AlfalfaGEDB | Msa1065610

M. sativa cultivar zhongmu-4 / Msa1065610

KEGG: K13254
GO: GO:0000226 GO:0000278 GO:0000280 GO:0000281 GO:0000910 GO:0001578 GO:0003674 GO:0003824 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005635 GO:0006810 GO:0006928 GO:0006996 GO:0006997 GO:0006998 GO:0007010 GO:0007017 GO:0007018 GO:0007049 GO:0007051 GO:0007052 GO:0008017 GO:0008088 GO:0008089 GO:0008092 GO:0008150 GO:0008568 GO:0009987 GO:0010256 GO:0010458 GO:0010970 GO:0012505 GO:0015631 GO:0016020 GO:0016043 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0019896 GO:0022402 GO:0022411 GO:0022607 GO:0030496 GO:0030705 GO:0031090 GO:0031468 GO:0031965 GO:0031967 GO:0031975 GO:0034214 GO:0034643 GO:0042623 GO:0043014 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043933 GO:0044085 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0044770 GO:0044772 GO:0046907 GO:0047497 GO:0048285 GO:0048487 GO:0051013 GO:0051179 GO:0051228 GO:0051230 GO:0051234 GO:0051259 GO:0051260 GO:0051301 GO:0051640 GO:0051641 GO:0051646 GO:0051649 GO:0051654 GO:0051656 GO:0061024 GO:0061640 GO:0065003 GO:0071840 GO:0072384 GO:0090148 GO:0098930 GO:0099111 GO:0140014 GO:0140096 GO:1902850 GO:1903008 GO:1903047
PFAM: PF00004.32

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1065610	XP_003623772.1	97.131	488	4	4	1	480	1	486	0.0	954

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1065610	sp\|Q5ZK92\|SPAST_CHICK	48.184	413	188	7	78	478	211	609	2.89e-112	347

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1065610	G7L0E6	97.131	488	4	4	1	480	1	486	0.0	954

TFs/TRs:

Gene ID	Type	Classification

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
Msa0010770	Msa1065610	0.808083	3.687069e-50	-8.615850e-47
Msa0014710	Msa1065610	0.804728	1.878919e-49	-8.615850e-47
Msa0015390	Msa1065610	0.828875	7.048814e-55	-8.615850e-47
Msa0017510	Msa1065610	0.819139	1.358855e-52	-8.615850e-47
Msa0020410	Msa1065610	0.800467	1.421897e-48	-8.615850e-47
Msa0026430	Msa1065610	0.803315	3.696662e-49	-8.615850e-47
Msa0026910	Msa1065610	0.816893	4.373466e-52	-8.615850e-47
Msa0027390	Msa1065610	0.807123	5.894459e-50	-8.615850e-47
Msa0028550	Msa1065610	0.808075	3.700754e-50	-8.615850e-47
Msa0029850	Msa1065610	0.806466	8.116524e-50	-8.615850e-47
Msa0031180	Msa1065610	0.834795	2.438354e-56	-8.615850e-47
Msa0031340	Msa1065610	0.816734	4.747108e-52	-8.615850e-47
Msa0033440	Msa1065610	0.857440	1.630492e-62	-8.615850e-47
Msa0035150	Msa1065610	0.842831	2.033032e-58	-8.615850e-47
Msa0036140	Msa1065610	0.839593	1.444147e-57	-8.615850e-47
Msa0036920	Msa1065610	0.817969	2.502156e-52	-8.615850e-47
Msa0037120	Msa1065610	0.812746	3.629590e-51	-8.615850e-47
Msa0037880	Msa1065610	0.809687	1.672818e-50	-8.615850e-47
Msa0040620	Msa1065610	0.828545	8.472163e-55	-8.615850e-47
Msa0043560	Msa1065610	0.808421	3.122300e-50	-8.615850e-47
Msa0043980	Msa1065610	0.814440	1.538714e-51	-8.615850e-47
Msa0048000	Msa1065610	0.817535	3.135903e-52	-8.615850e-47
Msa0053760	Msa1065610	0.811080	8.371102e-51	-8.615850e-47
Msa0057520	Msa1065610	0.815026	1.141378e-51	-8.615850e-47
Msa0058490	Msa1065610	0.818282	2.126529e-52	-8.615850e-47
Msa0058510	Msa1065610	0.828054	1.112881e-54	-8.615850e-47
Msa0068680	Msa1065610	0.810081	1.375929e-50	-8.615850e-47
Msa0076220	Msa1065610	0.820738	5.853765e-53	-8.615850e-47
Msa0077450	Msa1065610	0.834357	3.140007e-56	-8.615850e-47
Msa0077610	Msa1065610	0.800328	1.517612e-48	-8.615850e-47
Msa0078060	Msa1065610	0.830376	3.040449e-55	-8.615850e-47
Msa0078480	Msa1065610	0.823095	1.665267e-53	-8.615850e-47
Msa0084080	Msa1065610	0.827258	1.727912e-54	-8.615850e-47
Msa0084820	Msa1065610	0.813287	2.763086e-51	-8.615850e-47
Msa0085370	Msa1065610	0.827362	1.631070e-54	-8.615850e-47
Msa0089360	Msa1065610	0.802803	4.717069e-49	-8.615850e-47
Msa0095560	Msa1065610	0.822492	2.301174e-53	-8.615850e-47
Msa0096450	Msa1065610	0.808809	2.580751e-50	-8.615850e-47
Msa0099620	Msa1065610	0.813949	1.975236e-51	-8.615850e-47
Msa0099650	Msa1065610	0.819919	9.018390e-53	-8.615850e-47
Msa0104800	Msa1065610	0.817608	3.019443e-52	-8.615850e-47
Msa0105070	Msa1065610	0.803522	3.349200e-49	-8.615850e-47
Msa0108560	Msa1065610	0.814042	1.884135e-51	-8.615850e-47
Msa0109900	Msa1065610	0.807998	3.842762e-50	-8.615850e-47
Msa0113750	Msa1065610	0.807305	5.393684e-50	-8.615850e-47
Msa0114430	Msa1065610	0.803295	3.731174e-49	-8.615850e-47
Msa0116080	Msa1065610	0.830660	2.591821e-55	-8.615850e-47
Msa0117770	Msa1065610	0.805831	1.104133e-49	-8.615850e-47
Msa0120340	Msa1065610	0.801604	8.326253e-49	-8.615850e-47
Msa0606750	Msa1065610	0.806296	8.812927e-50	-8.615850e-47
Msa0608620	Msa1065610	0.802624	5.135486e-49	-8.615850e-47
Msa0610590	Msa1065610	0.834844	2.369912e-56	-8.615850e-47
Msa0610670	Msa1065610	0.819158	1.344891e-52	-8.615850e-47
Msa0613090	Msa1065610	0.842380	2.678663e-58	-8.615850e-47
Msa0614900	Msa1065610	0.804135	2.498260e-49	-8.615850e-47
Msa0624470	Msa1065610	0.803784	2.954706e-49	-8.615850e-47
Msa0626220	Msa1065610	0.827685	1.365097e-54	-8.615850e-47
Msa0629450	Msa1065610	0.810437	1.153018e-50	-8.615850e-47
Msa0633060	Msa1065610	0.808151	3.566045e-50	-8.615850e-47
Msa0637900	Msa1065610	0.806575	7.695782e-50	-8.615850e-47
Msa0638070	Msa1065610	0.816914	4.325787e-52	-8.615850e-47
Msa0638610	Msa1065610	0.824826	6.540047e-54	-8.615850e-47
Msa0648880	Msa1065610	0.807629	4.603520e-50	-8.615850e-47
Msa0651190	Msa1065610	0.829912	3.947895e-55	-8.615850e-47
Msa0651270	Msa1065610	0.831627	1.499787e-55	-8.615850e-47
Msa0657610	Msa1065610	0.825250	5.192100e-54	-8.615850e-47
Msa0657750	Msa1065610	0.846798	1.731500e-59	-8.615850e-47
Msa0657970	Msa1065610	0.829528	4.893750e-55	-8.615850e-47
Msa0659400	Msa1065610	0.818306	2.099413e-52	-8.615850e-47
Msa0663240	Msa1065610	0.813779	2.153220e-51	-8.615850e-47
Msa0663250	Msa1065610	0.812967	3.247730e-51	-8.615850e-47
Msa0663920	Msa1065610	0.806837	6.775226e-50	-8.615850e-47
Msa0667050	Msa1065610	0.839573	1.461674e-57	-8.615850e-47
Msa0667080	Msa1065610	0.804962	1.678974e-49	-8.615850e-47
Msa0669440	Msa1065610	0.809221	2.106116e-50	-8.615850e-47
Msa0676760	Msa1065610	0.824457	7.988353e-54	-8.615850e-47
Msa0679710	Msa1065610	0.806122	9.588431e-50	-8.615850e-47
Msa0682550	Msa1065610	0.824517	7.732767e-54	-8.615850e-47
Msa0683730	Msa1065610	0.804680	1.923465e-49	-8.615850e-47
Msa0685750	Msa1065610	0.856524	3.034997e-62	-8.615850e-47
Msa0687020	Msa1065610	0.804426	2.172388e-49	-8.615850e-47
Msa0688070	Msa1065610	0.849844	2.491290e-60	-8.615850e-47
Msa0688480	Msa1065610	0.823341	1.459310e-53	-8.615850e-47
Msa0689800	Msa1065610	0.807149	5.818939e-50	-8.615850e-47
Msa0692230	Msa1065610	0.834965	2.208966e-56	-8.615850e-47
Msa0693380	Msa1065610	0.843076	1.750462e-58	-8.615850e-47
Msa0696640	Msa1065610	0.815425	9.305173e-52	-8.615850e-47
Msa0698360	Msa1065610	0.821371	4.184240e-53	-8.615850e-47
Msa0702350	Msa1065610	0.819282	1.260615e-52	-8.615850e-47
Msa0702570	Msa1065610	0.804296	2.313002e-49	-8.615850e-47
Msa0702680	Msa1065610	0.812352	4.426360e-51	-8.615850e-47
Msa0703050	Msa1065610	0.824116	9.610242e-54	-8.615850e-47
Msa0704920	Msa1065610	0.816864	4.439431e-52	-8.615850e-47
Msa0711100	Msa1065610	0.807421	5.095500e-50	-8.615850e-47
Msa0711790	Msa1065610	0.815173	1.058923e-51	-8.615850e-47
Msa0715470	Msa1065610	0.814269	1.679403e-51	-8.615850e-47
Msa0717890	Msa1065610	0.820322	7.291978e-53	-8.615850e-47
Msa0722070	Msa1065610	0.835153	1.979916e-56	-8.615850e-47
Msa0731180	Msa1065610	0.813107	3.026272e-51	-8.615850e-47
Msa0740510	Msa1065610	0.824494	7.829794e-54	-8.615850e-47
Msa0744040	Msa1065610	0.805697	1.177783e-49	-8.615850e-47
Msa0749930	Msa1065610	0.812674	3.764435e-51	-8.615850e-47
Msa0751210	Msa1065610	0.817063	4.005353e-52	-8.615850e-47
Msa0753720	Msa1065610	0.813403	2.605751e-51	-8.615850e-47
Msa0760130	Msa1065610	0.818034	2.419128e-52	-8.615850e-47
Msa0763400	Msa1065610	0.837414	5.271392e-57	-8.615850e-47
Msa0763890	Msa1065610	0.815022	1.143551e-51	-8.615850e-47
Msa0763920	Msa1065610	0.804358	2.244183e-49	-8.615850e-47
Msa0765380	Msa1065610	0.807978	3.880239e-50	-8.615850e-47
Msa0767220	Msa1065610	0.820162	7.935762e-53	-8.615850e-47
Msa0768570	Msa1065610	0.807111	5.928657e-50	-8.615850e-47
Msa0771580	Msa1065610	0.810630	1.047847e-50	-8.615850e-47
Msa0773590	Msa1065610	0.801380	9.252731e-49	-8.615850e-47
Msa0777230	Msa1065610	0.801290	9.654553e-49	-8.615850e-47
Msa0777570	Msa1065610	-0.804982	1.663167e-49	-8.615850e-47
Msa0778520	Msa1065610	0.803027	4.240072e-49	-8.615850e-47
Msa0788710	Msa1065610	0.803850	2.863599e-49	-8.615850e-47
Msa0790510	Msa1065610	0.832388	9.728103e-56	-8.615850e-47
Msa0790890	Msa1065610	0.812689	3.737121e-51	-8.615850e-47
Msa0794320	Msa1065610	0.824356	8.439441e-54	-8.615850e-47
Msa0794510	Msa1065610	-0.815684	8.151213e-52	-8.615850e-47
Msa0795080	Msa1065610	0.809696	1.665223e-50	-8.615850e-47
Msa0795250	Msa1065610	0.826418	2.742514e-54	-8.615850e-47
Msa0803590	Msa1065610	0.802052	6.734865e-49	-8.615850e-47
Msa0804680	Msa1065610	0.804129	2.505312e-49	-8.615850e-47
Msa0805550	Msa1065610	0.843257	1.566217e-58	-8.615850e-47
Msa0810220	Msa1065610	0.814265	1.682040e-51	-8.615850e-47
Msa0811040	Msa1065610	0.806698	7.251082e-50	-8.615850e-47
Msa0816590	Msa1065610	0.819965	8.805011e-53	-8.615850e-47
Msa0820770	Msa1065610	0.826590	2.495792e-54	-8.615850e-47
Msa0828850	Msa1065610	0.816718	4.787409e-52	-8.615850e-47
Msa0828920	Msa1065610	0.837973	3.787955e-57	-8.615850e-47
Msa0830420	Msa1065610	0.820971	5.173623e-53	-8.615850e-47
Msa0830530	Msa1065610	0.819478	1.137501e-52	-8.615850e-47
Msa0831590	Msa1065610	0.828719	7.689536e-55	-8.615850e-47
Msa0831850	Msa1065610	0.802847	4.619225e-49	-8.615850e-47
Msa0832090	Msa1065610	0.829712	4.415899e-55	-8.615850e-47
Msa0832150	Msa1065610	0.820177	7.872809e-53	-8.615850e-47
Msa0832340	Msa1065610	0.808597	2.864030e-50	-8.615850e-47
Msa0121380	Msa1065610	0.800351	1.501376e-48	-8.615850e-47
Msa0122580	Msa1065610	0.804944	1.693464e-49	-8.615850e-47
Msa0122590	Msa1065610	0.862727	4.128765e-64	-8.615850e-47
Msa0123300	Msa1065610	0.835434	1.681597e-56	-8.615850e-47
Msa0125090	Msa1065610	0.801002	1.105661e-48	-8.615850e-47
Msa0130970	Msa1065610	0.801637	8.197521e-49	-8.615850e-47
Msa0131770	Msa1065610	0.806268	8.934371e-50	-8.615850e-47
Msa0138500	Msa1065610	0.835390	1.725659e-56	-8.615850e-47
Msa0138520	Msa1065610	0.830540	2.773222e-55	-8.615850e-47
Msa0140780	Msa1065610	0.805738	1.154925e-49	-8.615850e-47
Msa0140860	Msa1065610	0.813151	2.959004e-51	-8.615850e-47
Msa0141620	Msa1065610	0.816853	4.463435e-52	-8.615850e-47
Msa0142480	Msa1065610	0.809826	1.561817e-50	-8.615850e-47
Msa0144790	Msa1065610	0.821760	3.401050e-53	-8.615850e-47
Msa0146260	Msa1065610	0.801672	8.062109e-49	-8.615850e-47
Msa0151180	Msa1065610	0.842316	2.786446e-58	-8.615850e-47
Msa0157290	Msa1065610	0.819229	1.296292e-52	-8.615850e-47
Msa0159770	Msa1065610	0.847463	1.137981e-59	-8.615850e-47
Msa0161900	Msa1065610	0.802109	6.558220e-49	-8.615850e-47
Msa0165300	Msa1065610	0.806481	8.057167e-50	-8.615850e-47
Msa0166870	Msa1065610	0.847957	8.322165e-60	-8.615850e-47
Msa0168430	Msa1065610	0.817644	2.962879e-52	-8.615850e-47
Msa0169820	Msa1065610	0.801731	7.839761e-49	-8.615850e-47
Msa0169860	Msa1065610	0.811339	7.356271e-51	-8.615850e-47
Msa0170140	Msa1065610	0.846253	2.439306e-59	-8.615850e-47
Msa0170570	Msa1065610	0.829259	5.689427e-55	-8.615850e-47
Msa0171120	Msa1065610	0.837791	4.220222e-57	-8.615850e-47
Msa0171290	Msa1065610	0.804136	2.497314e-49	-8.615850e-47
Msa0176830	Msa1065610	0.804843	1.777840e-49	-8.615850e-47
Msa0178570	Msa1065610	0.808147	3.572304e-50	-8.615850e-47
Msa0178930	Msa1065610	0.821048	4.965549e-53	-8.615850e-47
Msa0183050	Msa1065610	0.813474	2.512810e-51	-8.615850e-47
Msa0183420	Msa1065610	0.812482	4.146738e-51	-8.615850e-47
Msa0187060	Msa1065610	0.823094	1.666394e-53	-8.615850e-47
Msa0188830	Msa1065610	0.831720	1.422332e-55	-8.615850e-47
Msa0189110	Msa1065610	0.810595	1.065908e-50	-8.615850e-47
Msa0200560	Msa1065610	0.827655	1.387925e-54	-8.615850e-47
Msa0205340	Msa1065610	0.800928	1.145054e-48	-8.615850e-47
Msa0205510	Msa1065610	0.814436	1.542373e-51	-8.615850e-47
Msa0205850	Msa1065610	0.817141	3.846506e-52	-8.615850e-47
Msa0206010	Msa1065610	0.850140	2.058723e-60	-8.615850e-47
Msa0210450	Msa1065610	0.818484	1.913659e-52	-8.615850e-47
Msa0212930	Msa1065610	0.805483	1.306082e-49	-8.615850e-47
Msa0212990	Msa1065610	0.834104	3.634172e-56	-8.615850e-47
Msa0213520	Msa1065610	0.838694	2.470169e-57	-8.615850e-47
Msa0217680	Msa1065610	0.815793	7.705479e-52	-8.615850e-47
Msa0218350	Msa1065610	0.807152	5.811797e-50	-8.615850e-47
Msa0219240	Msa1065610	0.828835	7.208924e-55	-8.615850e-47
Msa0220440	Msa1065610	0.831949	1.248940e-55	-8.615850e-47
Msa0220580	Msa1065610	0.840962	6.338335e-58	-8.615850e-47
Msa0223010	Msa1065610	0.825902	3.638052e-54	-8.615850e-47
Msa0226890	Msa1065610	0.809030	2.314529e-50	-8.615850e-47
Msa0230680	Msa1065610	0.812230	4.706692e-51	-8.615850e-47
Msa0231240	Msa1065610	0.821899	3.159007e-53	-8.615850e-47
Msa0232320	Msa1065610	0.810031	1.410911e-50	-8.615850e-47
Msa0233300	Msa1065610	0.821093	4.850246e-53	-8.615850e-47
Msa0237310	Msa1065610	0.856103	4.032892e-62	-8.615850e-47
Msa0369440	Msa1065610	0.811986	5.319397e-51	-8.615850e-47
Msa0369850	Msa1065610	0.818895	1.543663e-52	-8.615850e-47
Msa0370110	Msa1065610	0.801996	6.918055e-49	-8.615850e-47
Msa0373450	Msa1065610	0.858601	7.366765e-63	-8.615850e-47
Msa0373930	Msa1065610	0.800265	1.562795e-48	-8.615850e-47
Msa0376350	Msa1065610	0.832500	9.125440e-56	-8.615850e-47
Msa0376590	Msa1065610	0.826527	2.583191e-54	-8.615850e-47
Msa0376910	Msa1065610	0.815344	9.702031e-52	-8.615850e-47
Msa0379640	Msa1065610	0.847803	9.174513e-60	-8.615850e-47
Msa0387250	Msa1065610	0.830945	2.206138e-55	-8.615850e-47
Msa0389340	Msa1065610	0.823053	1.704065e-53	-8.615850e-47
Msa0390960	Msa1065610	0.815831	7.557432e-52	-8.615850e-47
Msa0392270	Msa1065610	0.807853	4.125279e-50	-8.615850e-47
Msa0394260	Msa1065610	0.803474	3.427060e-49	-8.615850e-47
Msa0395790	Msa1065610	0.801462	8.904423e-49	-8.615850e-47
Msa0412840	Msa1065610	0.801821	7.515313e-49	-8.615850e-47
Msa0422010	Msa1065610	0.827317	1.672397e-54	-8.615850e-47
Msa0424790	Msa1065610	0.807554	4.776758e-50	-8.615850e-47
Msa0426900	Msa1065610	0.858558	7.584820e-63	-8.615850e-47
Msa0427040	Msa1065610	0.800869	1.177379e-48	-8.615850e-47
Msa0431690	Msa1065610	0.813086	3.058245e-51	-8.615850e-47
Msa0433360	Msa1065610	0.807328	5.332775e-50	-8.615850e-47
Msa0436370	Msa1065610	0.848325	6.587057e-60	-8.615850e-47
Msa0439970	Msa1065610	0.859059	5.372887e-63	-8.615850e-47
Msa0440530	Msa1065610	0.819893	9.144025e-53	-8.615850e-47
Msa0442270	Msa1065610	0.801462	8.903728e-49	-8.615850e-47
Msa0443260	Msa1065610	0.811785	5.883718e-51	-8.615850e-47
Msa0449830	Msa1065610	0.806205	9.210018e-50	-8.615850e-47
Msa0455760	Msa1065610	0.807843	4.145679e-50	-8.615850e-47
Msa0464900	Msa1065610	0.806191	9.273236e-50	-8.615850e-47
Msa0467930	Msa1065610	0.808550	2.931281e-50	-8.615850e-47
Msa0468290	Msa1065610	0.806845	6.750353e-50	-8.615850e-47
Msa0468550	Msa1065610	0.829764	4.288040e-55	-8.615850e-47
Msa0471900	Msa1065610	0.825590	4.314972e-54	-8.615850e-47
Msa0473080	Msa1065610	0.805767	1.138786e-49	-8.615850e-47
Msa0475490	Msa1065610	0.807226	5.604950e-50	-8.615850e-47
Msa0477130	Msa1065610	-0.829705	4.432694e-55	-8.615850e-47
Msa0981310	Msa1065610	0.821341	4.251143e-53	-8.615850e-47
Msa0982240	Msa1065610	0.846346	2.300752e-59	-8.615850e-47
Msa0989220	Msa1065610	0.806162	9.404972e-50	-8.615850e-47
Msa0992490	Msa1065610	-0.801206	1.004434e-48	-8.615850e-47
Msa1008750	Msa1065610	0.813250	2.814586e-51	-8.615850e-47
Msa1010350	Msa1065610	0.828572	8.345718e-55	-8.615850e-47
Msa1015790	Msa1065610	0.800138	1.659162e-48	-8.615850e-47
Msa1019710	Msa1065610	0.813389	2.624261e-51	-8.615850e-47
Msa1023920	Msa1065610	0.815981	6.997364e-52	-8.615850e-47
Msa1029210	Msa1065610	0.861529	9.623649e-64	-8.615850e-47
Msa1030970	Msa1065610	0.816964	4.214311e-52	-8.615850e-47
Msa1032170	Msa1065610	0.804177	2.448575e-49	-8.615850e-47
Msa1038810	Msa1065610	0.801738	7.814121e-49	-8.615850e-47
Msa1041670	Msa1065610	0.835080	2.065722e-56	-8.615850e-47
Msa1043510	Msa1065610	0.806047	9.944581e-50	-8.615850e-47
Msa1044420	Msa1065610	0.817213	3.705348e-52	-8.615850e-47
Msa1052830	Msa1065610	0.812846	3.451160e-51	-8.615850e-47
Msa1058750	Msa1065610	0.806212	9.177461e-50	-8.615850e-47
Msa1059570	Msa1065610	0.801680	8.031415e-49	-8.615850e-47
Msa1062920	Msa1065610	0.813301	2.743796e-51	-8.615850e-47
Msa1065610	Msa1068200	-0.804824	1.794070e-49	-8.615850e-47
Msa1065610	Msa1075080	-0.808395	3.163128e-50	-8.615850e-47
Msa1065610	Msa1075220	-0.835826	1.338397e-56	-8.615850e-47
Msa1065610	Msa1077070	0.806588	7.648823e-50	-8.615850e-47
Msa1065610	Msa1081330	0.834486	2.915267e-56	-8.615850e-47
Msa1065610	Msa1081590	0.815586	8.568547e-52	-8.615850e-47
Msa1065610	Msa1082500	0.860390	2.135789e-63	-8.615850e-47
Msa1065610	Msa1084260	0.815651	8.288609e-52	-8.615850e-47
Msa1065610	Msa1084430	0.807092	5.983049e-50	-8.615850e-47
Msa1065610	Msa1085300	0.805032	1.623847e-49	-8.615850e-47
Msa1065610	Msa1085920	0.807759	4.320486e-50	-8.615850e-47
Msa1065610	Msa1087980	0.822348	2.485645e-53	-8.615850e-47
Msa1065610	Msa1092090	0.810508	1.112951e-50	-8.615850e-47
Msa1065610	Msa1097840	0.820819	5.606055e-53	-8.615850e-47
Msa1065610	Msa1098400	0.816618	5.040714e-52	-8.615850e-47
Msa1065610	Msa1098420	0.804298	2.310029e-49	-8.615850e-47
Msa1065610	Msa1107900	0.816561	5.189215e-52	-8.615850e-47
Msa1065610	Msa1111180	0.904289	1.434079e-79	-8.615850e-47
Msa1065610	Msa1116130	-0.819265	1.271487e-52	-8.615850e-47
Msa1065610	Msa1118110	0.813424	2.577709e-51	-8.615850e-47
Msa1065610	Msa1131220	0.836880	7.219575e-57	-8.615850e-47
Msa1065610	Msa1137570	0.816230	6.156514e-52	-8.615850e-47
Msa1065610	Msa1139000	-0.801479	8.829960e-49	-8.615850e-47
Msa1065610	Msa1154030	0.802636	5.105635e-49	-8.615850e-47
Msa1065610	Msa1154780	0.866817	2.159579e-65	-8.615850e-47
Msa1065610	Msa1162550	-0.823369	1.437717e-53	-8.615850e-47
Msa1065610	Msa1166560	0.840368	9.071594e-58	-8.615850e-47
Msa1065610	Msa1170170	0.810127	1.345280e-50	-8.615850e-47
Msa1065610	Msa1170280	0.816395	5.654118e-52	-8.615850e-47
Msa1065610	Msa1170440	0.808743	2.666201e-50	-8.615850e-47
Msa1065610	Msa1170800	0.835403	1.712694e-56	-8.615850e-47
Msa1065610	Msa1172670	0.826007	3.436034e-54	-8.615850e-47
Msa1065610	Msa1174040	0.835866	1.307283e-56	-8.615850e-47
Msa1065610	Msa1178110	0.805599	1.235146e-49	-8.615850e-47
Msa1065610	Msa1179940	0.820012	8.586357e-53	-8.615850e-47
Msa1065610	Msa1179970	0.820048	8.428275e-53	-8.615850e-47
Msa1065610	Msa1185980	0.802525	5.383927e-49	-8.615850e-47
Msa1065610	Msa1193290	0.819288	1.256738e-52	-8.615850e-47
Msa1065610	Msa1197060	0.812447	4.220976e-51	-8.615850e-47
Msa1065610	Msa1199070	0.821299	4.346041e-53	-8.615850e-47
Msa1065610	Msa1204530	0.813961	1.963902e-51	-8.615850e-47
Msa1065610	Msa1205370	0.813985	1.939931e-51	-8.615850e-47
Msa1065610	Msa1206100	0.822446	2.359269e-53	-8.615850e-47
Msa1065610	Msa1207380	0.803970	2.703797e-49	-8.615850e-47
Msa1065610	Msa1212940	0.819691	1.016775e-52	-8.615850e-47
Msa1065610	Msa1214880	0.808692	2.733124e-50	-8.615850e-47
Msa1065610	Msa1214890	0.822059	2.900670e-53	-8.615850e-47
Msa1065610	Msa1220150	0.812435	4.246820e-51	-8.615850e-47
Msa1065610	Msa1224480	0.852005	6.130121e-61	-8.615850e-47
Msa1065610	Msa1224580	-0.806673	7.336929e-50	-8.615850e-47
Msa1065610	Msa1224830	0.813389	2.624122e-51	-8.615850e-47
Msa1065610	Msa1225130	0.816526	5.284459e-52	-8.615850e-47
Msa1065610	Msa1227330	0.807328	5.332775e-50	-8.615850e-47
Msa1065610	Msa1230170	0.820148	7.992286e-53	-8.615850e-47
Msa1065610	Msa1233500	0.809448	1.883026e-50	-8.615850e-47
Msa1065610	Msa1233890	0.813588	2.371999e-51	-8.615850e-47
Msa1065610	Msa1237980	0.819802	9.591347e-53	-8.615850e-47
Msa1065610	Msa1239720	0.827894	1.215773e-54	-8.615850e-47
Msa1065610	Msa1240510	0.820177	7.871118e-53	-8.615850e-47
Msa1065610	Msa1250530	0.819182	1.328128e-52	-8.615850e-47
Msa1065610	Msa1257600	0.804278	2.332323e-49	-8.615850e-47
Msa1065610	Msa1267610	0.807955	3.924237e-50	-8.615850e-47
Msa1065610	Msa1276440	0.831381	1.724199e-55	-8.615850e-47
Msa1065610	Msa1279210	0.809847	1.545364e-50	-8.615850e-47
Msa1065610	Msa1283860	0.819089	1.394873e-52	-8.615850e-47
Msa1065610	Msa1284680	0.818542	1.856803e-52	-8.615850e-47
Msa1065610	Msa1291660	0.807311	5.378866e-50	-8.615850e-47
Msa1065610	Msa1292400	0.815004	1.154088e-51	-8.615850e-47
Msa1065610	Msa1295630	0.819355	1.213219e-52	-8.615850e-47
Msa1065610	Msa1297290	0.838232	3.250539e-57	-8.615850e-47
Msa1065610	Msa1300490	0.808574	2.896997e-50	-8.615850e-47
Msa1065610	Msa1305190	0.817420	3.328481e-52	-8.615850e-47
Msa1065610	Msa1305340	0.824397	8.251490e-54	-8.615850e-47
Msa1065610	Msa1305350	0.800965	1.124881e-48	-8.615850e-47
Msa1065610	Msa1306840	0.809914	1.494726e-50	-8.615850e-47
Msa1065610	Msa1306850	0.830421	2.965584e-55	-8.615850e-47
Msa1065610	Msa1307550	0.801324	9.500391e-49	-8.615850e-47
Msa1065610	Msa1314340	0.837460	5.131186e-57	-8.615850e-47
Msa1065610	Msa1316200	0.806905	6.553399e-50	-8.615850e-47
Msa1065610	Msa1318990	0.813657	2.290800e-51	-8.615850e-47
Msa1065610	Msa1320620	0.815003	1.154643e-51	-8.615850e-47
Msa1065610	Msa1320740	0.813541	2.429299e-51	-8.615850e-47
Msa1065610	Msa1322890	0.800316	1.525991e-48	-8.615850e-47
Msa1065610	Msa1329550	0.822871	1.878210e-53	-8.615850e-47
Msa1065610	Msa1329700	0.823553	1.301781e-53	-8.615850e-47
Msa1065610	Msa1331000	0.817832	2.687325e-52	-8.615850e-47
Msa1065610	Msa1331910	0.801146	1.033448e-48	-8.615850e-47
Msa1065610	Msa1333420	0.814548	1.456307e-51	-8.615850e-47
Msa1065610	Msa1333680	0.814121	1.810645e-51	-8.615850e-47
Msa1065610	Msa1333730	0.851958	6.319772e-61	-8.615850e-47
Msa1065610	Msa1340650	0.807398	5.155451e-50	-8.615850e-47
Msa1065610	Msa1340810	0.808944	2.414320e-50	-8.615850e-47
Msa1065610	Msa1341950	0.847966	8.275708e-60	-8.615850e-47
Msa1065610	Msa1343760	0.817185	3.759143e-52	-8.615850e-47
Msa1065610	Msa1348360	0.829593	4.719459e-55	-8.615850e-47
Msa1065610	Msa1348880	0.828403	9.165128e-55	-8.615850e-47
Msa1065610	Msa1349270	0.802579	5.247882e-49	-8.615850e-47
Msa1065610	Msa1353470	0.814123	1.808086e-51	-8.615850e-47
Msa1065610	Msa1353980	0.810719	1.002391e-50	-8.615850e-47
Msa1065610	Msa1359040	0.818589	1.811986e-52	-8.615850e-47
Msa1065610	Msa1360060	0.822156	2.754327e-53	-8.615850e-47
Msa1065610	Msa1364830	0.824699	7.007608e-54	-8.615850e-47
Msa1065610	Msa1366300	0.805249	1.462388e-49	-8.615850e-47
Msa1065610	Msa1372580	0.822736	2.018941e-53	-8.615850e-47
Msa1065610	Msa1372760	0.834923	2.263342e-56	-8.615850e-47
Msa1065610	Msa1379850	0.848683	5.244086e-60	-8.615850e-47
Msa1065610	Msa1380900	0.802256	6.114495e-49	-8.615850e-47
Msa1065610	Msa1384350	0.828925	6.855174e-55	-8.615850e-47
Msa1065610	Msa1385000	0.840064	1.088783e-57	-8.615850e-47
Msa1065610	Msa1392260	0.842788	2.087370e-58	-8.615850e-47
Msa1065610	Msa1392700	0.801550	8.539288e-49	-8.615850e-47
Msa1065610	Msa1393040	0.878314	3.104975e-69	-8.615850e-47
Msa1065610	Msa1397120	0.822389	2.431374e-53	-8.615850e-47
Msa1065610	Msa1402400	0.824954	6.099165e-54	-8.615850e-47
Msa1065610	Msa1403480	0.812638	3.833180e-51	-8.615850e-47
Msa1065610	Msa1403890	0.819258	1.276272e-52	-8.615850e-47
Msa1065610	Msa1404300	0.801618	8.270984e-49	-8.615850e-47
Msa1065610	Msa1404540	0.806575	7.695782e-50	-8.615850e-47
Msa1065610	Msa1407580	0.809688	1.671692e-50	-8.615850e-47
Msa1065610	Msa1407600	0.807309	5.384480e-50	-8.615850e-47
Msa1065610	Msa1408790	0.802161	6.398199e-49	-8.615850e-47
Msa1065610	Msa1409870	0.809381	1.946184e-50	-8.615850e-47
Msa1065610	Msa1410210	0.805554	1.262207e-49	-8.615850e-47
Msa1065610	Msa1410690	0.832263	1.044477e-55	-8.615850e-47
Msa1065610	Msa1411020	0.819046	1.426238e-52	-8.615850e-47
Msa1065610	Msa1415910	0.800531	1.379681e-48	-8.615850e-47
Msa1065610	Msa1418260	0.805950	1.042230e-49	-8.615850e-47
Msa1065610	Msa1419990	0.802411	5.681453e-49	-8.615850e-47
Msa1065610	Msa1420140	0.828752	7.548108e-55	-8.615850e-47
Msa1065610	Msa1420290	0.809903	1.503510e-50	-8.615850e-47
Msa1065610	Msa1420490	0.803560	3.288795e-49	-8.615850e-47
Msa1065610	Msa1423390	0.801710	7.919477e-49	-8.615850e-47
Msa1065610	Msa1423880	0.800157	1.644138e-48	-8.615850e-47
Msa1065610	Msa1424290	0.815616	8.440593e-52	-8.615850e-47
Msa1065610	Msa1424450	0.828414	9.112223e-55	-8.615850e-47
Msa1065610	Msa1424680	0.816483	5.402109e-52	-8.615850e-47
Msa1065610	Msa1425100	0.833207	6.088439e-56	-8.615850e-47
Msa1065610	Msa1426000	0.828794	7.372627e-55	-8.615850e-47
Msa1065610	Msa1427230	0.830771	2.433698e-55	-8.615850e-47
Msa1065610	Msa1429900	0.835599	1.527549e-56	-8.615850e-47
Msa1065610	Msa1431060	0.804041	2.612898e-49	-8.615850e-47
Msa1065610	Msa1432230	0.818376	2.024327e-52	-8.615850e-47
Msa1065610	Msa1433220	0.805249	1.462388e-49	-8.615850e-47
Msa1065610	Msa1434350	0.817078	3.974154e-52	-8.615850e-47
Msa1065610	Msa1435270	0.823574	1.287270e-53	-8.615850e-47
Msa1065610	Msa1437330	0.802317	5.941755e-49	-8.615850e-47
Msa1065610	Msa1437680	0.812804	3.526172e-51	-8.615850e-47
Msa1065610	Msa1439320	0.828724	7.667996e-55	-8.615850e-47
Msa1065610	Msa1440370	0.807770	4.296588e-50	-8.615850e-47
Msa1065610	Msa1440810	0.806112	9.636858e-50	-8.615850e-47
Msa1065610	Msa1443060	0.804235	2.381027e-49	-8.615850e-47
Msa1065610	Msa1445030	0.864423	1.228915e-64	-8.615850e-47
Msa1065610	Msa1447150	0.835044	2.109992e-56	-8.615850e-47
Msa1065610	Msa1449520	0.837761	4.296328e-57	-8.615850e-47
Msa1065610	Msa1451620	-0.840344	9.203185e-58	-8.615850e-47
Msa1065610	Msa1453560	0.832395	9.686265e-56	-8.615850e-47
Msa1065610	Msa1454120	0.807323	5.345784e-50	-8.615850e-47
Msa1065610	Msa1454860	0.824041	1.000407e-53	-8.615850e-47
Msa1065610	Msa1457430	0.817168	3.793038e-52	-8.615850e-47
Msa1065610	Msa1458610	0.806291	8.832019e-50	-8.615850e-47
Msa1065610	Msa1459950	0.818875	1.560025e-52	-8.615850e-47
Msa1065610	Msa1460050	0.830662	2.588142e-55	-8.615850e-47
Msa1065610	Msa1460830	0.830755	2.456871e-55	-8.615850e-47
Msa1065610	Msa1462290	0.820008	8.603468e-53	-8.615850e-47
Msa1065610	Msa1462930	0.816937	4.274678e-52	-8.615850e-47
Msa1065610	Msa1464940	0.830990	2.151463e-55	-8.615850e-47
Msa1065610	Msa1466540	0.808295	3.321575e-50	-8.615850e-47
Msa1065610	Msa1466730	0.832701	8.132652e-56	-8.615850e-47
Msa0242430	Msa1065610	0.827687	1.363016e-54	-8.615850e-47
Msa0243100	Msa1065610	0.821309	4.323462e-53	-8.615850e-47
Msa0243250	Msa1065610	0.833923	4.034728e-56	-8.615850e-47
Msa0243710	Msa1065610	0.850495	1.636704e-60	-8.615850e-47
Msa0244860	Msa1065610	0.800482	1.411827e-48	-8.615850e-47
Msa0245940	Msa1065610	0.843132	1.690795e-58	-8.615850e-47
Msa0248520	Msa1065610	0.813104	3.030243e-51	-8.615850e-47
Msa0249100	Msa1065610	0.854736	1.008867e-61	-8.615850e-47
Msa0250880	Msa1065610	0.808273	3.359011e-50	-8.615850e-47
Msa0253200	Msa1065610	0.807712	4.420122e-50	-8.615850e-47
Msa0258760	Msa1065610	0.816396	5.651314e-52	-8.615850e-47
Msa0260780	Msa1065610	0.806639	7.459236e-50	-8.615850e-47
Msa0260810	Msa1065610	0.817430	3.310641e-52	-8.615850e-47
Msa0261720	Msa1065610	0.815793	7.705085e-52	-8.615850e-47
Msa0261930	Msa1065610	0.831612	1.512523e-55	-8.615850e-47
Msa0262510	Msa1065610	0.803261	3.793739e-49	-8.615850e-47
Msa0264150	Msa1065610	0.800439	1.440438e-48	-8.615850e-47
Msa0264780	Msa1065610	0.816432	5.548170e-52	-8.615850e-47
Msa0269520	Msa1065610	0.800081	1.703352e-48	-8.615850e-47
Msa0270100	Msa1065610	0.823129	1.635123e-53	-8.615850e-47
Msa0272730	Msa1065610	0.813156	2.952216e-51	-8.615850e-47
Msa0274730	Msa1065610	0.857232	1.878212e-62	-8.615850e-47
Msa0276920	Msa1065610	0.808330	3.266420e-50	-8.615850e-47
Msa0281640	Msa1065610	0.832658	8.334847e-56	-8.615850e-47
Msa0282250	Msa1065610	0.804143	2.488289e-49	-8.615850e-47
Msa0283450	Msa1065610	0.805581	1.245715e-49	-8.615850e-47
Msa0283520	Msa1065610	0.804515	2.081886e-49	-8.615850e-47
Msa0284520	Msa1065610	0.828098	1.085787e-54	-8.615850e-47
Msa0285450	Msa1065610	0.827478	1.529986e-54	-8.615850e-47
Msa0286670	Msa1065610	0.819347	1.218039e-52	-8.615850e-47
Msa0287410	Msa1065610	0.867917	9.606397e-66	-8.615850e-47
Msa0287650	Msa1065610	0.832706	8.110352e-56	-8.615850e-47
Msa0288100	Msa1065610	0.804631	1.968639e-49	-8.615850e-47
Msa0290760	Msa1065610	0.803444	3.475830e-49	-8.615850e-47
Msa0292030	Msa1065610	0.809874	1.525246e-50	-8.615850e-47
Msa0292930	Msa1065610	0.825624	4.235436e-54	-8.615850e-47
Msa0299580	Msa1065610	0.845772	3.297251e-59	-8.615850e-47
Msa0299730	Msa1065610	0.817801	2.731668e-52	-8.615850e-47
Msa0305700	Msa1065610	0.823442	1.381921e-53	-8.615850e-47
Msa0311700	Msa1065610	0.823181	1.590376e-53	-8.615850e-47
Msa0313270	Msa1065610	0.814445	1.534772e-51	-8.615850e-47
Msa0313560	Msa1065610	0.817168	3.793136e-52	-8.615850e-47
Msa0315290	Msa1065610	0.827952	1.177376e-54	-8.615850e-47
Msa0315530	Msa1065610	0.854805	9.638381e-62	-8.615850e-47
Msa0318990	Msa1065610	0.814728	1.329170e-51	-8.615850e-47
Msa0319170	Msa1065610	0.813612	2.343556e-51	-8.615850e-47
Msa0320800	Msa1065610	0.840055	1.094564e-57	-8.615850e-47
Msa0323080	Msa1065610	0.801637	8.195477e-49	-8.615850e-47
Msa0323370	Msa1065610	0.819017	1.448039e-52	-8.615850e-47
Msa0326110	Msa1065610	0.847892	8.675439e-60	-8.615850e-47
Msa0326520	Msa1065610	0.812398	4.326563e-51	-8.615850e-47
Msa0330340	Msa1065610	0.831996	1.215965e-55	-8.615850e-47
Msa0332000	Msa1065610	0.803975	2.696957e-49	-8.615850e-47
Msa0333920	Msa1065610	0.811143	8.111241e-51	-8.615850e-47
Msa0334040	Msa1065610	0.815598	8.516596e-52	-8.615850e-47
Msa0337060	Msa1065610	0.821319	4.300285e-53	-8.615850e-47
Msa0339620	Msa1065610	0.824494	7.832139e-54	-8.615850e-47
Msa0341540	Msa1065610	0.816245	6.107885e-52	-8.615850e-47
Msa0344910	Msa1065610	0.800780	1.227128e-48	-8.615850e-47
Msa0344980	Msa1065610	0.817373	3.410068e-52	-8.615850e-47
Msa0346910	Msa1065610	0.826418	2.742906e-54	-8.615850e-47
Msa0351380	Msa1065610	0.813220	2.857923e-51	-8.615850e-47
Msa0351810	Msa1065610	0.820284	7.439743e-53	-8.615850e-47
Msa0357020	Msa1065610	0.813859	2.068271e-51	-8.615850e-47
Msa0359030	Msa1065610	0.830125	3.502685e-55	-8.615850e-47
Msa0363790	Msa1065610	0.811613	6.414136e-51	-8.615850e-47
Msa0484650	Msa1065610	0.811374	7.227086e-51	-8.615850e-47
Msa0484780	Msa1065610	0.863150	3.055966e-64	-8.615850e-47
Msa0485120	Msa1065610	0.814524	1.474263e-51	-8.615850e-47
Msa0488270	Msa1065610	0.807979	3.878498e-50	-8.615850e-47
Msa0488560	Msa1065610	0.805820	1.109804e-49	-8.615850e-47
Msa0489100	Msa1065610	0.820809	5.637177e-53	-8.615850e-47
Msa0495320	Msa1065610	0.813601	2.356317e-51	-8.615850e-47
Msa0495330	Msa1065610	0.806641	7.453250e-50	-8.615850e-47
Msa0498650	Msa1065610	0.801641	8.181022e-49	-8.615850e-47
Msa0503060	Msa1065610	0.837341	5.503428e-57	-8.615850e-47
Msa0512870	Msa1065610	0.820954	5.220728e-53	-8.615850e-47
Msa0512900	Msa1065610	0.817746	2.810934e-52	-8.615850e-47
Msa0515010	Msa1065610	0.801735	7.825776e-49	-8.615850e-47
Msa0516170	Msa1065610	0.829162	6.005403e-55	-8.615850e-47
Msa0516370	Msa1065610	0.811577	6.529885e-51	-8.615850e-47
Msa0523460	Msa1065610	0.827176	1.807952e-54	-8.615850e-47
Msa0532350	Msa1065610	0.832585	8.693516e-56	-8.615850e-47
Msa0536220	Msa1065610	0.835771	1.382426e-56	-8.615850e-47
Msa0545070	Msa1065610	0.811834	5.741774e-51	-8.615850e-47
Msa0555020	Msa1065610	0.822906	1.843380e-53	-8.615850e-47
Msa0561230	Msa1065610	0.802505	5.434027e-49	-8.615850e-47
Msa0563840	Msa1065610	0.803836	2.882835e-49	-8.615850e-47
Msa0571130	Msa1065610	0.816390	5.668284e-52	-8.615850e-47
Msa0572420	Msa1065610	0.839797	1.277983e-57	-8.615850e-47
Msa0572480	Msa1065610	0.836846	7.364650e-57	-8.615850e-47
Msa0575470	Msa1065610	0.821720	3.474842e-53	-8.615850e-47
Msa0576880	Msa1065610	0.808992	2.358042e-50	-8.615850e-47
Msa0577500	Msa1065610	0.807238	5.571901e-50	-8.615850e-47
Msa0577510	Msa1065610	0.807922	3.988474e-50	-8.615850e-47
Msa0578970	Msa1065610	0.835158	1.974130e-56	-8.615850e-47
Msa0579100	Msa1065610	0.804333	2.271465e-49	-8.615850e-47
Msa0579130	Msa1065610	0.832351	9.934043e-56	-8.615850e-47
Msa0579200	Msa1065610	0.833370	5.545111e-56	-8.615850e-47
Msa0585230	Msa1065610	0.822856	1.893498e-53	-8.615850e-47
Msa0593650	Msa1065610	0.802062	6.705692e-49	-8.615850e-47
Msa0598160	Msa1065610	0.807353	5.267607e-50	-8.615850e-47
Msa0599890	Msa1065610	0.824513	7.751157e-54	-8.615850e-47
Msa0842890	Msa1065610	0.803551	3.302669e-49	-8.615850e-47
Msa0844240	Msa1065610	0.803849	2.864371e-49	-8.615850e-47
Msa0844570	Msa1065610	0.824617	7.325213e-54	-8.615850e-47
Msa0847880	Msa1065610	0.801915	7.188985e-49	-8.615850e-47
Msa0857640	Msa1065610	0.805779	1.131941e-49	-8.615850e-47
Msa0861090	Msa1065610	0.825181	5.393255e-54	-8.615850e-47
Msa0861540	Msa1065610	0.807197	5.684705e-50	-8.615850e-47
Msa0861920	Msa1065610	0.806599	7.606803e-50	-8.615850e-47
Msa0861930	Msa1065610	0.829664	4.536257e-55	-8.615850e-47
Msa0866400	Msa1065610	0.800286	1.547319e-48	-8.615850e-47
Msa0866410	Msa1065610	0.822384	2.437665e-53	-8.615850e-47
Msa0869100	Msa1065610	0.820224	7.679993e-53	-8.615850e-47
Msa0876850	Msa1065610	-0.843448	1.392394e-58	-8.615850e-47
Msa0880140	Msa1065610	0.816769	4.662872e-52	-8.615850e-47
Msa0882510	Msa1065610	0.811869	5.641952e-51	-8.615850e-47
Msa0891600	Msa1065610	-0.812456	4.202295e-51	-8.615850e-47
Msa0896750	Msa1065610	0.816061	6.715822e-52	-8.615850e-47
Msa0898660	Msa1065610	0.800702	1.273064e-48	-8.615850e-47
Msa0908050	Msa1065610	0.840867	6.711738e-58	-8.615850e-47
Msa0908170	Msa1065610	0.800052	1.726604e-48	-8.615850e-47
Msa0910000	Msa1065610	0.802682	4.997552e-49	-8.615850e-47
Msa0910980	Msa1065610	-0.816813	4.556504e-52	-8.615850e-47
Msa0922410	Msa1065610	0.824250	8.935228e-54	-8.615850e-47
Msa0923330	Msa1065610	0.801307	9.579539e-49	-8.615850e-47
Msa0924310	Msa1065610	0.831729	1.415230e-55	-8.615850e-47
Msa0925290	Msa1065610	0.811677	6.211127e-51	-8.615850e-47
Msa0927290	Msa1065610	0.802419	5.660358e-49	-8.615850e-47
Msa0927670	Msa1065610	0.847878	8.750713e-60	-8.615850e-47
Msa0932730	Msa1065610	0.811344	7.339317e-51	-8.615850e-47
Msa0933100	Msa1065610	0.827024	1.965374e-54	-8.615850e-47
Msa0933230	Msa1065610	0.821257	4.446005e-53	-8.615850e-47
Msa0933310	Msa1065610	0.808816	2.572028e-50	-8.615850e-47
Msa0933450	Msa1065610	0.813457	2.534875e-51	-8.615850e-47
Msa0942080	Msa1065610	-0.827477	1.531051e-54	-8.615850e-47
Msa0944030	Msa1065610	0.804603	1.995846e-49	-8.615850e-47
Msa0946690	Msa1065610	-0.804689	1.914519e-49	-8.615850e-47
Msa0953120	Msa1065610	0.809883	1.518468e-50	-8.615850e-47
Msa0954550	Msa1065610	0.807647	4.563563e-50	-8.615850e-47
Msa0954920	Msa1065610	0.810499	1.118264e-50	-8.615850e-47
Msa0960160	Msa1065610	0.815018	1.145815e-51	-8.615850e-47
Msa0969450	Msa1065610	0.818453	1.945304e-52	-8.615850e-47
Msa0969520	Msa1065610	0.847596	1.046552e-59	-8.615850e-47
Msa0969600	Msa1065610	0.804240	2.375284e-49	-8.615850e-47
Msa0971090	Msa1065610	0.810835	9.461727e-51	-8.615850e-47

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1065610	MtrunA17_Chr7g0246111	93.307	508	4	4	1	480	1	506	0.0	944
Msa1065610	MtrunA17_Chr6g0459561	48.495	299	143	5	191	479	362	659	8.99e-96	303
Msa1065610	MtrunA17_Chr6g0459541	44.720	322	134	6	197	479	28	344	8.49e-91	280
Msa1065610	MtrunA17_Chr4g0026631	43.168	322	145	4	194	478	110	430	5.50e-80	255
Msa1065610	MtrunA17_Chr2g0321241	42.991	321	145	4	195	478	116	435	5.75e-80	255
Msa1065610	MtrunA17_Chr6g0459551	39.200	375	170	10	145	477	44	402	2.99e-79	253
Msa1065610	MtrunA17_Chr4g0004121	38.320	381	209	7	119	479	154	528	3.58e-77	251
Msa1065610	MtrunA17_Chr4g0052271	51.012	247	117	3	196	440	104	348	1.10e-76	245
Msa1065610	MtrunA17_Chr4g0038101	44.326	282	142	5	211	478	721	1001	6.58e-71	243
Msa1065610	MtrunA17_Chr6g0459531	40.753	292	137	4	197	479	53	317	4.81e-70	226
Msa1065610	MtrunA17_Chr5g0397121	42.532	308	131	8	211	478	513	814	6.16e-70	238
Msa1065610	MtrunA17_Chr6g0462581	41.391	302	141	6	211	478	500	799	4.77e-67	230
Msa1065610	MtrunA17_Chr3g0127401	41.042	307	163	6	161	459	40	336	4.89e-66	217
Msa1065610	MtrunA17_Chr8g0387641	39.812	319	135	7	211	478	521	833	1.10e-65	226
Msa1065610	MtrunA17_Chr1g0195731	42.321	293	143	6	211	478	934	1225	1.55e-65	229
Msa1065610	MtrunA17_Chr1g0195741	41.638	293	145	6	211	478	938	1229	1.31e-64	226
Msa1065610	MtrunA17_Chr3g0127431	41.727	278	150	5	161	436	43	310	3.57e-64	213
Msa1065610	MtrunA17_Chr1g0202371	38.816	304	148	4	211	478	397	698	1.37e-62	216
Msa1065610	MtrunA17_Chr3g0116131	42.373	295	140	6	211	478	902	1193	2.36e-62	219
Msa1065610	MtrunA17_Chr1g0202381	41.463	287	148	6	162	436	416	694	1.10e-61	214
Msa1065610	MtrunA17_Chr1g0204031	48.035	229	114	3	211	436	557	783	7.95e-61	213
Msa1065610	MtrunA17_Chr1g0192151	35.294	289	161	8	183	455	130	408	4.56e-49	173
Msa1065610	MtrunA17_Chr4g0014731	35.294	289	161	8	183	455	131	409	5.73e-49	173
Msa1065610	MtrunA17_Chr7g0255721	39.464	261	140	8	209	461	683	933	1.68e-48	179
Msa1065610	MtrunA17_Chr7g0255721	33.032	221	143	3	216	434	391	608	1.06e-25	111
Msa1065610	MtrunA17_Chr1g0180791	39.630	270	146	5	206	461	200	466	6.43e-48	176
Msa1065610	MtrunA17_Chr1g0180791	38.627	233	134	5	209	435	476	705	2.24e-46	172
Msa1065610	MtrunA17_Chr3g0145011	37.770	278	153	8	210	480	138	402	2.86e-47	168
Msa1065610	MtrunA17_Chr7g0264521	39.259	270	147	5	206	461	201	467	4.98e-47	174
Msa1065610	MtrunA17_Chr7g0264521	39.056	233	133	5	209	435	477	706	1.32e-46	172
Msa1065610	MtrunA17_Chr2g0327121	38.627	233	134	5	209	435	478	707	4.27e-46	171
Msa1065610	MtrunA17_Chr2g0327121	42.308	234	127	5	206	435	202	431	2.54e-44	166
Msa1065610	MtrunA17_Chr3g0141901	37.681	276	152	8	210	478	135	397	5.45e-46	164
Msa1065610	MtrunA17_Chr4g0050561	36.397	272	153	8	194	456	139	399	2.37e-45	163
Msa1065610	MtrunA17_Chr7g0255641	37.453	267	145	8	209	465	656	910	4.18e-44	166
Msa1065610	MtrunA17_Chr7g0255641	32.609	276	163	7	212	470	394	663	3.49e-29	121
Msa1065610	MtrunA17_Chr7g0262801	35.878	262	153	6	199	454	175	427	7.15e-42	154
Msa1065610	MtrunA17_Chr1g0182711	35.496	262	154	6	199	454	176	428	7.98e-42	154
Msa1065610	MtrunA17_Chr7g0255901	32.143	336	193	10	160	477	601	919	2.05e-41	158
Msa1065610	MtrunA17_Chr2g0277831	35.870	276	162	6	209	472	531	803	4.27e-41	157
Msa1065610	MtrunA17_Chr2g0277831	29.568	301	162	9	213	470	245	538	1.18e-29	123
Msa1065610	MtrunA17_Chr4g0033451	34.672	274	159	6	210	465	379	650	3.82e-38	149
Msa1065610	MtrunA17_Chr3g0108321	40.104	192	107	4	209	394	157	346	7.42e-37	139
Msa1065610	MtrunA17_Chr8g0345461	33.884	242	149	6	200	434	154	391	1.39e-36	139
Msa1065610	MtrunA17_Chr2g0316851	35.652	230	138	4	213	434	596	823	6.27e-36	142
Msa1065610	MtrunA17_Chr3g0086411	35.106	282	152	10	209	464	213	489	6.43e-36	139
Msa1065610	MtrunA17_Chr3g0086411	29.075	227	117	7	298	480	7	233	5.80e-16	80.1
Msa1065610	MtrunA17_Chr3g0135721	36.047	258	151	8	210	461	223	472	1.60e-35	140
Msa1065610	MtrunA17_Chr5g0432631	34.201	269	162	8	200	461	217	477	1.89e-35	140
Msa1065610	MtrunA17_Chr8g0362771	37.445	227	130	8	210	430	236	456	4.61e-35	139
Msa1065610	MtrunA17_Chr7g0255651	36.052	233	140	5	209	435	280	509	5.04e-35	137
Msa1065610	MtrunA17_Chr7g0255651	29.348	276	170	9	218	478	24	289	6.96e-16	80.1
Msa1065610	MtrunA17_Chr1g0200081	33.884	242	148	7	200	434	164	400	2.23e-34	134
Msa1065610	MtrunA17_Chr7g0255691	32.595	316	199	8	154	462	228	536	4.91e-34	134
Msa1065610	MtrunA17_Chr7g0255691	33.803	284	159	11	214	478	20	293	1.77e-27	115
Msa1065610	MtrunA17_Chr4g0043381	33.829	269	162	6	190	447	810	1073	5.26e-34	136
Msa1065610	MtrunA17_Chr4g0043381	27.037	270	170	11	216	460	554	821	7.95e-12	67.8
Msa1065610	MtrunA17_Chr4g0052411	36.797	231	136	6	210	434	228	454	9.53e-34	135
Msa1065610	MtrunA17_Chr2g0297281	36.797	231	136	6	210	434	285	511	2.48e-33	134
Msa1065610	MtrunA17_Chr7g0217421	36.364	231	137	6	210	434	38	264	2.81e-33	130
Msa1065610	MtrunA17_Chr6g0456351	36.207	232	141	5	207	434	313	541	3.37e-33	132
Msa1065610	MtrunA17_Chr2g0327231	36.649	191	115	3	187	373	322	510	6.06e-33	130
Msa1065610	MtrunA17_Chr2g0327231	36.585	123	69	3	206	327	148	262	3.53e-15	77.8
Msa1065610	MtrunA17_Chr3g0143721	36.364	231	137	6	210	434	248	474	6.63e-33	132
Msa1065610	MtrunA17_Chr3g0135761	34.766	256	153	8	212	461	223	470	1.38e-32	131
Msa1065610	MtrunA17_Chr6g0476861	35.565	239	139	7	206	434	192	425	5.58e-32	129
Msa1065610	MtrunA17_Chr7g0260601	35.146	239	140	7	206	434	235	468	1.27e-31	128
Msa1065610	MtrunA17_Chr3g0086401	30.303	297	174	7	209	477	383	674	2.25e-31	127
Msa1065610	MtrunA17_Chr3g0086401	31.159	276	144	8	245	477	128	400	1.87e-26	113
Msa1065610	MtrunA17_Chr3g0104211	35.565	239	141	7	206	435	299	533	7.65e-31	126
Msa1065610	MtrunA17_Chr7g0248361	35.294	238	131	8	211	434	192	420	1.42e-30	125
Msa1065610	MtrunA17_Chr4g0031821	35.043	234	137	7	211	434	320	548	3.33e-30	124
Msa1065610	MtrunA17_Chr5g0429571	29.738	343	193	9	137	435	204	542	4.64e-30	124
Msa1065610	MtrunA17_Chr2g0331161	31.522	276	171	7	205	470	409	676	3.50e-29	121
Msa1065610	MtrunA17_Chr2g0289231	29.703	303	191	8	140	428	224	518	9.08e-29	119
Msa1065610	MtrunA17_Chr1g0158881	33.992	253	158	7	213	462	331	577	1.13e-28	120
Msa1065610	MtrunA17_Chr8g0388371	33.465	254	149	7	203	441	396	644	1.87e-28	119
Msa1065610	MtrunA17_Chr5g0432641	33.929	224	141	5	210	430	190	409	1.97e-28	119
Msa1065610	MtrunA17_Chr3g0094871	33.761	234	141	7	210	434	10	238	7.07e-28	115
Msa1065610	MtrunA17_Chr3g0129971	36.864	236	137	7	210	435	295	528	2.93e-27	115
Msa1065610	MtrunA17_Chr3g0135781	39.264	163	93	4	210	370	54	212	3.27e-27	108
Msa1065610	MtrunA17_Chr4g0047411	32.157	255	141	11	245	473	211	459	1.14e-22	101
Msa1065610	MtrunA17_Chr8g0357301	33.838	198	117	7	247	434	506	699	4.10e-19	90.9
Msa1065610	MtrunA17_Chr5g0432391	33.103	145	92	3	288	430	81	222	1.69e-14	75.5
Msa1065610	MtrunA17_Chr4g0062081	43.590	78	42	2	215	290	11	88	9.63e-14	67.0
Msa1065610	MtrunA17_Chr5g0404291	28.358	201	119	4	246	424	387	584	9.79e-14	73.6
Msa1065610	MtrunA17_Chr4g0039781	32.192	146	96	2	246	391	368	510	1.12e-12	70.1
Msa1065610	MtrunA17_Chr6g0450161	32.653	147	94	3	246	391	362	504	1.57e-12	69.7
Msa1065610	MtrunA17_Chr1g0190401	26.702	191	130	6	207	390	673	860	2.20e-12	69.7

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1065610	AT2G45500.1	71.053	494	126	5	1	480	1	491	0.0	679
Msa1065610	AT2G45500.5	71.197	493	123	6	1	480	11	497	0.0	672
Msa1065610	AT2G45500.2	71.197	493	123	6	1	480	1	487	0.0	672
Msa1065610	AT2G45500.4	83.607	305	45	1	181	480	50	354	0.0	527
Msa1065610	AT2G45500.3	83.607	305	45	1	181	480	50	354	0.0	527
Msa1065610	AT3G27120.1	50.502	299	137	6	191	479	380	677	1.48e-96	306
Msa1065610	AT2G27600.1	43.168	322	145	4	194	478	112	432	8.84e-80	255
Msa1065610	AT1G80350.1	44.013	309	153	5	190	479	215	522	1.51e-78	254
Msa1065610	AT2G34560.1	43.478	299	151	5	196	479	85	380	7.31e-75	241
Msa1065610	AT2G34560.2	43.478	299	151	5	196	479	94	389	8.49e-75	241
Msa1065610	AT1G50140.2	43.038	316	158	8	181	478	658	969	1.85e-71	244
Msa1065610	AT1G50140.5	43.038	316	158	8	181	478	658	969	1.85e-71	244
Msa1065610	AT1G50140.3	43.038	316	158	8	181	478	680	991	1.98e-71	244
Msa1065610	AT1G50140.1	43.038	316	158	8	181	478	680	991	1.98e-71	244
Msa1065610	AT1G50140.4	43.038	316	158	8	181	478	680	991	1.98e-71	244
Msa1065610	AT3G19740.1	42.089	316	161	8	181	478	670	981	1.19e-70	242
Msa1065610	AT4G27680.1	41.275	298	161	5	167	456	42	333	2.60e-68	224
Msa1065610	AT1G64110.2	41.967	305	135	8	210	478	517	815	8.64e-68	232
Msa1065610	AT1G64110.4	41.967	305	135	8	210	478	517	815	8.64e-68	232
Msa1065610	AT1G64110.1	41.967	305	135	8	210	478	512	810	9.45e-68	232
Msa1065610	AT1G64110.5	41.967	305	135	8	210	478	515	813	9.71e-68	232
Msa1065610	AT1G64110.3	41.967	305	135	8	210	478	515	813	9.71e-68	232
Msa1065610	AT5G53540.1	40.604	298	163	5	167	456	45	336	1.95e-66	219
Msa1065610	AT4G02480.1	42.662	293	142	5	211	478	960	1251	2.36e-66	232
Msa1065610	AT4G28000.2	40.461	304	143	6	211	478	517	818	4.63e-66	228
Msa1065610	AT4G28000.1	40.461	304	143	6	211	478	515	816	4.66e-66	228
Msa1065610	AT5G52882.1	40.132	304	144	5	211	478	514	815	7.48e-66	227
Msa1065610	AT4G28000.3	47.368	228	116	3	211	436	517	742	2.16e-65	225
Msa1065610	AT4G24860.4	46.888	241	124	3	199	436	778	1017	9.75e-65	226
Msa1065610	AT4G24860.2	46.888	241	124	3	199	436	801	1040	1.01e-64	226
Msa1065610	AT4G24860.1	46.888	241	124	3	199	436	805	1044	1.11e-64	226
Msa1065610	AT4G24860.3	46.888	241	124	3	199	436	803	1042	1.17e-64	226
Msa1065610	AT1G02890.1	42.321	293	143	5	211	478	941	1232	1.12e-63	224
Msa1065610	AT1G62130.2	37.329	292	147	6	211	478	743	1022	6.12e-50	184
Msa1065610	AT1G62130.1	37.201	293	148	6	210	478	749	1029	6.36e-50	184
Msa1065610	AT3G56690.1	39.502	281	150	8	190	461	700	969	9.36e-49	180
Msa1065610	AT3G56690.1	35.747	221	138	2	216	434	387	605	2.33e-34	137
Msa1065610	AT3G05530.1	35.052	291	163	8	181	455	129	409	3.15e-48	172
Msa1065610	AT1G09100.1	34.948	289	162	8	183	455	130	408	7.90e-48	171
Msa1065610	AT1G02890.2	37.201	293	130	6	211	478	941	1204	2.13e-47	176
Msa1065610	AT5G43010.1	37.770	278	149	9	210	478	135	397	1.69e-46	166
Msa1065610	AT3G09840.1	37.762	286	159	6	206	475	199	481	1.90e-46	172
Msa1065610	AT3G09840.1	39.316	234	132	5	209	435	475	705	2.66e-44	166
Msa1065610	AT5G03340.1	38.889	270	148	5	206	461	199	465	3.03e-46	172
Msa1065610	AT5G03340.1	39.485	233	132	5	209	435	475	704	1.96e-45	170
Msa1065610	AT1G45000.1	37.681	276	152	8	210	478	135	397	3.23e-46	166
Msa1065610	AT3G53230.1	42.060	233	129	4	206	435	200	429	5.23e-46	171
Msa1065610	AT3G53230.1	39.056	233	133	5	209	435	476	705	4.21e-45	169
Msa1065610	AT5G20000.1	36.765	272	152	8	194	456	141	401	1.50e-44	162
Msa1065610	AT5G19990.1	36.765	272	152	8	194	456	141	401	1.54e-44	161
Msa1065610	AT5G19990.3	36.765	272	152	8	194	456	141	401	1.54e-44	161
Msa1065610	AT5G19990.2	36.765	272	152	8	194	456	83	343	1.93e-44	160
Msa1065610	AT1G03000.1	35.417	288	163	6	209	477	653	936	3.47e-43	164
Msa1065610	AT4G29040.1	36.641	262	151	6	199	454	173	425	4.66e-43	158
Msa1065610	AT2G20140.1	36.641	262	151	6	199	454	173	425	8.85e-43	157
Msa1065610	AT3G01610.1	36.900	271	154	7	209	466	523	789	6.10e-42	160
Msa1065610	AT3G01610.1	32.500	240	140	5	213	436	232	465	2.98e-28	119
Msa1065610	AT3G01610.2	36.900	271	154	7	209	466	523	789	7.20e-42	159
Msa1065610	AT3G01610.2	32.500	240	140	5	213	436	232	465	3.27e-28	119
Msa1065610	AT5G58290.1	37.768	233	136	5	209	435	150	379	3.16e-41	152
Msa1065610	AT3G15120.1	36.245	229	136	4	213	433	718	944	1.05e-37	148
Msa1065610	AT3G15120.2	36.245	229	136	4	213	433	728	954	1.06e-37	148
Msa1065610	AT2G03670.1	34.752	282	167	8	200	474	272	543	1.83e-36	142
Msa1065610	AT2G03670.1	35.842	279	153	11	215	478	23	290	2.35e-34	136
Msa1065610	AT1G05910.1	34.307	274	156	8	211	464	378	647	3.29e-36	143
Msa1065610	AT1G53750.1	33.884	242	149	6	200	434	154	391	3.46e-36	139
Msa1065610	AT3G02450.1	37.190	242	137	7	207	440	327	561	2.38e-35	139
Msa1065610	AT2G03670.2	35.842	279	153	11	215	478	23	290	2.71e-35	136
Msa1065610	AT2G03670.2	42.000	150	82	2	200	344	272	421	1.50e-23	103
Msa1065610	AT1G06430.1	36.797	231	136	6	210	434	216	442	8.41e-34	135
Msa1065610	AT1G06430.3	36.797	231	136	6	210	434	216	442	8.41e-34	135
Msa1065610	AT1G06430.2	36.797	231	136	6	210	434	216	442	8.41e-34	135
Msa1065610	AT2G30950.1	36.364	231	137	6	210	434	223	449	1.26e-33	135
Msa1065610	AT2G30950.2	36.364	231	137	6	210	434	223	449	1.26e-33	135
Msa1065610	AT2G30950.3	36.364	231	137	6	210	434	223	449	1.26e-33	135
Msa1065610	AT2G30950.4	36.364	231	137	6	210	434	227	453	1.44e-33	134
Msa1065610	AT5G42270.1	37.229	231	135	6	210	434	246	472	1.48e-33	134
Msa1065610	AT2G26140.1	35.802	243	146	7	210	448	223	459	2.68e-33	134
Msa1065610	AT1G53780.3	32.780	241	151	6	200	433	325	561	6.40e-33	132
Msa1065610	AT1G53780.1	32.780	241	151	6	200	433	326	562	6.95e-33	132
Msa1065610	AT1G53780.4	32.780	241	151	6	200	433	326	562	6.95e-33	132
Msa1065610	AT1G50250.1	36.364	231	137	6	210	434	258	484	7.33e-33	132
Msa1065610	AT1G53780.2	32.780	241	151	6	200	433	347	583	7.40e-33	132
Msa1065610	AT1G07510.1	35.417	240	140	7	211	440	324	558	1.52e-32	132
Msa1065610	AT5G08470.3	35.526	228	137	5	213	435	834	1056	2.19e-32	132
Msa1065610	AT5G08470.1	35.526	228	137	5	213	435	843	1065	3.12e-32	131
Msa1065610	AT2G29080.1	35.146	239	141	7	211	440	319	552	1.24e-31	129
Msa1065610	AT3G47060.1	30.220	364	196	11	119	440	209	556	2.43e-31	128
Msa1065610	AT5G15250.1	35.498	231	139	6	210	434	220	446	3.24e-31	127
Msa1065610	AT5G53170.1	35.294	255	152	8	213	462	361	607	1.20e-30	126
Msa1065610	AT5G58870.1	30.887	327	180	9	152	435	232	555	7.75e-30	124
Msa1065610	AT4G23940.1	35.968	253	144	6	203	441	419	667	8.21e-30	124
Msa1065610	AT5G15250.2	33.202	253	138	8	210	434	220	469	1.37e-28	119
Msa1065610	AT5G64580.1	32.534	292	167	8	154	435	274	545	3.41e-28	119
Msa1065610	AT4G04180.2	31.489	235	141	7	206	428	306	532	9.08e-27	114
Msa1065610	AT4G04180.1	31.489	235	141	7	206	428	311	537	9.43e-27	114
Msa1065610	AT3G16290.1	30.249	281	172	8	205	475	401	667	6.56e-26	112
Msa1065610	AT1G45000.2	38.849	139	79	3	210	343	135	272	4.09e-25	106
Msa1065610	AT5G08470.2	37.037	135	80	2	213	344	843	975	3.48e-22	100
Msa1065610	AT4G04910.1	31.395	258	139	11	245	473	248	496	1.75e-21	98.6
Msa1065610	AT1G79560.3	34.804	204	119	6	247	440	526	725	2.82e-21	98.2
Msa1065610	AT1G79560.1	34.804	204	119	6	247	440	526	725	3.07e-21	97.8
Msa1065610	AT1G79560.2	34.804	204	119	6	247	440	526	725	3.18e-21	97.8
Msa1065610	AT2G18330.1	32.394	142	91	3	246	386	384	521	2.39e-13	72.8
Msa1065610	AT4G24710.3	33.333	162	88	4	248	391	215	374	8.60e-13	70.9
Msa1065610	AT4G24710.1	33.333	162	88	4	248	391	203	362	8.79e-13	70.9
Msa1065610	AT5G16930.1	32.192	146	94	3	246	390	397	538	2.49e-12	69.7
Msa1065610	AT3G04340.1	26.667	195	129	7	207	392	777	966	3.54e-12	69.7
Msa1065610	AT4G36580.1	31.690	142	92	3	246	386	381	518	4.09e-12	68.9
Msa1065610	AT3G03060.1	30.882	204	112	6	246	424	385	584	5.07e-12	68.6

Find 108 sgRNAs with CRISPR-Local

Find 325 sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
CAGATGTTTGACTAGGTTTC+GGG	0.221153	7_2:+59408271	None:intergenic
TTTCAAGGCAATATGATTTC+AGG	0.222782	7_2:+59404895	None:intergenic
AGGAGAGAAAACAGAGTTAA+AGG	0.225077	7_2:+59410105	None:intergenic
ATCCAATTCCTGTGGCTTAT+TGG	0.227753	7_2:+59406158	None:intergenic
CAGCTTCCTTGACGTCAAAA+TGG	0.244361	7_2:-59407798	Msa1065610:CDS
CAAGTTTAAACAAAAGTAAA+TGG	0.245979	7_2:-59405102	Msa1065610:CDS
CATTGAAGAAGCACTGAAAT+TGG	0.247194	7_2:+59410054	None:intergenic
GACAAGGGCACCAAAGTTTA+TGG	0.255512	7_2:-59404956	Msa1065610:three_prime_UTR
CCAGATGTTTGACTAGGTTT+CGG	0.283554	7_2:+59408270	None:intergenic
GATGACATTGTGATTGTAAT+TGG	0.285252	7_2:-59406853	Msa1065610:intron
TTTGAGATTTATCATAGATT+TGG	0.310939	7_2:+59410263	None:intergenic
AAAGGCAAAGCAAGCTTTAA+TGG	0.312478	7_2:-59408081	Msa1065610:CDS
AGGTAGCTCATTTGCCAATC+AGG	0.328156	7_2:-59408612	Msa1065610:intron
AATTGGATGATGCCGTTCTT+AGG	0.330851	7_2:-59406143	Msa1065610:CDS
GTAGTATTTGATAGTTTAGT+TGG	0.333617	7_2:+59408351	None:intergenic
AACAAGTCTCTTCTCTTTGT+TGG	0.337816	7_2:+59408044	None:intergenic
CTTTACCAAATGAAAATGTT+AGG	0.342458	7_2:-59405850	Msa1065610:CDS
ACCTTCTTCTCCTTCTTCTT+CGG	0.351247	7_2:-59410023	Msa1065610:CDS
ATGTTGAAACTATTTATTGA+TGG	0.354439	7_2:-59404922	Msa1065610:three_prime_UTR
TTAGAACCCAGCTCTCTAAT+TGG	0.361235	7_2:+59405312	None:intergenic
GAATTCCTTATCCAGTTTGA+TGG	0.364436	7_2:-59406892	Msa1065610:CDS
CTCTTTGGTCCGCCTGGTAA+TGG	0.372609	7_2:-59407883	Msa1065610:CDS
GAGAGATGGAATGAGGAGTT+TGG	0.374466	7_2:-59405070	Msa1065610:CDS
TGATTCTGAAGCCACTGCTT+TGG	0.387336	7_2:+59407846	None:intergenic
ATTTAAAACAAAGCCTTTCA+AGG	0.392962	7_2:+59404880	None:intergenic
AAGAGATCGATAAAGCTGTT+AGG	0.394509	7_2:-59409946	Msa1065610:CDS
AATTCCTTATCCAGTTTGAT+GGG	0.396055	7_2:-59406891	Msa1065610:CDS
AACCAATAAGCCACAGGAAT+TGG	0.397626	7_2:-59406160	Msa1065610:CDS
AGCTGTTAGGGCTGAAGAAT+GGG	0.399219	7_2:-59409933	Msa1065610:CDS
CAATTTCAGTGCTTCTTCAA+TGG	0.404872	7_2:-59410053	Msa1065610:CDS
CATAAAAGTGATTATGCAAA+AGG	0.419153	7_2:+59410184	None:intergenic
TGGATGTCACCCCATCAAAC+TGG	0.427668	7_2:+59406881	None:intergenic
ACAAGTTTCTGAGAGATTGC+AGG	0.447126	7_2:-59408765	Msa1065610:CDS
TCGTTTGAAACCGAAGAAGA+AGG	0.449660	7_2:+59410013	None:intergenic
CACGTGTATGTATAATATAA+TGG	0.451025	7_2:+59404819	None:intergenic
TCACCCCATCAAACTGGATA+AGG	0.451624	7_2:+59406887	None:intergenic
AAGCTGTTAGGGCTGAAGAA+TGG	0.453233	7_2:-59409934	Msa1065610:CDS
AAATCCAGGTGGCCTGGAAA+AGG	0.456194	7_2:-59408099	Msa1065610:intron
AGCTTCCTTGACGTCAAAAT+GGG	0.456655	7_2:-59407797	Msa1065610:intron
TTGCTTCTCTTTGGTCCGCC+TGG	0.465849	7_2:-59407889	Msa1065610:CDS
TAGGGCTGAAGAATGGGGTT+TGG	0.467614	7_2:-59409927	Msa1065610:CDS
AATGGCAACCATTCCATTCA+AGG	0.471071	7_2:+59404837	None:intergenic
ATCGTCAAAAGATATCAAAA+TGG	0.471460	7_2:-59408793	Msa1065610:CDS
CCATTCAAGGCTGTATTGCC+AGG	0.472571	7_2:+59404850	None:intergenic
TCAAAAGATATCAAAATGGC+AGG	0.473502	7_2:-59408789	Msa1065610:CDS
CCTGGCAATACAGCCTTGAA+TGG	0.483864	7_2:-59404850	Msa1065610:three_prime_UTR
TGAAATCATATTGCCTTGAA+AGG	0.485549	7_2:-59404893	Msa1065610:three_prime_UTR
AGAGATCGATAAAGCTGTTA+GGG	0.491343	7_2:-59409945	Msa1065610:CDS
CATTGCAGCTTCTTCACACA+AGG	0.491414	7_2:+59405338	None:intergenic
TTATCGAAATCCAGGTGGCC+TGG	0.491589	7_2:-59408105	Msa1065610:intron
AATGGGAAGAGCTTGAGAGA+TGG	0.492767	7_2:-59405084	Msa1065610:CDS
CCGAAACCTAGTCAAACATC+TGG	0.497956	7_2:-59408270	Msa1065610:CDS
AGCAGTTTGTGCACGGTTTG+AGG	0.498983	7_2:+59408380	None:intergenic
AATCACAATGTCATCAGGAT+TGG	0.499345	7_2:+59406861	None:intergenic
TTCACTACAGGAATGCTCAT+AGG	0.499729	7_2:-59409889	Msa1065610:CDS
TGAAAATTATGATACGAAAC+TGG	0.500786	7_2:-59408247	Msa1065610:CDS
AGCCACTGCTTTGGCAAGCA+TGG	0.503878	7_2:+59407855	None:intergenic
GCTTGTACGGACACTATTCA+TGG	0.504705	7_2:-59407654	Msa1065610:CDS
ATTACAATCACAATGTCATC+AGG	0.507002	7_2:+59406856	None:intergenic
AATGATGCCAATTAGAGAGC+TGG	0.511129	7_2:-59405319	Msa1065610:CDS
AGCACGTCGCTTACTAGGTA+AGG	0.512942	7_2:+59405787	None:intergenic
GAGAACATAGCATACCTGAT+TGG	0.513560	7_2:+59408598	None:intergenic
TTCCTTCATTCATCACTCCT+AGG	0.516342	7_2:-59409838	Msa1065610:intron
AGAGCTTGAGAGATGGAATG+AGG	0.517140	7_2:-59405077	Msa1065610:CDS
AAGTTTAAACAAAAGTAAAT+GGG	0.518697	7_2:-59405101	Msa1065610:CDS
ACCGAAGAAGAAGGAGAAGA+AGG	0.522002	7_2:+59410022	None:intergenic
AGGTAGAGATCTAGAGATGC+TGG	0.523797	7_2:-59405541	Msa1065610:CDS
GCATGGTTTACAGGATACTC+TGG	0.534864	7_2:-59405375	Msa1065610:intron
CAGGCTCTCAGTAGACGAGC+AGG	0.535200	7_2:-59408746	Msa1065610:intron
ATAGAAGTCCTTCTGTTCGA+TGG	0.538003	7_2:-59408197	Msa1065610:CDS
ATGACGCTATTCTTCACTAC+AGG	0.538194	7_2:-59409901	Msa1065610:CDS
AAAGCAAGCTTTAATGGAGA+TGG	0.543064	7_2:-59408075	Msa1065610:CDS
CACCTAGGAGTGATGAATGA+AGG	0.548059	7_2:+59409836	None:intergenic
TCCAAGGCAATACCTCTAGC+TGG	0.549612	7_2:+59408005	None:intergenic
GGTAAGAGGACTGAGGTATG+AGG	0.557226	7_2:-59405155	Msa1065610:CDS
AAGAGAAGAGACTTGTTCAC+TGG	0.560846	7_2:-59408038	Msa1065610:CDS
TCTGCTAAAACACAAACTCA+AGG	0.566087	7_2:-59405822	Msa1065610:CDS
TAGAAGTCCTTCTGTTCGAT+GGG	0.566235	7_2:-59408196	Msa1065610:CDS
AGCATGGTCTTACCATTACC+AGG	0.568160	7_2:+59407871	None:intergenic
ATGATGCCAATTAGAGAGCT+GGG	0.568226	7_2:-59405318	Msa1065610:CDS
TCTGTTCGATGGGACGATGT+TGG	0.570316	7_2:-59408186	Msa1065610:intron
GAACTGCAGCAGTTTGTGCA+CGG	0.573485	7_2:+59408373	None:intergenic
TGATGCCGTTCTTAGGAGAC+TGG	0.580216	7_2:-59406136	Msa1065610:intron
GGAGTGATGAATGAAGGAAC+AGG	0.584398	7_2:+59409842	None:intergenic
GTGAAGCTGAAAAGCTTGTA+CGG	0.588120	7_2:-59407667	Msa1065610:CDS
ACATCGTCCCATCGAACAGA+AGG	0.588663	7_2:+59408189	None:intergenic
AAGGACGACAAATGAAAATG+AGG	0.591136	7_2:-59406935	Msa1065610:CDS
AGGTGCAACCAATAAGCCAC+AGG	0.594898	7_2:-59406166	Msa1065610:CDS
CAATACAGCCTTGAATGGAA+TGG	0.604940	7_2:-59404845	Msa1065610:three_prime_UTR
GTGTAGAATTAGCTTCAAGT+AGG	0.606311	7_2:+59409864	None:intergenic
CTGAAATGTAGAGCAAGACA+AGG	0.607620	7_2:-59404972	Msa1065610:three_prime_UTR
GACCATGCTTGCCAAAGCAG+TGG	0.609312	7_2:-59407857	Msa1065610:CDS
TCATCAATGAAAATTACAGA+TGG	0.615857	7_2:+59407614	None:intergenic
GCTGTTAGGGCTGAAGAATG+GGG	0.620550	7_2:-59409932	Msa1065610:CDS
ATTCCTTATCCAGTTTGATG+GGG	0.624550	7_2:-59406890	Msa1065610:CDS
GAATCCTCAAAGAAAAGATG+AGG	0.629125	7_2:-59408310	Msa1065610:CDS
TCTCACCAGTCTCCTAAGAA+CGG	0.637516	7_2:+59406131	None:intergenic
CTGCTAAAACACAAACTCAA+GGG	0.643305	7_2:-59405821	Msa1065610:CDS
AGAAGGACTTCTATCTACAA+TGG	0.646183	7_2:+59408206	None:intergenic
CAAAAGATATCAAAATGGCA+GGG	0.647481	7_2:-59408788	Msa1065610:CDS
TGAGGACTTCAAGAAAGCAA+TGG	0.650387	7_2:-59405137	Msa1065610:CDS
ACGGCATCATCCAATTCCTG+TGG	0.676070	7_2:+59406150	None:intergenic
TGAAATGTAGAGCAAGACAA+GGG	0.680291	7_2:-59404971	Msa1065610:three_prime_UTR
GGTCTTCGAAGACCAGCTAG+AGG	0.690852	7_2:-59408017	Msa1065610:intron
TTTACCAGGTAAGAGGACTG+AGG	0.698763	7_2:-59405162	Msa1065610:intron
TTGATAGTATAATGTCAACA+AGG	0.721787	7_2:-59406954	Msa1065610:CDS
ATGCTGGTAAAAGAAACCGA+AGG	0.728590	7_2:-59405525	Msa1065610:intron
ATGGTCTTACCATTACCAGG+CGG	0.798518	7_2:+59407874	None:intergenic

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content
!!!	TTAAGGTTAATTATTTTTTT+TGG	-	chr7_2:59409944-59409963	Msa1065610:CDS	10.0%
!!!	ATTTTTAATATTTGTGTTGT+TGG	-	chr7_2:59405468-59405487	Msa1065610:intron	15.0%
!!	TCTCAATTAAAATAAATTGA+TGG	+	chr7_2:59406000-59406019	None:intergenic	15.0%
!!	CAAAAAATCATTTAATACAA+GGG	+	chr7_2:59407664-59407683	None:intergenic	15.0%
!!	ACAAAAAATCATTTAATACA+AGG	+	chr7_2:59407665-59407684	None:intergenic	15.0%
!!	TTTCATCTTCTAATTAAAAT+AGG	-	chr7_2:59407797-59407816	Msa1065610:intron	15.0%
!!	TGTTTAATTAGTTAAATAGA+TGG	-	chr7_2:59408057-59408076	Msa1065610:CDS	15.0%
!!	ATGCAATTATAATTATTAGA+TGG	-	chr7_2:59408577-59408596	Msa1065610:intron	15.0%
!!	TGCAATTATAATTATTAGAT+GGG	-	chr7_2:59408578-59408597	Msa1065610:intron	15.0%
!!	CAAAAATAATGAATCATATT+TGG	+	chr7_2:59409731-59409750	None:intergenic	15.0%
!!	AAGTTTAAACAAAAGTAAAT+GGG	-	chr7_2:59410029-59410048	Msa1065610:CDS	15.0%
!!!	ATTAATTTTACCATAAACTT+TGG	+	chr7_2:59410187-59410206	None:intergenic	15.0%
!!!	TTTGAGATTTATCATAGATT+TGG	+	chr7_2:59404870-59404889	None:intergenic	20.0%
!!!	ATTTGATTGATTTGTTTATG+TGG	-	chr7_2:59405371-59405390	Msa1065610:intron	20.0%
!!!	TTTGATTGATTTGTTTATGT+GGG	-	chr7_2:59405372-59405391	Msa1065610:intron	20.0%
!!!	TTTTTTCATTGATTAGTTGA+AGG	-	chr7_2:59405411-59405430	Msa1065610:intron	20.0%
!!!	TTTTTCATTGATTAGTTGAA+GGG	-	chr7_2:59405412-59405431	Msa1065610:intron	20.0%
!!!	CTATTATTCAACTTTGATTT+TGG	+	chr7_2:59405747-59405766	None:intergenic	20.0%
!!	TCTTCAATTGACAATAATTA+AGG	+	chr7_2:59405780-59405799	None:intergenic	20.0%
!!	TCGTTTAAAAAACTCATTAT+TGG	+	chr7_2:59405870-59405889	None:intergenic	20.0%
!!!	CAAGTTAAAATCTCTATTTT+TGG	-	chr7_2:59405902-59405921	Msa1065610:intron	20.0%
!!	ATTATAACTAAGACCAAAAT+TGG	+	chr7_2:59406047-59406066	None:intergenic	20.0%
!!	AATTCAGTTAGTTAATCATA+AGG	-	chr7_2:59406145-59406164	Msa1065610:CDS	20.0%
!!	ATTCAGTTAGTTAATCATAA+GGG	-	chr7_2:59406146-59406165	Msa1065610:CDS	20.0%
!!	CAACAAAAAAATAAGATCAT+AGG	+	chr7_2:59406258-59406277	None:intergenic	20.0%
!!!	CTATGATCTTATTTTTTTGT+TGG	-	chr7_2:59406256-59406275	Msa1065610:intron	20.0%
!!	AATTCTCATAAAAGTCAAAA+CGG	+	chr7_2:59406447-59406466	None:intergenic	20.0%
!!	GATAATAAGAATCAAACAAA+TGG	+	chr7_2:59407010-59407029	None:intergenic	20.0%
!!	ATGAAAACTATAATTCTTTG+AGG	-	chr7_2:59407607-59407626	Msa1065610:intron	20.0%
!!!	ATGATTTTTTGTTTAATGCT+TGG	-	chr7_2:59407673-59407692	Msa1065610:CDS	20.0%
!!	TAAGAATGTAGATGTAAAAA+TGG	-	chr7_2:59407736-59407755	Msa1065610:intron	20.0%
!!	AAGAATGTAGATGTAAAAAT+GGG	-	chr7_2:59407737-59407756	Msa1065610:intron	20.0%
!!!	AGTAATCTACCTTTTTTTTT+TGG	+	chr7_2:59407838-59407857	None:intergenic	20.0%
!!	ATTTACTAAACAGAAAGAAA+AGG	-	chr7_2:59408080-59408099	Msa1065610:CDS	20.0%
!!	TTAATATCATTTGAATGAAG+TGG	+	chr7_2:59408132-59408151	None:intergenic	20.0%
!!	TTTAAAAGTGAAAACAAGAT+AGG	+	chr7_2:59408700-59408719	None:intergenic	20.0%
!!!	ATATAAAAGTTTAGTATCGA+GGG	+	chr7_2:59409377-59409396	None:intergenic	20.0%
!!!	AACTTTTATATGCATATTCT+TGG	-	chr7_2:59409386-59409405	Msa1065610:intron	20.0%
!!	ATGCAAAAAAATTACCAATT+GGG	-	chr7_2:59409428-59409447	Msa1065610:intron	20.0%
!!!	TTTTATTGTGTCCAAAATTT+GGG	-	chr7_2:59409703-59409722	Msa1065610:intron	20.0%
!!!	TTCATTATTTTTGTTTTGCA+TGG	-	chr7_2:59409738-59409757	Msa1065610:intron	20.0%
!!	ATAATTAACCTTAACAACAA+AGG	+	chr7_2:59409938-59409957	None:intergenic	20.0%
!!!	TTATTTTTTTTGGTTTTACC+AGG	-	chr7_2:59409954-59409973	Msa1065610:CDS	20.0%
!!!	CATTTACTTTTGTTTAAACT+TGG	+	chr7_2:59410030-59410049	None:intergenic	20.0%
!!	CAAGTTTAAACAAAAGTAAA+TGG	-	chr7_2:59410028-59410047	Msa1065610:CDS	20.0%
!!	ATGTTGAAACTATTTATTGA+TGG	-	chr7_2:59410208-59410227	Msa1065610:five_prime_UTR	20.0%
!!!	AAAGGCTTTGTTTTAAATTT+AGG	-	chr7_2:59410255-59410274	Msa1065610:five_prime_UTR	20.0%
!!!	AAGGCTTTGTTTTAAATTTA+GGG	-	chr7_2:59410256-59410275	Msa1065610:five_prime_UTR	20.0%
!	CATAAAAGTGATTATGCAAA+AGG	+	chr7_2:59404949-59404968	None:intergenic	25.0%
!!!	TTTTCATTGATTAGTTGAAG+GGG	-	chr7_2:59405413-59405432	Msa1065610:intron	25.0%
!!!	GTAAAAGCATTAATCTTGTT+AGG	-	chr7_2:59405490-59405509	Msa1065610:intron	25.0%
!!	TTTTGACGAAAGATATACTT+TGG	-	chr7_2:59405669-59405688	Msa1065610:intron	25.0%
!	TCTATAAAATCTCATGATCA+TGG	-	chr7_2:59405696-59405715	Msa1065610:intron	25.0%
!	ATTATTGTCAATTGAAGACT+TGG	-	chr7_2:59405782-59405801	Msa1065610:intron	25.0%
!	TACAAACTTACATACGTTTA+TGG	+	chr7_2:59405958-59405977	None:intergenic	25.0%
!!	GCTAAAAGTTAATCCAATTT+TGG	-	chr7_2:59406031-59406050	Msa1065610:intron	25.0%
!	AATAGCAGATTTCTGATATT+CGG	-	chr7_2:59406064-59406083	Msa1065610:intron	25.0%
!	ATGATTAACTAACTGAATTC+CGG	+	chr7_2:59406144-59406163	None:intergenic	25.0%
!	ATCGTCAAAAGATATCAAAA+TGG	-	chr7_2:59406337-59406356	Msa1065610:intron	25.0%
!	TGGAGAAAAAGGAATATTAA+TGG	+	chr7_2:59406713-59406732	None:intergenic	25.0%
!!!	ACAAACATTTTTGGAGAAAA+AGG	+	chr7_2:59406724-59406743	None:intergenic	25.0%
!!	GTAGTATTTGATAGTTTAGT+TGG	+	chr7_2:59406782-59406801	None:intergenic	25.0%
!	TGAAAATTATGATACGAAAC+TGG	-	chr7_2:59406883-59406902	Msa1065610:CDS	25.0%
!!!	AGCAACATTTTTTAATGTCA+CGG	-	chr7_2:59407309-59407328	Msa1065610:intron	25.0%
!	TCATCAATGAAAATTACAGA+TGG	+	chr7_2:59407519-59407538	None:intergenic	25.0%
!!	ATCTGTAATTTTCATTGATG+AGG	-	chr7_2:59407518-59407537	Msa1065610:intron	25.0%
!!!	TTTTTGTTTAATGCTTGGTT+TGG	-	chr7_2:59407678-59407697	Msa1065610:intron	25.0%
!	AGAATGTAGATGTAAAAATG+GGG	-	chr7_2:59407738-59407757	Msa1065610:intron	25.0%
!!	ATCTCTTTTGATAAACTTCT+TGG	-	chr7_2:59407770-59407789	Msa1065610:intron	25.0%
!!	TCTCTTTTGATAAACTTCTT+GGG	-	chr7_2:59407771-59407790	Msa1065610:intron	25.0%
!!!	AATCTACCTTTTTTTTTTGG+TGG	+	chr7_2:59407835-59407854	None:intergenic	25.0%
!	TGTGGAAATGATTAAAAATC+TGG	+	chr7_2:59407950-59407969	None:intergenic	25.0%
!	TAGTGCTTGTCAAATTATAT+TGG	+	chr7_2:59407976-59407995	None:intergenic	25.0%
!!	TTGATAGTATAATGTCAACA+AGG	-	chr7_2:59408176-59408195	Msa1065610:intron	25.0%
!!	TGCTCTTGTTAATCTATTTT+GGG	-	chr7_2:59408383-59408402	Msa1065610:CDS	25.0%
!	ACATAAAGTCATTTGTCAAA+GGG	+	chr7_2:59408439-59408458	None:intergenic	25.0%
!!	TATAATTATTAGATGGGCTT+TGG	-	chr7_2:59408584-59408603	Msa1065610:intron	25.0%
!!	ATAATTATTAGATGGGCTTT+GGG	-	chr7_2:59408585-59408604	Msa1065610:intron	25.0%
!	TTTCATCCATCAATAAATAG+AGG	+	chr7_2:59408779-59408798	None:intergenic	25.0%
!!	TCATACTTTTAATCCAGTAA+AGG	+	chr7_2:59409038-59409057	None:intergenic	25.0%
!!	CTAACATTTTCATTTGGTAA+AGG	+	chr7_2:59409282-59409301	None:intergenic	25.0%
!	CTTTACCAAATGAAAATGTT+AGG	-	chr7_2:59409280-59409299	Msa1065610:intron	25.0%
!!	AGTTTCCTAACATTTTCATT+TGG	+	chr7_2:59409288-59409307	None:intergenic	25.0%
!!	TATAAAAGTTTAGTATCGAG+GGG	+	chr7_2:59409376-59409395	None:intergenic	25.0%
!	CATATAAAAGTTTAGTATCG+AGG	+	chr7_2:59409378-59409397	None:intergenic	25.0%
!!	TTTTATATGCATATTCTTGG+AGG	-	chr7_2:59409389-59409408	Msa1065610:intron	25.0%
!	CATGCAAAAAAATTACCAAT+TGG	-	chr7_2:59409427-59409446	Msa1065610:intron	25.0%
!	ACAAATTATAAACTCCCAAT+TGG	+	chr7_2:59409445-59409464	None:intergenic	25.0%
!!!	ACTTACGATTTTTTTGTTAC+AGG	-	chr7_2:59409569-59409588	Msa1065610:intron	25.0%
!	TCAAAATCTATACTTACCTT+CGG	+	chr7_2:59409624-59409643	None:intergenic	25.0%
!	TAAAACAAAGAAGAGAGAAA+AGG	+	chr7_2:59409688-59409707	None:intergenic	25.0%
!!!	GTTTTATTGTGTCCAAAATT+TGG	-	chr7_2:59409702-59409721	Msa1065610:intron	25.0%
!!!	AAAATCTTCCTTTGTTGTTA+AGG	-	chr7_2:59409927-59409946	Msa1065610:CDS	25.0%
!!	ATTTAAAACAAAGCCTTTCA+AGG	+	chr7_2:59410253-59410272	None:intergenic	25.0%
!	CACGTGTATGTATAATATAA+TGG	+	chr7_2:59410314-59410333	None:intergenic	25.0%
	ATATAGCAAAAAACTCACCT+AGG	+	chr7_2:59405312-59405331	None:intergenic	30.0%
	ATTAATCTTGTTAGGACGAA+TGG	-	chr7_2:59405498-59405517	Msa1065610:intron	30.0%
	TCTTAGAGTTGTTCTTAGTT+TGG	-	chr7_2:59405568-59405587	Msa1065610:intron	30.0%
!	TTGTCTTGTTAGAGTATGTT+TGG	-	chr7_2:59405605-59405624	Msa1065610:intron	30.0%
	AGCTTCTCAATTAGAACTTA+TGG	-	chr7_2:59405820-59405839	Msa1065610:CDS	30.0%
	TCAAAAGATATCAAAATGGC+AGG	-	chr7_2:59406341-59406360	Msa1065610:intron	30.0%
	CAAAAGATATCAAAATGGCA+GGG	-	chr7_2:59406342-59406361	Msa1065610:intron	30.0%
	AGTCAAAACGGAATTCAAAA+AGG	+	chr7_2:59406435-59406454	None:intergenic	30.0%
!	TGATTTTGTTGAAGCCAAAA+CGG	+	chr7_2:59406591-59406610	None:intergenic	30.0%
	TCAGTGCTTCTTAAAACATA+TGG	-	chr7_2:59406608-59406627	Msa1065610:intron	30.0%
	TACGTTTCACTGAACATTAT+TGG	-	chr7_2:59406663-59406682	Msa1065610:intron	30.0%
	ACGTTTCACTGAACATTATT+GGG	-	chr7_2:59406664-59406683	Msa1065610:intron	30.0%
	GATTCTTATTATCGAAATCC+AGG	-	chr7_2:59407017-59407036	Msa1065610:intron	30.0%
!	CTGATGAACCTTTTCATTTT+AGG	-	chr7_2:59407217-59407236	Msa1065610:intron	30.0%
	GAAGCAAACCTAAAATGAAA+AGG	+	chr7_2:59407228-59407247	None:intergenic	30.0%
!!!	ATTTTAGGTTTGCTTCTCTT+TGG	-	chr7_2:59407232-59407251	Msa1065610:intron	30.0%
	AACTCAACACAAACAAGTTA+GGG	+	chr7_2:59407378-59407397	None:intergenic	30.0%
	AAACTCAACACAAACAAGTT+AGG	+	chr7_2:59407379-59407398	None:intergenic	30.0%
	TCTCTCTCATCTATATAGAA+AGG	-	chr7_2:59407543-59407562	Msa1065610:intron	30.0%
	GTGCAACTCTAATTGATTAT+TGG	-	chr7_2:59407702-59407721	Msa1065610:intron	30.0%
	ACTACACCACCAAAAAAAAA+AGG	-	chr7_2:59407826-59407845	Msa1065610:CDS	30.0%
!!	GTCAAATTATATTGGTCTTG+TGG	+	chr7_2:59407968-59407987	None:intergenic	30.0%
	TATCGTAAGTGACTAGATTT+AGG	+	chr7_2:59408010-59408029	None:intergenic	30.0%
	AATTCCTTATCCAGTTTGAT+GGG	-	chr7_2:59408239-59408258	Msa1065610:CDS	30.0%
	ATTACAATCACAATGTCATC+AGG	+	chr7_2:59408277-59408296	None:intergenic	30.0%
	GATGACATTGTGATTGTAAT+TGG	-	chr7_2:59408277-59408296	Msa1065610:CDS	30.0%
	TTCTCTATCTGTAATGAACA+TGG	-	chr7_2:59408325-59408344	Msa1065610:CDS	30.0%
!	GTGCTCTTGTTAATCTATTT+TGG	-	chr7_2:59408382-59408401	Msa1065610:CDS	30.0%
	CATAAAGTCATTTGTCAAAG+GGG	+	chr7_2:59408438-59408457	None:intergenic	30.0%
	CACATAAAGTCATTTGTCAA+AGG	+	chr7_2:59408440-59408459	None:intergenic	30.0%
	CTTTGACAAATGACTTTATG+TGG	-	chr7_2:59408438-59408457	Msa1065610:intron	30.0%
	TGTGGTTAAAATTCTCTTCT+AGG	-	chr7_2:59408456-59408475	Msa1065610:intron	30.0%
	GTGGTTAAAATTCTCTTCTA+GGG	-	chr7_2:59408457-59408476	Msa1065610:intron	30.0%
	AAGATAGGAGTAAACTTTAG+AGG	-	chr7_2:59408636-59408655	Msa1065610:intron	30.0%
	TCATTCTGTAACGATGTTAT+AGG	+	chr7_2:59408669-59408688	None:intergenic	30.0%
	TTACAATGGAAACCATATGT+GGG	+	chr7_2:59408736-59408755	None:intergenic	30.0%
	ATTACAATGGAAACCATATG+TGG	+	chr7_2:59408737-59408756	None:intergenic	30.0%
	ATATGGCCTCTATTTATTGA+TGG	-	chr7_2:59408770-59408789	Msa1065610:CDS	30.0%
	ATGGATGAAAAACTAAACTG+TGG	-	chr7_2:59408789-59408808	Msa1065610:CDS	30.0%
	ATTTCTTCATTGTCCTTTAC+TGG	-	chr7_2:59409022-59409041	Msa1065610:intron	30.0%
	AAACAAGAAGAGAGTTAGTA+AGG	+	chr7_2:59409229-59409248	None:intergenic	30.0%
!!!	TACACTTTTAACTTTCTACG+CGG	-	chr7_2:59409469-59409488	Msa1065610:intron	30.0%
!!!	TTTTGTTTTGCATGGTTTAC+AGG	-	chr7_2:59409746-59409765	Msa1065610:intron	30.0%
	TTTCAAGGCAATATGATTTC+AGG	+	chr7_2:59410238-59410257	None:intergenic	30.0%
	TGAAATCATATTGCCTTGAA+AGG	-	chr7_2:59410237-59410256	Msa1065610:five_prime_UTR	30.0%
!!!	TTGTTTTAAATTTAGGGACC+TGG	-	chr7_2:59410262-59410281	Msa1065610:five_prime_UTR	30.0%
!!!	TGATCGATGAGTTTTTTGCA+GGG	-	chr7_2:59404991-59405010	Msa1065610:three_prime_UTR	35.0%
	AGGAGAGAAAACAGAGTTAA+AGG	+	chr7_2:59405028-59405047	None:intergenic	35.0%
	GAAGAAGAAGAAGAAGATTG+AGG	+	chr7_2:59405048-59405067	None:intergenic	35.0%
!!	CATTGAAGAAGCACTGAAAT+TGG	+	chr7_2:59405079-59405098	None:intergenic	35.0%
	CAATTTCAGTGCTTCTTCAA+TGG	-	chr7_2:59405077-59405096	Msa1065610:CDS	35.0%
	AAGAGATCGATAAAGCTGTT+AGG	-	chr7_2:59405184-59405203	Msa1065610:intron	35.0%
	AGAGATCGATAAAGCTGTTA+GGG	-	chr7_2:59405185-59405204	Msa1065610:intron	35.0%
!	GTGTAGAATTAGCTTCAAGT+AGG	+	chr7_2:59405269-59405288	None:intergenic	35.0%
	TTAGTTGAAGGGGAGAAAAA+TGG	-	chr7_2:59405423-59405442	Msa1065610:intron	35.0%
	AGGGGAGAAAAATGGTATAT+AGG	-	chr7_2:59405431-59405450	Msa1065610:intron	35.0%
	ATCTTTCGTCAAAACCACTA+TGG	+	chr7_2:59405663-59405682	None:intergenic	35.0%
	AGATGCAGCAAAACAAGAAT+GGG	+	chr7_2:59406102-59406121	None:intergenic	35.0%
	AAGATGCAGCAAAACAAGAA+TGG	+	chr7_2:59406103-59406122	None:intergenic	35.0%
	TTTCAGTTTCCAAATTGCAC+CGG	-	chr7_2:59406122-59406141	Msa1065610:intron	35.0%
	AAGAGGAATAGGAACAAATG+AGG	+	chr7_2:59406488-59406507	None:intergenic	35.0%
	TGGAATGGAAAAAGAGGAAT+AGG	+	chr7_2:59406499-59406518	None:intergenic	35.0%
!	TATTCCTCTTTTTCCATTCC+AGG	-	chr7_2:59406498-59406517	Msa1065610:intron	35.0%
	TCTCTGTAAACTGTAAGTAC+AGG	-	chr7_2:59406551-59406570	Msa1065610:intron	35.0%
	CTCTGTAAACTGTAAGTACA+GGG	-	chr7_2:59406552-59406571	Msa1065610:intron	35.0%
!!!	GTTTTTTCTTTTCCCCGTTT+TGG	-	chr7_2:59406574-59406593	Msa1065610:intron	35.0%
!	ATTTTGTTGAAGCCAAAACG+GGG	+	chr7_2:59406589-59406608	None:intergenic	35.0%
!	GATTTTGTTGAAGCCAAAAC+GGG	+	chr7_2:59406590-59406609	None:intergenic	35.0%
!	AGGTGCTCTACAAACATTTT+TGG	+	chr7_2:59406733-59406752	None:intergenic	35.0%
	GAATCCTCAAAGAAAAGATG+AGG	-	chr7_2:59406820-59406839	Msa1065610:intron	35.0%
!	TTCACCTCATCTTTTCTTTG+AGG	+	chr7_2:59406827-59406846	None:intergenic	35.0%
!	TTTTCACCAGATGTTTGACT+AGG	+	chr7_2:59406869-59406888	None:intergenic	35.0%
	AGAAGGACTTCTATCTACAA+TGG	+	chr7_2:59406927-59406946	None:intergenic	35.0%
	TCTTATTATCGAAATCCAGG+TGG	-	chr7_2:59407020-59407039	Msa1065610:intron	35.0%
!	AAAGGCAAAGCAAGCTTTAA+TGG	-	chr7_2:59407049-59407068	Msa1065610:intron	35.0%
!	AAAGCAAGCTTTAATGGAGA+TGG	-	chr7_2:59407055-59407074	Msa1065610:intron	35.0%
	AACAAGTCTCTTCTCTTTGT+TGG	+	chr7_2:59407089-59407108	None:intergenic	35.0%
	TTACATAACCCAAAGAGACA+AGG	+	chr7_2:59407152-59407171	None:intergenic	35.0%
!	AGACTTAAGAAGTGTAACCA+TGG	-	chr7_2:59407411-59407430	Msa1065610:intron	35.0%
	TAGTGAGTACAAGTTAACCA+TGG	+	chr7_2:59407431-59407450	None:intergenic	35.0%
	ACTTGTACTCACTACTCAAT+AGG	-	chr7_2:59407437-59407456	Msa1065610:intron	35.0%
	AAATTTATAGCAGGAGTAGG+GGG	+	chr7_2:59407576-59407595	None:intergenic	35.0%
	CAAATTTATAGCAGGAGTAG+GGG	+	chr7_2:59407577-59407596	None:intergenic	35.0%
	CCAAATTTATAGCAGGAGTA+GGG	+	chr7_2:59407578-59407597	None:intergenic	35.0%
	CTTGTTGCCAAATTTATAGC+AGG	+	chr7_2:59407585-59407604	None:intergenic	35.0%
	ATGTAGATGTAAAAATGGGG+TGG	-	chr7_2:59407741-59407760	Msa1065610:intron	35.0%
	AAGGACGACAAATGAAAATG+AGG	-	chr7_2:59408195-59408214	Msa1065610:CDS	35.0%
!!	TTCAGATTTTAATCGTCTGC+TGG	+	chr7_2:59408221-59408240	None:intergenic	35.0%
	GAATTCCTTATCCAGTTTGA+TGG	-	chr7_2:59408238-59408257	Msa1065610:CDS	35.0%
	ATTCCTTATCCAGTTTGATG+GGG	-	chr7_2:59408240-59408259	Msa1065610:CDS	35.0%
	AATCACAATGTCATCAGGAT+TGG	+	chr7_2:59408272-59408291	None:intergenic	35.0%
!!	ATTAACAAGAGCACTGTTCA+TGG	+	chr7_2:59408376-59408395	None:intergenic	35.0%
	CTGGAATTCGAAAAACTCAT+GGG	-	chr7_2:59408484-59408503	Msa1065610:intron	35.0%
	TAAATAGAGGCCATATTCTC+AGG	+	chr7_2:59408766-59408785	None:intergenic	35.0%
	AACTGTGGCTATTGTAAATC+TGG	-	chr7_2:59408804-59408823	Msa1065610:CDS	35.0%
	TTCCTTTCCCTTCTGAATAT+AGG	-	chr7_2:59408944-59408963	Msa1065610:intron	35.0%
	TTCTCCACTTAAAGTCACAT+CGG	+	chr7_2:59409084-59409103	None:intergenic	35.0%
!!!	CTTCTTGTTTTTACTGTGCT+AGG	-	chr7_2:59409239-59409258	Msa1065610:intron	35.0%
	TCTGCTAAAACACAAACTCA+AGG	-	chr7_2:59409308-59409327	Msa1065610:intron	35.0%
	CTGCTAAAACACAAACTCAA+GGG	-	chr7_2:59409309-59409328	Msa1065610:intron	35.0%
!!	GATTTTGAGTCACGATGAAA+AGG	-	chr7_2:59409636-59409655	Msa1065610:intron	35.0%
!!!	CATATTTGGTGCCCAAATTT+TGG	+	chr7_2:59409717-59409736	None:intergenic	35.0%
	GCGCAACGAAAAAATTAAAG+TGG	+	chr7_2:59409885-59409904	None:intergenic	35.0%
!!!	TTTTGGTTTTACCAGGTAAG+AGG	-	chr7_2:59409961-59409980	Msa1065610:CDS	35.0%
	TGAAATGTAGAGCAAGACAA+GGG	-	chr7_2:59410159-59410178	Msa1065610:five_prime_UTR	35.0%
!!!	GTGATCGATGAGTTTTTTGC+AGG	-	chr7_2:59404990-59405009	Msa1065610:three_prime_UTR	40.0%
	ACCTTCTTCTCCTTCTTCTT+CGG	-	chr7_2:59405107-59405126	Msa1065610:CDS	40.0%
!	TCGTTTGAAACCGAAGAAGA+AGG	+	chr7_2:59405120-59405139	None:intergenic	40.0%
	ATGACGCTATTCTTCACTAC+AGG	-	chr7_2:59405229-59405248	Msa1065610:intron	40.0%
	TTCACTACAGGAATGCTCAT+AGG	-	chr7_2:59405241-59405260	Msa1065610:intron	40.0%
	TTCCTTCATTCATCACTCCT+AGG	-	chr7_2:59405292-59405311	Msa1065610:intron	40.0%
!!	TTCTTAGTTTGGTGCTAGCT+AGG	-	chr7_2:59405579-59405598	Msa1065610:intron	40.0%
	GAAATCACATTGTGCCATAG+TGG	-	chr7_2:59405646-59405665	Msa1065610:intron	40.0%
	GATGCAGCAAAACAAGAATG+GGG	+	chr7_2:59406101-59406120	None:intergenic	40.0%
	AACTGAATTCCGGTGCAATT+TGG	+	chr7_2:59406134-59406153	None:intergenic	40.0%
	CTAAGCTGTCACATAGTCAA+AGG	+	chr7_2:59406176-59406195	None:intergenic	40.0%
	CCTTTGTCATCAAGTTACTG+AGG	+	chr7_2:59406229-59406248	None:intergenic	40.0%
!	CCTCAGTAACTTGATGACAA+AGG	-	chr7_2:59406226-59406245	Msa1065610:intron	40.0%
!	ACAAGTTTCTGAGAGATTGC+AGG	-	chr7_2:59406365-59406384	Msa1065610:intron	40.0%
	GAGAACATAGCATACCTGAT+TGG	+	chr7_2:59406535-59406554	None:intergenic	40.0%
	CAGATGTTTGACTAGGTTTC+GGG	+	chr7_2:59406862-59406881	None:intergenic	40.0%
	CCAGATGTTTGACTAGGTTT+CGG	+	chr7_2:59406863-59406882	None:intergenic	40.0%
	ATAGAAGTCCTTCTGTTCGA+TGG	-	chr7_2:59406933-59406952	Msa1065610:CDS	40.0%
	TAGAAGTCCTTCTGTTCGAT+GGG	-	chr7_2:59406934-59406953	Msa1065610:CDS	40.0%
!	AAGAGAAGAGACTTGTTCAC+TGG	-	chr7_2:59407092-59407111	Msa1065610:intron	40.0%
	AGCTTCCTTGACGTCAAAAT+GGG	-	chr7_2:59407333-59407352	Msa1065610:intron	40.0%
!!	AAGTACCCATTTTGACGTCA+AGG	+	chr7_2:59407341-59407360	None:intergenic	40.0%
	TGTACTCACTACTCAATAGG+TGG	-	chr7_2:59407440-59407459	Msa1065610:intron	40.0%
	GTACTCACTACTCAATAGGT+GGG	-	chr7_2:59407441-59407460	Msa1065610:intron	40.0%
	GTGAAGCTGAAAAGCTTGTA+CGG	-	chr7_2:59407463-59407482	Msa1065610:intron	40.0%
	CCCTACTCCTGCTATAAATT+TGG	-	chr7_2:59407575-59407594	Msa1065610:intron	40.0%
	GCCAAATTTATAGCAGGAGT+AGG	+	chr7_2:59407579-59407598	None:intergenic	40.0%
	ATGTAAAAATGGGGTGGCTA+AGG	-	chr7_2:59407747-59407766	Msa1065610:intron	40.0%
	CTGACATTCAAAAAAGACGC+TGG	+	chr7_2:59407899-59407918	None:intergenic	40.0%
	TTTGTCAAAGGGGAACAAAG+AGG	+	chr7_2:59408428-59408447	None:intergenic	40.0%
!	AATTCTCTTCTAGGGAATGC+TGG	-	chr7_2:59408465-59408484	Msa1065610:intron	40.0%
	GCTGGAATTCGAAAAACTCA+TGG	-	chr7_2:59408483-59408502	Msa1065610:intron	40.0%
	TCAGTTGTATCTCCCACATA+TGG	-	chr7_2:59408721-59408740	Msa1065610:intron	40.0%
	TAATCTGCCTCCTGAGAATA+TGG	-	chr7_2:59408753-59408772	Msa1065610:CDS	40.0%
	CACCTATATTCAGAAGGGAA+AGG	+	chr7_2:59408949-59408968	None:intergenic	40.0%
	GGTTGCACCTATATTCAGAA+GGG	+	chr7_2:59408954-59408973	None:intergenic	40.0%
	TGGTTGCACCTATATTCAGA+AGG	+	chr7_2:59408955-59408974	None:intergenic	40.0%
	AACCAATAAGCCACAGGAAT+TGG	-	chr7_2:59408970-59408989	Msa1065610:intron	40.0%
	ATCCAATTCCTGTGGCTTAT+TGG	+	chr7_2:59408975-59408994	None:intergenic	40.0%
	AATTGGATGATGCCGTTCTT+AGG	-	chr7_2:59408987-59409006	Msa1065610:intron	40.0%
	ACATCGGCAATATGACATTC+TGG	+	chr7_2:59409068-59409087	None:intergenic	40.0%
	ATTGCCGATGTGACTTTAAG+TGG	-	chr7_2:59409077-59409096	Msa1065610:intron	40.0%
	ATGCTGGTAAAAGAAACCGA+AGG	-	chr7_2:59409605-59409624	Msa1065610:intron	40.0%
	AATGATGCCAATTAGAGAGC+TGG	-	chr7_2:59409811-59409830	Msa1065610:intron	40.0%
	ATGATGCCAATTAGAGAGCT+GGG	-	chr7_2:59409812-59409831	Msa1065610:intron	40.0%
	TTAGAACCCAGCTCTCTAAT+TGG	+	chr7_2:59409821-59409840	None:intergenic	40.0%
	TTCTAACATTCTCACCGTCA+AGG	-	chr7_2:59409835-59409854	Msa1065610:intron	40.0%
	TGAGGACTTCAAGAAAGCAA+TGG	-	chr7_2:59409993-59410012	Msa1065610:CDS	40.0%
	CTGAAATGTAGAGCAAGACA+AGG	-	chr7_2:59410158-59410177	Msa1065610:five_prime_UTR	40.0%
	CAATACAGCCTTGAATGGAA+TGG	-	chr7_2:59410285-59410304	Msa1065610:five_prime_UTR	40.0%
	AATGGCAACCATTCCATTCA+AGG	+	chr7_2:59410296-59410315	None:intergenic	40.0%
	ACCGAAGAAGAAGGAGAAGA+AGG	+	chr7_2:59405111-59405130	None:intergenic	45.0%
	AAGCTGTTAGGGCTGAAGAA+TGG	-	chr7_2:59405196-59405215	Msa1065610:intron	45.0%
	AGCTGTTAGGGCTGAAGAAT+GGG	-	chr7_2:59405197-59405216	Msa1065610:intron	45.0%
	GGAGTGATGAATGAAGGAAC+AGG	+	chr7_2:59405291-59405310	None:intergenic	45.0%
	CACCTAGGAGTGATGAATGA+AGG	+	chr7_2:59405297-59405316	None:intergenic	45.0%
	GCTACCTGGAATGGAAAAAG+AGG	+	chr7_2:59406505-59406524	None:intergenic	45.0%
	TGATTGGCAAATGAGCTACC+TGG	+	chr7_2:59406519-59406538	None:intergenic	45.0%
	AGGTAGCTCATTTGCCAATC+AGG	-	chr7_2:59406518-59406537	Msa1065610:intron	45.0%
	CACTGAACATTATTGGGTGC+TGG	-	chr7_2:59406670-59406689	Msa1065610:intron	45.0%
	CCGAAACCTAGTCAAACATC+TGG	-	chr7_2:59406860-59406879	Msa1065610:CDS	45.0%
!!	AAGCTTGCTTTGCCTTTTCC+AGG	+	chr7_2:59407046-59407065	None:intergenic	45.0%
	CCTTGGAACCTTGTCTCTTT+GGG	-	chr7_2:59407141-59407160	Msa1065610:intron	45.0%
!	ATGGTCTTACCATTACCAGG+CGG	+	chr7_2:59407259-59407278	None:intergenic	45.0%
!	AGCATGGTCTTACCATTACC+AGG	+	chr7_2:59407262-59407281	None:intergenic	45.0%
!!	TGATTCTGAAGCCACTGCTT+TGG	+	chr7_2:59407287-59407306	None:intergenic	45.0%
	CAGCTTCCTTGACGTCAAAA+TGG	-	chr7_2:59407332-59407351	Msa1065610:intron	45.0%
	GCTTGTACGGACACTATTCA+TGG	-	chr7_2:59407476-59407495	Msa1065610:intron	45.0%
	TCACCCCATCAAACTGGATA+AGG	+	chr7_2:59408246-59408265	None:intergenic	45.0%
	GGGATTGTTCCAGAAGAACT+CGG	-	chr7_2:59408605-59408624	Msa1065610:intron	45.0%
!!	AACTCGGCTGCTCTAAAGAT+AGG	-	chr7_2:59408621-59408640	Msa1065610:intron	45.0%
	TCTCAGGAGGCAGATTACAA+TGG	+	chr7_2:59408750-59408769	None:intergenic	45.0%
	ATAGAGGCCATATTCTCAGG+AGG	+	chr7_2:59408763-59408782	None:intergenic	45.0%
	TCTCACCAGTCTCCTAAGAA+CGG	+	chr7_2:59409002-59409021	None:intergenic	45.0%
!	AAAAGAGCACGTCGCTTACT+AGG	+	chr7_2:59409351-59409370	None:intergenic	45.0%
!	ATGCATATTCTTGGAGGCAC+CGG	-	chr7_2:59409395-59409414	Msa1065610:intron	45.0%
!	TTTTTGCATGTTCCGCCTTC+CGG	+	chr7_2:59409417-59409436	None:intergenic	45.0%
	AGGTAGAGATCTAGAGATGC+TGG	-	chr7_2:59409589-59409608	Msa1065610:intron	45.0%
	GCATGGTTTACAGGATACTC+TGG	-	chr7_2:59409755-59409774	Msa1065610:intron	45.0%
	CATTGCAGCTTCTTCACACA+AGG	+	chr7_2:59409795-59409814	None:intergenic	45.0%
	TTTACCAGGTAAGAGGACTG+AGG	-	chr7_2:59409968-59409987	Msa1065610:CDS	45.0%
	AATGGGAAGAGCTTGAGAGA+TGG	-	chr7_2:59410046-59410065	Msa1065610:CDS	45.0%
	AGAGCTTGAGAGATGGAATG+AGG	-	chr7_2:59410053-59410072	Msa1065610:CDS	45.0%
	GAGAGATGGAATGAGGAGTT+TGG	-	chr7_2:59410060-59410079	Msa1065610:CDS	45.0%
!!	GACAAGGGCACCAAAGTTTA+TGG	-	chr7_2:59410174-59410193	Msa1065610:five_prime_UTR	45.0%
!!!	TTTTATTTTATTTTTAAGAA+TGG	+	chr7_2:59404836-59404855	None:intergenic	5.0%
	GCTGTTAGGGCTGAAGAATG+GGG	-	chr7_2:59405198-59405217	Msa1065610:intron	50.0%
	TAGGGCTGAAGAATGGGGTT+TGG	-	chr7_2:59405203-59405222	Msa1065610:intron	50.0%
	GGCAAATGAGCTACCTGGAA+TGG	+	chr7_2:59406514-59406533	None:intergenic	50.0%
	AGCAGTTTGTGCACGGTTTG+AGG	+	chr7_2:59406753-59406772	None:intergenic	50.0%
	GAACTGCAGCAGTTTGTGCA+CGG	+	chr7_2:59406760-59406779	None:intergenic	50.0%
	ACATCGTCCCATCGAACAGA+AGG	+	chr7_2:59406944-59406963	None:intergenic	50.0%
	TCTGTTCGATGGGACGATGT+TGG	-	chr7_2:59406944-59406963	Msa1065610:CDS	50.0%
	TTATCGAAATCCAGGTGGCC+TGG	-	chr7_2:59407025-59407044	Msa1065610:intron	50.0%
	AAATCCAGGTGGCCTGGAAA+AGG	-	chr7_2:59407031-59407050	Msa1065610:intron	50.0%
!!	ACCAGCTAGAGGTATTGCCT+TGG	-	chr7_2:59407124-59407143	Msa1065610:intron	50.0%
	TCCAAGGCAATACCTCTAGC+TGG	+	chr7_2:59407128-59407147	None:intergenic	50.0%
	GCCTTGGAACCTTGTCTCTT+TGG	-	chr7_2:59407140-59407159	Msa1065610:intron	50.0%
	CCCAAAGAGACAAGGTTCCA+AGG	+	chr7_2:59407144-59407163	None:intergenic	50.0%
	TTATAGCAGGAGTAGGGGGT+GGG	+	chr7_2:59407572-59407591	None:intergenic	50.0%
	TTTATAGCAGGAGTAGGGGG+TGG	+	chr7_2:59407573-59407592	None:intergenic	50.0%
	TGGATGTCACCCCATCAAAC+TGG	+	chr7_2:59408252-59408271	None:intergenic	50.0%
	TTAGAGCAGCCGAGTTCTTC+TGG	+	chr7_2:59408617-59408636	None:intergenic	50.0%
	AGGTGCAACCAATAAGCCAC+AGG	-	chr7_2:59408964-59408983	Msa1065610:intron	50.0%
	ACGGCATCATCCAATTCCTG+TGG	+	chr7_2:59408983-59409002	None:intergenic	50.0%
	TGATGCCGTTCTTAGGAGAC+TGG	-	chr7_2:59408994-59409013	Msa1065610:intron	50.0%
	AGCACGTCGCTTACTAGGTA+AGG	+	chr7_2:59409346-59409365	None:intergenic	50.0%
!!	ATATTCTTGGAGGCACCGGA+AGG	-	chr7_2:59409399-59409418	Msa1065610:intron	50.0%
	TCTCACCGTCAAGGCAAATC+AGG	-	chr7_2:59409844-59409863	Msa1065610:CDS	50.0%
!	GCATGCCTGATTTGCCTTGA+CGG	+	chr7_2:59409852-59409871	None:intergenic	50.0%
	CATACCTCAGTCCTCTTACC+TGG	+	chr7_2:59409975-59409994	None:intergenic	50.0%
	GGTAAGAGGACTGAGGTATG+AGG	-	chr7_2:59409975-59409994	Msa1065610:CDS	50.0%
	CCATTCAAGGCTGTATTGCC+AGG	+	chr7_2:59410283-59410302	None:intergenic	50.0%
	CCTGGCAATACAGCCTTGAA+TGG	-	chr7_2:59410280-59410299	Msa1065610:five_prime_UTR	50.0%
	CGCGTCGCGTATAAGCTGAA+AGG	-	chr7_2:59405141-59405160	Msa1065610:CDS	55.0%
!	TTTGCCTTTTCCAGGCCACC+TGG	+	chr7_2:59407038-59407057	None:intergenic	55.0%
	GGTCTTCGAAGACCAGCTAG+AGG	-	chr7_2:59407113-59407132	Msa1065610:intron	55.0%
	TTGCTTCTCTTTGGTCCGCC+TGG	-	chr7_2:59407241-59407260	Msa1065610:intron	55.0%
	CTCTTTGGTCCGCCTGGTAA+TGG	-	chr7_2:59407247-59407266	Msa1065610:intron	55.0%
	GACCATGCTTGCCAAAGCAG+TGG	-	chr7_2:59407273-59407292	Msa1065610:intron	55.0%
	AGCCACTGCTTTGGCAAGCA+TGG	+	chr7_2:59407278-59407297	None:intergenic	55.0%
	TATAGCAGGAGTAGGGGGTG+GGG	+	chr7_2:59407571-59407590	None:intergenic	55.0%
	CAGGCTCTCAGTAGACGAGC+AGG	-	chr7_2:59406384-59406403	Msa1065610:intron	60.0%
	ATAGCAGGAGTAGGGGGTGG+GGG	+	chr7_2:59407570-59407589	None:intergenic	60.0%
!!	TTCTTGGAGGCACCGGAAGG+CGG	-	chr7_2:59409402-59409421	Msa1065610:intron	60.0%

Chromosome	Type	Strat	End	Strand	Name
chr7_2	gene	59404788	59410364	59404788	ID=Msa1065610;Name=Msa1065610
chr7_2	mRNA	59404788	59410364	59404788	ID=Msa1065610-mRNA-1;Parent=Msa1065610;Name=Msa1065610-mRNA-1;_AED=0.09;_eAED=0.09;_QI=209\|0.91\|0.92\|1\|0.91\|0.92\|13\|272\|480
chr7_2	exon	59404788	59405176	59404788	ID=Msa1065610-mRNA-1:exon:11436;Parent=Msa1065610-mRNA-1
chr7_2	exon	59405302	59405384	59405302	ID=Msa1065610-mRNA-1:exon:11435;Parent=Msa1065610-mRNA-1
chr7_2	exon	59405526	59405561	59405526	ID=Msa1065610-mRNA-1:exon:11434;Parent=Msa1065610-mRNA-1
chr7_2	exon	59405801	59405891	59405801	ID=Msa1065610-mRNA-1:exon:11433;Parent=Msa1065610-mRNA-1
chr7_2	exon	59406137	59406186	59406137	ID=Msa1065610-mRNA-1:exon:11432;Parent=Msa1065610-mRNA-1
chr7_2	exon	59406854	59406977	59406854	ID=Msa1065610-mRNA-1:exon:11431;Parent=Msa1065610-mRNA-1
chr7_2	exon	59407613	59407693	59407613	ID=Msa1065610-mRNA-1:exon:11430;Parent=Msa1065610-mRNA-1
chr7_2	exon	59407798	59407913	59407798	ID=Msa1065610-mRNA-1:exon:11429;Parent=Msa1065610-mRNA-1
chr7_2	exon	59408018	59408113	59408018	ID=Msa1065610-mRNA-1:exon:11428;Parent=Msa1065610-mRNA-1
chr7_2	exon	59408187	59408406	59408187	ID=Msa1065610-mRNA-1:exon:11427;Parent=Msa1065610-mRNA-1
chr7_2	exon	59408613	59408632	59408613	ID=Msa1065610-mRNA-1:exon:11426;Parent=Msa1065610-mRNA-1
chr7_2	exon	59408747	59408838	59408747	ID=Msa1065610-mRNA-1:exon:11425;Parent=Msa1065610-mRNA-1
chr7_2	exon	59409839	59410364	59409839	ID=Msa1065610-mRNA-1:exon:11424;Parent=Msa1065610-mRNA-1
chr7_2	five_prime_UTR	59410156	59410364	59410156	ID=Msa1065610-mRNA-1:five_prime_utr;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59409839	59410155	59409839	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59408747	59408838	59408747	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59408613	59408632	59408613	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59408187	59408406	59408187	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59408018	59408113	59408018	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59407798	59407913	59407798	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59407613	59407693	59407613	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59406854	59406977	59406854	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59406137	59406186	59406137	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59405801	59405891	59405801	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59405526	59405561	59405526	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59405302	59405384	59405302	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	CDS	59405060	59405176	59405060	ID=Msa1065610-mRNA-1:cds;Parent=Msa1065610-mRNA-1
chr7_2	three_prime_UTR	59404788	59405059	59404788	ID=Msa1065610-mRNA-1:three_prime_utr;Parent=Msa1065610-mRNA-1

Gene Sequence

>Msa1065610

ATGAGTTTTTTGCAGGGAATCATTGATTCCTTTAACTCTGTTTTCTCTCCTCAATCTTCTTCTTCTTCTTCTTCTCAAACCAATTTCAGTGCTTCTTCAATGGAAGCTTCACCTTCTTCTCCTTCTTCTTCGGTTTCAAACGAACGCGTCGCGTATAAGCTGAAAGGCTACTACGATTTAGCAACACAAGAGATCGATAAAGCTGTTAGGGCTGAAGAATGGGGTTTGGTCGATGACGCTATTCTTCACTACAGGAATGCTCATAGGATCCTACTTGAAGCTAATTCTACACCTGTTCCTTCATTCATCACTCCTAGTGAGAAACAGAAAGTACAATCATATCGTCAAAAGATATCAAAATGGCAGGGACAAGTTTCTGAGAGATTGCAGGCTCTCAGTAGACGAGCAGGTAGCTCATTTGCCAATCAGAGCACCTCAAACCGTGCACAAACTGCTGCAGTTCCAACTAAACTATCAAATACTACAAAAAAAGTGCTACAAAAGAATCCTCAAAGAAAAGATGAGGTGAATAAAGTTCAAAGCCCGAAACCTAGTCAAACATCTGGTGAAAATTATGATACGAAACTGGTTGAAATGATTAACACTGCCATTGTAGATAGAAGTCCTTCTGTTCGATGGGACGATGTTGGTGGCCTGGAAAAGGCAAAGCAAGCTTTAATGGAGATGGTTATTTTGCCAACAAAGAGAAGAGACTTGTTCACTGGTCTTCGAAGACCAGCTAGAGGTTTGCTTCTCTTTGGTCCGCCTGGTAATGGTAAGACCATGCTTGCCAAAGCAGTGGCTTCAGAATCAGAAGCAACATTTTTTAATGTCACGGCAGCTTCCTTGACGTCAAAATGGGTGGGTGAAGCTGAAAAGCTTGTACGGACACTATTCATGGTAGCTGTATCGAGACAGCCATCTGTAATTTTCATTGATGAGATTGATAGTATAATGTCAACAAGGACGACAAATGAAAATGAGGCCAGCAGACGATTAAAATCTGAATTCCTTATCCAGTTTGATGGGGTGACATCCAATCCTGATGACATTGTGATTGTAATTGGTGCAACCAATAAGCCACAGGAATTGGATGATGCCGTTCTTAGGAGACTGGTTAAGAGAATATATGTACCTTTACCAAATGAAAATGTTAGGAAACTTCTGCTAAAACACAAACTCAAGGGTCAAGCGTTCTCCTTACCTAGTAGAGATCTAGAGATGCTGGTAAAAGAAACCGAAGGATACTCTGGAAGTGATCTGCAAGCCTTGTGTGAAGAAGCTGCAATGATGCCAATTAGAGAGCTGGGTTCTAACATTCTCACCGTAAGAGGACTGAGGTATGAGGACTTCAAGAAAGCAATGGCTGTGATCAGACCAAGTTTAAACAAAAGTAAATGGGAAGAGCTTGAGAGATGGAATGAGGAGTTTGGTTCAAATTGA

Protein sequence

>Msa1065610

MSFLQGIIDSFNSVFSPQSSSSSSSQTNFSASSMEASPSSPSSSVSNERVAYKLKGYYDLATQEIDKAVRAEEWGLVDDAILHYRNAHRILLEANSTPVPSFITPSEKQKVQSYRQKISKWQGQVSERLQALSRRAGSSFANQSTSNRAQTAAVPTKLSNTTKKVLQKNPQRKDEVNKVQSPKPSQTSGENYDTKLVEMINTAIVDRSPSVRWDDVGGLEKAKQALMEMVILPTKRRDLFTGLRRPARGLLLFGPPGNGKTMLAKAVASESEATFFNVTAASLTSKWVGEAEKLVRTLFMVAVSRQPSVIFIDEIDSIMSTRTTNENEASRRLKSEFLIQFDGVTSNPDDIVIVIGATNKPQELDDAVLRRLVKRIYVPLPNENVRKLLLKHKLKGQAFSLPSRDLEMLVKETEGYSGSDLQALCEEAAMMPIRELGSNILTVRGLRYEDFKKAMAVIRPSLNKSKWEELERWNEEFGSN*