 | 2.870576e-53 |
MsG0080048058.01 | MsG0780039712.01 | 0.868210 | 7.731093e-66 | 2.773954e-62 |
MsG0080048058.01 | MsG0780039717.01 | 0.884716 | 1.512372e-71 | 1.008635e-67 |
MsG0080048058.01 | MsG0780039777.01 | 0.852617 | 4.103387e-61 | 8.623755e-58 |
MsG0080048058.01 | MsG0780039845.01 | 0.860314 | 2.252482e-63 | 6.130615e-60 |
MsG0080048058.01 | MsG0780039858.01 | 0.816563 | 5.185845e-52 | 3.687104e-49 |
MsG0080048058.01 | MsG0780039900.01 | 0.805050 | 1.609579e-49 | 8.431032e-47 |
MsG0080048058.01 | MsG0780040030.01 | 0.803124 | 4.048519e-49 | 2.018059e-46 |
MsG0080048058.01 | MsG0780040044.01 | 0.864360 | 1.285846e-64 | 4.026167e-61 |
MsG0080048058.01 | MsG0780040047.01 | 0.839854 | 1.235006e-57 | 1.727490e-54 |
MsG0080048058.01 | MsG0780040125.01 | 0.832175 | 1.098276e-55 | 1.217981e-52 |
MsG0080048058.01 | MsG0780040176.01 | 0.826907 | 2.097007e-54 | 1.993374e-51 |
MsG0080048058.01 | MsG0780040182.01 | 0.804024 | 2.634732e-49 | 1.344134e-46 |
MsG0080048058.01 | MsG0780040254.01 | 0.816512 | 5.323600e-52 | 3.779707e-49 |
MsG0080048058.01 | MsG0780040261.01 | 0.817242 | 3.650205e-52 | 2.643974e-49 |
MsG0080048058.01 | MsG0780040290.01 | 0.837164 | 6.110466e-57 | 7.870510e-54 |
MsG0080048058.01 | MsG0780040308.01 | 0.805178 | 1.513457e-49 | 7.953633e-47 |
MsG0080048058.01 | MsG0780040312.01 | 0.884222 | 2.305796e-71 | 1.509067e-67 |
MsG0080048058.01 | MsG0780040389.01 | 0.813888 | 2.038091e-51 | 1.347308e-48 |
MsG0080048058.01 | MsG0780040411.01 | 0.858772 | 6.549801e-63 | 1.690625e-59 |
MsG0080048058.01 | MsG0780040488.01 | 0.862223 | 5.900420e-64 | 1.715163e-60 |
MsG0080048058.01 | MsG0780040516.01 | 0.824174 | 9.313854e-54 | 8.187906e-51 |
MsG0080048058.01 | MsG0780040519.01 | 0.853661 | 2.061622e-61 | 4.487665e-58 |
MsG0080048058.01 | MsG0780040669.01 | 0.818846 | 1.583846e-52 | 1.199054e-49 |
MsG0080048058.01 | MsG0780040687.01 | 0.855613 | 5.608201e-62 | 1.302285e-58 |
MsG0080048058.01 | MsG0780040688.01 | 0.868316 | 7.147431e-66 | 2.573824e-62 |
MsG0080048058.01 | MsG0780040691.01 | 0.845073 | 5.097868e-59 | 8.396925e-56 |
MsG0080048058.01 | MsG0780040712.01 | 0.837792 | 4.217080e-57 | 5.538519e-54 |
MsG0080048058.01 | MsG0780040742.01 | 0.812497 | 4.115319e-51 | 2.620712e-48 |
MsG0080048058.01 | MsG0780040788.01 | 0.813032 | 3.142041e-51 | 2.029387e-48 |
MsG0080048058.01 | MsG0780040845.01 | 0.861710 | 8.470855e-64 | 2.418249e-60 |
MsG0080048058.01 | MsG0780040854.01 | 0.834141 | 3.558394e-56 | 4.184835e-53 |
MsG0080048058.01 | MsG0780040856.01 | 0.848175 | 7.246144e-60 | 1.318409e-56 |
MsG0080048058.01 | MsG0780040880.01 | 0.826778 | 2.250561e-54 | 2.131085e-51 |
MsG0080048058.01 | MsG0780040897.01 | 0.839521 | 1.507552e-57 | 2.087131e-54 |
MsG0080048058.01 | MsG0780040947.01 | 0.837709 | 4.428517e-57 | 5.801462e-54 |
MsG0080048058.01 | MsG0780041033.01 | 0.822978 | 1.773363e-53 | 1.507283e-50 |
MsG0080048058.01 | MsG0780041065.01 | 0.810778 | 9.732538e-51 | 5.920292e-48 |
MsG0080048058.01 | MsG0780041127.01 | 0.808937 | 2.422429e-50 | 1.403306e-47 |
MsG0080048058.01 | MsG0780041161.01 | 0.830917 | 2.241982e-55 | 2.395757e-52 |
MsG0080048058.01 | MsG0780041183.01 | 0.825702 | 4.057785e-54 | 3.726641e-51 |
MsG0080048058.01 | MsG0780041239.01 | 0.825682 | 4.102256e-54 | 3.765346e-51 |
MsG0080048058.01 | MsG0780041255.01 | 0.829991 | 3.776298e-55 | 3.927646e-52 |
MsG0080048058.01 | MsG0780041305.01 | 0.855324 | 6.811451e-62 | 1.566767e-58 |
MsG0080048058.01 | MsG0780041310.01 | 0.845138 | 4.894330e-59 | 8.077539e-56 |
MsG0080048058.01 | MsG0780041368.01 | 0.827185 | 1.798937e-54 | 1.723972e-51 |
MsG0080048058.01 | MsG0780041370.01 | 0.818375 | 2.025657e-52 | 1.513755e-49 |
MsG0080048058.01 | MsG0780041371.01 | 0.839455 | 1.568134e-57 | 2.166751e-54 |
MsG0080048058.01 | MsG0780041376.01 | 0.834801 | 2.428706e-56 | 2.913495e-53 |
MsG0080048058.01 | MsG0780041399.01 | 0.808979 | 2.372725e-50 | 1.376089e-47 |
MsG0080048058.01 | MsG0780041423.01 | 0.862418 | 5.139351e-64 | 1.504171e-60 |
MsG0080048058.01 | MsG0780041432.01 | 0.807811 | 4.211193e-50 | 2.368452e-47 |
MsG0080048058.01 | MsG0780041469.01 | 0.888659 | 4.852406e-73 | 3.792813e-69 |
MsG0080048058.01 | MsG0780041490.01 | 0.834517 | 2.862656e-56 | 3.405492e-53 |
MsG0080048058.01 | MsG0780041498.01 | 0.833180 | 6.184336e-56 | 7.067255e-53 |
MsG0080048058.01 | MsG0780041499.01 | 0.804211 | 2.408497e-49 | 1.234568e-46 |
MsG0080048058.01 | MsG0780041535.01 | 0.802917 | 4.468291e-49 | 2.215689e-46 |
MsG0080048058.01 | MsG0780041667.01 | 0.811723 | 6.071661e-51 | 3.786736e-48 |
MsG0080048058.01 | MsG0780041671.01 | 0.843223 | 1.599264e-58 | 2.485054e-55 |
MsG0080048058.01 | MsG0780041754.01 | 0.848879 | 4.625606e-60 | 8.611629e-57 |
MsG0080048058.01 | MsG0880041969.01 | 0.814233 | 1.710349e-51 | 1.141251e-48 |
MsG0080048058.01 | MsG0880042052.01 | 0.835793 | 1.364216e-56 | 1.686033e-53 |
MsG0080048058.01 | MsG0880042206.01 | 0.880248 | 6.415816e-70 | 3.588210e-66 |
MsG0080048058.01 | MsG0880042207.01 | 0.804957 | 1.682876e-49 | 8.794586e-47 |
MsG0080048058.01 | MsG0880042329.01 | 0.857877 | 1.210096e-62 | 3.030724e-59 |
MsG0080048058.01 | MsG0880042520.01 | 0.803750 | 3.003136e-49 | 1.521297e-46 |
MsG0080048058.01 | MsG0880042543.01 | 0.839093 | 1.947118e-57 | 2.660609e-54 |
MsG0080048058.01 | MsG0880042547.01 | 0.882299 | 1.170073e-70 | 7.089550e-67 |
MsG0080048058.01 | MsG0880042552.01 | 0.905851 | 2.773343e-80 | 4.572650e-76 |
MsG0080048058.01 | MsG0880042760.01 | 0.873736 | 1.167209e-67 | 5.120086e-64 |
MsG0080048058.01 | MsG0880042811.01 | 0.825668 | 4.133587e-54 | 3.792620e-51 |
MsG0080048058.01 | MsG0880042829.01 | 0.888839 | 4.134242e-73 | 3.254596e-69 |
MsG0080048058.01 | MsG0880042837.01 | 0.808780 | 2.617073e-50 | 1.509751e-47 |
MsG0080048058.01 | MsG0880042848.01 | 0.809185 | 2.144270e-50 | 1.250524e-47 |
MsG0080048058.01 | MsG0880042983.01 | 0.825202 | 5.329168e-54 | 4.825136e-51 |
MsG0080048058.01 | MsG0880043001.01 | 0.822937 | 1.813363e-53 | 1.539473e-50 |
MsG0080048058.01 | MsG0880043116.01 | 0.830191 | 3.374160e-55 | 3.529875e-52 |
MsG0080048058.01 | MsG0880043142.01 | 0.822911 | 1.838142e-53 | 1.559416e-50 |
MsG0080048058.01 | MsG0880043162.01 | 0.835504 | 1.615134e-56 | 1.978954e-53 |
MsG0080048058.01 | MsG0880043341.01 | 0.843052 | 1.776106e-58 | 2.744844e-55 |
MsG0080048058.01 | MsG0880043480.01 | 0.828363 | 9.372475e-55 | 9.295420e-52 |
MsG0080048058.01 | MsG0880043489.01 | 0.823526 | 1.320889e-53 | 1.140156e-50 |
MsG0080048058.01 | MsG0880043522.01 | 0.845798 | 3.242788e-59 | 5.468034e-56 |
MsG0080048058.01 | MsG0880043532.01 | 0.842174 | 3.038285e-58 | 4.568277e-55 |
MsG0080048058.01 | MsG0880043533.01 | 0.844717 | 6.361343e-59 | 1.036042e-55 |
MsG0080048058.01 | MsG0880043547.01 | 0.803499 | 3.385254e-49 | 1.703889e-46 |
MsG0080048058.01 | MsG0880043692.01 | 0.805984 | 1.025186e-49 | 5.500621e-47 |
MsG0080048058.01 | MsG0880043750.01 | 0.802773 | 4.785343e-49 | 2.364266e-46 |
MsG0080048058.01 | MsG0880043804.01 | 0.821401 | 4.116753e-53 | 3.345765e-50 |
MsG0080048058.01 | MsG0880043886.01 | 0.857213 | 1.902497e-62 | 4.660254e-59 |
MsG0080048058.01 | MsG0880043921.01 | 0.832676 | 8.251296e-56 | 9.288367e-53 |
MsG0080048058.01 | MsG0880044075.01 | 0.890449 | 9.757612e-74 | 8.206113e-70 |
MsG0080048058.01 | MsG0880044237.01 | 0.813174 | 2.925839e-51 | 1.896865e-48 |
MsG0080048058.01 | MsG0880044477.01 | 0.841842 | 3.717105e-58 | 5.531081e-55 |
MsG0080048058.01 | MsG0880044510.01 | 0.829493 | 4.991247e-55 | 5.116532e-52 |
MsG0080048058.01 | MsG0880044546.01 | 0.836748 | 7.801055e-57 | 9.923547e-54 |
MsG0080048058.01 | MsG0880044565.01 | 0.830767 | 2.439940e-55 | 2.595668e-52 |
MsG0080048058.01 | MsG0880044732.01 | 0.815338 | 9.728219e-52 | 6.688901e-49 |
MsG0080048058.01 | MsG0880044878.01 | 0.826327 | 2.882769e-54 | 2.694942e-51 |
MsG0080048058.01 | MsG0880044917.01 | 0.899334 | 2.196301e-77 | 2.704021e-73 |
MsG0080048058.01 | MsG0880045106.01 | 0.844331 | 8.078017e-59 | 1.299751e-55 |
MsG0080048058.01 | MsG0880045165.01 | 0.835407 | 1.708932e-56 | 2.087871e-53 |
MsG0080048058.01 | MsG0880045329.01 | 0.845376 | 4.219957e-59 | 7.018541e-56 |
MsG0080048058.01 | MsG0880045381.01 | 0.841524 | 4.510809e-58 | 6.645887e-55 |
MsG0080048058.01 | MsG0880045393.01 | 0.873192 | 1.779300e-67 | 7.653818e-64 |
MsG0080048058.01 | MsG0880045415.01 | 0.803437 | 3.488386e-49 | 1.752921e-46 |
MsG0080048058.01 | MsG0880045429.01 | 0.824396 | 8.255313e-54 | 7.303020e-51 |
MsG0080048058.01 | MsG0880045433.01 | -0.809691 | 1.669609e-50 | 9.869127e-48 |
MsG0080048058.01 | MsG0880045448.01 | 0.824866 | 6.398443e-54 | 5.738201e-51 |
MsG0080048058.01 | MsG0880045450.01 | 0.816109 | 6.550008e-52 | 4.599731e-49 |
MsG0080048058.01 | MsG0880045506.01 | 0.825328 | 4.977426e-54 | 4.522884e-51 |
MsG0080048058.01 | MsG0880045619.01 | 0.847767 | 9.389493e-60 | 1.686371e-56 |
MsG0080048058.01 | MsG0880045639.01 | 0.827174 | 1.810214e-54 | 1.734170e-51 |
MsG0080048058.01 | MsG0880045656.01 | 0.809307 | 2.018722e-50 | 1.181115e-47 |
MsG0080048058.01 | MsG0880045687.01 | 0.800502 | 1.398564e-48 | 6.522527e-46 |
MsG0080048058.01 | MsG0880045754.01 | 0.821401 | 4.116753e-53 | 3.345765e-50 |
MsG0080048058.01 | MsG0880045838.01 | 0.833714 | 4.550850e-56 | 5.283965e-53 |
MsG0080048058.01 | MsG0880045914.01 | 0.841869 | 3.657769e-58 | 5.447391e-55 |
MsG0080048058.01 | MsG0880046027.01 | 0.924196 | 9.731124e-90 | 4.056092e-85 |
MsG0080048058.01 | MsG0880046047.01 | 0.884401 | 1.979556e-71 | 1.304002e-67 |
MsG0080048058.01 | MsG0880046068.01 | 0.841691 | 4.074662e-58 | 6.033967e-55 |
MsG0080048058.01 | MsG0880046074.01 | 0.818048 | 2.402516e-52 | 1.779029e-49 |
MsG0080048058.01 | MsG0880046113.01 | 0.846138 | 2.621042e-59 | 4.467374e-56 |
MsG0080048058.01 | MsG0880046132.01 | 0.809512 | 1.824047e-50 | 1.073048e-47 |
MsG0080048058.01 | MsG0880046163.01 | 0.821340 | 4.253988e-53 | 3.451406e-50 |
MsG0080048058.01 | MsG0880046317.01 | 0.839836 | 1.248412e-57 | 1.745272e-54 |
MsG0080048058.01 | MsG0880046404.01 | 0.812569 | 3.969257e-51 | 2.532439e-48 |
MsG0080048058.01 | MsG0880046450.01 | 0.809927 | 1.485739e-50 | 8.836704e-48 |
MsG0080048058.01 | MsG0880046532.01 | 0.846792 | 1.738379e-59 | 3.026689e-56 |
MsG0080048058.01 | MsG0880046535.01 | 0.818454 | 1.943517e-52 | 1.455574e-49 |
MsG0080048058.01 | MsG0880046556.01 | 0.819913 | 9.047115e-53 | 7.055306e-50 |
MsG0080048058.01 | MsG0880046560.01 | 0.837289 | 5.673516e-57 | 7.335721e-54 |
MsG0080048058.01 | MsG0880046561.01 | 0.837534 | 4.912052e-57 | 6.399670e-54 |
MsG0080048058.01 | MsG0880046643.01 | 0.844292 | 8.274509e-59 | 1.329743e-55 |
MsG0080048058.01 | MsG0880046684.01 | 0.900351 | 7.995563e-78 | 1.030134e-73 |
MsG0080048058.01 | MsG0880046718.01 | 0.823917 | 1.070017e-53 | 9.339006e-51 |
MsG0080048058.01 | MsG0880046733.01 | 0.801371 | 9.292829e-49 | 4.430478e-46 |
MsG0080048058.01 | MsG0880046762.01 | 0.882973 | 6.647094e-71 | 4.135326e-67 |
MsG0080048058.01 | MsG0880046893.01 | 0.853570 | 2.189133e-61 | 4.751125e-58 |
MsG0080048058.01 | MsG0880046901.01 | 0.810193 | 1.301591e-50 | 7.795036e-48 |
MsG0080048058.01 | MsG0880047016.01 | 0.863685 | 2.086939e-64 | 6.382095e-61 |
MsG0080048058.01 | MsG0880047044.01 | 0.853389 | 2.468004e-61 | 5.323951e-58 |
MsG0080048058.01 | MsG0880047192.01 | 0.824287 | 8.760983e-54 | 7.725989e-51 |
MsG0080048058.01 | MsG0880047289.01 | 0.826789 | 2.236577e-54 | 2.118598e-51 |
MsG0080048058.01 | MsG0880047293.01 | 0.844329 | 8.089635e-59 | 1.301525e-55 |
MsG0080048058.01 | MsG0880047337.01 | 0.810262 | 1.258110e-50 | 7.548550e-48 |
MsG0080048058.01 | MsG0880047353.01 | 0.812357 | 4.415161e-51 | 2.801258e-48 |
MsG0080048058.01 | MsG0880047391.01 | 0.823229 | 1.550113e-53 | 1.326803e-50 |
MsG0080048058.01 | MsG0880047437.01 | 0.822030 | 2.945855e-53 | 2.436979e-50 |
MsG0080048058.01 | MsG0880047470.01 | 0.814384 | 1.583820e-51 | 1.061216e-48 |
MsG0080048058.01 | MsG0880047472.01 | 0.811024 | 8.608491e-51 | 5.271231e-48 |
MsG0080048058.01 | MsG0880047473.01 | 0.803398 | 3.553858e-49 | 1.784074e-46 |
MsG0080048058.01 | MsG0880047497.01 | 0.813380 | 2.635512e-51 | 1.718464e-48 |
MsG0080048058.01 | MsG0880047590.01 | 0.870155 | 1.806554e-66 | 6.956242e-63 |
MsG0080048058.01 | MsG0880047594.01 | 0.808690 | 2.736514e-50 | 1.574916e-47 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048058.01.T01 | MTR_0121s0010 | 100.000 | 242 | 0 | 0 | 1 | 242 | 330 | 571 | 2.83e-176 | 505 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080048058.01.T01 | AT2G41770 | 73.589 | 443 | 113 | 3 | 1 | 440 | 330 | 771 | 0.0 | 701 |
MsG0080048058.01.T01 | AT3G57420 | 72.748 | 444 | 116 | 3 | 1 | 440 | 323 | 765 | 0.0 | 681 |
Find 197 sgRNAs with CRISPR-Local
Find 360 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
ATTGGATGAACAAGCGAATT+TGG | 0.154291 | contig185end:+27480 | MsG0080048058.01.T01:five_prime_UTR |
TGGATCGTGGTTTCGGTTTC+GGG | 0.176847 | contig185end:+27344 | MsG0080048058.01.T01:five_prime_UTR |
TTACCCCTTTATTGTATATT+TGG | 0.182549 | contig185end:+31183 | MsG0080048058.01.T01:three_prime_UTR |
ATGGATCGTGGTTTCGGTTT+CGG | 0.202501 | contig185end:+27343 | MsG0080048058.01.T01:five_prime_UTR |
CTTGAATGGAGGTTGCTTTA+TGG | 0.204494 | contig185end:+28594 | MsG0080048058.01.T01:CDS |
GGCTTTGATGCTTCCGGTTT+CGG | 0.226169 | contig185end:+28029 | MsG0080048058.01.T01:CDS |
TTAATCCGTATGTTCATTTC+GGG | 0.242895 | contig185end:+27728 | MsG0080048058.01.T01:five_prime_UTR |
CCATTTCTCCGATAAGAAAT+TGG | 0.244039 | contig185end:-27324 | None:intergenic |
GGAAGTGATTGATGGGGATT+TGG | 0.244626 | contig185end:+27615 | MsG0080048058.01.T01:five_prime_UTR |
GTTAATCCGTATGTTCATTT+CGG | 0.262879 | contig185end:+27727 | MsG0080048058.01.T01:five_prime_UTR |
TGGTCGTTTGATTAAGTATT+TGG | 0.267726 | contig185end:+28209 | MsG0080048058.01.T01:CDS |
TTGAATGGAGGTTGCTTTAT+GGG | 0.271758 | contig185end:+28595 | MsG0080048058.01.T01:CDS |
ATTGGGGACAGAGGCTTCTT+TGG | 0.272761 | contig185end:+28085 | MsG0080048058.01.T01:CDS |
CAAGTGTATTACATGTTTCT+TGG | 0.275021 | contig185end:-31051 | None:intergenic |
ATAATACAATTCTTAACTAT+TGG | 0.279959 | contig185end:+29566 | MsG0080048058.01.T01:CDS |
GGATTTGGATTTGGATTTGA+TGG | 0.280995 | contig185end:-27026 | None:intergenic |
CAGAGGCTTCTTTGGGAAGT+TGG | 0.281653 | contig185end:+28093 | MsG0080048058.01.T01:CDS |
CAATACAACTTCAACTAGTT+TGG | 0.291418 | contig185end:-26776 | None:intergenic |
ACTTACTGCCGCTTGGCTTC+AGG | 0.292900 | contig185end:+28329 | MsG0080048058.01.T01:CDS |
AACAAGCGAATTTGGGGTTT+AGG | 0.295560 | contig185end:+27488 | MsG0080048058.01.T01:five_prime_UTR |
GTGGACCAAATATACAATAA+AGG | 0.296960 | contig185end:-31188 | None:intergenic |
TTGGATGAACAAGCGAATTT+GGG | 0.298467 | contig185end:+27481 | MsG0080048058.01.T01:five_prime_UTR |
GAAGTGATTGATGGGGATTT+GGG | 0.301864 | contig185end:+27616 | MsG0080048058.01.T01:five_prime_UTR |
GGAGAAATGGATCGTGGTTT+CGG | 0.315807 | contig185end:+27337 | MsG0080048058.01.T01:five_prime_UTR |
ACAAGCGAATTTGGGGTTTA+GGG | 0.318031 | contig185end:+27489 | MsG0080048058.01.T01:five_prime_UTR |
TAAGGTTGAGGTTACTTGTT+TGG | 0.318086 | contig185end:-26820 | None:intergenic |
TCCTATGTTCTTTGTCTCAA+TGG | 0.319924 | contig185end:+30796 | MsG0080048058.01.T01:CDS |
GGATGTAGATCTTGTTGTTC+AGG | 0.321727 | contig185end:+28656 | MsG0080048058.01.T01:CDS |
TATTAAGCTTATCAGAATAA+TGG | 0.322958 | contig185end:+30952 | MsG0080048058.01.T01:CDS |
GGATTAACAACAGTCCTATT+AGG | 0.325620 | contig185end:-27712 | None:intergenic |
TAATTCATCGACTCTTTATT+CGG | 0.328571 | contig185end:+30880 | MsG0080048058.01.T01:CDS |
TGGACCAAATATACAATAAA+GGG | 0.337671 | contig185end:-31187 | None:intergenic |
GCAGCCAAGGCTAATGTCTT+TGG | 0.343412 | contig185end:+28374 | MsG0080048058.01.T01:CDS |
AGTTGCCGTCTGTTCATCTT+GGG | 0.343959 | contig185end:+28457 | MsG0080048058.01.T01:CDS |
CAAACTGTGGATCACTAATA+AGG | 0.351930 | contig185end:+29612 | MsG0080048058.01.T01:CDS |
TGCCTTATGATTCTTATGTT+AGG | 0.355042 | contig185end:+27524 | MsG0080048058.01.T01:five_prime_UTR |
TCAAGGGCCGTGCGTTCAAC+AGG | 0.356613 | contig185end:-28576 | None:intergenic |
CCAATTTCTTATCGGAGAAA+TGG | 0.359485 | contig185end:+27324 | MsG0080048058.01.T01:five_prime_UTR |
TGTTGTTCAGGAGGTCCATT+TGG | 0.361246 | contig185end:+28668 | MsG0080048058.01.T01:CDS |
CTTATTAGTGATCCACAGTT+TGG | 0.364518 | contig185end:-29611 | None:intergenic |
CCTTTCAAACCAATTCCATT+AGG | 0.365051 | contig185end:-30991 | None:intergenic |
TAGATTGTTTGAGAAGATCT+TGG | 0.375637 | contig185end:+28254 | MsG0080048058.01.T01:CDS |
GGATCCACTCCTAATGGAAT+TGG | 0.390534 | contig185end:+30982 | MsG0080048058.01.T01:CDS |
ATAGTCATGATAATCCTAAT+AGG | 0.391156 | contig185end:+27698 | MsG0080048058.01.T01:five_prime_UTR |
TGAAGTTGTATTGAAGCTTA+AGG | 0.391419 | contig185end:+26786 | MsG0080048058.01.T01:five_prime_UTR |
CATCTTGGGGTTGAAGAAAC+AGG | 0.392444 | contig185end:+28471 | MsG0080048058.01.T01:CDS |
GCGGTACGCCAATTTCTTAT+CGG | 0.393983 | contig185end:+27316 | MsG0080048058.01.T01:five_prime_UTR |
CTACTGTTCATAGATATGAT+AGG | 0.407020 | contig185end:+28139 | MsG0080048058.01.T01:CDS |
TTGGAAAATGTGGGTGAGAT+TGG | 0.407974 | contig185end:+27781 | MsG0080048058.01.T01:five_prime_UTR |
AAGGTTGAGGTTACTTGTTT+GGG | 0.411934 | contig185end:-26819 | None:intergenic |
TTGGGGACAGAGGCTTCTTT+GGG | 0.414271 | contig185end:+28086 | MsG0080048058.01.T01:CDS |
AGGCTAATGTCTTTGGAACT+TGG | 0.425095 | contig185end:+28381 | MsG0080048058.01.T01:CDS |
TTTGAGCTGAAGAATGCTCT+TGG | 0.429481 | contig185end:-27001 | None:intergenic |
ACTTGTATGCTTGGTCCAAA+TGG | 0.429651 | contig185end:-28683 | None:intergenic |
AAGTTGCCGTCTGTTCATCT+TGG | 0.435637 | contig185end:+28456 | MsG0080048058.01.T01:CDS |
GGATCTCTAGATTGTCTACT+AGG | 0.437860 | contig185end:-30757 | None:intergenic |
TCGAGTATCCACGCGTCGAT+TGG | 0.438176 | contig185end:+27261 | MsG0080048058.01.T01:five_prime_UTR |
CTTCAGGATTTGTTAGCTGT+TGG | 0.439157 | contig185end:+28345 | MsG0080048058.01.T01:CDS |
GCCATCCTACTAACCGAAAC+CGG | 0.441030 | contig185end:-28042 | None:intergenic |
TTCCTAACATAAGAATCATA+AGG | 0.444632 | contig185end:-27526 | None:intergenic |
AAGATCTTTCTCCTCCGAAA+AGG | 0.448139 | contig185end:-28175 | None:intergenic |
TCCGGTTTCGGTTAGTAGGA+TGG | 0.448274 | contig185end:+28041 | MsG0080048058.01.T01:CDS |
ACAGGGCTTACTTGTATGCT+TGG | 0.450117 | contig185end:-28692 | None:intergenic |
TCTTATGTTAGGAAAATTGT+TGG | 0.452749 | contig185end:+27535 | MsG0080048058.01.T01:five_prime_UTR |
GTATGAGTAAAACGGTTTGT+AGG | 0.456341 | contig185end:-27077 | None:intergenic |
AAGTGATTGATGGGGATTTG+GGG | 0.459051 | contig185end:+27617 | MsG0080048058.01.T01:five_prime_UTR |
CTGTTTCTTAATACTAGCTC+AGG | 0.460358 | contig185end:+31020 | MsG0080048058.01.T01:three_prime_UTR |
TGCTTCCGGTTTCGGTTAGT+AGG | 0.460720 | contig185end:+28037 | MsG0080048058.01.T01:CDS |
TGGGAAACAGTTTATTCAGC+AGG | 0.461080 | contig185end:+27834 | MsG0080048058.01.T01:five_prime_UTR |
ATCGTATTAAATGAATTAAC+CGG | 0.461414 | contig185end:-27985 | None:intergenic |
GGTTGGCAGGTTGTGGCGAT+TGG | 0.462329 | contig185end:+27406 | MsG0080048058.01.T01:five_prime_UTR |
ATTTCGGGCAAAGATCGGTT+TGG | 0.462691 | contig185end:+27743 | MsG0080048058.01.T01:five_prime_UTR |
GGTGAAGGTGAAGGGTTGGC+AGG | 0.466313 | contig185end:+27393 | MsG0080048058.01.T01:five_prime_UTR |
TTGAACGCACGGCCCTTGAA+TGG | 0.467596 | contig185end:+28580 | MsG0080048058.01.T01:CDS |
TGCTCATCATGCATTGCAGC+GGG | 0.467759 | contig185end:+28553 | MsG0080048058.01.T01:CDS |
CATAAAGCAACCTCCATTCA+AGG | 0.468909 | contig185end:-28593 | None:intergenic |
TAAGAATTGTATTATCCTGC+AGG | 0.478651 | contig185end:-29558 | None:intergenic |
TGCTCTTGGACCAACATTGA+AGG | 0.480017 | contig185end:-26987 | None:intergenic |
TGAAGGGGATCCACTCCTAA+TGG | 0.480182 | contig185end:+30976 | MsG0080048058.01.T01:CDS |
TTTATATTCTAAAATTTGTA+GGG | 0.481296 | contig185end:+31138 | MsG0080048058.01.T01:three_prime_UTR |
CCTTGAGGCAATGCAACCTT+CGG | 0.482435 | contig185end:-27952 | None:intergenic |
ACAAGCAAGCATGGTACAAA+AGG | 0.482807 | contig185end:+30598 | MsG0080048058.01.T01:CDS |
GATAGAGGGGAAGTGATTGA+TGG | 0.484221 | contig185end:+27607 | MsG0080048058.01.T01:five_prime_UTR |
CAAGAAACATGTAATACACT+TGG | 0.488778 | contig185end:+31052 | MsG0080048058.01.T01:three_prime_UTR |
CCGGCGGATTGGAGTTTGAA+AGG | 0.489846 | contig185end:+27442 | MsG0080048058.01.T01:five_prime_UTR |
CTTATGTTAGGAAAATTGTT+GGG | 0.491867 | contig185end:+27536 | MsG0080048058.01.T01:five_prime_UTR |
TGGAAAATGTGGGTGAGATT+GGG | 0.491908 | contig185end:+27782 | MsG0080048058.01.T01:five_prime_UTR |
GGTGAAGGGTTGGCAGGTTG+TGG | 0.495035 | contig185end:+27399 | MsG0080048058.01.T01:five_prime_UTR |
ATTCGAGAACTCCGGCGGAT+TGG | 0.496519 | contig185end:+27431 | MsG0080048058.01.T01:five_prime_UTR |
CCGTCGCCAATGTTTGCTCT+CGG | 0.496762 | contig185end:-28408 | None:intergenic |
TGTTCATTTCGGGCAAAGAT+CGG | 0.496894 | contig185end:+27738 | MsG0080048058.01.T01:five_prime_UTR |
ATAGAGGGGAAGTGATTGAT+GGG | 0.496914 | contig185end:+27608 | MsG0080048058.01.T01:five_prime_UTR |
CGCGAATTTCTATCGGCGAT+TGG | 0.499666 | contig185end:-27296 | None:intergenic |
GGTTCTTTGTATGAGTAAAA+CGG | 0.504942 | contig185end:-27085 | None:intergenic |
TTTGTGGGATAAACTCCCTC+TGG | 0.506060 | contig185end:-28434 | None:intergenic |
CCTAATGGAATTGGTTTGAA+AGG | 0.515705 | contig185end:+30991 | MsG0080048058.01.T01:exon |
AGGTTTGCCGTTGGAAAATG+TGG | 0.515820 | contig185end:+27771 | MsG0080048058.01.T01:five_prime_UTR |
ATTTGATAAGCATGCGCCGA+AGG | 0.516174 | contig185end:+27936 | MsG0080048058.01.T01:five_prime_UTR |
AGATCTTTCTCCTCCGAAAA+GGG | 0.517524 | contig185end:-28174 | None:intergenic |
AGGCTTCTTTGGGAAGTTGG+TGG | 0.517813 | contig185end:+28096 | MsG0080048058.01.T01:CDS |
GATGTTGAATTGGTTGGTGA+AGG | 0.518714 | contig185end:+27649 | MsG0080048058.01.T01:five_prime_UTR |
ACACTCCATGGATGAACAGC+AGG | 0.520445 | contig185end:-30911 | None:intergenic |
TAAAACACAGAATCAACATC+AGG | 0.525213 | contig185end:-27874 | None:intergenic |
GGATCCAGGTACCCGAGTCT+TGG | 0.526382 | contig185end:+30531 | MsG0080048058.01.T01:intron |
AGATTGCTAATTTAATCAGA+TGG | 0.527605 | contig185end:+28508 | MsG0080048058.01.T01:CDS |
ATTCAGCAGGGGATTTCGAA+TGG | 0.529606 | contig185end:+27847 | MsG0080048058.01.T01:five_prime_UTR |
GTATTTGGTTCTGTGGAGAT+CGG | 0.533204 | contig185end:+28224 | MsG0080048058.01.T01:CDS |
AAGTCCCTGCTGTTCATCCA+TGG | 0.538895 | contig185end:+30906 | MsG0080048058.01.T01:CDS |
TGCTCACTTGATACACTCCA+TGG | 0.539121 | contig185end:-30923 | None:intergenic |
ATATTCTAAAATTTGTAGGG+TGG | 0.539442 | contig185end:+31141 | MsG0080048058.01.T01:three_prime_UTR |
GGCGTACCGCGAATTTCTAT+CGG | 0.540568 | contig185end:-27303 | None:intergenic |
CTTATCAGAATAATGGCTGA+AGG | 0.541500 | contig185end:+30959 | MsG0080048058.01.T01:CDS |
CCGAAGGTTGCATTGCCTCA+AGG | 0.543760 | contig185end:+27952 | MsG0080048058.01.T01:five_prime_UTR |
CAAACCAATTCCATTAGGAG+TGG | 0.547394 | contig185end:-30986 | None:intergenic |
AATTGGTTGGTGAAGGTGCT+AGG | 0.547539 | contig185end:+27656 | MsG0080048058.01.T01:five_prime_UTR |
TAGGAATTGCAACCTTCTGA+TGG | 0.548976 | contig185end:-30778 | None:intergenic |
TACTGTTCATAGATATGATA+GGG | 0.549071 | contig185end:+28140 | MsG0080048058.01.T01:CDS |
AATTGGTGAAGGTGAAGGGT+TGG | 0.549083 | contig185end:+27389 | MsG0080048058.01.T01:five_prime_UTR |
GAGCTATGCAATGGCAGAGG+AGG | 0.549739 | contig185end:+28281 | MsG0080048058.01.T01:CDS |
GATCAATTTAGCAGTGCAGA+AGG | 0.550258 | contig185end:+29526 | MsG0080048058.01.T01:CDS |
AAAGATCTTCATGTGAATGT+TGG | 0.550556 | contig185end:+28189 | MsG0080048058.01.T01:CDS |
AGTTCCAAAGACATTAGCCT+TGG | 0.553282 | contig185end:-28378 | None:intergenic |
TGATTAAGTATTTGGTTCTG+TGG | 0.556491 | contig185end:+28217 | MsG0080048058.01.T01:CDS |
CTGTTGGTTATCAGCAGCCA+AGG | 0.556994 | contig185end:+28361 | MsG0080048058.01.T01:CDS |
CAAAGATCGGTTTGGCCGAG+AGG | 0.557674 | contig185end:+27751 | MsG0080048058.01.T01:five_prime_UTR |
ATGTGAAACTTACTGCCGCT+TGG | 0.558320 | contig185end:+28322 | MsG0080048058.01.T01:CDS |
AGTAAGTTTCACATCCTTGT+CGG | 0.561276 | contig185end:-28313 | None:intergenic |
CTTCAACTAGTTTGGTGTGG+TGG | 0.566078 | contig185end:-26768 | None:intergenic |
CTATTGGAACTTACTACAAG+CGG | 0.566905 | contig185end:+29582 | MsG0080048058.01.T01:CDS |
TTATCAAATCGAATATCAAA+CGG | 0.567778 | contig185end:-27922 | None:intergenic |
GGTTACTTGTTTGGGTGTGT+CGG | 0.569498 | contig185end:-26811 | None:intergenic |
TTATCAGAATAATGGCTGAA+GGG | 0.569902 | contig185end:+30960 | MsG0080048058.01.T01:CDS |
TATCAGAATAATGGCTGAAG+GGG | 0.570759 | contig185end:+30961 | MsG0080048058.01.T01:CDS |
GGGAAACAGTTTATTCAGCA+GGG | 0.570903 | contig185end:+27835 | MsG0080048058.01.T01:five_prime_UTR |
AGCTATGCAATGGCAGAGGA+GGG | 0.571690 | contig185end:+28282 | MsG0080048058.01.T01:CDS |
CAGCGGGCCTGTTGAACGCA+CGG | 0.576027 | contig185end:+28569 | MsG0080048058.01.T01:CDS |
GAACCTCGACTTCTCCGTAT+GGG | 0.576994 | contig185end:+27103 | MsG0080048058.01.T01:five_prime_UTR |
TAATTGACTTGAAAGTGAGC+TGG | 0.577756 | contig185end:-30635 | None:intergenic |
TTGGCCGAGAGGTTTGCCGT+TGG | 0.578979 | contig185end:+27762 | MsG0080048058.01.T01:five_prime_UTR |
TCATAGATATGATAGGGTTG+AGG | 0.580741 | contig185end:+28146 | MsG0080048058.01.T01:CDS |
CTTTGCCCGAAATGAACATA+CGG | 0.581045 | contig185end:-27733 | None:intergenic |
TTTACACTCAGGTGTTTGGT+GGG | 0.581224 | contig185end:+27815 | MsG0080048058.01.T01:five_prime_UTR |
GTTGCCGTCTGTTCATCTTG+GGG | 0.584264 | contig185end:+28458 | MsG0080048058.01.T01:CDS |
AGAACCTCGACTTCTCCGTA+TGG | 0.585282 | contig185end:+27102 | MsG0080048058.01.T01:five_prime_UTR |
CTATCATATCTATGAACAGT+AGG | 0.586324 | contig185end:-28138 | None:intergenic |
GCCTCAAGGTGTGATGATGC+CGG | 0.591200 | contig185end:+27966 | MsG0080048058.01.T01:exon |
GTTATCTCAACAAGCAAGCA+TGG | 0.594597 | contig185end:+30589 | MsG0080048058.01.T01:CDS |
CTTGGATTTGAGCTATGCAA+TGG | 0.599337 | contig185end:+28272 | MsG0080048058.01.T01:CDS |
TGGTGAAGGTGCTAGGCAAG+AGG | 0.599388 | contig185end:+27663 | MsG0080048058.01.T01:five_prime_UTR |
CTGGGGACAACAATGCCGAC+TGG | 0.599896 | contig185end:+30567 | MsG0080048058.01.T01:CDS |
TGAGAGGTTATTGGGGACAG+AGG | 0.600387 | contig185end:+28076 | MsG0080048058.01.T01:CDS |
TGTAGATCTTGTTGTTCAGG+AGG | 0.604664 | contig185end:+28659 | MsG0080048058.01.T01:CDS |
AAGAAACATGTAATACACTT+GGG | 0.605203 | contig185end:+31053 | MsG0080048058.01.T01:three_prime_UTR |
TCTCAGAACTGCATAACAAG+AGG | 0.608851 | contig185end:-30685 | None:intergenic |
ATAAAGCAACCTCCATTCAA+GGG | 0.609066 | contig185end:-28592 | None:intergenic |
AACGCACGGCCCTTGAATGG+AGG | 0.610127 | contig185end:+28583 | MsG0080048058.01.T01:CDS |
GTGCTCATCATGCATTGCAG+CGG | 0.613729 | contig185end:+28552 | MsG0080048058.01.T01:CDS |
TGGATGAACAAGCGAATTTG+GGG | 0.613883 | contig185end:+27482 | MsG0080048058.01.T01:five_prime_UTR |
CTTATCGGAGAAATGGATCG+TGG | 0.614495 | contig185end:+27331 | MsG0080048058.01.T01:five_prime_UTR |
GATTGGTGATTCGAGAACTC+CGG | 0.618148 | contig185end:+27423 | MsG0080048058.01.T01:five_prime_UTR |
CAATCTAGAGATCCATCAGA+AGG | 0.618842 | contig185end:+30766 | MsG0080048058.01.T01:CDS |
TAAAGAGTCGATGAATTAGT+CGG | 0.622063 | contig185end:-30875 | None:intergenic |
TCATATCTATGAACAGTAGG+TGG | 0.622312 | contig185end:-28135 | None:intergenic |
CAATCGCCGATAGAAATTCG+CGG | 0.623883 | contig185end:+27297 | MsG0080048058.01.T01:five_prime_UTR |
TCCATTGAGACAAAGAACAT+AGG | 0.624497 | contig185end:-30797 | None:intergenic |
CCTTTCAAACTCCAATCCGC+CGG | 0.626527 | contig185end:-27442 | None:intergenic |
CCGAGAGCAAACATTGGCGA+CGG | 0.626681 | contig185end:+28408 | MsG0080048058.01.T01:CDS |
TTTCTGTCTCTCTGTCTGTG+TGG | 0.626924 | contig185end:+26862 | MsG0080048058.01.T01:five_prime_UTR |
TTTGAGCTATGCAATGGCAG+AGG | 0.629954 | contig185end:+28278 | MsG0080048058.01.T01:CDS |
AAAACAGAAGACCAAGACTC+GGG | 0.631408 | contig185end:-30542 | None:intergenic |
ACCGGCATCATCACACCTTG+AGG | 0.632524 | contig185end:-27967 | None:intergenic |
TAAAACAGAAGACCAAGACT+CGG | 0.634593 | contig185end:-30543 | None:intergenic |
CAACTTCAACTAGTTTGGTG+TGG | 0.635626 | contig185end:-26771 | None:intergenic |
TAGGAAGAAAAGTGCTGCGA+CGG | 0.642741 | contig185end:-27174 | None:intergenic |
GGAAACAGTTTATTCAGCAG+GGG | 0.643036 | contig185end:+27836 | MsG0080048058.01.T01:five_prime_UTR |
GGTCGTCCGAGAGCAAACAT+TGG | 0.645849 | contig185end:+28402 | MsG0080048058.01.T01:CDS |
TGGTGATTCGAGAACTCCGG+CGG | 0.650136 | contig185end:+27426 | MsG0080048058.01.T01:five_prime_UTR |
GGACCAAATATACAATAAAG+GGG | 0.650966 | contig185end:-31186 | None:intergenic |
CTCGAAACAAAGTAAAGCGG+CGG | 0.651448 | contig185end:-27213 | None:intergenic |
TATTTGTTTGCAATTCAACA+TGG | 0.651854 | contig185end:+27559 | MsG0080048058.01.T01:five_prime_UTR |
ATGCCCATACGGAGAAGTCG+AGG | 0.653724 | contig185end:-27106 | None:intergenic |
GATTGTCTACTAGGTTAACA+AGG | 0.654365 | contig185end:-30748 | None:intergenic |
TAGAGGGGAAGTGATTGATG+GGG | 0.654974 | contig185end:+27609 | MsG0080048058.01.T01:five_prime_UTR |
TCAACCCCAAGATGAACAGA+CGG | 0.659344 | contig185end:-28462 | None:intergenic |
GGTTACGACGAGAAGAATGA+CGG | 0.668817 | contig185end:-27153 | None:intergenic |
GTTCTCGAAACAAAGTAAAG+CGG | 0.672242 | contig185end:-27216 | None:intergenic |
CATTGGCGACGGAGACCAGA+GGG | 0.673144 | contig185end:+28419 | MsG0080048058.01.T01:CDS |
TAACAAATCCTGAAGCCAAG+CGG | 0.680742 | contig185end:-28337 | None:intergenic |
TGCTTGTTGAGATAACCAGT+CGG | 0.682815 | contig185end:-30582 | None:intergenic |
CGGTGTCGCCAACGTTACGT+AGG | 0.691901 | contig185end:-27193 | None:intergenic |
AAGCGGATAAAACCAAACTG+TGG | 0.694265 | contig185end:+29599 | MsG0080048058.01.T01:CDS |
CACTCCATGGATGAACAGCA+GGG | 0.698430 | contig185end:-30910 | None:intergenic |
AGAGTCGATGAATTAGTCGG+AGG | 0.700411 | contig185end:-30872 | None:intergenic |
GGTTTGCCGTTGGAAAATGT+GGG | 0.718853 | contig185end:+27772 | MsG0080048058.01.T01:five_prime_UTR |
AAATCACTAATTAAGCGCTG+AGG | 0.719879 | contig185end:-30719 | None:intergenic |
ACTTGGGTAAATCATCTACA+CGG | 0.722737 | contig185end:+31069 | MsG0080048058.01.T01:three_prime_UTR |
ACATTGGCGACGGAGACCAG+AGG | 0.725189 | contig185end:+28418 | MsG0080048058.01.T01:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!!! | TTTATATTCTAAAATTTGTA+GGG | + | contig185end:31138-31157 | MsG0080048058.01.T01:three_prime_UTR | 10.0% |
!!! | TTTTATATTCTAAAATTTGT+AGG | + | contig185end:31137-31156 | MsG0080048058.01.T01:three_prime_UTR | 10.0% |
!! | AAAAGAAAAACATAAATACA+GGG | - | contig185end:30092-30111 | None:intergenic | 15.0% |
!! | AAACATTATATTAACAACTT+AGG | - | contig185end:29972-29991 | None:intergenic | 15.0% |
!! | AAATTAAAATTATATCCAGT+AGG | - | contig185end:29467-29486 | None:intergenic | 15.0% |
!! | AAGATATGTGAAAATTATAA+AGG | + | contig185end:30307-30326 | MsG0080048058.01.T01:intron | 15.0% |
!! | AGATATGTGAAAATTATAAA+GGG | + | contig185end:30308-30327 | MsG0080048058.01.T01:intron | 15.0% |
!! | ATAATACAATTCTTAACTAT+TGG | + | contig185end:29566-29585 | MsG0080048058.01.T01:CDS | 15.0% |
!! | ATTAGAAATAAATCATGAAA+AGG | + | contig185end:29364-29383 | MsG0080048058.01.T01:intron | 15.0% |
!! | TAAAAGAAAAACATAAATAC+AGG | - | contig185end:30093-30112 | None:intergenic | 15.0% |
!! | TTAGAAATAAATCATGAAAA+GGG | + | contig185end:29365-29384 | MsG0080048058.01.T01:intron | 15.0% |
!!! | AACAATTTTGTAAAGATTTT+CGG | - | contig185end:27132-27151 | None:intergenic | 15.0% |
!!! | ATATTTTCACAAAAAAAGAA+AGG | - | contig185end:31238-31257 | None:intergenic | 15.0% |
!!! | CTAAATTGATCAAATATTTT+TGG | - | contig185end:29517-29536 | None:intergenic | 15.0% |
!!! | TTTTTTACATAACATATGAT+TGG | - | contig185end:29941-29960 | None:intergenic | 15.0% |
!!! | TTTTTTGTGAAAATATGAAA+CGG | + | contig185end:31242-31261 | MsG0080048058.01.T01:three_prime_UTR | 15.0% |
!! | AAAGAAAAACATAAATACAG+GGG | - | contig185end:30091-30110 | None:intergenic | 20.0% |
!! | AATAAAGGGGTAAAAAAAAA+AGG | - | contig185end:31176-31195 | None:intergenic | 20.0% |
!! | ATAAAGGGGTAAAAAAAAAA+GGG | - | contig185end:31175-31194 | None:intergenic | 20.0% |
!! | ATCGTATTAAATGAATTAAC+CGG | - | contig185end:27988-28007 | None:intergenic | 20.0% |
!! | ATGTTATGTAAAAAAGAGTT+TGG | + | contig185end:29946-29965 | MsG0080048058.01.T01:intron | 20.0% |
!! | CATATATTAATGTTAGCATA+TGG | - | contig185end:29143-29162 | None:intergenic | 20.0% |
!! | TATTAAGCTTATCAGAATAA+TGG | + | contig185end:30952-30971 | MsG0080048058.01.T01:CDS | 20.0% |
!! | TTATCAAATCGAATATCAAA+CGG | - | contig185end:27925-27944 | None:intergenic | 20.0% |
!!! | AGATCACTTTTTTTCAAATA+AGG | - | contig185end:27056-27075 | None:intergenic | 20.0% |
!!! | ATTCTGTGTTTTATTTTACA+AGG | + | contig185end:27884-27903 | MsG0080048058.01.T01:five_prime_UTR | 20.0% |
!!! | ATTTGGTATCAAATGTTTTA+TGG | + | contig185end:28944-28963 | MsG0080048058.01.T01:intron | 20.0% |
!!! | CGATATAGTTTTAATAATTG+CGG | + | contig185end:28788-28807 | MsG0080048058.01.T01:intron | 20.0% |
!!! | CTTTTTTTCAAATAAGGTTT+TGG | - | contig185end:27050-27069 | None:intergenic | 20.0% |
!!! | GTTTTATTTTACAAGGAAAT+CGG | + | contig185end:27891-27910 | MsG0080048058.01.T01:five_prime_UTR | 20.0% |
!!! | TAATGTGTTCATTTTATGTA+TGG | - | contig185end:30271-30290 | None:intergenic | 20.0% |
!!! | TTTGGTATCAAATGTTTTAT+GGG | + | contig185end:28945-28964 | MsG0080048058.01.T01:intron | 20.0% |
!!! | TTTTATTTTACAAGGAAATC+GGG | + | contig185end:27892-27911 | MsG0080048058.01.T01:five_prime_UTR | 20.0% |
!!! | TTTTTTTCACTAAATCATGT+TGG | + | contig185end:30006-30025 | MsG0080048058.01.T01:intron | 20.0% |
! | AAGAAACATGTAATACACTT+GGG | + | contig185end:31053-31072 | MsG0080048058.01.T01:three_prime_UTR | 25.0% |
! | AATACACTAGTACTTCAATA+AGG | - | contig185end:29415-29434 | None:intergenic | 25.0% |
! | AATGCTATGTCTTTCAAAAA+TGG | - | contig185end:30385-30404 | None:intergenic | 25.0% |
! | AGATTGCTAATTTAATCAGA+TGG | + | contig185end:28508-28527 | MsG0080048058.01.T01:CDS | 25.0% |
! | AGTTGTATGCAAAATAAAAC+AGG | - | contig185end:28713-28732 | None:intergenic | 25.0% |
! | ATAATCATTAGAGGCTTATT+TGG | - | contig185end:30177-30196 | None:intergenic | 25.0% |
! | ATAGTCATGATAATCCTAAT+AGG | + | contig185end:27698-27717 | MsG0080048058.01.T01:five_prime_UTR | 25.0% |
! | ATATGAAAGTAGAGTTAAGA+TGG | + | contig185end:29335-29354 | MsG0080048058.01.T01:intron | 25.0% |
! | ATTTGATACCAAATTGTGAA+GGG | - | contig185end:28938-28957 | None:intergenic | 25.0% |
! | CAGACAATAATAATCATTAG+AGG | - | contig185end:30186-30205 | None:intergenic | 25.0% |
! | CTCTAATGATTATTATTGTC+TGG | + | contig185end:30184-30203 | MsG0080048058.01.T01:intron | 25.0% |
! | CTTATGTTAGGAAAATTGTT+GGG | + | contig185end:27536-27555 | MsG0080048058.01.T01:five_prime_UTR | 25.0% |
! | GATTAGAAATAAATGCTTCA+CGG | - | contig185end:29249-29268 | None:intergenic | 25.0% |
! | GTTGTATGCAAAATAAAACA+GGG | - | contig185end:28712-28731 | None:intergenic | 25.0% |
! | TACTGTTCATAGATATGATA+GGG | + | contig185end:28140-28159 | MsG0080048058.01.T01:CDS | 25.0% |
! | TATTTGTTTGCAATTCAACA+TGG | + | contig185end:27559-27578 | MsG0080048058.01.T01:five_prime_UTR | 25.0% |
! | TCTTATGTTAGGAAAATTGT+TGG | + | contig185end:27535-27554 | MsG0080048058.01.T01:five_prime_UTR | 25.0% |
! | TGACTTTGATCAAATAATGA+GGG | - | contig185end:30066-30085 | None:intergenic | 25.0% |
! | TGGACCAAATATACAATAAA+GGG | - | contig185end:31190-31209 | None:intergenic | 25.0% |
! | TTACCCCTTTATTGTATATT+TGG | + | contig185end:31183-31202 | MsG0080048058.01.T01:three_prime_UTR | 25.0% |
! | TTCAGAGTCTGATAAAATAT+CGG | + | contig185end:29051-29070 | MsG0080048058.01.T01:intron | 25.0% |
! | TTCCTAACATAAGAATCATA+AGG | - | contig185end:27529-27548 | None:intergenic | 25.0% |
! | TTGACTTTGATCAAATAATG+AGG | - | contig185end:30067-30086 | None:intergenic | 25.0% |
! | TTGCAAATTAAAACAGAAAG+TGG | - | contig185end:29727-29746 | None:intergenic | 25.0% |
!! | AAGGAAAAAAAAAGAAGTGT+TGG | - | contig185end:26971-26990 | None:intergenic | 25.0% |
!! | ACATTAATTCATTTTCTCTG+TGG | - | contig185end:31210-31229 | None:intergenic | 25.0% |
!! | ATTTGAAATAGTGCTCATTT+AGG | - | contig185end:30129-30148 | None:intergenic | 25.0% |
!! | TTTGAAATAGTGCTCATTTA+GGG | - | contig185end:30128-30147 | None:intergenic | 25.0% |
!!! | AACGTTTTTTAAAACCAAAC+AGG | - | contig185end:29693-29712 | None:intergenic | 25.0% |
!!! | ACTTTTTGATTGATCATGAA+AGG | + | contig185end:29276-29295 | MsG0080048058.01.T01:intron | 25.0% |
!!! | ATATTCTAAAATTTGTAGGG+TGG | + | contig185end:31141-31160 | MsG0080048058.01.T01:three_prime_UTR | 25.0% |
!!! | ATTGATCAAATATTTTTGGC+AGG | - | contig185end:29513-29532 | None:intergenic | 25.0% |
!!! | CTTTTTTTTTCCTTCAATGT+TGG | + | contig185end:26977-26996 | MsG0080048058.01.T01:five_prime_UTR | 25.0% |
!!! | GAAACATTTTGATGTTGAAT+TGG | + | contig185end:27639-27658 | MsG0080048058.01.T01:five_prime_UTR | 25.0% |
!!! | TAATTCATCGACTCTTTATT+CGG | + | contig185end:30880-30899 | MsG0080048058.01.T01:CDS | 25.0% |
!!! | TAGATTGTTTTATCAAGAAC+AGG | - | contig185end:30842-30861 | None:intergenic | 25.0% |
!!! | TTACTACTATTTTTTCCTAC+TGG | + | contig185end:29449-29468 | MsG0080048058.01.T01:intron | 25.0% |
!!! | TTCAAATAAGGTTTTGGATT+TGG | - | contig185end:27044-27063 | None:intergenic | 25.0% |
AAAGATCTTCATGTGAATGT+TGG | + | contig185end:28189-28208 | MsG0080048058.01.T01:CDS | 30.0% | |
AAATGCTTCACGGTAAAAAT+AGG | - | contig185end:29239-29258 | None:intergenic | 30.0% | |
ATCAGATGGAGAAAAACTTT+CGG | + | contig185end:28522-28541 | MsG0080048058.01.T01:CDS | 30.0% | |
CAAGAAACATGTAATACACT+TGG | + | contig185end:31052-31071 | MsG0080048058.01.T01:three_prime_UTR | 30.0% | |
CAAGTGTATTACATGTTTCT+TGG | - | contig185end:31054-31073 | None:intergenic | 30.0% | |
CAATACAACTTCAACTAGTT+TGG | - | contig185end:26779-26798 | None:intergenic | 30.0% | |
CATTAACTCTTAAAACTCCA+CGG | + | contig185end:30401-30420 | MsG0080048058.01.T01:intron | 30.0% | |
CATTTGATACCAAATTGTGA+AGG | - | contig185end:28939-28958 | None:intergenic | 30.0% | |
CTACTGTTCATAGATATGAT+AGG | + | contig185end:28139-28158 | MsG0080048058.01.T01:CDS | 30.0% | |
CTATCATATCTATGAACAGT+AGG | - | contig185end:28141-28160 | None:intergenic | 30.0% | |
GAGACAAAATGAAAGTAAGA+AGG | - | contig185end:29761-29780 | None:intergenic | 30.0% | |
GGACCAAATATACAATAAAG+GGG | - | contig185end:31189-31208 | None:intergenic | 30.0% | |
GGTTCTTTGTATGAGTAAAA+CGG | - | contig185end:27088-27107 | None:intergenic | 30.0% | |
GTGAACACAGATAATGAAAT+CGG | + | contig185end:29794-29813 | MsG0080048058.01.T01:intron | 30.0% | |
GTGGACCAAATATACAATAA+AGG | - | contig185end:31191-31210 | None:intergenic | 30.0% | |
GTTAATCCGTATGTTCATTT+CGG | + | contig185end:27727-27746 | MsG0080048058.01.T01:five_prime_UTR | 30.0% | |
TAAAACACAGAATCAACATC+AGG | - | contig185end:27877-27896 | None:intergenic | 30.0% | |
TAAAGAGTCGATGAATTAGT+CGG | - | contig185end:30878-30897 | None:intergenic | 30.0% | |
TAAATACATTCGTATACGCA+GGG | + | contig185end:30230-30249 | MsG0080048058.01.T01:intron | 30.0% | |
TAAGAATTGTATTATCCTGC+AGG | - | contig185end:29561-29580 | None:intergenic | 30.0% | |
TAGATTGTTTGAGAAGATCT+TGG | + | contig185end:28254-28273 | MsG0080048058.01.T01:CDS | 30.0% | |
TGAAGTTGTATTGAAGCTTA+AGG | + | contig185end:26786-26805 | MsG0080048058.01.T01:five_prime_UTR | 30.0% | |
TGATTGATCATGAAAGGATT+TGG | + | contig185end:29282-29301 | MsG0080048058.01.T01:intron | 30.0% | |
TGCCTTATGATTCTTATGTT+AGG | + | contig185end:27524-27543 | MsG0080048058.01.T01:five_prime_UTR | 30.0% | |
TGGTCGTTTGATTAAGTATT+TGG | + | contig185end:28209-28228 | MsG0080048058.01.T01:CDS | 30.0% | |
TTAAATACATTCGTATACGC+AGG | + | contig185end:30229-30248 | MsG0080048058.01.T01:intron | 30.0% | |
TTAATCCGTATGTTCATTTC+GGG | + | contig185end:27728-27747 | MsG0080048058.01.T01:five_prime_UTR | 30.0% | |
TTAGCATATGGTTAAAGTGA+TGG | - | contig185end:29131-29150 | None:intergenic | 30.0% | |
TTATCAGAATAATGGCTGAA+GGG | + | contig185end:30960-30979 | MsG0080048058.01.T01:CDS | 30.0% | |
! | AGGTTGTATCTTTTTGTCAT+TGG | + | contig185end:27462-27481 | MsG0080048058.01.T01:five_prime_UTR | 30.0% |
! | ATGAGTTGAAAAATTGGTGA+AGG | + | contig185end:27378-27397 | MsG0080048058.01.T01:five_prime_UTR | 30.0% |
! | ATTTTTGATGCTGATGATAG+AGG | + | contig185end:27592-27611 | MsG0080048058.01.T01:five_prime_UTR | 30.0% |
! | CATGAATCTAAAACTGAACA+TGG | + | contig185end:28911-28930 | MsG0080048058.01.T01:intron | 30.0% |
! | GTTGTTGAAGATTTTGTATG+AGG | - | contig185end:29883-29902 | None:intergenic | 30.0% |
! | TTTTTGATGCTGATGATAGA+GGG | + | contig185end:27593-27612 | MsG0080048058.01.T01:five_prime_UTR | 30.0% |
! | TTTTTGTTCAACACTTGAAC+TGG | + | contig185end:26892-26911 | MsG0080048058.01.T01:five_prime_UTR | 30.0% |
!! | AATTTTTCAACTCATCACTC+GGG | - | contig185end:27373-27392 | None:intergenic | 30.0% |
!! | CAATTTTTCAACTCATCACT+CGG | - | contig185end:27374-27393 | None:intergenic | 30.0% |
!! | CATTTTGATGTTGAATTGGT+TGG | + | contig185end:27643-27662 | MsG0080048058.01.T01:five_prime_UTR | 30.0% |
!! | GTTTTAATAATTGCGGTCTA+TGG | + | contig185end:28795-28814 | MsG0080048058.01.T01:intron | 30.0% |
!! | TGATTAAGTATTTGGTTCTG+TGG | + | contig185end:28217-28236 | MsG0080048058.01.T01:CDS | 30.0% |
!! | TTTCTGTTGACTCAAATTAG+TGG | + | contig185end:29657-29676 | MsG0080048058.01.T01:intron | 30.0% |
!!! | AGTGTAAGTAGTTTTGTGTA+AGG | - | contig185end:26841-26860 | None:intergenic | 30.0% |
!!! | CACTATTTTTGATTGAGAAG+AGG | - | contig185end:31095-31114 | None:intergenic | 30.0% |
!!! | GGAATCATGGTTTTAAATTG+TGG | - | contig185end:28886-28905 | None:intergenic | 30.0% |
!!! | TAAGGTTTTGGATTTGGATT+TGG | - | contig185end:27038-27057 | None:intergenic | 30.0% |
!!! | TGATGTTTTGAGAGGTTATT+GGG | + | contig185end:28068-28087 | MsG0080048058.01.T01:CDS | 30.0% |
!!! | TGTTCAGTTTTAGATTCATG+TGG | - | contig185end:28911-28930 | None:intergenic | 30.0% |
!!! | TTTTTTCATTTCCTGTTTCC+AGG | + | contig185end:29485-29504 | MsG0080048058.01.T01:intron | 30.0% |
AAATACATTCGTATACGCAG+GGG | + | contig185end:30231-30250 | MsG0080048058.01.T01:intron | 35.0% | |
AAGGTTGAGGTTACTTGTTT+GGG | - | contig185end:26822-26841 | None:intergenic | 35.0% | |
ACTTGGGTAAATCATCTACA+CGG | + | contig185end:31069-31088 | MsG0080048058.01.T01:three_prime_UTR | 35.0% | |
AGTAAGTTTCACATCCTTGT+CGG | - | contig185end:28316-28335 | None:intergenic | 35.0% | |
ATAAAGCAACCTCCATTCAA+GGG | - | contig185end:28595-28614 | None:intergenic | 35.0% | |
ATCATGCAAACACAAGAACT+GGG | - | contig185end:29845-29864 | None:intergenic | 35.0% | |
ATTGGATGAACAAGCGAATT+TGG | + | contig185end:27480-27499 | MsG0080048058.01.T01:five_prime_UTR | 35.0% | |
CAAACTGTGGATCACTAATA+AGG | + | contig185end:29612-29631 | MsG0080048058.01.T01:CDS | 35.0% | |
CATGAAAAGGGAATTGTAGA+GGG | + | contig185end:29377-29396 | MsG0080048058.01.T01:intron | 35.0% | |
CCAATTTCTTATCGGAGAAA+TGG | + | contig185end:27324-27343 | MsG0080048058.01.T01:five_prime_UTR | 35.0% | |
CCATTTCTCCGATAAGAAAT+TGG | - | contig185end:27327-27346 | None:intergenic | 35.0% | |
CCTTTCAAACCAATTCCATT+AGG | - | contig185end:30994-31013 | None:intergenic | 35.0% | |
CTATTGGAACTTACTACAAG+CGG | + | contig185end:29582-29601 | MsG0080048058.01.T01:CDS | 35.0% | |
CTTATCAGAATAATGGCTGA+AGG | + | contig185end:30959-30978 | MsG0080048058.01.T01:CDS | 35.0% | |
CTTATTAGTGATCCACAGTT+TGG | - | contig185end:29614-29633 | None:intergenic | 35.0% | |
GAAAAATTGGTGAAGGTGAA+GGG | + | contig185end:27385-27404 | MsG0080048058.01.T01:five_prime_UTR | 35.0% | |
GGATAATGATTCTGTATCTG+CGG | - | contig185end:29920-29939 | None:intergenic | 35.0% | |
GGATTAACAACAGTCCTATT+AGG | - | contig185end:27715-27734 | None:intergenic | 35.0% | |
GGATTTGGATTTGGATTTGA+TGG | - | contig185end:27029-27048 | None:intergenic | 35.0% | |
GTATGAGTAAAACGGTTTGT+AGG | - | contig185end:27080-27099 | None:intergenic | 35.0% | |
GTTCTCGAAACAAAGTAAAG+CGG | - | contig185end:27219-27238 | None:intergenic | 35.0% | |
TAAAACAGAAGACCAAGACT+CGG | - | contig185end:30546-30565 | None:intergenic | 35.0% | |
TAAGGTTGAGGTTACTTGTT+TGG | - | contig185end:26823-26842 | None:intergenic | 35.0% | |
TATAAAGGGTCCTCAGAAAA+AGG | + | contig185end:30322-30341 | MsG0080048058.01.T01:intron | 35.0% | |
TATCAGAATAATGGCTGAAG+GGG | + | contig185end:30961-30980 | MsG0080048058.01.T01:CDS | 35.0% | |
TATCATGCAAACACAAGAAC+TGG | - | contig185end:29846-29865 | None:intergenic | 35.0% | |
TCAGATGGAGAAAAACTTTC+GGG | + | contig185end:28523-28542 | MsG0080048058.01.T01:CDS | 35.0% | |
TCATAGATATGATAGGGTTG+AGG | + | contig185end:28146-28165 | MsG0080048058.01.T01:CDS | 35.0% | |
TCATATCTATGAACAGTAGG+TGG | - | contig185end:28138-28157 | None:intergenic | 35.0% | |
TCATGAAAAGGGAATTGTAG+AGG | + | contig185end:29376-29395 | MsG0080048058.01.T01:intron | 35.0% | |
TCCATTGAGACAAAGAACAT+AGG | - | contig185end:30800-30819 | None:intergenic | 35.0% | |
TCCTATGTTCTTTGTCTCAA+TGG | + | contig185end:30796-30815 | MsG0080048058.01.T01:CDS | 35.0% | |
TGAAAAATTGGTGAAGGTGA+AGG | + | contig185end:27384-27403 | MsG0080048058.01.T01:five_prime_UTR | 35.0% | |
TTAATAATTGCGGTCTATGG+CGG | + | contig185end:28798-28817 | MsG0080048058.01.T01:intron | 35.0% | |
TTGGATGAACAAGCGAATTT+GGG | + | contig185end:27481-27500 | MsG0080048058.01.T01:five_prime_UTR | 35.0% | |
! | AAATCACTAATTAAGCGCTG+AGG | - | contig185end:30722-30741 | None:intergenic | 35.0% |
! | AAGATTTTGTATGAGGAGGA+GGG | - | contig185end:29876-29895 | None:intergenic | 35.0% |
! | AGAAGGATTTTTATTCCTGC+AGG | + | contig185end:29543-29562 | MsG0080048058.01.T01:CDS | 35.0% |
! | CGAGTGATGAGTTGAAAAAT+TGG | + | contig185end:27372-27391 | MsG0080048058.01.T01:five_prime_UTR | 35.0% |
! | CTGTTTCTTAATACTAGCTC+AGG | + | contig185end:31020-31039 | MsG0080048058.01.T01:three_prime_UTR | 35.0% |
! | GAAAGGATTTGGAATAGAGA+TGG | + | contig185end:29293-29312 | MsG0080048058.01.T01:intron | 35.0% |
! | GGAAGAAGTGCGTATAAAAA+GGG | + | contig185end:30347-30366 | MsG0080048058.01.T01:intron | 35.0% |
! | GTTGAAGATTTTGTATGAGG+AGG | - | contig185end:29880-29899 | None:intergenic | 35.0% |
! | TTGAATGGAGGTTGCTTTAT+GGG | + | contig185end:28595-28614 | MsG0080048058.01.T01:CDS | 35.0% |
! | TTTTACAAGGAAATCGGGTT+TGG | + | contig185end:27897-27916 | MsG0080048058.01.T01:five_prime_UTR | 35.0% |
! | TTTTGATGCTGATGATAGAG+GGG | + | contig185end:27594-27613 | MsG0080048058.01.T01:five_prime_UTR | 35.0% |
!! | CCTAATGGAATTGGTTTGAA+AGG | + | contig185end:30991-31010 | MsG0080048058.01.T01:exon | 35.0% |
!! | CGTTATTTTGTCGGAAAAGA+AGG | + | contig185end:28635-28654 | MsG0080048058.01.T01:CDS | 35.0% |
!! | TAATTGACTTGAAAGTGAGC+TGG | - | contig185end:30638-30657 | None:intergenic | 35.0% |
!!! | AAATATTTTTGGCAGGTACC+TGG | - | contig185end:29506-29525 | None:intergenic | 35.0% |
!!! | AGTAGTTTTGTGTAAGGTTG+AGG | - | contig185end:26835-26854 | None:intergenic | 35.0% |
!!! | CAATTTTGGCTGCAAAATAG+AGG | - | contig185end:28853-28872 | None:intergenic | 35.0% |
!!! | CAGAAGTGTCGTTATTTTGT+CGG | + | contig185end:28626-28645 | MsG0080048058.01.T01:CDS | 35.0% |
!!! | CAGTTTTAGATTCATGTGGA+TGG | - | contig185end:28907-28926 | None:intergenic | 35.0% |
!!! | CTGATGTTTTGAGAGGTTAT+TGG | + | contig185end:28067-28086 | MsG0080048058.01.T01:CDS | 35.0% |
!!! | CTTGGTCTTCTGTTTTAACT+GGG | + | contig185end:30549-30568 | MsG0080048058.01.T01:CDS | 35.0% |
!!! | GAAGTGTTGGTTTGTGTTTT+TGG | - | contig185end:26958-26977 | None:intergenic | 35.0% |
!!! | GATGTTTTGAGAGGTTATTG+GGG | + | contig185end:28069-28088 | MsG0080048058.01.T01:CDS | 35.0% |
!!! | TCTTGGTCTTCTGTTTTAAC+TGG | + | contig185end:30548-30567 | MsG0080048058.01.T01:CDS | 35.0% |
!!! | TTGGTCTTCTGTTTTAACTG+GGG | + | contig185end:30550-30569 | MsG0080048058.01.T01:CDS | 35.0% |
AAAACAGAAGACCAAGACTC+GGG | - | contig185end:30545-30564 | None:intergenic | 40.0% | |
AAAAGGGAATTGTAGAGGGA+AGG | + | contig185end:29381-29400 | MsG0080048058.01.T01:intron | 40.0% | |
AACATGGACCCTTCACAATT+TGG | + | contig185end:28927-28946 | MsG0080048058.01.T01:intron | 40.0% | |
AAGATCTTTCTCCTCCGAAA+AGG | - | contig185end:28178-28197 | None:intergenic | 40.0% | |
AAGCGGATAAAACCAAACTG+TGG | + | contig185end:29599-29618 | MsG0080048058.01.T01:CDS | 40.0% | |
AAGTGATTGATGGGGATTTG+GGG | + | contig185end:27617-27636 | MsG0080048058.01.T01:five_prime_UTR | 40.0% | |
ACAAGCAAGCATGGTACAAA+AGG | + | contig185end:30598-30617 | MsG0080048058.01.T01:CDS | 40.0% | |
ACTAAGCTGCGTATTAGTGA+TGG | + | contig185end:28761-28780 | MsG0080048058.01.T01:intron | 40.0% | |
ACTTGTATGCTTGGTCCAAA+TGG | - | contig185end:28686-28705 | None:intergenic | 40.0% | |
AGAGGGAAAATGAAAGCTAG+TGG | - | contig185end:30496-30515 | None:intergenic | 40.0% | |
AGATCTTTCTCCTCCGAAAA+GGG | - | contig185end:28177-28196 | None:intergenic | 40.0% | |
ATAGAGGGGAAGTGATTGAT+GGG | + | contig185end:27608-27627 | MsG0080048058.01.T01:five_prime_UTR | 40.0% | |
CAAACCAATTCCATTAGGAG+TGG | - | contig185end:30989-31008 | None:intergenic | 40.0% | |
CATAAAGCAACCTCCATTCA+AGG | - | contig185end:28596-28615 | None:intergenic | 40.0% | |
CTTGGATTTGAGCTATGCAA+TGG | + | contig185end:28272-28291 | MsG0080048058.01.T01:CDS | 40.0% | |
CTTTGCCCGAAATGAACATA+CGG | - | contig185end:27736-27755 | None:intergenic | 40.0% | |
GAAGTGATTGATGGGGATTT+GGG | + | contig185end:27616-27635 | MsG0080048058.01.T01:five_prime_UTR | 40.0% | |
GATCAATTTAGCAGTGCAGA+AGG | + | contig185end:29526-29545 | MsG0080048058.01.T01:CDS | 40.0% | |
GATTCATGTGGATGGAATCA+TGG | - | contig185end:28899-28918 | None:intergenic | 40.0% | |
GGAAACAGTTTATTCAGCAG+GGG | + | contig185end:27836-27855 | MsG0080048058.01.T01:five_prime_UTR | 40.0% | |
GGGAAACAGTTTATTCAGCA+GGG | + | contig185end:27835-27854 | MsG0080048058.01.T01:five_prime_UTR | 40.0% | |
GTGCGTATAAAAAGGGATAG+AGG | + | contig185end:30354-30373 | MsG0080048058.01.T01:intron | 40.0% | |
GTTATCTCAACAAGCAAGCA+TGG | + | contig185end:30589-30608 | MsG0080048058.01.T01:CDS | 40.0% | |
TAACAAATCCTGAAGCCAAG+CGG | - | contig185end:28340-28359 | None:intergenic | 40.0% | |
TAGGAATTGCAACCTTCTGA+TGG | - | contig185end:30781-30800 | None:intergenic | 40.0% | |
TAGTGCTCATTTAGGGACAA+AGG | - | contig185end:30121-30140 | None:intergenic | 40.0% | |
TCTCAGAACTGCATAACAAG+AGG | - | contig185end:30688-30707 | None:intergenic | 40.0% | |
TCTTCCAAAGTTTCCATTGG+TGG | - | contig185end:29194-29213 | None:intergenic | 40.0% | |
TGCTCTTCCAAAGTTTCCAT+TGG | - | contig185end:29197-29216 | None:intergenic | 40.0% | |
TGGAAAATGTGGGTGAGATT+GGG | + | contig185end:27782-27801 | MsG0080048058.01.T01:five_prime_UTR | 40.0% | |
TGGATGAACAAGCGAATTTG+GGG | + | contig185end:27482-27501 | MsG0080048058.01.T01:five_prime_UTR | 40.0% | |
TGGGAAACAGTTTATTCAGC+AGG | + | contig185end:27834-27853 | MsG0080048058.01.T01:five_prime_UTR | 40.0% | |
TGTTCATTTCGGGCAAAGAT+CGG | + | contig185end:27738-27757 | MsG0080048058.01.T01:five_prime_UTR | 40.0% | |
TTATGGGCAATAGAAGACTG+AGG | + | contig185end:28961-28980 | MsG0080048058.01.T01:intron | 40.0% | |
TTGGAAAATGTGGGTGAGAT+TGG | + | contig185end:27781-27800 | MsG0080048058.01.T01:five_prime_UTR | 40.0% | |
TTTACACTCAGGTGTTTGGT+GGG | + | contig185end:27815-27834 | MsG0080048058.01.T01:five_prime_UTR | 40.0% | |
TTTGAGCTGAAGAATGCTCT+TGG | - | contig185end:27004-27023 | None:intergenic | 40.0% | |
! | AACAAGCGAATTTGGGGTTT+AGG | + | contig185end:27488-27507 | MsG0080048058.01.T01:five_prime_UTR | 40.0% |
! | AAGATTTTCGGATGCCCATA+CGG | - | contig185end:27120-27139 | None:intergenic | 40.0% |
! | ACAAGCGAATTTGGGGTTTA+GGG | + | contig185end:27489-27508 | MsG0080048058.01.T01:five_prime_UTR | 40.0% |
! | AGATTTTGTATGAGGAGGAG+GGG | - | contig185end:29875-29894 | None:intergenic | 40.0% |
! | AGTTCCAAAGACATTAGCCT+TGG | - | contig185end:28381-28400 | None:intergenic | 40.0% |
! | ATCTCACCCACATTTTCCAA+CGG | - | contig185end:27781-27800 | None:intergenic | 40.0% |
! | CAACTTCAACTAGTTTGGTG+TGG | - | contig185end:26774-26793 | None:intergenic | 40.0% |
! | CGGAAGAAGTGCGTATAAAA+AGG | + | contig185end:30346-30365 | MsG0080048058.01.T01:intron | 40.0% |
! | CTTGAATGGAGGTTGCTTTA+TGG | + | contig185end:28594-28613 | MsG0080048058.01.T01:CDS | 40.0% |
! | CTTTCATTTTCCCTCTCTGA+CGG | + | contig185end:30500-30519 | MsG0080048058.01.T01:intron | 40.0% |
! | CTTTTCTTCCTACGTAACGT+TGG | + | contig185end:27185-27204 | MsG0080048058.01.T01:five_prime_UTR | 40.0% |
! | GAAGATTTTGTATGAGGAGG+AGG | - | contig185end:29877-29896 | None:intergenic | 40.0% |
! | GAGTTTTACACTCAGGTGTT+TGG | + | contig185end:27811-27830 | MsG0080048058.01.T01:five_prime_UTR | 40.0% |
! | GCATGAAGAGTTTTACACTC+AGG | + | contig185end:27804-27823 | MsG0080048058.01.T01:five_prime_UTR | 40.0% |
! | TGCTTGTTGAGATAACCAGT+CGG | - | contig185end:30585-30604 | None:intergenic | 40.0% |
! | TTTTACACTCAGGTGTTTGG+TGG | + | contig185end:27814-27833 | MsG0080048058.01.T01:five_prime_UTR | 40.0% |
! | TTTTATACGCACTTCTTCCG+TGG | - | contig185end:30346-30365 | None:intergenic | 40.0% |
!! | AGGCTAATGTCTTTGGAACT+TGG | + | contig185end:28381-28400 | MsG0080048058.01.T01:CDS | 40.0% |
!! | ATGGCTTCTGATGTTTTGAG+AGG | + | contig185end:28060-28079 | MsG0080048058.01.T01:CDS | 40.0% |
!! | CTTCAGGATTTGTTAGCTGT+TGG | + | contig185end:28345-28364 | MsG0080048058.01.T01:CDS | 40.0% |
!! | GATGTTGAATTGGTTGGTGA+AGG | + | contig185end:27649-27668 | MsG0080048058.01.T01:five_prime_UTR | 40.0% |
!! | GGATGTAGATCTTGTTGTTC+AGG | + | contig185end:28656-28675 | MsG0080048058.01.T01:CDS | 40.0% |
!! | GTATTTGGTTCTGTGGAGAT+CGG | + | contig185end:28224-28243 | MsG0080048058.01.T01:CDS | 40.0% |
!! | TGTAGATCTTGTTGTTCAGG+AGG | + | contig185end:28659-28678 | MsG0080048058.01.T01:CDS | 40.0% |
!! | TGTATCATTCGCCTGCTTTT+TGG | + | contig185end:28007-28026 | MsG0080048058.01.T01:CDS | 40.0% |
!! | TTTTTGGGCTTTGATGCTTC+CGG | + | contig185end:28023-28042 | MsG0080048058.01.T01:CDS | 40.0% |
!!! | GTATCATTCGCCTGCTTTTT+GGG | + | contig185end:28008-28027 | MsG0080048058.01.T01:CDS | 40.0% |
AAGGGTCCTCAGAAAAAGGA+CGG | + | contig185end:30326-30345 | MsG0080048058.01.T01:intron | 45.0% | |
AAGTTGCCGTCTGTTCATCT+TGG | + | contig185end:28456-28475 | MsG0080048058.01.T01:CDS | 45.0% | |
AATTGGTGAAGGTGAAGGGT+TGG | + | contig185end:27389-27408 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
ACAGGGCTTACTTGTATGCT+TGG | - | contig185end:28695-28714 | None:intergenic | 45.0% | |
AGAGTCGATGAATTAGTCGG+AGG | - | contig185end:30875-30894 | None:intergenic | 45.0% | |
AGCATCAAAGCCCAAAAAGC+AGG | - | contig185end:28021-28040 | None:intergenic | 45.0% | |
AGGTTTGCCGTTGGAAAATG+TGG | + | contig185end:27771-27790 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
AGTTGCCGTCTGTTCATCTT+GGG | + | contig185end:28457-28476 | MsG0080048058.01.T01:CDS | 45.0% | |
ATGGATCGTGGTTTCGGTTT+CGG | + | contig185end:27343-27362 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
ATGTGAAACTTACTGCCGCT+TGG | + | contig185end:28322-28341 | MsG0080048058.01.T01:CDS | 45.0% | |
ATTCAGCAGGGGATTTCGAA+TGG | + | contig185end:27847-27866 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
ATTTCGGGCAAAGATCGGTT+TGG | + | contig185end:27743-27762 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
ATTTGATAAGCATGCGCCGA+AGG | + | contig185end:27936-27955 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
CAATCGCCGATAGAAATTCG+CGG | + | contig185end:27297-27316 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
CATCTTGGGGTTGAAGAAAC+AGG | + | contig185end:28471-28490 | MsG0080048058.01.T01:CDS | 45.0% | |
CTCACCACCAATGGAAACTT+TGG | + | contig185end:29187-29206 | MsG0080048058.01.T01:intron | 45.0% | |
CTCGAAACAAAGTAAAGCGG+CGG | - | contig185end:27216-27235 | None:intergenic | 45.0% | |
CTTATCGGAGAAATGGATCG+TGG | + | contig185end:27331-27350 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
GATAGAGGGGAAGTGATTGA+TGG | + | contig185end:27607-27626 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
GCGGTACGCCAATTTCTTAT+CGG | + | contig185end:27316-27335 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
GGAAGTGATTGATGGGGATT+TGG | + | contig185end:27615-27634 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
GGAGAAATGGATCGTGGTTT+CGG | + | contig185end:27337-27356 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
GGATCCACTCCTAATGGAAT+TGG | + | contig185end:30982-31001 | MsG0080048058.01.T01:CDS | 45.0% | |
GGTTACGACGAGAAGAATGA+CGG | - | contig185end:27156-27175 | None:intergenic | 45.0% | |
GGTTACTTGTTTGGGTGTGT+CGG | - | contig185end:26814-26833 | None:intergenic | 45.0% | |
GGTTTGCCGTTGGAAAATGT+GGG | + | contig185end:27772-27791 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
GTGGATACTTAGCTCCTGTT+TGG | + | contig185end:29676-29695 | MsG0080048058.01.T01:intron | 45.0% | |
TAGAGGGGAAGTGATTGATG+GGG | + | contig185end:27609-27628 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
TCAACCCCAAGATGAACAGA+CGG | - | contig185end:28465-28484 | None:intergenic | 45.0% | |
TGCAGCCAAAATTGCAGTTG+TGG | + | contig185end:28859-28878 | MsG0080048058.01.T01:intron | 45.0% | |
TGCTCACTTGATACACTCCA+TGG | - | contig185end:30926-30945 | None:intergenic | 45.0% | |
TGCTCTTGGACCAACATTGA+AGG | - | contig185end:26990-27009 | None:intergenic | 45.0% | |
TGTTGTTCAGGAGGTCCATT+TGG | + | contig185end:28668-28687 | MsG0080048058.01.T01:CDS | 45.0% | |
TTTCTGTCTCTCTGTCTGTG+TGG | + | contig185end:26862-26881 | MsG0080048058.01.T01:five_prime_UTR | 45.0% | |
TTTGAGCTATGCAATGGCAG+AGG | + | contig185end:28278-28297 | MsG0080048058.01.T01:CDS | 45.0% | |
TTTGTGGGATAAACTCCCTC+TGG | - | contig185end:28437-28456 | None:intergenic | 45.0% | |
! | ACACAAGAACTGGGCTTGTT+TGG | - | contig185end:29836-29855 | None:intergenic | 45.0% |
! | ATTTTGTTCCAATCGACGCG+TGG | - | contig185end:27272-27291 | None:intergenic | 45.0% |
! | CACAAGAACTGGGCTTGTTT+GGG | - | contig185end:29835-29854 | None:intergenic | 45.0% |
! | CTTCTTCCGTCCTTTTTCTG+AGG | - | contig185end:30335-30354 | None:intergenic | 45.0% |
! | GAACAGACGGCAACTTTTGT+GGG | - | contig185end:28452-28471 | None:intergenic | 45.0% |
! | GATTGGTGATTCGAGAACTC+CGG | + | contig185end:27423-27442 | MsG0080048058.01.T01:five_prime_UTR | 45.0% |
! | GGTTGAGGCTTATCCCTTTT+CGG | + | contig185end:28161-28180 | MsG0080048058.01.T01:CDS | 45.0% |
! | GTGGTCCACAACTGCAATTT+TGG | - | contig185end:28867-28886 | None:intergenic | 45.0% |
! | TGAACAGACGGCAACTTTTG+TGG | - | contig185end:28453-28472 | None:intergenic | 45.0% |
! | TTTTCCAACGGCAAACCTCT+CGG | - | contig185end:27769-27788 | None:intergenic | 45.0% |
!! | AATTGGTTGGTGAAGGTGCT+AGG | + | contig185end:27656-27675 | MsG0080048058.01.T01:five_prime_UTR | 45.0% |
!! | GGATTTTGATGTCGCTGCAA+TGG | - | contig185end:28832-28851 | None:intergenic | 45.0% |
!! | TAGGAAGAAAAGTGCTGCGA+CGG | - | contig185end:27177-27196 | None:intergenic | 45.0% |
!!! | CGTATACGCAGGGGTATTTT+AGG | + | contig185end:30240-30259 | MsG0080048058.01.T01:intron | 45.0% |
AAGTCCCTGCTGTTCATCCA+TGG | + | contig185end:30906-30925 | MsG0080048058.01.T01:CDS | 50.0% | |
ACACTCCATGGATGAACAGC+AGG | - | contig185end:30914-30933 | None:intergenic | 50.0% | |
ACAGCATGACTCACCACCAA+TGG | + | contig185end:29178-29197 | MsG0080048058.01.T01:intron | 50.0% | |
AGAACCTCGACTTCTCCGTA+TGG | + | contig185end:27102-27121 | MsG0080048058.01.T01:five_prime_UTR | 50.0% | |
AGCTATGCAATGGCAGAGGA+GGG | + | contig185end:28282-28301 | MsG0080048058.01.T01:CDS | 50.0% | |
ATTGGGGACAGAGGCTTCTT+TGG | + | contig185end:28085-28104 | MsG0080048058.01.T01:CDS | 50.0% | |
CACTCCATGGATGAACAGCA+GGG | - | contig185end:30913-30932 | None:intergenic | 50.0% | |
CCCAATGAATCCGTCAGAGA+GGG | - | contig185end:30513-30532 | None:intergenic | 50.0% | |
CCTTGAGGCAATGCAACCTT+CGG | - | contig185end:27955-27974 | None:intergenic | 50.0% | |
CCTTTCAAACTCCAATCCGC+CGG | - | contig185end:27445-27464 | None:intergenic | 50.0% | |
CGCGAATTTCTATCGGCGAT+TGG | - | contig185end:27299-27318 | None:intergenic | 50.0% | |
GAACCTCGACTTCTCCGTAT+GGG | + | contig185end:27103-27122 | MsG0080048058.01.T01:five_prime_UTR | 50.0% | |
GCAGCCAAGGCTAATGTCTT+TGG | + | contig185end:28374-28393 | MsG0080048058.01.T01:CDS | 50.0% | |
GCCATCCTACTAACCGAAAC+CGG | - | contig185end:28045-28064 | None:intergenic | 50.0% | |
GGCGTACCGCGAATTTCTAT+CGG | - | contig185end:27306-27325 | None:intergenic | 50.0% | |
GTGCTCATCATGCATTGCAG+CGG | + | contig185end:28552-28571 | MsG0080048058.01.T01:CDS | 50.0% | |
GTTGCCGTCTGTTCATCTTG+GGG | + | contig185end:28458-28477 | MsG0080048058.01.T01:CDS | 50.0% | |
TCCCAATGAATCCGTCAGAG+AGG | - | contig185end:30514-30533 | None:intergenic | 50.0% | |
TCCGGTTTCGGTTAGTAGGA+TGG | + | contig185end:28041-28060 | MsG0080048058.01.T01:CDS | 50.0% | |
TGAAGGGGATCCACTCCTAA+TGG | + | contig185end:30976-30995 | MsG0080048058.01.T01:CDS | 50.0% | |
TGAGAGGTTATTGGGGACAG+AGG | + | contig185end:28076-28095 | MsG0080048058.01.T01:CDS | 50.0% | |
TGCTCATCATGCATTGCAGC+GGG | + | contig185end:28553-28572 | MsG0080048058.01.T01:CDS | 50.0% | |
TGCTTCCGGTTTCGGTTAGT+AGG | + | contig185end:28037-28056 | MsG0080048058.01.T01:CDS | 50.0% | |
TGGATCGTGGTTTCGGTTTC+GGG | + | contig185end:27344-27363 | MsG0080048058.01.T01:five_prime_UTR | 50.0% | |
TTGGGGACAGAGGCTTCTTT+GGG | + | contig185end:28086-28105 | MsG0080048058.01.T01:CDS | 50.0% | |
TTTGGCAGGTACCTGGAAAC+AGG | - | contig185end:29499-29518 | None:intergenic | 50.0% | |
! | AGGCTTCTTTGGGAAGTTGG+TGG | + | contig185end:28096-28115 | MsG0080048058.01.T01:CDS | 50.0% |
! | CAATGGCAGAGGAGGGTTTT+TGG | + | contig185end:28289-28308 | MsG0080048058.01.T01:CDS | 50.0% |
! | CAGAGGCTTCTTTGGGAAGT+TGG | + | contig185end:28093-28112 | MsG0080048058.01.T01:CDS | 50.0% |
! | CTGTTGGTTATCAGCAGCCA+AGG | + | contig185end:28361-28380 | MsG0080048058.01.T01:CDS | 50.0% |
! | GGCTTTGATGCTTCCGGTTT+CGG | + | contig185end:28029-28048 | MsG0080048058.01.T01:CDS | 50.0% |
! | TGAGGCTTATCCCTTTTCGG+AGG | + | contig185end:28164-28183 | MsG0080048058.01.T01:CDS | 50.0% |
!! | CCCTCTCTGACGGATTCATT+GGG | + | contig185end:30510-30529 | MsG0080048058.01.T01:intron | 50.0% |
!! | TCCCTCTCTGACGGATTCAT+TGG | + | contig185end:30509-30528 | MsG0080048058.01.T01:intron | 50.0% |
!! | TGACGGATTCATTGGGATCC+AGG | + | contig185end:30517-30536 | MsG0080048058.01.T01:intron | 50.0% |
AAGACCAAGACTCGGGTACC+TGG | - | contig185end:30538-30557 | None:intergenic | 55.0% | |
ACCGGCATCATCACACCTTG+AGG | - | contig185end:27970-27989 | None:intergenic | 55.0% | |
ATGCCCATACGGAGAAGTCG+AGG | - | contig185end:27109-27128 | None:intergenic | 55.0% | |
ATTCGAGAACTCCGGCGGAT+TGG | + | contig185end:27431-27450 | MsG0080048058.01.T01:five_prime_UTR | 55.0% | |
CCGAAGGTTGCATTGCCTCA+AGG | + | contig185end:27952-27971 | MsG0080048058.01.T01:five_prime_UTR | 55.0% | |
CCGAGAGCAAACATTGGCGA+CGG | + | contig185end:28408-28427 | MsG0080048058.01.T01:CDS | 55.0% | |
CCGTCGCCAATGTTTGCTCT+CGG | - | contig185end:28411-28430 | None:intergenic | 55.0% | |
GAGCTATGCAATGGCAGAGG+AGG | + | contig185end:28281-28300 | MsG0080048058.01.T01:CDS | 55.0% | |
GGTCGTCCGAGAGCAAACAT+TGG | + | contig185end:28402-28421 | MsG0080048058.01.T01:CDS | 55.0% | |
TGGTGATTCGAGAACTCCGG+CGG | + | contig185end:27426-27445 | MsG0080048058.01.T01:five_prime_UTR | 55.0% | |
TTGAACGCACGGCCCTTGAA+TGG | + | contig185end:28580-28599 | MsG0080048058.01.T01:CDS | 55.0% | |
! | ACTTACTGCCGCTTGGCTTC+AGG | + | contig185end:28329-28348 | MsG0080048058.01.T01:CDS | 55.0% |
! | GCCTCAAGGTGTGATGATGC+CGG | + | contig185end:27966-27985 | MsG0080048058.01.T01:exon | 55.0% |
! | TCGAGTATCCACGCGTCGAT+TGG | + | contig185end:27261-27280 | MsG0080048058.01.T01:five_prime_UTR | 55.0% |
!! | CAAAGATCGGTTTGGCCGAG+AGG | + | contig185end:27751-27770 | MsG0080048058.01.T01:five_prime_UTR | 55.0% |
!! | CCGGCGGATTGGAGTTTGAA+AGG | + | contig185end:27442-27461 | MsG0080048058.01.T01:five_prime_UTR | 55.0% |
!! | GGAGGGTTTTTGGACCGACA+AGG | + | contig185end:28299-28318 | MsG0080048058.01.T01:CDS | 55.0% |
!! | TGGTGAAGGTGCTAGGCAAG+AGG | + | contig185end:27663-27682 | MsG0080048058.01.T01:five_prime_UTR | 55.0% |
AACGCACGGCCCTTGAATGG+AGG | + | contig185end:28583-28602 | MsG0080048058.01.T01:CDS | 60.0% | |
ACATTGGCGACGGAGACCAG+AGG | + | contig185end:28418-28437 | MsG0080048058.01.T01:CDS | 60.0% | |
CATTGGCGACGGAGACCAGA+GGG | + | contig185end:28419-28438 | MsG0080048058.01.T01:CDS | 60.0% | |
CTGGGGACAACAATGCCGAC+TGG | + | contig185end:30567-30586 | MsG0080048058.01.T01:CDS | 60.0% | |
GGATCCAGGTACCCGAGTCT+TGG | + | contig185end:30531-30550 | MsG0080048058.01.T01:intron | 60.0% | |
GGTTGGCAGGTTGTGGCGAT+TGG | + | contig185end:27406-27425 | MsG0080048058.01.T01:five_prime_UTR | 60.0% | |
TCAAGGGCCGTGCGTTCAAC+AGG | - | contig185end:28579-28598 | None:intergenic | 60.0% | |
TTGGCCGAGAGGTTTGCCGT+TGG | + | contig185end:27762-27781 | MsG0080048058.01.T01:five_prime_UTR | 60.0% | |
! | GGTGAAGGGTTGGCAGGTTG+TGG | + | contig185end:27399-27418 | MsG0080048058.01.T01:five_prime_UTR | 60.0% |
! | GGTGAAGGTGAAGGGTTGGC+AGG | + | contig185end:27393-27412 | MsG0080048058.01.T01:five_prime_UTR | 60.0% |
!! | CGGTGTCGCCAACGTTACGT+AGG | - | contig185end:27196-27215 | None:intergenic | 60.0% |
CAGCGGGCCTGTTGAACGCA+CGG | + | contig185end:28569-28588 | MsG0080048058.01.T01:CDS | 65.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
contig185end | gene | 26770 | 31318 | 26770 | ID=MsG0080048058.01;Name=MsG0080048058.01 |
contig185end | mRNA | 26770 | 31318 | 26770 | ID=MsG0080048058.01.T01;Parent=MsG0080048058.01;Name=MsG0080048058.01.T01;_AED=0.22;_eAED=0.22;_QI=1209|1|1|1|1|1|3|309|440 |
contig185end | exon | 26770 | 28703 | 26770 | ID=MsG0080048058.01.T01:exon:11281;Parent=MsG0080048058.01.T01 |
contig185end | exon | 29507 | 29633 | 29507 | ID=MsG0080048058.01.T01:exon:11282;Parent=MsG0080048058.01.T01 |
contig185end | exon | 30539 | 31318 | 30539 | ID=MsG0080048058.01.T01:exon:11283;Parent=MsG0080048058.01.T01 |
contig185end | five_prime_UTR | 26770 | 27978 | 26770 | ID=MsG0080048058.01.T01:five_prime_utr;Parent=MsG0080048058.01.T01 |
contig185end | CDS | 27979 | 28703 | 27979 | ID=MsG0080048058.01.T01:cds;Parent=MsG0080048058.01.T01 |
contig185end | CDS | 29507 | 29633 | 29507 | ID=MsG0080048058.01.T01:cds;Parent=MsG0080048058.01.T01 |
contig185end | CDS | 30539 | 31009 | 30539 | ID=MsG0080048058.01.T01:cds;Parent=MsG0080048058.01.T01 |
contig185end | three_prime_UTR | 31010 | 31318 | 31010 | ID=MsG0080048058.01.T01:three_prime_utr;Parent=MsG0080048058.01.T01 |
Gene Sequence |
Protein sequence |