AlfalfaGEDB | Msa0824850

M. sativa cultivar zhongmu-4 / Msa0824850

KEGG: K07426|K07428|K10717|K17873|K20660
GO: GO:0003674 GO:0003824 GO:0004497 GO:0006082 GO:0006629 GO:0006720 GO:0006721 GO:0006722 GO:0008150 GO:0008152 GO:0008299 GO:0008300 GO:0008610 GO:0009056 GO:0009058 GO:0009987 GO:0016042 GO:0016053 GO:0016104 GO:0016105 GO:0016114 GO:0016115 GO:0016491 GO:0016705 GO:0016709 GO:0017144 GO:0019741 GO:0019742 GO:0019745 GO:0019752 GO:0032787 GO:0042180 GO:0042181 GO:0042182 GO:0043436 GO:0044237 GO:0044238 GO:0044242 GO:0044248 GO:0044249 GO:0044255 GO:0044281 GO:0044282 GO:0044283 GO:0046394 GO:0055114 GO:0071704 GO:0072330 GO:1901360 GO:1901361 GO:1901362 GO:1901575 GO:1901576 GO:1901615 GO:1901617 GO:1902381 GO:1902382 GO:1902384 GO:1902386
PFAM: PF00067.25

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0824850	QFS19023.1	98.062	516	10	0	1	516	1	516	0.0	1045

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0824850	sp\|Q2MJ19\|C7A68_MEDTR	69.515	515	157	0	2	516	6	520	0.0	777

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0824850	A0A5P8TXS1	98.062	516	10	0	1	516	1	516	0.0	1045

TFs/TRs:

Gene ID	Type	Classification

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
Msa0004580	Msa0824850	0.800614	1.326976e-48	-8.615850e-47
Msa0004940	Msa0824850	0.806418	8.305015e-50	-8.615850e-47
Msa0004990	Msa0824850	0.824615	7.333242e-54	-8.615850e-47
Msa0010150	Msa0824850	0.843820	1.107617e-58	-8.615850e-47
Msa0011010	Msa0824850	0.805922	1.056550e-49	-8.615850e-47
Msa0011040	Msa0824850	0.813709	2.231479e-51	-8.615850e-47
Msa0014590	Msa0824850	0.841974	3.431749e-58	-8.615850e-47
Msa0017710	Msa0824850	0.813648	2.300816e-51	-8.615850e-47
Msa0019570	Msa0824850	0.804562	2.035579e-49	-8.615850e-47
Msa0021870	Msa0824850	0.820798	5.668602e-53	-8.615850e-47
Msa0025570	Msa0824850	0.804658	1.943800e-49	-8.615850e-47
Msa0027860	Msa0824850	0.842192	3.003777e-58	-8.615850e-47
Msa0036550	Msa0824850	0.809206	2.121388e-50	-8.615850e-47
Msa0038010	Msa0824850	0.846259	2.430752e-59	-8.615850e-47
Msa0046390	Msa0824850	0.816327	5.855890e-52	-8.615850e-47
Msa0048380	Msa0824850	0.810652	1.036014e-50	-8.615850e-47
Msa0048950	Msa0824850	0.805219	1.483488e-49	-8.615850e-47
Msa0053040	Msa0824850	0.820178	7.869797e-53	-8.615850e-47
Msa0059880	Msa0824850	0.846499	2.090327e-59	-8.615850e-47
Msa0061600	Msa0824850	0.806147	9.472522e-50	-8.615850e-47
Msa0063540	Msa0824850	0.837568	4.813379e-57	-8.615850e-47
Msa0064990	Msa0824850	0.800863	1.180211e-48	-8.615850e-47
Msa0073110	Msa0824850	0.831818	1.345451e-55	-8.615850e-47
Msa0074620	Msa0824850	0.827984	1.156380e-54	-8.615850e-47
Msa0075560	Msa0824850	0.809723	1.643462e-50	-8.615850e-47
Msa0080010	Msa0824850	0.815294	9.949726e-52	-8.615850e-47
Msa0084150	Msa0824850	0.804416	2.183096e-49	-8.615850e-47
Msa0084160	Msa0824850	0.822660	2.103474e-53	-8.615850e-47
Msa0085110	Msa0824850	0.820857	5.494477e-53	-8.615850e-47
Msa0085710	Msa0824850	0.847562	1.069286e-59	-8.615850e-47
Msa0087900	Msa0824850	0.818455	1.942886e-52	-8.615850e-47
Msa0093530	Msa0824850	0.807546	4.795348e-50	-8.615850e-47
Msa0095910	Msa0824850	0.809490	1.843949e-50	-8.615850e-47
Msa0096860	Msa0824850	0.818959	1.492964e-52	-8.615850e-47
Msa0102930	Msa0824850	0.803060	4.174441e-49	-8.615850e-47
Msa0108350	Msa0824850	0.829733	4.362919e-55	-8.615850e-47
Msa0120450	Msa0824850	0.806888	6.609513e-50	-8.615850e-47
Msa0604200	Msa0824850	0.839193	1.834057e-57	-8.615850e-47
Msa0604280	Msa0824850	0.820704	5.960202e-53	-8.615850e-47
Msa0605410	Msa0824850	0.806047	9.942879e-50	-8.615850e-47
Msa0605470	Msa0824850	0.818570	1.829840e-52	-8.615850e-47
Msa0605480	Msa0824850	0.804086	2.557758e-49	-8.615850e-47
Msa0609460	Msa0824850	0.812245	4.670522e-51	-8.615850e-47
Msa0610190	Msa0824850	0.829933	3.900160e-55	-8.615850e-47
Msa0614960	Msa0824850	0.825999	3.450935e-54	-8.615850e-47
Msa0616300	Msa0824850	0.805970	1.032166e-49	-8.615850e-47
Msa0623750	Msa0824850	0.824259	8.894877e-54	-8.615850e-47
Msa0629720	Msa0824850	0.826193	3.102479e-54	-8.615850e-47
Msa0630130	Msa0824850	0.824781	6.703167e-54	-8.615850e-47
Msa0631700	Msa0824850	0.861321	1.113690e-63	-8.615850e-47
Msa0634290	Msa0824850	0.865523	5.550880e-65	-8.615850e-47
Msa0639400	Msa0824850	0.816971	4.200538e-52	-8.615850e-47
Msa0639410	Msa0824850	0.819824	9.479826e-53	-8.615850e-47
Msa0640290	Msa0824850	0.824683	7.067127e-54	-8.615850e-47
Msa0641700	Msa0824850	0.813629	2.323867e-51	-8.615850e-47
Msa0643840	Msa0824850	0.857725	1.342026e-62	-8.615850e-47
Msa0645150	Msa0824850	0.830541	2.771635e-55	-8.615850e-47
Msa0645370	Msa0824850	0.836690	8.069994e-57	-8.615850e-47
Msa0647300	Msa0824850	0.811281	7.572650e-51	-8.615850e-47
Msa0650100	Msa0824850	0.812467	4.177697e-51	-8.615850e-47
Msa0651090	Msa0824850	0.812761	3.603827e-51	-8.615850e-47
Msa0655370	Msa0824850	0.823890	1.085770e-53	-8.615850e-47
Msa0655800	Msa0824850	0.813270	2.786137e-51	-8.615850e-47
Msa0667600	Msa0824850	0.842586	2.362248e-58	-8.615850e-47
Msa0667620	Msa0824850	0.823131	1.634087e-53	-8.615850e-47
Msa0668210	Msa0824850	0.833587	4.895134e-56	-8.615850e-47
Msa0668220	Msa0824850	0.841298	5.173118e-58	-8.615850e-47
Msa0668230	Msa0824850	0.820943	5.249504e-53	-8.615850e-47
Msa0670360	Msa0824850	0.873749	1.155151e-67	-8.615850e-47
Msa0671400	Msa0824850	0.818384	2.016009e-52	-8.615850e-47
Msa0671490	Msa0824850	0.824084	9.777838e-54	-8.615850e-47
Msa0671640	Msa0824850	0.831013	2.123400e-55	-8.615850e-47
Msa0676190	Msa0824850	0.802552	5.313871e-49	-8.615850e-47
Msa0678620	Msa0824850	0.822396	2.422308e-53	-8.615850e-47
Msa0680460	Msa0824850	0.819732	9.949939e-53	-8.615850e-47
Msa0682420	Msa0824850	0.838194	3.324223e-57	-8.615850e-47
Msa0683690	Msa0824850	0.815777	7.768785e-52	-8.615850e-47
Msa0684720	Msa0824850	0.811345	7.335031e-51	-8.615850e-47
Msa0685080	Msa0824850	0.835466	1.651342e-56	-8.615850e-47
Msa0686830	Msa0824850	0.808651	2.789470e-50	-8.615850e-47
Msa0689840	Msa0824850	0.804764	1.847208e-49	-8.615850e-47
Msa0692090	Msa0824850	0.812684	3.745787e-51	-8.615850e-47
Msa0694320	Msa0824850	0.803548	3.307769e-49	-8.615850e-47
Msa0699170	Msa0824850	0.827711	1.344998e-54	-8.615850e-47
Msa0708680	Msa0824850	0.818636	1.767256e-52	-8.615850e-47
Msa0711240	Msa0824850	0.831248	1.859304e-55	-8.615850e-47
Msa0711250	Msa0824850	0.826913	2.089469e-54	-8.615850e-47
Msa0711260	Msa0824850	0.831618	1.506963e-55	-8.615850e-47
Msa0715250	Msa0824850	0.812630	3.848898e-51	-8.615850e-47
Msa0716980	Msa0824850	0.830023	3.708176e-55	-8.615850e-47
Msa0717030	Msa0824850	0.808243	3.407784e-50	-8.615850e-47
Msa0718770	Msa0824850	0.809187	2.142159e-50	-8.615850e-47
Msa0720810	Msa0824850	0.829843	4.102853e-55	-8.615850e-47
Msa0720870	Msa0824850	0.804141	2.490733e-49	-8.615850e-47
Msa0727480	Msa0824850	0.845043	5.193790e-59	-8.615850e-47
Msa0728210	Msa0824850	0.827226	1.758592e-54	-8.615850e-47
Msa0728520	Msa0824850	0.805030	1.625263e-49	-8.615850e-47
Msa0730890	Msa0824850	0.806362	8.533622e-50	-8.615850e-47
Msa0735140	Msa0824850	0.817850	2.662612e-52	-8.615850e-47
Msa0735340	Msa0824850	0.811591	6.484893e-51	-8.615850e-47
Msa0747710	Msa0824850	0.817648	2.957113e-52	-8.615850e-47
Msa0751960	Msa0824850	0.863949	1.727525e-64	-8.615850e-47
Msa0754530	Msa0824850	0.804783	1.830120e-49	-8.615850e-47
Msa0757120	Msa0824850	0.841828	3.749274e-58	-8.615850e-47
Msa0758150	Msa0824850	0.821732	3.453242e-53	-8.615850e-47
Msa0761950	Msa0824850	0.829853	4.078787e-55	-8.615850e-47
Msa0768670	Msa0824850	0.838872	2.221299e-57	-8.615850e-47
Msa0768720	Msa0824850	0.838550	2.691062e-57	-8.615850e-47
Msa0776540	Msa0824850	0.808067	3.716056e-50	-8.615850e-47
Msa0777060	Msa0824850	0.817044	4.043820e-52	-8.615850e-47
Msa0777070	Msa0824850	0.831561	1.556522e-55	-8.615850e-47
Msa0777210	Msa0824850	0.802827	4.663961e-49	-8.615850e-47
Msa0777600	Msa0824850	0.820477	6.720107e-53	-8.615850e-47
Msa0783580	Msa0824850	0.803356	3.625066e-49	-8.615850e-47
Msa0787860	Msa0824850	0.966493	5.389568e-126	-8.615850e-47
Msa0789410	Msa0824850	0.817788	2.749707e-52	-8.615850e-47
Msa0792330	Msa0824850	0.833312	5.733491e-56	-8.615850e-47
Msa0792410	Msa0824850	0.811609	6.427294e-51	-8.615850e-47
Msa0798150	Msa0824850	0.815828	7.567171e-52	-8.615850e-47
Msa0798240	Msa0824850	0.824539	7.643675e-54	-8.615850e-47
Msa0802600	Msa0824850	0.805531	1.276038e-49	-8.615850e-47
Msa0803880	Msa0824850	0.811551	6.617532e-51	-8.615850e-47
Msa0806930	Msa0824850	0.865426	5.956427e-65	-8.615850e-47
Msa0812220	Msa0824850	0.807814	4.205252e-50	-8.615850e-47
Msa0814160	Msa0824850	0.856204	3.767655e-62	-8.615850e-47
Msa0814230	Msa0824850	0.806924	6.495953e-50	-8.615850e-47
Msa0816140	Msa0824850	0.994999	4.382224e-212	-8.615850e-47
Msa0817100	Msa0824850	0.830451	2.915035e-55	-8.615850e-47
Msa0824850	Msa0824860	0.866089	3.679146e-65	-8.615850e-47
Msa0824850	Msa0827800	0.846357	2.284581e-59	-8.615850e-47
Msa0824850	Msa0831310	0.802627	5.128656e-49	-8.615850e-47
Msa0824850	Msa0831890	0.861661	8.773249e-64	-8.615850e-47
Msa0824850	Msa0833230	0.804817	1.800916e-49	-8.615850e-47
Msa0824850	Msa0839040	0.849534	3.040429e-60	-8.615850e-47
Msa0824850	Msa0841930	0.831238	1.869560e-55	-8.615850e-47
Msa0824850	Msa0847140	0.817408	3.349765e-52	-8.615850e-47
Msa0824850	Msa0848720	-0.815303	9.908434e-52	-8.615850e-47
Msa0824850	Msa0853080	0.815388	9.486773e-52	-8.615850e-47
Msa0824850	Msa0854840	0.850837	1.311683e-60	-8.615850e-47
Msa0824850	Msa0854860	0.804240	2.375931e-49	-8.615850e-47
Msa0824850	Msa0855260	0.812437	4.241540e-51	-8.615850e-47
Msa0824850	Msa0861730	0.815925	7.201569e-52	-8.615850e-47
Msa0824850	Msa0863840	0.879358	1.330138e-69	-8.615850e-47
Msa0824850	Msa0863850	0.901651	2.159355e-78	-8.615850e-47
Msa0824850	Msa0863860	0.985355	2.612694e-163	-8.615850e-47
Msa0824850	Msa0864160	0.968954	2.035304e-129	-8.615850e-47
Msa0824850	Msa0867080	0.837153	6.146811e-57	-8.615850e-47
Msa0824850	Msa0868820	0.827676	1.371710e-54	-8.615850e-47
Msa0824850	Msa0868870	0.817328	3.490271e-52	-8.615850e-47
Msa0824850	Msa0874750	0.815105	1.096457e-51	-8.615850e-47
Msa0824850	Msa0876600	0.830782	2.418624e-55	-8.615850e-47
Msa0824850	Msa0883640	0.832324	1.009028e-55	-8.615850e-47
Msa0824850	Msa0886370	0.823256	1.527276e-53	-8.615850e-47
Msa0824850	Msa0890210	0.802998	4.298308e-49	-8.615850e-47
Msa0824850	Msa0893220	0.803388	3.570622e-49	-8.615850e-47
Msa0824850	Msa0893840	0.816871	4.421989e-52	-8.615850e-47
Msa0824850	Msa0896910	0.816207	6.228132e-52	-8.615850e-47
Msa0824850	Msa0896920	0.866382	2.970811e-65	-8.615850e-47
Msa0824850	Msa0896950	0.845523	3.851848e-59	-8.615850e-47
Msa0824850	Msa0898830	-0.800094	1.693106e-48	-8.615850e-47
Msa0824850	Msa0898970	0.801399	9.169364e-49	-8.615850e-47
Msa0824850	Msa0902340	0.817614	3.009384e-52	-8.615850e-47
Msa0824850	Msa0910590	0.806904	6.557380e-50	-8.615850e-47
Msa0824850	Msa0910830	0.841121	5.759268e-58	-8.615850e-47
Msa0824850	Msa0913500	0.818152	2.275613e-52	-8.615850e-47
Msa0824850	Msa0913550	0.825985	3.477769e-54	-8.615850e-47
Msa0824850	Msa0922090	0.801984	6.957688e-49	-8.615850e-47
Msa0824850	Msa0932890	0.822760	1.993370e-53	-8.615850e-47
Msa0824850	Msa0932900	0.817150	3.827441e-52	-8.615850e-47
Msa0824850	Msa0932910	0.817236	3.662190e-52	-8.615850e-47
Msa0824850	Msa0932930	0.841054	5.995461e-58	-8.615850e-47
Msa0824850	Msa0933580	0.816916	4.320353e-52	-8.615850e-47
Msa0824850	Msa0933590	0.812081	5.072520e-51	-8.615850e-47
Msa0824850	Msa0933610	0.856727	2.645495e-62	-8.615850e-47
Msa0824850	Msa0941120	0.821488	3.932642e-53	-8.615850e-47
Msa0824850	Msa0948430	0.813069	3.084880e-51	-8.615850e-47
Msa0824850	Msa0951060	0.802698	4.959052e-49	-8.615850e-47
Msa0824850	Msa0960090	0.833215	6.059659e-56	-8.615850e-47
Msa0824850	Msa0962260	0.801554	8.524296e-49	-8.615850e-47
Msa0824850	Msa0962320	0.806961	6.378789e-50	-8.615850e-47
Msa0824850	Msa0964510	0.843226	1.595698e-58	-8.615850e-47
Msa0824850	Msa0970790	0.870628	1.264032e-66	-8.615850e-47
Msa0824850	Msa0970820	0.805620	1.222273e-49	-8.615850e-47
Msa0824850	Msa0976400	0.812200	4.779562e-51	-8.615850e-47
Msa0824850	Msa0985250	0.808132	3.599865e-50	-8.615850e-47
Msa0824850	Msa0985700	0.834045	3.760213e-56	-8.615850e-47
Msa0824850	Msa0986560	-0.805427	1.342050e-49	-8.615850e-47
Msa0824850	Msa0987020	0.810583	1.072372e-50	-8.615850e-47
Msa0824850	Msa0987550	0.823351	1.451571e-53	-8.615850e-47
Msa0824850	Msa0987640	0.801600	8.339650e-49	-8.615850e-47
Msa0824850	Msa0993450	0.802569	5.271951e-49	-8.615850e-47
Msa0824850	Msa0996980	0.825742	3.970433e-54	-8.615850e-47
Msa0824850	Msa0996990	0.823387	1.423505e-53	-8.615850e-47
Msa0824850	Msa0998780	0.800965	1.124991e-48	-8.615850e-47
Msa0824850	Msa1003110	0.810587	1.070097e-50	-8.615850e-47
Msa0824850	Msa1006030	0.852099	5.765736e-61	-8.615850e-47
Msa0824850	Msa1006170	0.853638	2.094166e-61	-8.615850e-47
Msa0824850	Msa1007930	0.855168	7.559568e-62	-8.615850e-47
Msa0824850	Msa1018590	0.806624	7.513895e-50	-8.615850e-47
Msa0824850	Msa1021620	0.822259	2.607090e-53	-8.615850e-47
Msa0824850	Msa1022490	0.822138	2.780907e-53	-8.615850e-47
Msa0824850	Msa1022510	0.841269	5.263496e-58	-8.615850e-47
Msa0824850	Msa1024350	0.837681	4.502429e-57	-8.615850e-47
Msa0824850	Msa1024420	0.825998	3.451392e-54	-8.615850e-47
Msa0824850	Msa1024480	0.833537	5.039156e-56	-8.615850e-47
Msa0824850	Msa1026050	0.843195	1.626294e-58	-8.615850e-47
Msa0824850	Msa1026170	0.833460	5.266596e-56	-8.615850e-47
Msa0824850	Msa1029860	0.811128	8.175693e-51	-8.615850e-47
Msa0824850	Msa1030320	0.822908	1.841970e-53	-8.615850e-47
Msa0824850	Msa1031060	0.801356	9.357142e-49	-8.615850e-47
Msa0824850	Msa1036020	0.805389	1.367124e-49	-8.615850e-47
Msa0824850	Msa1036590	0.810904	9.141081e-51	-8.615850e-47
Msa0824850	Msa1037350	0.836226	1.059405e-56	-8.615850e-47
Msa0824850	Msa1037360	0.801685	8.012249e-49	-8.615850e-47
Msa0824850	Msa1037530	0.820895	5.385205e-53	-8.615850e-47
Msa0824850	Msa1041910	0.854186	1.455611e-61	-8.615850e-47
Msa0824850	Msa1043020	-0.802587	5.226694e-49	-8.615850e-47
Msa0824850	Msa1046220	0.800686	1.282960e-48	-8.615850e-47
Msa0824850	Msa1048350	0.846264	2.422923e-59	-8.615850e-47
Msa0824850	Msa1048390	0.821540	3.825154e-53	-8.615850e-47
Msa0824850	Msa1049400	0.842288	2.833913e-58	-8.615850e-47
Msa0824850	Msa1055450	0.811550	6.618024e-51	-8.615850e-47
Msa0824850	Msa1061670	0.872924	2.187153e-67	-8.615850e-47
Msa0824850	Msa1063210	0.826407	2.759270e-54	-8.615850e-47
Msa0824850	Msa1064930	0.826145	3.185206e-54	-8.615850e-47
Msa0824850	Msa1064940	0.879836	8.998295e-70	-8.615850e-47
Msa0824850	Msa1068080	0.805323	1.410991e-49	-8.615850e-47
Msa0824850	Msa1068900	0.806828	6.806258e-50	-8.615850e-47
Msa0824850	Msa1069440	-0.800235	1.585337e-48	-8.615850e-47
Msa0824850	Msa1075030	0.806679	7.317049e-50	-8.615850e-47
Msa0824850	Msa1076280	0.817022	4.090212e-52	-8.615850e-47
Msa0824850	Msa1076830	0.834913	2.276159e-56	-8.615850e-47
Msa0824850	Msa1076900	0.811026	8.599138e-51	-8.615850e-47
Msa0824850	Msa1079820	0.813530	2.442641e-51	-8.615850e-47
Msa0824850	Msa1081610	0.822986	1.766076e-53	-8.615850e-47
Msa0824850	Msa1083100	0.804138	2.494611e-49	-8.615850e-47
Msa0824850	Msa1084800	0.807192	5.699245e-50	-8.615850e-47
Msa0824850	Msa1087370	0.834887	2.310825e-56	-8.615850e-47
Msa0824850	Msa1087380	0.845593	3.686459e-59	-8.615850e-47
Msa0824850	Msa1094780	0.803290	3.741068e-49	-8.615850e-47
Msa0824850	Msa1096510	-0.814811	1.273549e-51	-8.615850e-47
Msa0824850	Msa1096520	-0.805599	1.235220e-49	-8.615850e-47
Msa0824850	Msa1096570	-0.806221	9.141347e-50	-8.615850e-47
Msa0824850	Msa1098100	0.834517	2.862848e-56	-8.615850e-47
Msa0824850	Msa1099640	0.876831	1.020884e-68	-8.615850e-47
Msa0824850	Msa1099650	0.816266	6.041746e-52	-8.615850e-47
Msa0824850	Msa1100030	0.809455	1.876047e-50	-8.615850e-47
Msa0824850	Msa1100330	0.842636	2.291497e-58	-8.615850e-47
Msa0824850	Msa1103450	0.808880	2.491692e-50	-8.615850e-47
Msa0824850	Msa1104960	0.829539	4.864559e-55	-8.615850e-47
Msa0824850	Msa1106680	0.853305	2.609506e-61	-8.615850e-47
Msa0824850	Msa1106960	0.874154	8.430262e-68	-8.615850e-47
Msa0824850	Msa1107220	0.802816	4.687770e-49	-8.615850e-47
Msa0824850	Msa1108560	0.812314	4.513127e-51	-8.615850e-47
Msa0824850	Msa1108610	0.811483	6.844278e-51	-8.615850e-47
Msa0824850	Msa1109540	0.857912	1.181365e-62	-8.615850e-47
Msa0824850	Msa1109880	0.846099	2.686196e-59	-8.615850e-47
Msa0824850	Msa1109890	0.828809	7.314871e-55	-8.615850e-47
Msa0824850	Msa1110040	0.846511	2.075061e-59	-8.615850e-47
Msa0824850	Msa1115900	0.823348	1.453786e-53	-8.615850e-47
Msa0824850	Msa1119670	0.809677	1.681417e-50	-8.615850e-47
Msa0824850	Msa1120680	0.808796	2.597115e-50	-8.615850e-47
Msa0824850	Msa1120960	0.814298	1.654072e-51	-8.615850e-47
Msa0824850	Msa1122550	0.802713	4.924461e-49	-8.615850e-47
Msa0824850	Msa1123000	0.813498	2.482668e-51	-8.615850e-47
Msa0824850	Msa1123010	0.838895	2.191293e-57	-8.615850e-47
Msa0824850	Msa1124220	0.805474	1.311717e-49	-8.615850e-47
Msa0824850	Msa1130410	0.805184	1.508519e-49	-8.615850e-47
Msa0824850	Msa1133860	0.807508	4.885665e-50	-8.615850e-47
Msa0824850	Msa1138110	0.858588	7.432861e-63	-8.615850e-47
Msa0824850	Msa1143250	0.802494	5.463863e-49	-8.615850e-47
Msa0824850	Msa1147010	0.804473	2.123789e-49	-8.615850e-47
Msa0824850	Msa1147030	0.843207	1.614518e-58	-8.615850e-47
Msa0824850	Msa1148210	0.838353	3.024594e-57	-8.615850e-47
Msa0824850	Msa1149020	0.801438	9.004560e-49	-8.615850e-47
Msa0824850	Msa1149570	-0.802306	5.972257e-49	-8.615850e-47
Msa0824850	Msa1150760	0.805688	1.182863e-49	-8.615850e-47
Msa0824850	Msa1152180	0.810642	1.041496e-50	-8.615850e-47
Msa0824850	Msa1153690	0.864458	1.198152e-64	-8.615850e-47
Msa0824850	Msa1156240	0.843194	1.628020e-58	-8.615850e-47
Msa0824850	Msa1156670	0.804679	1.924094e-49	-8.615850e-47
Msa0824850	Msa1157210	0.816885	4.389612e-52	-8.615850e-47
Msa0824850	Msa1157310	-0.802433	5.623467e-49	-8.615850e-47
Msa0824850	Msa1160540	0.801284	9.682038e-49	-8.615850e-47
Msa0824850	Msa1162370	0.813920	2.004422e-51	-8.615850e-47
Msa0824850	Msa1164240	0.822561	2.218400e-53	-8.615850e-47
Msa0824850	Msa1166530	0.805264	1.451728e-49	-8.615850e-47
Msa0824850	Msa1167960	0.852270	5.154943e-61	-8.615850e-47
Msa0824850	Msa1170340	0.867853	1.007481e-65	-8.615850e-47
Msa0824850	Msa1173290	0.818704	1.705481e-52	-8.615850e-47
Msa0824850	Msa1177090	0.825981	3.483762e-54	-8.615850e-47
Msa0824850	Msa1179190	0.824451	8.013410e-54	-8.615850e-47
Msa0824850	Msa1181090	0.825224	5.266827e-54	-8.615850e-47
Msa0824850	Msa1186340	0.816762	4.679872e-52	-8.615850e-47
Msa0824850	Msa1186430	0.805324	1.410071e-49	-8.615850e-47
Msa0824850	Msa1191270	0.816364	5.745713e-52	-8.615850e-47
Msa0824850	Msa1191350	0.824094	9.722860e-54	-8.615850e-47
Msa0824850	Msa1206330	0.834975	2.196544e-56	-8.615850e-47
Msa0824850	Msa1206380	0.838523	2.734607e-57	-8.615850e-47
Msa0824850	Msa1216120	0.804872	1.753499e-49	-8.615850e-47
Msa0824850	Msa1216370	0.817225	3.682484e-52	-8.615850e-47
Msa0824850	Msa1223710	0.805500	1.295805e-49	-8.615850e-47
Msa0824850	Msa1223960	0.803080	4.135322e-49	-8.615850e-47
Msa0824850	Msa1223990	0.823228	1.550556e-53	-8.615850e-47
Msa0824850	Msa1225850	0.836721	7.924568e-57	-8.615850e-47
Msa0824850	Msa1231720	0.812323	4.492123e-51	-8.615850e-47
Msa0824850	Msa1233620	0.815876	7.385006e-52	-8.615850e-47
Msa0824850	Msa1233630	0.813992	1.933168e-51	-8.615850e-47
Msa0824850	Msa1236680	0.822441	2.365110e-53	-8.615850e-47
Msa0824850	Msa1238250	0.820816	5.616644e-53	-8.615850e-47
Msa0824850	Msa1240710	0.807996	3.846765e-50	-8.615850e-47
Msa0824850	Msa1256730	0.803969	2.704047e-49	-8.615850e-47
Msa0824850	Msa1259570	0.805813	1.113629e-49	-8.615850e-47
Msa0824850	Msa1263000	0.815754	7.861490e-52	-8.615850e-47
Msa0824850	Msa1263110	0.813991	1.934178e-51	-8.615850e-47
Msa0824850	Msa1263120	0.820876	5.441569e-53	-8.615850e-47
Msa0824850	Msa1263370	0.806326	8.685066e-50	-8.615850e-47
Msa0824850	Msa1267990	0.835237	1.885718e-56	-8.615850e-47
Msa0824850	Msa1269500	0.810770	9.772936e-51	-8.615850e-47
Msa0824850	Msa1273320	0.824624	7.297226e-54	-8.615850e-47
Msa0824850	Msa1275840	0.821006	5.077463e-53	-8.615850e-47
Msa0824850	Msa1279750	0.820972	5.169362e-53	-8.615850e-47
Msa0824850	Msa1280460	0.806692	7.269856e-50	-8.615850e-47
Msa0824850	Msa1283600	0.800806	1.212611e-48	-8.615850e-47
Msa0824850	Msa1294020	0.821968	3.044364e-53	-8.615850e-47
Msa0824850	Msa1296870	0.800177	1.628955e-48	-8.615850e-47
Msa0824850	Msa1300610	0.832051	1.178302e-55	-8.615850e-47
Msa0824850	Msa1302630	0.806830	6.798493e-50	-8.615850e-47
Msa0824850	Msa1314020	0.821611	3.682439e-53	-8.615850e-47
Msa0824850	Msa1319010	0.819916	9.032551e-53	-8.615850e-47
Msa0824850	Msa1319030	0.818648	1.756319e-52	-8.615850e-47
Msa0824850	Msa1319190	0.820078	8.294526e-53	-8.615850e-47
Msa0824850	Msa1321970	0.836027	1.189944e-56	-8.615850e-47
Msa0824850	Msa1322500	0.824508	7.772785e-54	-8.615850e-47
Msa0824850	Msa1323030	0.808183	3.509907e-50	-8.615850e-47
Msa0824850	Msa1323120	0.823476	1.357220e-53	-8.615850e-47
Msa0824850	Msa1329740	0.810351	1.203471e-50	-8.615850e-47
Msa0824850	Msa1338510	0.805753	1.146297e-49	-8.615850e-47
Msa0824850	Msa1339490	0.817373	3.410934e-52	-8.615850e-47
Msa0824850	Msa1341030	0.831439	1.668281e-55	-8.615850e-47
Msa0824850	Msa1343590	0.828452	8.922489e-55	-8.615850e-47
Msa0824850	Msa1349420	0.806091	9.731827e-50	-8.615850e-47
Msa0824850	Msa1355330	0.855256	7.128721e-62	-8.615850e-47
Msa0824850	Msa1355340	0.864349	1.296627e-64	-8.615850e-47
Msa0824850	Msa1357750	0.803791	2.944632e-49	-8.615850e-47
Msa0824850	Msa1357840	0.848858	4.688987e-60	-8.615850e-47
Msa0824850	Msa1357860	0.824052	9.943784e-54	-8.615850e-47
Msa0824850	Msa1362520	0.808980	2.371562e-50	-8.615850e-47
Msa0824850	Msa1364690	0.808342	3.246125e-50	-8.615850e-47
Msa0824850	Msa1373560	0.811031	8.579877e-51	-8.615850e-47
Msa0824850	Msa1376070	0.846365	2.273134e-59	-8.615850e-47
Msa0824850	Msa1377460	0.809137	2.195493e-50	-8.615850e-47
Msa0824850	Msa1377520	0.823573	1.288257e-53	-8.615850e-47
Msa0824850	Msa1378400	0.805640	1.210676e-49	-8.615850e-47
Msa0824850	Msa1378950	0.827579	1.447436e-54	-8.615850e-47
Msa0824850	Msa1380740	0.839978	1.146585e-57	-8.615850e-47
Msa0824850	Msa1382180	0.801043	1.084566e-48	-8.615850e-47
Msa0824850	Msa1384130	0.803583	3.252573e-49	-8.615850e-47
Msa0824850	Msa1386120	0.802649	5.075256e-49	-8.615850e-47
Msa0824850	Msa1395690	0.810145	1.333381e-50	-8.615850e-47
Msa0824850	Msa1395720	0.805917	1.058785e-49	-8.615850e-47
Msa0824850	Msa1407670	0.823212	1.563824e-53	-8.615850e-47
Msa0824850	Msa1409600	0.826437	2.713939e-54	-8.615850e-47
Msa0824850	Msa1411550	0.879479	1.204651e-69	-8.615850e-47
Msa0824850	Msa1412360	0.801807	7.562753e-49	-8.615850e-47
Msa0824850	Msa1417220	0.828602	8.207021e-55	-8.615850e-47
Msa0824850	Msa1419390	0.822798	1.953809e-53	-8.615850e-47
Msa0824850	Msa1421130	0.849707	2.720010e-60	-8.615850e-47
Msa0824850	Msa1422150	-0.811026	8.599267e-51	-8.615850e-47
Msa0824850	Msa1427670	0.802566	5.279893e-49	-8.615850e-47
Msa0824850	Msa1441450	0.802644	5.087221e-49	-8.615850e-47
Msa0824850	Msa1445780	0.817254	3.627291e-52	-8.615850e-47
Msa0824850	Msa1445900	0.813899	2.025964e-51	-8.615850e-47
Msa0824850	Msa1446090	0.823935	1.059504e-53	-8.615850e-47
Msa0824850	Msa1448150	0.805701	1.175343e-49	-8.615850e-47
Msa0824850	Msa1449770	0.819017	1.448121e-52	-8.615850e-47
Msa0824850	Msa1451660	0.814103	1.826831e-51	-8.615850e-47
Msa0824850	Msa1452920	0.803202	3.902083e-49	-8.615850e-47
Msa0824850	Msa1453650	0.837478	5.076591e-57	-8.615850e-47
Msa0824850	Msa1456600	0.839648	1.397743e-57	-8.615850e-47
Msa0824850	Msa1458270	0.805861	1.087858e-49	-8.615850e-47
Msa0824850	Msa1459610	0.835914	1.271313e-56	-8.615850e-47
Msa0824850	Msa1459970	0.803728	3.034594e-49	-8.615850e-47
Msa0824850	Msa1461660	0.826954	2.043291e-54	-8.615850e-47
Msa0824850	Msa1462610	0.811325	7.406951e-51	-8.615850e-47
Msa0121320	Msa0824850	0.821288	4.373553e-53	-8.615850e-47
Msa0121500	Msa0824850	0.801363	9.326911e-49	-8.615850e-47
Msa0123530	Msa0824850	0.810109	1.357470e-50	-8.615850e-47
Msa0125600	Msa0824850	0.809576	1.767089e-50	-8.615850e-47
Msa0126960	Msa0824850	0.807366	5.236269e-50	-8.615850e-47
Msa0128340	Msa0824850	0.810820	9.529965e-51	-8.615850e-47
Msa0128740	Msa0824850	0.810178	1.311499e-50	-8.615850e-47
Msa0129850	Msa0824850	0.827083	1.902510e-54	-8.615850e-47
Msa0130710	Msa0824850	0.808775	2.624009e-50	-8.615850e-47
Msa0132250	Msa0824850	0.852086	5.815203e-61	-8.615850e-47
Msa0140270	Msa0824850	0.817452	3.273316e-52	-8.615850e-47
Msa0144010	Msa0824850	0.806547	7.802754e-50	-8.615850e-47
Msa0150000	Msa0824850	0.801098	1.056924e-48	-8.615850e-47
Msa0150910	Msa0824850	0.855032	8.277749e-62	-8.615850e-47
Msa0150920	Msa0824850	0.819594	1.069920e-52	-8.615850e-47
Msa0154460	Msa0824850	0.820107	8.167359e-53	-8.615850e-47
Msa0154750	Msa0824850	0.814598	1.420325e-51	-8.615850e-47
Msa0160580	Msa0824850	0.856150	3.908030e-62	-8.615850e-47
Msa0163340	Msa0824850	0.819124	1.369017e-52	-8.615850e-47
Msa0163690	Msa0824850	0.802710	4.930040e-49	-8.615850e-47
Msa0166030	Msa0824850	0.821814	3.305328e-53	-8.615850e-47
Msa0166180	Msa0824850	0.821742	3.433777e-53	-8.615850e-47
Msa0168010	Msa0824850	0.834294	3.257616e-56	-8.615850e-47
Msa0170990	Msa0824850	0.823037	1.718370e-53	-8.615850e-47
Msa0175060	Msa0824850	0.829551	4.832326e-55	-8.615850e-47
Msa0176600	Msa0824850	0.812287	4.574859e-51	-8.615850e-47
Msa0176620	Msa0824850	0.808494	3.013406e-50	-8.615850e-47
Msa0177550	Msa0824850	0.855677	5.372232e-62	-8.615850e-47
Msa0184390	Msa0824850	0.840106	1.061594e-57	-8.615850e-47
Msa0189150	Msa0824850	-0.800296	1.540168e-48	-8.615850e-47
Msa0190670	Msa0824850	0.846668	1.879400e-59	-8.615850e-47
Msa0190890	Msa0824850	0.819677	1.024185e-52	-8.615850e-47
Msa0191100	Msa0824850	0.815955	7.090501e-52	-8.615850e-47
Msa0194230	Msa0824850	0.828093	1.088939e-54	-8.615850e-47
Msa0195190	Msa0824850	0.841415	4.818138e-58	-8.615850e-47
Msa0196260	Msa0824850	0.817706	2.869839e-52	-8.615850e-47
Msa0197020	Msa0824850	0.824394	8.265765e-54	-8.615850e-47
Msa0199860	Msa0824850	0.816572	5.159761e-52	-8.615850e-47
Msa0202650	Msa0824850	0.804380	2.221237e-49	-8.615850e-47
Msa0207640	Msa0824850	0.844732	6.302172e-59	-8.615850e-47
Msa0209520	Msa0824850	0.809658	1.697249e-50	-8.615850e-47
Msa0212550	Msa0824850	0.816913	4.327250e-52	-8.615850e-47
Msa0218060	Msa0824850	0.806763	7.023894e-50	-8.615850e-47
Msa0218140	Msa0824850	0.801498	8.752900e-49	-8.615850e-47
Msa0223880	Msa0824850	0.802273	6.065395e-49	-8.615850e-47
Msa0225910	Msa0824850	0.842684	2.225269e-58	-8.615850e-47
Msa0225920	Msa0824850	0.810741	9.914506e-51	-8.615850e-47
Msa0233210	Msa0824850	0.806244	9.036641e-50	-8.615850e-47
Msa0234120	Msa0824850	0.833881	4.132459e-56	-8.615850e-47
Msa0234130	Msa0824850	0.805673	1.191773e-49	-8.615850e-47
Msa0238110	Msa0824850	0.825077	5.705260e-54	-8.615850e-47
Msa0366510	Msa0824850	0.853042	3.103086e-61	-8.615850e-47
Msa0367340	Msa0824850	0.800707	1.270240e-48	-8.615850e-47
Msa0370620	Msa0824850	0.821480	3.949323e-53	-8.615850e-47
Msa0374040	Msa0824850	0.854437	1.231358e-61	-8.615850e-47
Msa0374470	Msa0824850	0.809733	1.634870e-50	-8.615850e-47
Msa0374560	Msa0824850	0.807688	4.472776e-50	-8.615850e-47
Msa0374600	Msa0824850	0.807395	5.160671e-50	-8.615850e-47
Msa0384150	Msa0824850	-0.800496	1.402697e-48	-8.615850e-47
Msa0391270	Msa0824850	0.802358	5.826900e-49	-8.615850e-47
Msa0396700	Msa0824850	0.826647	2.418576e-54	-8.615850e-47
Msa0396790	Msa0824850	0.830728	2.494340e-55	-8.615850e-47
Msa0396860	Msa0824850	0.820602	6.289465e-53	-8.615850e-47
Msa0398690	Msa0824850	0.822835	1.914570e-53	-8.615850e-47
Msa0401420	Msa0824850	0.805580	1.246241e-49	-8.615850e-47
Msa0409490	Msa0824850	0.808547	2.936077e-50	-8.615850e-47
Msa0409500	Msa0824850	0.848141	7.402517e-60	-8.615850e-47
Msa0409530	Msa0824850	0.823532	1.316667e-53	-8.615850e-47
Msa0414480	Msa0824850	0.878894	1.940491e-69	-8.615850e-47
Msa0417400	Msa0824850	0.809954	1.465337e-50	-8.615850e-47
Msa0418150	Msa0824850	0.852303	5.044280e-61	-8.615850e-47
Msa0418160	Msa0824850	0.857501	1.563217e-62	-8.615850e-47
Msa0423200	Msa0824850	0.813985	1.939421e-51	-8.615850e-47
Msa0423220	Msa0824850	0.819771	9.749031e-53	-8.615850e-47
Msa0444200	Msa0824850	0.809253	2.073560e-50	-8.615850e-47
Msa0444210	Msa0824850	0.814699	1.348740e-51	-8.615850e-47
Msa0444250	Msa0824850	0.825787	3.875420e-54	-8.615850e-47
Msa0444400	Msa0824850	0.841169	5.594316e-58	-8.615850e-47
Msa0445530	Msa0824850	0.838191	3.329413e-57	-8.615850e-47
Msa0454160	Msa0824850	0.819460	1.148138e-52	-8.615850e-47
Msa0454770	Msa0824850	0.822639	2.127248e-53	-8.615850e-47
Msa0464300	Msa0824850	0.867168	1.669222e-65	-8.615850e-47
Msa0464310	Msa0824850	0.882301	1.168299e-70	-8.615850e-47
Msa0469450	Msa0824850	0.835588	1.537283e-56	-8.615850e-47
Msa0472390	Msa0824850	0.808122	3.617562e-50	-8.615850e-47
Msa0478730	Msa0824850	-0.802560	5.293417e-49	-8.615850e-47
Msa0240580	Msa0824850	0.803110	4.075412e-49	-8.615850e-47
Msa0242390	Msa0824850	0.807394	5.164909e-50	-8.615850e-47
Msa0242830	Msa0824850	0.805406	1.355606e-49	-8.615850e-47
Msa0243970	Msa0824850	0.846210	2.505350e-59	-8.615850e-47
Msa0243990	Msa0824850	0.843302	1.523613e-58	-8.615850e-47
Msa0244310	Msa0824850	0.808197	3.486062e-50	-8.615850e-47
Msa0245660	Msa0824850	0.809342	1.984003e-50	-8.615850e-47
Msa0248320	Msa0824850	0.827403	1.594963e-54	-8.615850e-47
Msa0252930	Msa0824850	0.806814	6.851773e-50	-8.615850e-47
Msa0258010	Msa0824850	0.811076	8.388923e-51	-8.615850e-47
Msa0259110	Msa0824850	0.812787	3.556322e-51	-8.615850e-47
Msa0259300	Msa0824850	0.801176	1.018582e-48	-8.615850e-47
Msa0266640	Msa0824850	0.832895	7.281428e-56	-8.615850e-47
Msa0266650	Msa0824850	0.815573	8.626287e-52	-8.615850e-47
Msa0269240	Msa0824850	0.805048	1.610889e-49	-8.615850e-47
Msa0269710	Msa0824850	0.803398	3.553360e-49	-8.615850e-47
Msa0269720	Msa0824850	0.828988	6.617564e-55	-8.615850e-47
Msa0272210	Msa0824850	0.824009	1.017806e-53	-8.615850e-47
Msa0274250	Msa0824850	0.847654	1.008734e-59	-8.615850e-47
Msa0274260	Msa0824850	0.838551	2.689635e-57	-8.615850e-47
Msa0275570	Msa0824850	0.822503	2.287726e-53	-8.615850e-47
Msa0276580	Msa0824850	0.831547	1.569329e-55	-8.615850e-47
Msa0278460	Msa0824850	0.860186	2.462350e-63	-8.615850e-47
Msa0278940	Msa0824850	0.853050	3.086623e-61	-8.615850e-47
Msa0278950	Msa0824850	0.857565	1.497124e-62	-8.615850e-47
Msa0278960	Msa0824850	0.819194	1.320231e-52	-8.615850e-47
Msa0279810	Msa0824850	0.811212	7.837302e-51	-8.615850e-47
Msa0280980	Msa0824850	0.831779	1.375875e-55	-8.615850e-47
Msa0281190	Msa0824850	0.817629	2.987099e-52	-8.615850e-47
Msa0297650	Msa0824850	0.800538	1.375150e-48	-8.615850e-47
Msa0303900	Msa0824850	0.816643	4.974497e-52	-8.615850e-47
Msa0307630	Msa0824850	0.807920	3.993680e-50	-8.615850e-47
Msa0311540	Msa0824850	0.826109	3.248258e-54	-8.615850e-47
Msa0314440	Msa0824850	0.843181	1.641328e-58	-8.615850e-47
Msa0315300	Msa0824850	0.801749	7.774832e-49	-8.615850e-47
Msa0316600	Msa0824850	0.838736	2.408271e-57	-8.615850e-47
Msa0318370	Msa0824850	0.831800	1.358942e-55	-8.615850e-47
Msa0319220	Msa0824850	0.807749	4.341215e-50	-8.615850e-47
Msa0319830	Msa0824850	0.803017	4.260869e-49	-8.615850e-47
Msa0320150	Msa0824850	0.818531	1.867739e-52	-8.615850e-47
Msa0322460	Msa0824850	0.803187	3.928636e-49	-8.615850e-47
Msa0328090	Msa0824850	0.856843	2.445360e-62	-8.615850e-47
Msa0333770	Msa0824850	0.833353	5.598785e-56	-8.615850e-47
Msa0335340	Msa0824850	0.810111	1.356108e-50	-8.615850e-47
Msa0336640	Msa0824850	0.811344	7.337718e-51	-8.615850e-47
Msa0342130	Msa0824850	0.812740	3.641530e-51	-8.615850e-47
Msa0346170	Msa0824850	0.822834	1.916337e-53	-8.615850e-47
Msa0348370	Msa0824850	0.804324	2.281871e-49	-8.615850e-47
Msa0349910	Msa0824850	0.851656	7.700546e-61	-8.615850e-47
Msa0354540	Msa0824850	0.812604	3.899756e-51	-8.615850e-47
Msa0354550	Msa0824850	0.816254	6.078914e-52	-8.615850e-47
Msa0356200	Msa0824850	0.803450	3.466263e-49	-8.615850e-47
Msa0356240	Msa0824850	0.806592	7.634514e-50	-8.615850e-47
Msa0356250	Msa0824850	0.809417	1.911938e-50	-8.615850e-47
Msa0356270	Msa0824850	0.817753	2.800779e-52	-8.615850e-47
Msa0356320	Msa0824850	0.832030	1.192487e-55	-8.615850e-47
Msa0361700	Msa0824850	0.830867	2.305833e-55	-8.615850e-47
Msa0487100	Msa0824850	0.814094	1.835273e-51	-8.615850e-47
Msa0487110	Msa0824850	0.805743	1.151831e-49	-8.615850e-47
Msa0489370	Msa0824850	0.818908	1.533385e-52	-8.615850e-47
Msa0490060	Msa0824850	0.825130	5.542141e-54	-8.615850e-47
Msa0491770	Msa0824850	0.846805	1.724406e-59	-8.615850e-47
Msa0491780	Msa0824850	0.814965	1.177294e-51	-8.615850e-47
Msa0491800	Msa0824850	0.830863	2.311204e-55	-8.615850e-47
Msa0491830	Msa0824850	0.826314	2.903708e-54	-8.615850e-47
Msa0491950	Msa0824850	0.830925	2.231997e-55	-8.615850e-47
Msa0493710	Msa0824850	0.852567	4.242469e-61	-8.615850e-47
Msa0496060	Msa0824850	0.807540	4.808638e-50	-8.615850e-47
Msa0496070	Msa0824850	0.807248	5.546303e-50	-8.615850e-47
Msa0497680	Msa0824850	0.802604	5.186000e-49	-8.615850e-47
Msa0502940	Msa0824850	0.830089	3.573699e-55	-8.615850e-47
Msa0515130	Msa0824850	0.834388	3.084768e-56	-8.615850e-47
Msa0515150	Msa0824850	0.835118	2.020788e-56	-8.615850e-47
Msa0522810	Msa0824850	-0.801820	7.518473e-49	-8.615850e-47
Msa0525400	Msa0824850	0.808253	3.390761e-50	-8.615850e-47
Msa0529420	Msa0824850	0.814427	1.549586e-51	-8.615850e-47
Msa0530250	Msa0824850	-0.801232	9.923028e-49	-8.615850e-47
Msa0531030	Msa0824850	0.802644	5.087675e-49	-8.615850e-47
Msa0531040	Msa0824850	0.807264	5.501940e-50	-8.615850e-47
Msa0531080	Msa0824850	0.803877	2.825773e-49	-8.615850e-47
Msa0531800	Msa0824850	0.803508	3.371416e-49	-8.615850e-47
Msa0532660	Msa0824850	0.810065	1.387443e-50	-8.615850e-47
Msa0532670	Msa0824850	0.804869	1.756211e-49	-8.615850e-47
Msa0532680	Msa0824850	0.808583	2.884376e-50	-8.615850e-47
Msa0533510	Msa0824850	0.831634	1.493223e-55	-8.615850e-47
Msa0533520	Msa0824850	0.816206	6.232676e-52	-8.615850e-47
Msa0535570	Msa0824850	0.874814	5.031193e-68	-8.615850e-47
Msa0538440	Msa0824850	0.864377	1.270273e-64	-8.615850e-47
Msa0538450	Msa0824850	0.848783	4.917280e-60	-8.615850e-47
Msa0538520	Msa0824850	0.851212	1.027833e-60	-8.615850e-47
Msa0538530	Msa0824850	0.864785	9.468459e-65	-8.615850e-47
Msa0539260	Msa0824850	0.810697	1.013533e-50	-8.615850e-47
Msa0540640	Msa0824850	0.811917	5.508870e-51	-8.615850e-47
Msa0543740	Msa0824850	0.844939	5.542251e-59	-8.615850e-47
Msa0546760	Msa0824850	0.818811	1.613079e-52	-8.615850e-47
Msa0549170	Msa0824850	0.848854	4.700699e-60	-8.615850e-47
Msa0549920	Msa0824850	0.803730	3.031787e-49	-8.615850e-47
Msa0549970	Msa0824850	0.804593	2.005262e-49	-8.615850e-47
Msa0554660	Msa0824850	0.833573	4.935738e-56	-8.615850e-47
Msa0555920	Msa0824850	0.807195	5.691105e-50	-8.615850e-47
Msa0561830	Msa0824850	0.808096	3.663627e-50	-8.615850e-47
Msa0579530	Msa0824850	0.822119	2.808806e-53	-8.615850e-47
Msa0587730	Msa0824850	0.832540	8.920346e-56	-8.615850e-47
Msa0587920	Msa0824850	0.812725	3.669604e-51	-8.615850e-47
Msa0589450	Msa0824850	0.804535	2.061757e-49	-8.615850e-47
Msa0589460	Msa0824850	0.819864	9.284365e-53	-8.615850e-47
Msa0589720	Msa0824850	0.847644	1.015007e-59	-8.615850e-47
Msa0589730	Msa0824850	0.823884	1.088984e-53	-8.615850e-47
Msa0589740	Msa0824850	0.872686	2.627353e-67	-8.615850e-47
Msa0589750	Msa0824850	0.800133	1.662872e-48	-8.615850e-47
Msa0591490	Msa0824850	0.870348	1.562141e-66	-8.615850e-47
Msa0594320	Msa0824850	0.828437	8.992631e-55	-8.615850e-47
Msa0594330	Msa0824850	0.883126	5.839895e-71	-8.615850e-47
Msa0599600	Msa0824850	0.817953	2.523944e-52	-8.615850e-47
Msa0601400	Msa0824850	0.819885	9.182680e-53	-8.615850e-47

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0824850	MtrunA17_Chr5g0446131	97.481	516	13	0	1	516	1	516	0.0	1041
Msa0824850	MtrunA17_Chr2g0313751	79.651	516	105	0	1	516	30	545	0.0	868
Msa0824850	MtrunA17_Chr2g0313761	76.550	516	118	1	1	516	1	513	0.0	788
Msa0824850	MtrunA17_Chr2g0307301	69.515	515	157	0	2	516	6	520	0.0	777
Msa0824850	MtrunA17_Chr2g0307291	70.312	512	152	0	5	516	9	520	0.0	773
Msa0824850	MtrunA17_Chr2g0313821	71.037	511	147	1	7	516	8	518	0.0	770
Msa0824850	MtrunA17_Chr2g0313801	70.392	510	150	1	7	515	8	517	0.0	764
Msa0824850	MtrunA17_Chr2g0313781	68.893	524	150	2	5	515	6	529	0.0	751
Msa0824850	MtrunA17_Chr2g0313791	69.141	512	152	2	5	515	6	512	0.0	749
Msa0824850	MtrunA17_Chr2g0313811	70.986	517	137	2	12	515	13	529	0.0	744
Msa0824850	MtrunA17_Chr2g0313831	68.639	507	158	1	10	515	11	517	0.0	738
Msa0824850	MtrunA17_Chr2g0288661	66.667	513	171	0	4	516	8	520	0.0	722
Msa0824850	MtrunA17_Chr2g0313771	58.904	511	202	5	10	514	15	523	0.0	627
Msa0824850	MtrunA17_Chr8g0354511	56.783	516	211	5	7	514	13	524	0.0	593
Msa0824850	MtrunA17_Chr8g0354571	55.642	514	220	4	7	514	13	524	0.0	591
Msa0824850	MtrunA17_Chr8g0354531	54.971	513	224	4	7	514	135	645	0.0	583
Msa0824850	MtrunA17_Chr4g0014051	52.539	512	238	5	6	514	19	528	0.0	572
Msa0824850	MtrunA17_Chr4g0063221	40.600	500	279	6	26	515	29	520	2.22e-130	389
Msa0824850	MtrunA17_Chr7g0262111	39.279	499	284	7	21	514	21	505	5.94e-122	367
Msa0824850	MtrunA17_Chr1g0193811	36.853	502	306	5	20	515	21	517	6.86e-117	354
Msa0824850	MtrunA17_Chr6g0457421	34.682	519	315	9	6	515	5	508	7.77e-105	323
Msa0824850	MtrunA17_Chr1g0154731	33.665	502	316	5	17	514	15	503	2.96e-103	318
Msa0824850	MtrunA17_Chr7g0215181	33.915	516	317	8	10	516	11	511	7.70e-102	315
Msa0824850	MtrunA17_Chr1g0203141	30.645	496	326	7	27	514	30	515	5.85e-93	292
Msa0824850	MtrunA17_Chr8g0354561	46.201	329	149	5	7	329	95	401	6.34e-90	281
Msa0824850	MtrunA17_Chr1g0203151	31.452	496	318	9	27	514	30	511	4.53e-89	282
Msa0824850	MtrunA17_Chr7g0235261	32.465	499	312	7	27	507	12	503	2.72e-87	278
Msa0824850	MtrunA17_Chr3g0128461	31.041	509	334	7	16	513	21	523	3.11e-86	275
Msa0824850	MtrunA17_Chr8g0354541	67.416	178	58	0	337	514	1	178	3.34e-86	263
Msa0824850	MtrunA17_Chr4g0004601	30.874	515	332	8	10	507	17	524	2.10e-84	271
Msa0824850	MtrunA17_Chr6g0479681	29.961	514	319	10	27	514	31	529	2.38e-83	268
Msa0824850	MtrunA17_Chr8g0364081	31.250	512	333	9	22	515	32	542	3.46e-82	265
Msa0824850	MtrunA17_Chr6g0472221	29.644	533	329	11	4	514	18	526	2.71e-81	262
Msa0824850	MtrunA17_Chr8g0336361	28.801	559	338	9	6	514	10	558	5.28e-78	254
Msa0824850	MtrunA17_Chr2g0308651	35.323	402	247	8	126	515	16	416	4.37e-73	238
Msa0824850	MtrunA17_Chr8g0362731	34.031	382	242	5	132	512	32	404	1.32e-71	233
Msa0824850	MtrunA17_Chr2g0307311	64.912	114	40	0	40	153	9	122	6.69e-46	157
Msa0824850	MtrunA17_Chr2g0307321	69.892	93	28	0	164	256	1	93	1.09e-40	142
Msa0824850	MtrunA17_Chr5g0396521	26.770	452	265	14	90	487	103	542	6.76e-39	149
Msa0824850	MtrunA17_Chr1g0179811	26.807	429	263	14	90	489	108	514	1.30e-38	148
Msa0824850	MtrunA17_Chr6g0472161	27.778	360	244	8	22	374	22	372	5.23e-36	137
Msa0824850	MtrunA17_Chr6g0472171	35.507	138	89	0	377	514	21	158	3.63e-35	129
Msa0824850	MtrunA17_Chr1g0182861	36.957	138	87	0	377	514	26	163	6.65e-35	128
Msa0824850	MtrunA17_Chr0c19g0493771	25.513	439	273	14	90	500	218	630	2.32e-34	137
Msa0824850	MtrunA17_Chr3g0108651	43.269	104	59	0	399	502	1	104	3.74e-25	100
Msa0824850	MtrunA17_Chr7g0248991	25.392	319	206	10	136	438	49	351	2.30e-22	99.0
Msa0824850	MtrunA17_Chr3g0116741	25.348	359	244	11	142	489	140	485	2.97e-22	100
Msa0824850	MtrunA17_Chr5g0403351	22.062	417	293	11	90	487	68	471	4.36e-22	99.4
Msa0824850	MtrunA17_Chr4g0058231	21.445	429	302	12	83	487	52	469	5.09e-22	99.4
Msa0824850	MtrunA17_Chr3g0101711	22.751	378	271	11	142	510	127	492	5.12e-22	99.4
Msa0824850	MtrunA17_Chr3g0119681	24.658	438	275	17	98	498	80	499	1.55e-21	97.8
Msa0824850	MtrunA17_Chr5g0445461	22.967	418	294	16	90	493	71	474	1.62e-21	97.8
Msa0824850	MtrunA17_Chr1g0184421	25.250	400	249	14	132	509	118	489	3.07e-21	97.1
Msa0824850	MtrunA17_Chr1g0182871	25.397	252	163	6	136	378	27	262	4.71e-21	92.8
Msa0824850	MtrunA17_Chr6g0449331	22.697	445	312	14	97	513	74	514	5.72e-21	96.3
Msa0824850	MtrunA17_Chr1g0164321	23.210	461	291	16	97	513	105	546	6.06e-21	96.3
Msa0824850	MtrunA17_Chr3g0101691	25.070	359	243	11	142	487	128	473	7.15e-21	95.9
Msa0824850	MtrunA17_Chr3g0101631	23.342	377	259	13	123	487	106	464	7.26e-21	95.5
Msa0824850	MtrunA17_Chr5g0403331	21.910	356	258	8	142	487	127	472	8.04e-21	95.5
Msa0824850	MtrunA17_Chr1g0162811	24.163	418	285	13	87	487	66	468	1.02e-20	95.1
Msa0824850	MtrunA17_Chr5g0446161	23.596	356	256	9	142	493	131	474	1.44e-20	94.7
Msa0824850	MtrunA17_Chr8g0351391	23.585	424	264	17	101	488	85	484	2.11e-20	94.4
Msa0824850	MtrunA17_Chr4g0038271	21.973	446	308	13	98	513	124	559	2.56e-20	94.4
Msa0824850	MtrunA17_Chr3g0101701	24.156	385	257	14	142	510	128	493	3.74e-20	93.6
Msa0824850	MtrunA17_Chr7g0260831	22.811	434	283	16	99	504	81	490	6.06e-20	92.8
Msa0824850	MtrunA17_Chr5g0405001	25.083	303	206	9	199	487	186	481	6.80e-20	92.8
Msa0824850	MtrunA17_Chr3g0101731	21.667	360	262	10	137	487	121	469	1.46e-19	91.7
Msa0824850	MtrunA17_Chr4g0047641	21.801	422	298	13	90	492	81	489	1.49e-19	91.7
Msa0824850	MtrunA17_Chr4g0052851	24.279	416	272	17	85	483	59	448	1.72e-19	91.3
Msa0824850	MtrunA17_Chr7g0218611	25.503	298	207	7	197	486	177	467	2.02e-19	91.3
Msa0824850	MtrunA17_Chr4g0058191	23.841	302	213	7	197	490	169	461	2.93e-19	90.5
Msa0824850	MtrunA17_Chr5g0445381	23.908	435	289	20	75	487	85	499	3.86e-19	90.5
Msa0824850	MtrunA17_Chr1g0204271	22.986	422	270	16	101	488	79	479	4.29e-19	90.1
Msa0824850	MtrunA17_Chr5g0445421	22.482	427	284	14	75	487	128	521	5.89e-19	90.1
Msa0824850	MtrunA17_Chr1g0163391	22.601	469	297	19	87	513	57	501	6.98e-19	89.7
Msa0824850	MtrunA17_Chr3g0101571	25.974	308	206	9	191	487	171	467	7.02e-19	89.7
Msa0824850	MtrunA17_Chr5g0445441	22.779	439	301	17	75	493	95	515	1.46e-18	89.0
Msa0824850	MtrunA17_Chr4g0004481	22.782	417	274	14	124	514	98	492	1.49e-18	88.6
Msa0824850	MtrunA17_Chr4g0020041	21.667	420	295	15	87	487	66	470	1.50e-18	88.6
Msa0824850	MtrunA17_Chr8g0351401	23.990	396	248	15	125	487	107	482	1.52e-18	88.6
Msa0824850	MtrunA17_Chr8g0351311	23.434	431	257	19	101	488	85	485	1.72e-18	88.6
Msa0824850	MtrunA17_Chr6g0484811	22.778	360	262	11	142	492	126	478	1.80e-18	88.2
Msa0824850	MtrunA17_Chr7g0227281	22.222	459	313	17	82	513	52	493	1.86e-18	88.2
Msa0824850	MtrunA17_Chr5g0403321	22.438	361	253	11	142	487	126	474	2.99e-18	87.8
Msa0824850	MtrunA17_Chr4g0058281	22.590	363	248	12	142	487	135	481	3.00e-18	87.8
Msa0824850	MtrunA17_Chr4g0035921	21.988	332	243	6	171	487	151	481	3.39e-18	87.4
Msa0824850	MtrunA17_Chr4g0047631	22.328	421	294	14	90	492	80	485	3.49e-18	87.4
Msa0824850	MtrunA17_Chr5g0419451	22.864	398	271	14	104	483	105	484	3.77e-18	87.4
Msa0824850	MtrunA17_Chr4g0017411	23.971	413	277	16	85	483	56	445	5.70e-18	86.7
Msa0824850	MtrunA17_Chr7g0225531	28.862	246	149	7	252	487	255	484	5.72e-18	86.7
Msa0824850	MtrunA17_Chr3g0101601	23.097	381	262	13	123	490	106	468	5.77e-18	86.7
Msa0824850	MtrunA17_Chr1g0174441	26.433	314	205	10	191	487	193	497	6.90e-18	86.7
Msa0824850	MtrunA17_Chr8g0390881	24.104	307	216	9	191	487	173	472	7.05e-18	86.7
Msa0824850	MtrunA17_Chr6g0463801	24.765	319	220	10	183	493	165	471	7.87e-18	86.3
Msa0824850	MtrunA17_Chr3g0101621	22.632	380	262	14	123	490	103	462	8.82e-18	86.3
Msa0824850	MtrunA17_Chr3g0101721	21.629	356	258	9	142	487	127	471	9.27e-18	86.3
Msa0824850	MtrunA17_Chr4g0047691	22.066	426	293	14	83	487	76	483	1.05e-17	85.9
Msa0824850	MtrunA17_Chr6g0465511	23.971	413	262	17	104	487	80	469	1.09e-17	85.9
Msa0824850	MtrunA17_Chr6g0466331	23.971	413	262	17	104	487	80	469	1.15e-17	85.9
Msa0824850	MtrunA17_Chr4g0011981	24.915	293	203	8	204	487	180	464	1.20e-17	85.9
Msa0824850	MtrunA17_Chr5g0446151	23.810	357	255	10	142	493	131	475	1.42e-17	85.5
Msa0824850	MtrunA17_Chr7g0246221	22.222	459	301	16	88	516	63	495	1.64e-17	85.5
Msa0824850	MtrunA17_Chr1g0184461	23.235	439	280	17	98	509	81	489	1.79e-17	85.1
Msa0824850	MtrunA17_Chr8g0377341	23.500	400	278	11	98	483	108	493	1.93e-17	85.1
Msa0824850	MtrunA17_Chr4g0058201	23.377	308	219	7	188	487	162	460	2.19e-17	85.1
Msa0824850	MtrunA17_Chr6g0458561	22.248	427	286	15	90	487	88	497	2.61e-17	84.7
Msa0824850	MtrunA17_Chr8g0361471	23.971	413	262	17	104	487	80	469	2.81e-17	84.7
Msa0824850	MtrunA17_Chr4g0024771	21.412	425	296	17	84	487	61	468	3.33e-17	84.3
Msa0824850	MtrunA17_Chr6g0449341	22.472	445	313	14	97	513	122	562	3.45e-17	84.7
Msa0824850	MtrunA17_Chr5g0443401	22.782	417	266	12	82	483	67	442	3.89e-17	84.0
Msa0824850	MtrunA17_Chr5g0430031	23.229	353	252	10	145	487	129	472	3.90e-17	84.3
Msa0824850	MtrunA17_Chr5g0443731	24.317	366	228	15	137	487	115	446	4.13e-17	84.0
Msa0824850	MtrunA17_Chr3g0101671	20.613	359	259	9	142	487	128	473	5.50e-17	83.6
Msa0824850	MtrunA17_Chr4g0076161	21.127	355	259	8	142	487	129	471	5.65e-17	83.6
Msa0824850	MtrunA17_Chr5g0431501	23.414	457	281	18	77	487	37	470	5.76e-17	83.6
Msa0824850	MtrunA17_Chr5g0431461	23.414	457	281	18	77	487	37	470	5.76e-17	83.6
Msa0824850	MtrunA17_Chr4g0039391	22.249	418	296	12	87	486	63	469	6.19e-17	83.6
Msa0824850	MtrunA17_Chr8g0380501	22.271	458	315	14	82	513	48	490	6.35e-17	83.6
Msa0824850	MtrunA17_Chr5g0431591	23.390	295	210	10	200	487	1	286	6.68e-17	81.6
Msa0824850	MtrunA17_Chr1g0151221	23.608	449	281	15	87	488	67	500	6.81e-17	83.6
Msa0824850	MtrunA17_Chr5g0431671	21.528	432	313	15	70	487	50	469	8.51e-17	83.2
Msa0824850	MtrunA17_Chr5g0445531	21.516	409	298	13	90	487	71	467	9.08e-17	83.2
Msa0824850	MtrunA17_Chr5g0445451	22.573	412	291	16	90	487	71	468	9.11e-17	83.2
Msa0824850	MtrunA17_Chr3g0135841	24.236	458	272	18	87	488	70	508	1.01e-16	83.2
Msa0824850	MtrunA17_Chr7g0218601	25.000	304	201	9	197	487	178	467	1.33e-16	82.4
Msa0824850	MtrunA17_Chr6g0449381	20.674	445	311	14	97	513	74	504	1.41e-16	82.4
Msa0824850	MtrunA17_Chr1g0210091	23.697	422	279	15	69	464	79	483	1.78e-16	82.4
Msa0824850	MtrunA17_Chr6g0463791	23.099	355	250	9	142	487	127	467	1.93e-16	82.0
Msa0824850	MtrunA17_Chr7g0265611	24.399	291	206	9	204	488	204	486	1.94e-16	82.0
Msa0824850	MtrunA17_Chr1g0163351	22.294	462	320	16	82	513	52	504	2.38e-16	81.6
Msa0824850	MtrunA17_Chr5g0431641	23.810	294	209	9	200	487	184	468	2.43e-16	81.6
Msa0824850	MtrunA17_Chr3g0101581	25.868	317	210	12	184	487	166	470	2.50e-16	81.6
Msa0824850	MtrunA17_Chr5g0430071	23.129	294	216	6	200	487	36	325	3.11e-16	80.5
Msa0824850	MtrunA17_Chr4g0047661	21.583	417	298	15	90	487	79	485	3.35e-16	81.3
Msa0824850	MtrunA17_Chr4g0056951	22.300	426	266	15	75	464	60	456	3.48e-16	81.3
Msa0824850	MtrunA17_Chr4g0058211	27.473	182	129	3	311	490	9	189	3.71e-16	77.8
Msa0824850	MtrunA17_Chr5g0395331	25.581	301	198	12	199	487	186	472	3.81e-16	81.3
Msa0824850	MtrunA17_Chr5g0446101	23.232	297	215	6	200	493	1	287	4.21e-16	79.3
Msa0824850	MtrunA17_Chr8g0339331	22.118	425	292	14	90	487	72	484	4.29e-16	80.9
Msa0824850	MtrunA17_Chr1g0160861	25.781	256	173	8	237	487	63	306	4.62e-16	79.7
Msa0824850	MtrunA17_Chr7g0227291	22.658	459	311	16	82	513	52	493	4.72e-16	80.9
Msa0824850	MtrunA17_Chr3g0101661	22.527	364	245	13	142	487	128	472	4.91e-16	80.9
Msa0824850	MtrunA17_Chr1g0174461	25.559	313	207	10	191	487	173	475	4.91e-16	80.9
Msa0824850	MtrunA17_Chr8g0372251	23.588	301	214	9	199	487	177	473	6.32e-16	80.5
Msa0824850	MtrunA17_Chr5g0395321	22.249	418	286	16	87	487	70	465	6.70e-16	80.5
Msa0824850	MtrunA17_Chr1g0198191	23.709	426	298	16	82	489	71	487	7.16e-16	80.5
Msa0824850	MtrunA17_Chr5g0431511	23.184	358	251	10	143	487	124	470	8.29e-16	80.1
Msa0824850	MtrunA17_Chr1g0205361	25.417	240	163	7	252	487	238	465	9.53e-16	79.7
Msa0824850	MtrunA17_Chr5g0430091	24.916	297	207	8	200	487	183	472	9.53e-16	79.7
Msa0824850	MtrunA17_Chr4g0052861	21.154	416	285	13	90	483	63	457	1.16e-15	79.7
Msa0824850	MtrunA17_Chr3g0116681	24.415	299	208	10	201	490	185	474	1.52e-15	79.3
Msa0824850	MtrunA17_Chr8g0356001	22.129	357	251	9	144	487	132	474	1.63e-15	79.3
Msa0824850	MtrunA17_Chr8g0390871	26.857	175	126	2	315	487	20	194	1.86e-15	75.9
Msa0824850	MtrunA17_Chr8g0380471	26.984	252	162	6	240	487	217	450	2.97e-15	78.2
Msa0824850	MtrunA17_Chr5g0403451	24.715	263	153	8	283	513	29	278	3.36e-15	76.3
Msa0824850	MtrunA17_Chr2g0293421	23.367	398	258	14	98	483	92	454	3.78e-15	77.8
Msa0824850	MtrunA17_Chr5g0430081	22.559	297	220	6	197	487	178	470	4.10e-15	77.8
Msa0824850	MtrunA17_Chr3g0101811	22.546	377	252	14	137	487	122	484	4.70e-15	77.8
Msa0824850	MtrunA17_Chr2g0280261	26.861	309	210	9	191	493	170	468	5.20e-15	77.4
Msa0824850	MtrunA17_Chr1g0205371	23.383	402	263	11	87	464	63	443	6.43e-15	77.4
Msa0824850	MtrunA17_Chr8g0351441	23.636	385	251	15	132	488	113	482	7.75e-15	77.0
Msa0824850	MtrunA17_Chr3g0101801	21.667	420	296	14	87	487	71	476	1.15e-14	76.6
Msa0824850	MtrunA17_Chr4g0011901	21.986	423	290	12	88	487	59	464	1.72e-14	75.9
Msa0824850	MtrunA17_Chr1g0197891	25.203	246	171	6	245	487	228	463	1.76e-14	75.9
Msa0824850	MtrunA17_Chr1g0197871	24.901	253	176	8	239	487	221	463	1.77e-14	75.9
Msa0824850	MtrunA17_Chr1g0163451	26.000	200	137	4	323	513	326	523	1.82e-14	75.9
Msa0824850	MtrunA17_Chr6g0463621	25.389	193	134	5	323	509	2	190	1.83e-14	72.4
Msa0824850	MtrunA17_Chr5g0400421	23.940	401	254	15	98	483	92	456	1.86e-14	75.9
Msa0824850	MtrunA17_Chr8g0362701	24.919	309	207	10	191	483	172	471	2.06e-14	75.9
Msa0824850	MtrunA17_Chr8g0334891	22.159	352	232	10	150	487	133	456	2.15e-14	75.5
Msa0824850	MtrunA17_Chr1g0197881	25.203	246	171	6	245	487	227	462	2.71e-14	75.1
Msa0824850	MtrunA17_Chr8g0381541	25.847	236	153	7	259	486	241	462	3.24e-14	75.1
Msa0824850	MtrunA17_Chr8g0362481	24.194	310	208	10	191	483	103	402	3.31e-14	74.7
Msa0824850	MtrunA17_Chr1g0197851	25.610	246	170	7	245	487	228	463	3.41e-14	75.1
Msa0824850	MtrunA17_Chr5g0430101	21.452	303	226	7	191	487	173	469	5.07e-14	74.3
Msa0824850	MtrunA17_Chr1g0174451	23.718	312	214	8	191	487	174	476	5.61e-14	74.3
Msa0824850	MtrunA17_Chr8g0387001	22.323	439	288	14	104	509	82	500	5.71e-14	74.3
Msa0824850	MtrunA17_Chr1g0164211	25.203	246	167	7	247	487	229	462	6.30e-14	74.3
Msa0824850	MtrunA17_Chr2g0280011	30.208	192	121	7	318	499	5	193	6.58e-14	70.9
Msa0824850	MtrunA17_Chr8g0381571	26.180	233	146	8	259	483	241	455	7.02e-14	73.9
Msa0824850	MtrunA17_Chr5g0430131	23.469	294	214	7	200	487	183	471	7.06e-14	73.9
Msa0824850	MtrunA17_Chr1g0200951	21.667	300	214	8	196	485	209	497	7.79e-14	73.9
Msa0824850	MtrunA17_Chr1g0156101	22.506	391	261	15	145	508	125	500	8.74e-14	73.9
Msa0824850	MtrunA17_Chr4g0057001	21.498	414	283	14	75	464	66	461	9.36e-14	73.6
Msa0824850	MtrunA17_Chr1g0160851	27.374	179	126	4	312	487	288	465	1.09e-13	73.6
Msa0824850	MtrunA17_Chr3g0101651	21.260	381	273	11	142	510	128	493	1.10e-13	73.6
Msa0824850	MtrunA17_Chr8g0334941	22.561	328	212	10	174	487	2	301	1.40e-13	72.0
Msa0824850	MtrunA17_Chr1g0162801	24.769	432	268	17	87	487	66	471	1.73e-13	72.8
Msa0824850	MtrunA17_Chr7g0246151	22.014	427	287	15	89	488	64	471	2.07e-13	72.4
Msa0824850	MtrunA17_Chr3g0101761	23.292	322	222	10	178	487	161	469	2.50e-13	72.4
Msa0824850	MtrunA17_Chr3g0101611	22.482	427	278	17	90	487	69	471	2.65e-13	72.4
Msa0824850	MtrunA17_Chr1g0163491	20.536	448	312	14	97	513	86	520	2.88e-13	72.0
Msa0824850	MtrunA17_Chr7g0255531	23.077	312	211	9	200	498	178	473	3.27e-13	72.0
Msa0824850	MtrunA17_Chr1g0200961	24.161	447	305	17	87	514	56	487	3.61e-13	71.6
Msa0824850	MtrunA17_Chr4g0011961	22.408	299	216	11	197	487	173	463	4.24e-13	71.6
Msa0824850	MtrunA17_Chr6g0484841	21.378	421	306	11	83	487	61	472	4.42e-13	71.6
Msa0824850	MtrunA17_Chr1g0163461	25.500	200	138	4	323	513	321	518	6.22e-13	71.2
Msa0824850	MtrunA17_Chr1g0167321	22.851	442	305	14	87	509	63	487	6.90e-13	70.9
Msa0824850	MtrunA17_Chr6g0466941	21.410	383	265	14	127	483	111	483	7.09e-13	70.9
Msa0824850	MtrunA17_Chr3g0101831	21.488	363	264	11	135	487	119	470	8.08e-13	70.9
Msa0824850	MtrunA17_Chr7g0214931	24.571	350	219	16	97	416	96	430	8.16e-13	70.5
Msa0824850	MtrunA17_Chr5g0400411	23.291	395	257	12	102	483	94	455	1.53e-12	69.7
Msa0824850	MtrunA17_Chr1g0163421	24.000	200	141	4	323	513	342	539	1.73e-12	69.7
Msa0824850	MtrunA17_Chr3g0101821	22.006	309	219	8	191	487	171	469	1.80e-12	69.7
Msa0824850	MtrunA17_Chr2g0334021	26.667	270	175	8	223	487	219	470	1.84e-12	69.7
Msa0824850	MtrunA17_Chr8g0387101	28.495	186	122	5	312	487	292	476	1.94e-12	69.3
Msa0824850	MtrunA17_Chr1g0153371	22.595	447	294	12	65	487	25	443	2.09e-12	69.3
Msa0824850	MtrunA17_Chr2g0280081	21.609	435	311	13	81	494	55	480	2.19e-12	70.1
Msa0824850	MtrunA17_Chr2g0280081	27.027	185	125	4	312	487	792	975	2.54e-12	69.7
Msa0824850	MtrunA17_Chr8g0364651	25.843	267	162	9	245	488	216	469	2.26e-12	69.3
Msa0824850	MtrunA17_Chr8g0344181	23.294	425	286	15	87	487	66	474	2.42e-12	69.3
Msa0824850	MtrunA17_Chr8g0339311	27.322	183	126	5	307	483	307	488	2.67e-12	68.9
Msa0824850	MtrunA17_Chr4g0011921	22.115	312	224	9	186	487	162	464	2.78e-12	68.9
Msa0824850	MtrunA17_Chr2g0314731	26.316	228	152	9	265	487	249	465	3.40e-12	68.6
Msa0824850	MtrunA17_Chr3g0101751	22.977	309	216	8	191	487	178	476	3.40e-12	68.9
Msa0824850	MtrunA17_Chr6g0451691	27.660	235	154	8	256	483	268	493	3.64e-12	68.6
Msa0824850	MtrunA17_Chr3g0101741	20.345	290	213	6	204	487	114	391	4.41e-12	68.2
Msa0824850	MtrunA17_Chr2g0286091	24.803	254	156	7	231	469	221	454	4.89e-12	68.2
Msa0824850	MtrunA17_Chr2g0280071	28.804	184	121	5	313	487	325	507	9.26e-12	67.8
Msa0824850	MtrunA17_Chr5g0419691	22.259	301	215	8	197	487	173	464	1.02e-11	67.0
Msa0824850	MtrunA17_Chr3g0101591	27.711	166	117	3	324	487	42	206	1.02e-11	65.1
Msa0824850	MtrunA17_Chr8g0357421	20.807	322	239	7	174	487	156	469	1.12e-11	67.0
Msa0824850	MtrunA17_Chr6g0451751	21.203	316	223	9	185	483	183	489	1.98e-11	66.2
Msa0824850	MtrunA17_Chr6g0466901	22.165	388	263	16	127	488	111	485	2.34e-11	66.2
Msa0824850	MtrunA17_Chr2g0280061	29.167	192	123	7	318	499	5	193	2.40e-11	63.5
Msa0824850	MtrunA17_Chr4g0008101	22.844	429	285	16	90	483	72	489	2.67e-11	65.9
Msa0824850	MtrunA17_Chr2g0280121	21.294	371	271	9	138	494	123	486	3.20e-11	65.9
Msa0824850	MtrunA17_Chr4g0011871	21.598	463	305	17	65	487	21	465	3.21e-11	65.5
Msa0824850	MtrunA17_Chr8g0344151	23.948	309	204	11	197	487	177	472	3.29e-11	65.5
Msa0824850	MtrunA17_Chr7g0254641	20.984	305	216	10	196	484	184	479	4.51e-11	65.1
Msa0824850	MtrunA17_Chr1g0163401	20.000	455	313	16	97	513	70	511	5.77e-11	64.7
Msa0824850	MtrunA17_Chr1g0183611	25.134	187	129	4	324	501	228	412	6.91e-11	64.3
Msa0824850	MtrunA17_Chr5g0429651	22.556	399	260	15	123	493	108	485	8.10e-11	64.3
Msa0824850	MtrunA17_Chr3g0094231	21.000	300	218	11	196	487	182	470	8.18e-11	64.3
Msa0824850	MtrunA17_Chr6g0469321	37.662	77	44	2	309	384	14	87	8.90e-11	60.8
Msa0824850	MtrunA17_Chr1g0174431	24.157	178	120	4	321	487	1	174	9.62e-11	61.6

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0824850	AT3G14690.1	54.054	518	228	5	1	514	1	512	0.0	601
Msa0824850	AT3G14690.2	54.054	518	228	5	1	514	36	547	0.0	601
Msa0824850	AT3G14610.1	56.600	500	208	5	18	514	19	512	0.0	592
Msa0824850	AT3G14660.1	55.645	496	212	4	21	514	23	512	0.0	584
Msa0824850	AT3G14680.1	55.444	496	213	4	21	514	23	512	0.0	582
Msa0824850	AT3G14650.1	55.242	496	214	4	21	514	23	512	0.0	582
Msa0824850	AT3G14640.1	55.221	498	213	5	21	514	23	514	0.0	579
Msa0824850	AT3G14640.2	55.221	498	213	5	21	514	45	536	0.0	578
Msa0824850	AT3G14620.1	55.689	501	209	5	18	514	24	515	0.0	570
Msa0824850	AT3G14630.2	53.620	511	225	6	10	514	59	563	0.0	566
Msa0824850	AT3G14630.1	53.620	511	225	6	10	514	4	508	0.0	564
Msa0824850	AT3G14660.2	56.818	352	145	3	164	514	21	366	3.74e-147	426
Msa0824850	AT2G26710.1	40.762	525	286	7	2	514	4	515	1.26e-144	426
Msa0824850	AT3G14660.3	51.541	357	165	4	21	375	23	373	1.39e-129	383
Msa0824850	AT1G75130.1	37.223	497	292	7	26	516	23	505	1.02e-113	346
Msa0824850	AT2G46960.2	37.255	510	293	11	19	515	23	518	2.64e-112	343
Msa0824850	AT4G27710.1	36.329	523	318	6	1	514	1	517	4.16e-112	342
Msa0824850	AT2G46950.1	36.779	503	301	8	19	515	80	571	3.68e-110	339
Msa0824850	AT5G38450.1	34.757	515	324	7	6	514	8	516	4.37e-94	296
Msa0824850	AT2G46960.1	38.293	410	231	8	117	515	4	402	8.17e-92	286
Msa0824850	AT5G52400.1	30.989	526	333	11	3	514	10	519	3.84e-91	288
Msa0824850	AT5G24910.1	32.836	536	316	11	6	513	13	532	1.44e-89	285
Msa0824850	AT1G67110.1	33.204	515	325	7	7	515	10	511	1.82e-88	281
Msa0824850	AT5G24900.1	31.643	493	315	7	32	509	37	522	1.54e-86	276
Msa0824850	AT5G24900.2	34.896	384	240	4	132	509	26	405	1.92e-77	249
Msa0824850	AT1G17060.1	40.357	280	157	3	11	284	15	290	5.85e-72	232
Msa0824850	AT2G46950.2	34.807	362	219	8	19	374	80	430	3.53e-62	210
Msa0824850	AT4G27710.2	33.613	357	220	6	6	355	11	357	2.63e-59	201
Msa0824850	AT5G38450.2	30.548	383	257	5	6	382	8	387	1.25e-45	164
Msa0824850	AT5G24910.2	27.384	409	254	10	6	387	13	405	1.43e-40	151
Msa0824850	AT1G67110.2	30.481	374	244	6	7	374	10	373	1.50e-40	150
Msa0824850	AT3G53130.1	26.526	426	268	12	90	489	108	514	8.17e-38	146
Msa0824850	AT1G31800.1	26.047	430	265	13	90	490	139	544	1.17e-35	140
Msa0824850	AT4G15110.1	25.446	448	277	15	90	487	110	550	2.26e-33	134
Msa0824850	AT3G26125.1	24.619	459	299	14	96	515	85	535	4.49e-29	121
Msa0824850	AT1G13140.1	23.146	445	305	13	96	511	85	521	5.62e-26	111
Msa0824850	AT3G48310.1	22.276	413	296	9	90	491	63	461	2.03e-25	109
Msa0824850	AT1G13150.1	24.336	452	301	16	96	515	78	520	4.93e-25	108
Msa0824850	AT2G30770.1	27.759	299	194	8	199	487	178	464	1.75e-24	107
Msa0824850	AT3G48300.1	23.040	421	294	13	78	486	51	453	3.02e-24	106
Msa0824850	AT3G48300.2	23.040	421	294	13	78	486	53	455	3.06e-24	106
Msa0824850	AT1G24540.1	23.251	443	308	14	96	512	82	518	4.48e-24	105
Msa0824850	AT1G57750.1	26.067	445	279	15	97	513	73	495	5.27e-24	105
Msa0824850	AT1G13140.2	22.603	438	290	12	96	511	85	495	2.86e-23	103
Msa0824850	AT3G48270.1	23.077	416	283	12	90	488	62	457	5.66e-23	102
Msa0824850	AT3G48280.1	26.646	319	214	9	197	508	171	476	1.15e-22	101
Msa0824850	AT1G13080.1	23.546	361	250	12	142	487	120	469	2.68e-22	100
Msa0824850	AT5G23190.1	22.991	448	299	14	97	511	103	537	1.12e-21	99.0
Msa0824850	AT3G48290.1	24.029	412	282	12	90	487	64	458	1.86e-21	97.8
Msa0824850	AT1G13080.2	23.794	311	214	10	191	487	50	351	2.12e-21	96.7
Msa0824850	AT1G11610.1	24.823	423	277	16	90	490	64	467	3.13e-21	97.1
Msa0824850	AT1G11610.2	24.824	427	272	16	90	490	64	467	3.74e-21	97.1
Msa0824850	AT3G26160.1	22.248	427	295	13	91	493	62	475	5.78e-20	93.2
Msa0824850	AT2G30750.1	28.470	281	179	9	199	469	178	446	8.87e-20	92.8
Msa0824850	AT3G26230.1	23.248	314	215	10	191	487	163	467	1.02e-19	92.4
Msa0824850	AT2G45510.1	22.249	418	281	12	101	488	78	481	1.38e-19	92.4
Msa0824850	AT2G21910.1	24.215	446	297	16	97	513	72	505	1.42e-19	92.0
Msa0824850	AT3G26150.1	22.558	430	290	15	91	493	62	475	1.73e-19	92.0
Msa0824850	AT5G52320.1	23.516	455	285	17	97	514	74	502	2.08e-19	91.7
Msa0824850	AT2G44890.1	21.687	415	287	11	101	488	78	481	2.17e-19	91.7
Msa0824850	AT5G63450.1	26.027	438	273	19	98	509	79	491	3.33e-19	90.9
Msa0824850	AT5G63450.2	26.027	438	273	19	98	509	137	549	4.09e-19	90.9
Msa0824850	AT5G52320.2	23.714	447	278	17	97	506	74	494	7.35e-19	90.1
Msa0824850	AT5G24950.1	22.760	413	293	13	90	487	63	464	1.03e-18	89.4
Msa0824850	AT3G48320.1	23.295	352	249	7	142	487	121	457	2.19e-18	88.6
Msa0824850	AT3G48290.2	23.434	431	287	14	90	487	64	484	3.04e-18	88.2
Msa0824850	AT2G26170.1	23.414	457	289	17	87	506	73	505	3.60e-18	87.8
Msa0824850	AT5G08250.1	21.918	438	293	15	97	501	42	463	4.66e-18	87.4
Msa0824850	AT2G44890.2	21.308	413	273	11	101	488	78	463	5.20e-18	87.4
Msa0824850	AT1G69500.1	23.864	440	265	17	106	489	73	498	5.76e-18	87.4
Msa0824850	AT5G04330.1	24.251	334	229	9	171	487	146	472	7.30e-18	87.0
Msa0824850	AT5G08250.2	21.918	438	293	15	97	501	104	525	8.72e-18	86.7
Msa0824850	AT3G10560.1	24.356	427	278	18	82	483	72	478	9.27e-18	86.7
Msa0824850	AT5G09970.1	22.683	410	279	14	98	485	111	504	9.58e-18	86.7
Msa0824850	AT3G26830.1	20.471	425	301	16	87	488	56	466	1.33e-17	85.9
Msa0824850	AT3G26210.1	21.853	421	296	15	88	487	60	468	1.34e-17	85.9
Msa0824850	AT2G23180.1	22.707	458	291	17	98	513	75	511	3.43e-17	84.7
Msa0824850	AT2G26170.2	23.371	445	280	17	99	506	2	422	3.65e-17	84.3
Msa0824850	AT1G13090.2	22.928	362	250	12	142	487	117	465	3.75e-17	84.7
Msa0824850	AT4G36220.1	23.373	338	230	10	171	487	154	483	5.00e-17	84.3
Msa0824850	AT3G48520.1	23.982	442	277	19	98	509	76	488	7.02e-17	84.0
Msa0824850	AT1G13100.1	22.010	418	298	14	90	487	56	465	7.59e-17	83.6
Msa0824850	AT5G02900.1	30.049	203	129	6	321	513	279	478	8.13e-17	83.6
Msa0824850	AT4G31500.1	23.121	346	239	10	156	487	134	466	9.45e-17	83.6
Msa0824850	AT4G37400.1	23.389	419	282	14	88	486	60	459	1.76e-16	82.4
Msa0824850	AT4G13310.1	22.803	421	284	14	90	487	63	465	2.04e-16	82.4
Msa0824850	AT4G32170.1	29.208	202	129	5	321	513	306	502	2.15e-16	82.4
Msa0824850	AT5G24960.1	24.172	302	204	9	203	492	182	470	4.11e-16	81.3
Msa0824850	AT4G13290.1	22.434	419	280	12	90	487	64	458	4.28e-16	81.3
Msa0824850	AT3G26310.1	25.168	298	204	9	200	487	176	464	5.38e-16	80.9
Msa0824850	AT4G39510.1	28.141	199	135	4	321	513	308	504	5.66e-16	80.9
Msa0824850	AT5G44620.1	22.304	408	289	15	75	464	62	459	6.85e-16	80.9
Msa0824850	AT3G10570.1	26.316	228	156	8	268	489	263	484	7.30e-16	80.9
Msa0824850	AT2G27690.1	23.000	400	273	11	104	483	76	460	7.62e-16	80.5
Msa0824850	AT3G26270.1	21.028	428	292	15	88	487	61	470	8.64e-16	80.5
Msa0824850	AT2G42850.1	23.210	461	297	15	52	503	56	468	9.04e-16	80.1
Msa0824850	AT3G26300.1	22.512	422	289	14	88	487	60	465	9.08e-16	80.5
Msa0824850	AT3G26180.1	19.725	436	311	13	83	493	54	475	9.90e-16	80.1
Msa0824850	AT3G25180.1	22.673	419	288	13	90	486	72	476	1.12e-15	80.1
Msa0824850	AT3G26170.1	19.266	436	313	13	83	493	54	475	1.19e-15	80.1
Msa0824850	AT5G04630.1	23.462	439	299	21	82	497	64	488	1.23e-15	80.1
Msa0824850	AT4G39500.1	28.788	198	134	5	321	513	270	465	1.77e-15	79.3
Msa0824850	AT4G39500.2	28.788	198	134	5	321	513	320	515	3.32e-15	78.6
Msa0824850	AT4G39490.1	22.247	454	303	17	98	513	74	515	3.72e-15	78.6
Msa0824850	AT5G04660.1	22.494	449	316	16	82	512	67	501	6.00e-15	77.8
Msa0824850	AT1G65340.1	26.500	200	135	5	321	514	310	503	6.28e-15	77.8
Msa0824850	AT2G24180.1	21.752	331	239	8	191	510	173	494	6.74e-15	77.8
Msa0824850	AT1G13110.1	20.670	358	259	11	142	484	121	468	8.00e-15	77.4
Msa0824850	AT5G25140.1	22.169	415	293	13	90	487	60	461	8.62e-15	77.4
Msa0824850	AT1G66540.1	23.739	337	220	12	167	486	29	345	1.12e-14	76.3
Msa0824850	AT1G34540.1	22.464	414	281	15	99	487	72	470	1.14e-14	77.0
Msa0824850	AT5G10610.1	22.566	452	294	20	83	509	57	477	1.57e-14	76.6
Msa0824850	AT3G20950.1	25.806	310	199	10	191	483	184	479	2.20e-14	76.3
Msa0824850	AT1G01280.1	21.002	419	297	13	90	483	63	472	2.83e-14	75.9
Msa0824850	AT3G26190.1	20.759	448	315	14	90	514	59	489	2.90e-14	75.5
Msa0824850	AT3G61040.1	26.190	210	143	5	280	486	263	463	3.64e-14	75.5
Msa0824850	AT1G01600.1	28.652	178	111	4	321	482	305	482	3.89e-14	75.5
Msa0824850	AT5G36220.1	21.644	365	247	12	137	486	124	464	6.37e-14	74.7
Msa0824850	AT1G66540.2	23.000	300	203	9	197	486	5	286	9.69e-14	72.8
Msa0824850	AT4G20240.1	23.280	378	238	12	90	440	64	416	1.28e-13	73.6
Msa0824850	AT4G37410.1	21.531	418	283	15	89	483	61	456	1.47e-13	73.6
Msa0824850	AT1G47620.1	26.000	200	139	4	321	513	317	514	1.90e-13	73.2
Msa0824850	AT4G19230.1	21.429	462	290	16	81	513	44	461	2.13e-13	72.8
Msa0824850	AT4G15360.1	22.222	306	222	7	191	487	178	476	4.11e-13	72.0
Msa0824850	AT1G63710.1	25.854	205	140	2	321	513	302	506	4.22e-13	72.0
Msa0824850	AT4G37370.1	22.888	367	240	14	137	486	117	457	4.71e-13	72.0
Msa0824850	AT1G55940.1	24.590	244	165	6	245	482	228	458	5.36e-13	71.6
Msa0824850	AT4G19230.2	22.222	414	267	15	82	484	60	429	5.68e-13	71.6
Msa0824850	AT1G55940.2	24.590	244	165	6	245	482	228	458	6.18e-13	71.6
Msa0824850	AT1G64940.1	26.374	182	129	4	309	486	298	478	7.76e-13	71.2
Msa0824850	AT5G36220.2	21.498	307	210	9	191	486	32	318	9.18e-13	70.1
Msa0824850	AT5G25120.1	23.684	304	205	7	197	487	172	461	1.08e-12	70.9
Msa0824850	AT5G06900.1	21.226	424	296	14	85	487	59	465	1.27e-12	70.5
Msa0824850	AT3G20935.1	23.569	297	190	8	216	483	13	301	1.51e-12	69.3
Msa0824850	AT4G37320.1	24.176	364	239	14	137	486	118	458	3.56e-12	68.9
Msa0824850	AT2G25160.1	24.092	303	203	9	178	462	165	458	4.61e-12	68.9
Msa0824850	AT3G26220.1	22.222	315	219	8	191	488	166	471	4.69e-12	68.6
Msa0824850	AT1G64930.1	24.457	184	132	4	309	486	296	478	5.37e-12	68.6
Msa0824850	AT2G45560.1	22.868	258	178	7	239	487	230	475	6.65e-12	68.2
Msa0824850	AT4G22690.1	23.881	402	266	16	90	468	116	500	8.51e-12	68.2
Msa0824850	AT2G45580.2	26.347	167	121	2	322	487	157	322	8.64e-12	67.0
Msa0824850	AT3G26200.1	20.950	358	263	11	142	487	117	466	9.38e-12	67.8
Msa0824850	AT1G28430.1	22.000	300	213	9	200	487	187	477	9.62e-12	67.8
Msa0824850	AT1G12740.4	21.780	427	289	13	76	486	53	450	1.02e-11	67.4
Msa0824850	AT4G37310.1	21.247	433	301	15	78	486	54	470	1.17e-11	67.4
Msa0824850	AT3G20140.1	21.753	308	218	9	191	487	180	475	1.18e-11	67.4
Msa0824850	AT2G45580.1	26.347	167	121	2	322	487	311	476	1.27e-11	67.4
Msa0824850	AT4G15396.1	24.017	229	145	9	270	484	227	440	1.50e-11	67.0
Msa0824850	AT4G15310.1	26.601	203	133	6	287	484	251	442	1.52e-11	67.0
Msa0824850	AT4G15396.3	24.017	229	145	9	270	484	227	440	1.72e-11	66.6
Msa0824850	AT5G57220.1	21.412	425	274	17	90	486	61	453	2.53e-11	66.2
Msa0824850	AT2G28860.1	22.802	364	231	14	142	486	127	459	3.22e-11	66.2
Msa0824850	AT5G42590.1	21.934	424	283	13	90	487	63	464	3.36e-11	65.9
Msa0824850	AT4G22710.1	23.737	396	262	16	96	468	91	469	3.62e-11	65.9
Msa0824850	AT4G15393.2	25.561	223	143	7	270	482	227	436	4.35e-11	65.5
Msa0824850	AT5G67310.1	20.000	415	287	15	94	486	78	469	4.96e-11	65.5
Msa0824850	AT3G61880.1	23.320	253	151	8	250	490	280	501	7.45e-11	65.1
Msa0824850	AT3G61880.2	23.320	253	151	8	250	490	280	501	8.69e-11	64.7
Msa0824850	AT4G12310.1	22.484	467	314	20	75	516	60	503	9.06e-11	64.7
Msa0824850	AT3G20940.1	23.473	311	206	9	191	483	180	476	9.11e-11	64.7

Find 115 sgRNAs with CRISPR-Local

Find 258 sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
ATGGCCTTCCCTTCAGAATT+TGG	0.171134	5_3:+64493202	Msa0824850:CDS
TCCATTTCTCTGTTTGTAAT+TGG	0.176071	5_3:-64490795	None:intergenic
AATAGGAGGATTAATGAAAT+TGG	0.205642	5_3:+64493505	Msa0824850:CDS
GCAATGATTTAATTAGAAAA+TGG	0.211121	5_3:+64493138	Msa0824850:CDS
AACAGCTTCTCTAGCTTCTT+TGG	0.214282	5_3:-64490900	None:intergenic
ATTCCTCCAGAAAATCTTTC+AGG	0.221298	5_3:-64494777	None:intergenic
TGCACCATGATTGTGAATTA+TGG	0.225322	5_3:+64494730	Msa0824850:CDS
CTACTTCAACTTTACTTGTT+TGG	0.238479	5_3:+64493737	Msa0824850:CDS
GTTTCGCGAAAGCTCAATTA+TGG	0.257252	5_3:-64494634	None:intergenic
TCATATTATTCTGCGTAAAT+TGG	0.261176	5_3:+64494995	Msa0824850:CDS
TCATGGTGCAACAATATAAT+TGG	0.263625	5_3:-64494717	None:intergenic
TTATTTAGCCCATCAAAATT+TGG	0.263674	5_3:-64493841	None:intergenic
TGCAAGTTGTTCTACTTTGC+AGG	0.275508	5_3:+64493706	Msa0824850:CDS
TTGTGACGCTTGGTTTGATA+TGG	0.276438	5_3:+64490844	Msa0824850:CDS
GAAAATAAGAATGACTTATT+AGG	0.284202	5_3:+64493595	Msa0824850:CDS
AACTCTACCGTTCGTTGCTT+TGG	0.302769	5_3:-64494802	None:intergenic
CAAAAGGGTGAAAATATTAA+AGG	0.308079	5_3:+64493564	Msa0824850:CDS
GAGGAAGTATTACAAATCTT+TGG	0.316129	5_3:+64493808	Msa0824850:CDS
TCTCCATACAAAATCCTATA+TGG	0.323570	5_3:-64490948	None:intergenic
GTTATTTCTCGAACAACATT+TGG	0.349051	5_3:+64493233	Msa0824850:CDS
CAATGATTTAATTAGAAAAT+GGG	0.357344	5_3:+64493139	Msa0824850:CDS
TTGCAGGTTTGTACCTACTA+TGG	0.359334	5_3:+64493480	Msa0824850:intron
CAACACAATGTTAAAATTCA+TGG	0.363907	5_3:+64491062	Msa0824850:CDS
GAATATTGAAGATGTAATTC+AGG	0.371272	5_3:+64493681	Msa0824850:CDS
ACCAATTACAAACAGAGAAA+TGG	0.372065	5_3:+64490794	Msa0824850:exon
CTTGCCCTTGCTTGCCACTC+AGG	0.379083	5_3:-64493784	None:intergenic
TTCTCTATTGGAAGCAAAGA+TGG	0.382599	5_3:+64494875	Msa0824850:CDS
TTTAACATTGTGTTGGATGT+AGG	0.388508	5_3:-64491054	None:intergenic
TATATCATCGGTGAGATTCA+TGG	0.389863	5_3:-64491015	None:intergenic
AAAAGTGGAGCAAGCATAGA+AGG	0.399835	5_3:+64492853	Msa0824850:CDS
ATTTCTCTGTTTGTAATTGG+TGG	0.401543	5_3:-64490792	None:intergenic
GCACCATGATTGTGAATTAT+GGG	0.407055	5_3:+64494731	Msa0824850:CDS
ATAGGAGGATTAATGAAATT+GGG	0.411585	5_3:+64493506	Msa0824850:CDS
CCACTCCAGCAGATAATGTT+AGG	0.418409	5_3:-64494683	None:intergenic
TTTCTCTGTTTGTAATTGGT+GGG	0.420505	5_3:-64490791	None:intergenic
CAAACCAAGCGTCACAATGA+TGG	0.423439	5_3:-64490838	None:intergenic
TTAAGAGAACAAGGTCTTCA+AGG	0.436422	5_3:+64490921	Msa0824850:CDS
TTTCGCGAAAGCTCAATTAT+GGG	0.436932	5_3:-64494633	None:intergenic
TTCCATTTGGATGGGGTCCT+AGG	0.438258	5_3:+64494832	Msa0824850:CDS
TGCTGAATTGGTTGTGGTTG+AGG	0.441437	5_3:+64490877	Msa0824850:CDS
GGGCATGGAGGATGCTGAAT+TGG	0.445072	5_3:+64490865	Msa0824850:CDS
TTTGGAAGTAGTTATGAAGA+AGG	0.447029	5_3:+64493251	Msa0824850:CDS
TTAAGGATATGATCAACAAA+AGG	0.447635	5_3:+64493548	Msa0824850:CDS
TTAACATTGTGTTGGATGTA+GGG	0.447689	5_3:-64491053	None:intergenic
TTGTACCTACTATGGTCAAT+AGG	0.448076	5_3:+64493488	Msa0824850:CDS
TTGCCCTTGCTTGCCACTCA+GGG	0.451750	5_3:-64493783	None:intergenic
CATAAAGGATCTTATTAAGA+TGG	0.454230	5_3:+64490971	Msa0824850:CDS
TGTAATTGGTGGGGCAAAGA+AGG	0.460936	5_3:-64490781	None:intergenic
AGATATAAAATCTTCACTTA+AGG	0.461164	5_3:+64493531	Msa0824850:CDS
TCTATTTCACATGATCCATC+TGG	0.465020	5_3:-64493176	None:intergenic
AATACATCTACGATTTGCTC+AGG	0.469074	5_3:-64492750	None:intergenic
TTCTCTGTTTGTAATTGGTG+GGG	0.469380	5_3:-64490790	None:intergenic
ATTCCCATCATTGTGACGCT+TGG	0.486344	5_3:+64490834	Msa0824850:CDS
GTCTTCAAGGGAATCCATAT+AGG	0.486578	5_3:+64490934	Msa0824850:CDS
TTAAGAGCAATTACTGTGGC+TGG	0.493931	5_3:-64494957	None:intergenic
GATCATGTGAAATAGACATA+TGG	0.501447	5_3:+64493183	Msa0824850:CDS
ATCCTAGGACCCCATCCAAA+TGG	0.501917	5_3:-64494834	None:intergenic
GGATCTTATTAAGATGGAAA+AGG	0.509720	5_3:+64490977	Msa0824850:CDS
GGAGGATGCTGAATTGGTTG+TGG	0.511983	5_3:+64490871	Msa0824850:CDS
CATAACCTCATACAAAATCA+TGG	0.515351	5_3:-64494598	None:intergenic
AACTTTACTTGTTTGGACAA+TGG	0.516866	5_3:+64493744	Msa0824850:CDS
GGACAATGGTATTATTGAGT+AGG	0.517455	5_3:+64493758	Msa0824850:CDS
TGTGACGCTTGGTTTGATAT+GGG	0.517779	5_3:+64490845	Msa0824850:CDS
AAACCAAGCGTCACAATGAT+GGG	0.521180	5_3:-64490837	None:intergenic
TAGTGGTCTTGCAAGTCTTG+AGG	0.522354	5_3:+64492827	Msa0824850:CDS
AGTGGTCTTGCAAGTCTTGA+GGG	0.523272	5_3:+64492828	Msa0824850:CDS
GGTTCTGTGAGAATCACCCT+TGG	0.525245	5_3:-64492729	None:intergenic
CCTAACATTATCTGCTGGAG+TGG	0.533125	5_3:+64494683	Msa0824850:CDS
CTGAGTGGCAAGCAAGGGCA+AGG	0.533809	5_3:+64493785	Msa0824850:CDS
TAAGGATATGATCAACAAAA+GGG	0.535704	5_3:+64493549	Msa0824850:CDS
CGCTTGGTTTGATATGGGCA+TGG	0.537175	5_3:+64490850	Msa0824850:CDS
GCAAGTTGTTCTACTTTGCA+GGG	0.538368	5_3:+64493707	Msa0824850:CDS
CACCCCATAATTCACAATCA+TGG	0.542452	5_3:-64494734	None:intergenic
AACATTATCTGCTGGAGTGG+AGG	0.542694	5_3:+64494686	Msa0824850:CDS
AGTCTTAATTACCTCCATAG+AGG	0.552576	5_3:-64493344	None:intergenic
ACACGGAAACAACGTGAATG+TGG	0.557304	5_3:+64493654	Msa0824850:CDS
CATCACTAGCCAAATTCTGA+AGG	0.557704	5_3:-64493211	None:intergenic
TTAAGATGGAAAAGGAAGCC+AGG	0.557908	5_3:+64490985	Msa0824850:CDS
ATTGCTCTTAAGCCACAATA+CGG	0.558864	5_3:+64494969	Msa0824850:CDS
CAAGTCTTGAGGGAGAAAAG+TGG	0.561871	5_3:+64492838	Msa0824850:CDS
ATCCTCCTATTGACCATAGT+AGG	0.562488	5_3:-64493493	None:intergenic
GGTACCCTGAGTGGCAAGCA+AGG	0.562549	5_3:+64493779	Msa0824850:CDS
TGGGGTCCTAGGATCTGCAT+TGG	0.563202	5_3:+64494843	Msa0824850:CDS
GAGAAGCTGTTAAGAGAACA+AGG	0.565605	5_3:+64490912	Msa0824850:CDS
GGAGACCTAACATTATCTGC+TGG	0.567226	5_3:+64494678	Msa0824850:CDS
GCTGGAGCATGAGCATAGGC+TGG	0.568382	5_3:-64494939	None:intergenic
GTGAAAATATTAAAGGAAGG+TGG	0.568967	5_3:+64493571	Msa0824850:CDS
GAGATTCATGGATTTAGACC+TGG	0.569485	5_3:-64491003	None:intergenic
AGGGTGAAAATATTAAAGGA+AGG	0.573235	5_3:+64493568	Msa0824850:CDS
CTAGCCAAATTCTGAAGGGA+AGG	0.581397	5_3:-64493206	None:intergenic
ATAATATGAGCACCGTATTG+TGG	0.582346	5_3:-64494981	None:intergenic
TACCTACTATGGTCAATAGG+AGG	0.583831	5_3:+64493491	Msa0824850:CDS
ATCACTAGCCAAATTCTGAA+GGG	0.584793	5_3:-64493210	None:intergenic
TAAGAGAACAAGGTCTTCAA+GGG	0.585971	5_3:+64490922	Msa0824850:CDS
GTGGCAAGCAAGGGCAAGGG+AGG	0.589601	5_3:+64493789	Msa0824850:CDS
GAGGAAATGTTGTCTCCAGA+TGG	0.591198	5_3:+64493161	Msa0824850:CDS
TTGGTTTGGAACAAAACCAA+GGG	0.591413	5_3:+64492713	Msa0824850:CDS
CACGGAAACAACGTGAATGT+GGG	0.596449	5_3:+64493655	Msa0824850:CDS
TACACGTGGCGTTATATCAT+CGG	0.596840	5_3:-64491027	None:intergenic
TTACAAACAGAGAAATGGAA+TGG	0.598701	5_3:+64490799	Msa0824850:exon
CGCGAAAGCTCAATTATGGG+AGG	0.599936	5_3:-64494630	None:intergenic
CACAAGGAAATTAAAGAACA+CGG	0.600350	5_3:+64493637	Msa0824850:CDS
TGAGTGGCAAGCAAGGGCAA+GGG	0.606267	5_3:+64493786	Msa0824850:CDS
TGTGGCTGGAGCATGAGCAT+AGG	0.608845	5_3:-64494943	None:intergenic
CGTGTTCTTTAATTTCCTTG+TGG	0.610561	5_3:-64493636	None:intergenic
TTTGGTTTGGAACAAAACCA+AGG	0.613316	5_3:+64492712	Msa0824850:CDS
TGATTTAATTAGAAAATGGG+AGG	0.627740	5_3:+64493142	Msa0824850:CDS
GTACCCTGAGTGGCAAGCAA+GGG	0.646016	5_3:+64493780	Msa0824850:CDS
GGAATTTCCAAAGCAACGAA+CGG	0.652740	5_3:+64494795	Msa0824850:CDS
CACCATGATTGTGAATTATG+GGG	0.656392	5_3:+64494732	Msa0824850:CDS
TCTTCTAGAGACAAACCACA+AGG	0.719349	5_3:+64493621	Msa0824850:CDS
TATTGAGTAGGTACCCTGAG+TGG	0.723660	5_3:+64493770	Msa0824850:CDS
TTGGTTTGATATGGGCATGG+AGG	0.730690	5_3:+64490853	Msa0824850:CDS
TGGATGTAGGGAATTACACG+TGG	0.736158	5_3:-64491041	None:intergenic
TGGCTTAAGAGCAATTACTG+TGG	0.764853	5_3:-64494961	None:intergenic

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content
!!!	TTTTTTTTTTTTTAATTAAA+TGG	-	chr5_3:64492613-64492632	None:intergenic	0.0%
!!!	TATTTCTGTTTAATATAATT+TGG	+	chr5_3:64491440-64491459	Msa0824850:intron	10.0%
!!	ATTTCTGTTTAATATAATTT+GGG	+	chr5_3:64491441-64491460	Msa0824850:intron	10.0%
!!	GTTTATTTAAATGATTTAAT+TGG	-	chr5_3:64491549-64491568	None:intergenic	10.0%
!!	AATGTTTAATTATGTTATTA+AGG	+	chr5_3:64491867-64491886	Msa0824850:intron	10.0%
!!	ATGTTTAATTATGTTATTAA+GGG	+	chr5_3:64491868-64491887	Msa0824850:intron	10.0%
!!	AAAGATAAAACAAATTAAAT+TGG	-	chr5_3:64491907-64491926	None:intergenic	10.0%
!!!	TTAAAAAAATAAAGTTTGTT+AGG	+	chr5_3:64492058-64492077	Msa0824850:intron	10.0%
!!!	TAAAAAAATAAAGTTTGTTA+GGG	+	chr5_3:64492059-64492078	Msa0824850:intron	10.0%
!!!	AAATTTTATGATTATTCTTT+GGG	-	chr5_3:64492794-64492813	None:intergenic	10.0%
!!!	AAAATTTTATGATTATTCTT+TGG	-	chr5_3:64492795-64492814	None:intergenic	10.0%
!!	ATTTCTAAATATTTAGTAAA+GGG	-	chr5_3:64492926-64492945	None:intergenic	10.0%
!!	AATTTCTAAATATTTAGTAA+AGG	-	chr5_3:64492927-64492946	None:intergenic	10.0%
!!!	TATTATATTTTATATGTTAG+CGG	-	chr5_3:64494246-64494265	None:intergenic	10.0%
!!!	TATAATTTTTTTGTCATTAT+AGG	+	chr5_3:64494572-64494591	Msa0824850:intron	10.0%
!!	ATAAGTCAAAATAATGTATA+TGG	+	chr5_3:64491227-64491246	Msa0824850:intron	15.0%
!!	ATTCAAGATAATTTATGATT+TGG	+	chr5_3:64491601-64491620	Msa0824850:intron	15.0%
!!!	TTGTTTTATCTTTAATTTTC+AGG	+	chr5_3:64491914-64491933	Msa0824850:intron	15.0%
!!!	TGTTTTATCTTTAATTTTCA+GGG	+	chr5_3:64491915-64491934	Msa0824850:intron	15.0%
!!	AAAAAAACTTGTAATTATGT+TGG	+	chr5_3:64492394-64492413	Msa0824850:intron	15.0%
!!	AAAAAACTTGTAATATATGT+TGG	+	chr5_3:64492493-64492512	Msa0824850:intron	15.0%
!!	AAAAAAACTTGTAATTATGT+TGG	+	chr5_3:64492394-64492413	Msa0824850:intron	15.0%
!!!	AAGAATTTTTTTATTTGGTT+TGG	+	chr5_3:64492699-64492718	Msa0824850:CDS	15.0%
!!	CAATGATTTAATTAGAAAAT+GGG	+	chr5_3:64493139-64493158	Msa0824850:CDS	15.0%
!!!	TTAAAAATCAATCACAATTT+TGG	+	chr5_3:64494316-64494335	Msa0824850:intron	15.0%
!!!	TAATAATGCTTTGAATTTTT+TGG	-	chr5_3:64494469-64494488	None:intergenic	15.0%
!!	TAAATAAACTCTTCTACAAA+TGG	+	chr5_3:64491560-64491579	Msa0824850:intron	20.0%
!!	ATTTAGATAAACTCTTCTAA+AGG	+	chr5_3:64491674-64491693	Msa0824850:intron	20.0%
!!	AGGTGAATTTAATACTTATT+TGG	+	chr5_3:64491706-64491725	Msa0824850:intron	20.0%
!!	AGTAGTAATATATATTGTCT+AGG	-	chr5_3:64491779-64491798	None:intergenic	20.0%
!!!	ATATCTAATTAATTTGACGA+TGG	+	chr5_3:64491989-64492008	Msa0824850:intron	20.0%
!!!	TTTTGTACTTTAATTAAGGT+TGG	-	chr5_3:64492111-64492130	None:intergenic	20.0%
!!!	TGGTTTTTGTACTTTAATTA+AGG	-	chr5_3:64492115-64492134	None:intergenic	20.0%
!!!	AAAATGTTTAAAGTTATCGA+TGG	-	chr5_3:64492205-64492224	None:intergenic	20.0%
!!	ATTTACACAAATTTACTTGA+TGG	+	chr5_3:64492249-64492268	Msa0824850:intron	20.0%
!!	AAAAAAACTTGTAATTGTGT+TGG	+	chr5_3:64492295-64492314	Msa0824850:intron	20.0%
!!!	TAGGGAAGAATTTTTTTATT+TGG	+	chr5_3:64492694-64492713	Msa0824850:intron	20.0%
!!	GCAATGATTTAATTAGAAAA+TGG	+	chr5_3:64493138-64493157	Msa0824850:CDS	20.0%
!!	AGATATAAAATCTTCACTTA+AGG	+	chr5_3:64493531-64493550	Msa0824850:CDS	20.0%
!!	GAAAATAAGAATGACTTATT+AGG	+	chr5_3:64493595-64493614	Msa0824850:CDS	20.0%
!!!	AACAAAAAACCAAATTTTGA+TGG	+	chr5_3:64493832-64493851	Msa0824850:CDS	20.0%
!!!	ACAAAAAACCAAATTTTGAT+GGG	+	chr5_3:64493833-64493852	Msa0824850:CDS	20.0%
!!!	TCTTTCTAGTATTTTACTTA+CGG	+	chr5_3:64493924-64493943	Msa0824850:intron	20.0%
!!	AAAATATTAGATTCCAATCA+GGG	-	chr5_3:64494386-64494405	None:intergenic	20.0%
!!	AAAAATATTAGATTCCAATC+AGG	-	chr5_3:64494387-64494406	None:intergenic	20.0%
!!!	ATATTTTAGTATTTGGCATT+AGG	+	chr5_3:64494428-64494447	Msa0824850:intron	20.0%
!!!	AAAATTCAAAGCATTATTAC+TGG	+	chr5_3:64494470-64494489	Msa0824850:intron	20.0%
!!	TATACTACAAGTAAGTATTA+TGG	-	chr5_3:64494556-64494575	None:intergenic	20.0%
!!	AATCCATATAGGATTTTGTA+TGG	+	chr5_3:64490945-64490964	Msa0824850:CDS	25.0%
!	CATAAAGGATCTTATTAAGA+TGG	+	chr5_3:64490971-64490990	Msa0824850:CDS	25.0%
!!!	CATGAATTTTAACATTGTGT+TGG	-	chr5_3:64491064-64491083	None:intergenic	25.0%
!	CAACACAATGTTAAAATTCA+TGG	+	chr5_3:64491062-64491081	Msa0824850:CDS	25.0%
!!!	TTTTTTTTCCCTAACAAACT+TGG	+	chr5_3:64491483-64491502	Msa0824850:intron	25.0%
!!!	TTTTTTTCCCTAACAAACTT+GGG	+	chr5_3:64491484-64491503	Msa0824850:intron	25.0%
!	TGAATTCAACTTTGTATACA+GGG	-	chr5_3:64491586-64491605	None:intergenic	25.0%
!	TTGAATTCAACTTTGTATAC+AGG	-	chr5_3:64491587-64491606	None:intergenic	25.0%
!	AAAAACCACTTGAATCTATT+TGG	+	chr5_3:64492127-64492146	Msa0824850:intron	25.0%
!!!	ATTTTCAAGTTACTAGTTAG+TGG	+	chr5_3:64492810-64492829	Msa0824850:CDS	25.0%
!	TTTCCATTCAGAAAAATTGA+AGG	+	chr5_3:64492890-64492909	Msa0824850:CDS	25.0%
!!	TAACCTTCAATTTTTCTGAA+TGG	-	chr5_3:64492896-64492915	None:intergenic	25.0%
!!!	TTGCAACTTTTGAAAAAAGT+TGG	-	chr5_3:64493122-64493141	None:intergenic	25.0%
!	TGATTTAATTAGAAAATGGG+AGG	+	chr5_3:64493142-64493161	Msa0824850:CDS	25.0%
!!	TGAATTTTTACATTCCTCTA+TGG	+	chr5_3:64493330-64493349	Msa0824850:CDS	25.0%
!	TTTGTAATTAATCACTAGCT+AGG	+	chr5_3:64493429-64493448	Msa0824850:intron	25.0%
!	AATAGGAGGATTAATGAAAT+TGG	+	chr5_3:64493505-64493524	Msa0824850:CDS	25.0%
!	ATAGGAGGATTAATGAAATT+GGG	+	chr5_3:64493506-64493525	Msa0824850:CDS	25.0%
!	TTAAGGATATGATCAACAAA+AGG	+	chr5_3:64493548-64493567	Msa0824850:CDS	25.0%
!	TAAGGATATGATCAACAAAA+GGG	+	chr5_3:64493549-64493568	Msa0824850:CDS	25.0%
!	CAAAAGGGTGAAAATATTAA+AGG	+	chr5_3:64493564-64493583	Msa0824850:CDS	25.0%
!	GAATATTGAAGATGTAATTC+AGG	+	chr5_3:64493681-64493700	Msa0824850:CDS	25.0%
!	TTATTTAGCCCATCAAAATT+TGG	-	chr5_3:64493844-64493863	None:intergenic	25.0%
!!	ACTTTTGTCCAACAAATTTA+AGG	+	chr5_3:64493952-64493971	Msa0824850:intron	25.0%
!!	CAAGTAATGCATCTTTTAAA+CGG	-	chr5_3:64494141-64494160	None:intergenic	25.0%
!	TTAAAAGATGCATTACTTGT+TGG	+	chr5_3:64494142-64494161	Msa0824850:intron	25.0%
!	CTGAAATTATGACCATAATT+CGG	+	chr5_3:64494220-64494239	Msa0824850:intron	25.0%
!!!	GCCTCTAATATTTTAGTATT+TGG	+	chr5_3:64494421-64494440	Msa0824850:intron	25.0%
!	GCCAAATACTAAAATATTAG+AGG	-	chr5_3:64494425-64494444	None:intergenic	25.0%
!!!	AGAGTTTCATTTTTTCCATT+TGG	+	chr5_3:64494819-64494838	Msa0824850:CDS	25.0%
!!!	TTTCATTTTTTCCATTTGGA+TGG	+	chr5_3:64494823-64494842	Msa0824850:CDS	25.0%
!!!	TTCATTTTTTCCATTTGGAT+GGG	+	chr5_3:64494824-64494843	Msa0824850:CDS	25.0%
!	TCATATTATTCTGCGTAAAT+TGG	+	chr5_3:64494995-64495014	Msa0824850:CDS	25.0%
	TTTCTCTGTTTGTAATTGGT+GGG	-	chr5_3:64490794-64490813	None:intergenic	30.0%
	ATTTCTCTGTTTGTAATTGG+TGG	-	chr5_3:64490795-64490814	None:intergenic	30.0%
	ACCAATTACAAACAGAGAAA+TGG	+	chr5_3:64490794-64490813	Msa0824850:exon	30.0%
	TCCATTTCTCTGTTTGTAAT+TGG	-	chr5_3:64490798-64490817	None:intergenic	30.0%
	TTACAAACAGAGAAATGGAA+TGG	+	chr5_3:64490799-64490818	Msa0824850:exon	30.0%
	TCTCCATACAAAATCCTATA+TGG	-	chr5_3:64490951-64490970	None:intergenic	30.0%
!	GATTTTGTATGGAGACATAA+AGG	+	chr5_3:64490956-64490975	Msa0824850:CDS	30.0%
	GGATCTTATTAAGATGGAAA+AGG	+	chr5_3:64490977-64490996	Msa0824850:CDS	30.0%
	TTAACATTGTGTTGGATGTA+GGG	-	chr5_3:64491056-64491075	None:intergenic	30.0%
	TTTAACATTGTGTTGGATGT+AGG	-	chr5_3:64491057-64491076	None:intergenic	30.0%
	AAAGATGACACATGACATTT+AGG	-	chr5_3:64491124-64491143	None:intergenic	30.0%
	ATATCGAGTTTGATTCCTTA+TGG	+	chr5_3:64491401-64491420	Msa0824850:intron	30.0%
!!	ATATCAACCCAAGTTTGTTA+GGG	-	chr5_3:64491494-64491513	None:intergenic	30.0%
!	AATATCAACCCAAGTTTGTT+AGG	-	chr5_3:64491495-64491514	None:intergenic	30.0%
!!	ACTTGGGTTGATATTGTTAA+AGG	+	chr5_3:64491500-64491519	Msa0824850:intron	30.0%
!	TGTTTTGCTTATTGTGATGA+AGG	+	chr5_3:64492015-64492034	Msa0824850:intron	30.0%
!	TGAATTTAGGCATTTTCGAT+TGG	+	chr5_3:64492084-64492103	Msa0824850:intron	30.0%
	ATCAACCAAATAGATTCAAG+TGG	-	chr5_3:64492135-64492154	None:intergenic	30.0%
	TTGAATCTATTTGGTTGATC+AGG	+	chr5_3:64492136-64492155	Msa0824850:intron	30.0%
	TAGAGTTGCAAATGTTATGT+AGG	+	chr5_3:64492340-64492359	Msa0824850:intron	30.0%
	AGAGTTGCAAATGTTATGTA+GGG	+	chr5_3:64492341-64492360	Msa0824850:intron	30.0%
	TAGAGTTGCAAATGTTATGT+AGG	+	chr5_3:64492340-64492359	Msa0824850:intron	30.0%
	AGAGTTGCAAATGTTATGTA+GGG	+	chr5_3:64492341-64492360	Msa0824850:intron	30.0%
	TAGAGTTGCAAATGTTATGT+AGG	+	chr5_3:64492340-64492359	Msa0824850:intron	30.0%
	AGAGTTGCAAATGTTATGTA+GGG	+	chr5_3:64492341-64492360	Msa0824850:intron	30.0%
	TAGAGTTGCAAATGTTATGT+AGG	+	chr5_3:64492340-64492359	Msa0824850:intron	30.0%
	AGAGTTGCAAATGTTATGTA+GGG	+	chr5_3:64492341-64492360	Msa0824850:intron	30.0%
	TAGAGTTGCAAATGTTATGT+AGG	+	chr5_3:64492340-64492359	Msa0824850:intron	30.0%
	AGAGTTGCAAATGTTATGTA+GGG	+	chr5_3:64492341-64492360	Msa0824850:intron	30.0%
!	ATTTTTCTGAATGGAAAGCA+GGG	-	chr5_3:64492887-64492906	None:intergenic	30.0%
!	AATTTTTCTGAATGGAAAGC+AGG	-	chr5_3:64492888-64492907	None:intergenic	30.0%
!	ACTTTGAAGGCAAAAAATGA+AGG	-	chr5_3:64492961-64492980	None:intergenic	30.0%
	TTTGCAGAAATGTACTTTGA+AGG	-	chr5_3:64492974-64492993	None:intergenic	30.0%
	GATCATGTGAAATAGACATA+TGG	+	chr5_3:64493183-64493202	Msa0824850:CDS	30.0%
!!	GTTATTTCTCGAACAACATT+TGG	+	chr5_3:64493233-64493252	Msa0824850:CDS	30.0%
	TTTGGAAGTAGTTATGAAGA+AGG	+	chr5_3:64493251-64493270	Msa0824850:CDS	30.0%
!	ATTTTTACATTCCTCTATGG+AGG	+	chr5_3:64493333-64493352	Msa0824850:CDS	30.0%
	AGGGTGAAAATATTAAAGGA+AGG	+	chr5_3:64493568-64493587	Msa0824850:CDS	30.0%
	GTGAAAATATTAAAGGAAGG+TGG	+	chr5_3:64493571-64493590	Msa0824850:CDS	30.0%
	CACAAGGAAATTAAAGAACA+CGG	+	chr5_3:64493637-64493656	Msa0824850:CDS	30.0%
	CTACTTCAACTTTACTTGTT+TGG	+	chr5_3:64493737-64493756	Msa0824850:CDS	30.0%
	AACTTTACTTGTTTGGACAA+TGG	+	chr5_3:64493744-64493763	Msa0824850:CDS	30.0%
!!	GAGGAAGTATTACAAATCTT+TGG	+	chr5_3:64493808-64493827	Msa0824850:CDS	30.0%
	TGACAAAGCCTTAAATTTGT+TGG	-	chr5_3:64493963-64493982	None:intergenic	30.0%
!!	AAATATTAGAGGCATTTGTC+TGG	-	chr5_3:64494414-64494433	None:intergenic	30.0%
!	CTGAAAGCTTTATATTCAAC+TGG	+	chr5_3:64494502-64494521	Msa0824850:intron	30.0%
	ACAAGTAAGTATTATGGCTT+TGG	-	chr5_3:64494550-64494569	None:intergenic	30.0%
	CATAACCTCATACAAAATCA+TGG	-	chr5_3:64494601-64494620	None:intergenic	30.0%
	GTTGAGAAAAATGTGAAACT+TGG	+	chr5_3:64494657-64494676	Msa0824850:CDS	30.0%
	TCATGGTGCAACAATATAAT+TGG	-	chr5_3:64494720-64494739	None:intergenic	30.0%
!	TTCAATCCTGAAAGATTTTC+TGG	+	chr5_3:64494771-64494790	Msa0824850:CDS	30.0%
!!!	TCATTTTTTCCATTTGGATG+GGG	+	chr5_3:64494825-64494844	Msa0824850:CDS	30.0%
!	TGGACAAAACTTTTCTCTAT+TGG	+	chr5_3:64494863-64494882	Msa0824850:CDS	30.0%
	TTCTCTGTTTGTAATTGGTG+GGG	-	chr5_3:64490793-64490812	None:intergenic	35.0%
	TTAAGAGAACAAGGTCTTCA+AGG	+	chr5_3:64490921-64490940	Msa0824850:CDS	35.0%
	TAAGAGAACAAGGTCTTCAA+GGG	+	chr5_3:64490922-64490941	Msa0824850:CDS	35.0%
	TATATCATCGGTGAGATTCA+TGG	-	chr5_3:64491018-64491037	None:intergenic	35.0%
!	TATTGTTGGTAAGTGGTAAC+TGG	+	chr5_3:64491343-64491362	Msa0824850:intron	35.0%
!	TCTTCTAAAGGTTCACACTA+AGG	+	chr5_3:64491686-64491705	Msa0824850:intron	35.0%
!	GTTTGTTAGGGCTTGAATTT+AGG	+	chr5_3:64492071-64492090	Msa0824850:intron	35.0%
!!	TTTGGTTTGGAACAAAACCA+AGG	+	chr5_3:64492712-64492731	Msa0824850:CDS	35.0%
!!	TTGGTTTGGAACAAAACCAA+GGG	+	chr5_3:64492713-64492732	Msa0824850:CDS	35.0%
!	AATACATCTACGATTTGCTC+AGG	-	chr5_3:64492753-64492772	None:intergenic	35.0%
	TCTATTTCACATGATCCATC+TGG	-	chr5_3:64493179-64493198	None:intergenic	35.0%
	ATCACTAGCCAAATTCTGAA+GGG	-	chr5_3:64493213-64493232	None:intergenic	35.0%
	AGTCTTAATTACCTCCATAG+AGG	-	chr5_3:64493347-64493366	None:intergenic	35.0%
	GTAATTAATCACTAGCTAGG+AGG	+	chr5_3:64493432-64493451	Msa0824850:intron	35.0%
	AAACATGTCATTCGTGTAAC+TGG	-	chr5_3:64493458-64493477	None:intergenic	35.0%
	CGAATGACATGTTTATTTGC+AGG	+	chr5_3:64493464-64493483	Msa0824850:intron	35.0%
	TTGTACCTACTATGGTCAAT+AGG	+	chr5_3:64493488-64493507	Msa0824850:CDS	35.0%
!	CGTGTTCTTTAATTTCCTTG+TGG	-	chr5_3:64493639-64493658	None:intergenic	35.0%
	GGACAATGGTATTATTGAGT+AGG	+	chr5_3:64493758-64493777	Msa0824850:CDS	35.0%
!!	GAGGTCTAAGCTTTAGAAAA+TGG	+	chr5_3:64493990-64494009	Msa0824850:intron	35.0%
	CAGAGTTAGTGACCAAATTT+CGG	+	chr5_3:64494276-64494295	Msa0824850:intron	35.0%
!	GGTTACCATGATTTTGTATG+AGG	+	chr5_3:64494593-64494612	Msa0824850:intron	35.0%
	TTTCGCGAAAGCTCAATTAT+GGG	-	chr5_3:64494636-64494655	None:intergenic	35.0%
	TGCACCATGATTGTGAATTA+TGG	+	chr5_3:64494730-64494749	Msa0824850:CDS	35.0%
	GCACCATGATTGTGAATTAT+GGG	+	chr5_3:64494731-64494750	Msa0824850:CDS	35.0%
	CACCATGATTGTGAATTATG+GGG	+	chr5_3:64494732-64494751	Msa0824850:CDS	35.0%
!	AATCCTGAAAGATTTTCTGG+AGG	+	chr5_3:64494774-64494793	Msa0824850:CDS	35.0%
	ATTCCTCCAGAAAATCTTTC+AGG	-	chr5_3:64494780-64494799	None:intergenic	35.0%
	TTCTCTATTGGAAGCAAAGA+TGG	+	chr5_3:64494875-64494894	Msa0824850:CDS	35.0%
	ATTGCTCTTAAGCCACAATA+CGG	+	chr5_3:64494969-64494988	Msa0824850:CDS	35.0%
!	ATAATATGAGCACCGTATTG+TGG	-	chr5_3:64494984-64495003	None:intergenic	35.0%
	AAACCAAGCGTCACAATGAT+GGG	-	chr5_3:64490840-64490859	None:intergenic	40.0%
!	TTGTGACGCTTGGTTTGATA+TGG	+	chr5_3:64490844-64490863	Msa0824850:CDS	40.0%
!	TGTGACGCTTGGTTTGATAT+GGG	+	chr5_3:64490845-64490864	Msa0824850:CDS	40.0%
!	AACAGCTTCTCTAGCTTCTT+TGG	-	chr5_3:64490903-64490922	None:intergenic	40.0%
	GAGAAGCTGTTAAGAGAACA+AGG	+	chr5_3:64490912-64490931	Msa0824850:CDS	40.0%
	GTCTTCAAGGGAATCCATAT+AGG	+	chr5_3:64490934-64490953	Msa0824850:CDS	40.0%
	TTAAGATGGAAAAGGAAGCC+AGG	+	chr5_3:64490985-64491004	Msa0824850:CDS	40.0%
	GAGATTCATGGATTTAGACC+TGG	-	chr5_3:64491006-64491025	None:intergenic	40.0%
	TACACGTGGCGTTATATCAT+CGG	-	chr5_3:64491030-64491049	None:intergenic	40.0%
	CAAAGTCCAGTGCATATTGT+TGG	+	chr5_3:64491329-64491348	Msa0824850:intron	40.0%
	CACTTACCAACAATATGCAC+TGG	-	chr5_3:64491338-64491357	None:intergenic	40.0%
!	CAGTGCATATTGTTGGTAAG+TGG	+	chr5_3:64491336-64491355	Msa0824850:intron	40.0%
	TAGCAATCAAGTGCACCATA+AGG	-	chr5_3:64491419-64491438	None:intergenic	40.0%
	CTATTTGGTTGATCAGGACA+CGG	+	chr5_3:64492142-64492161	Msa0824850:intron	40.0%
	TATTTGGTTGATCAGGACAC+GGG	+	chr5_3:64492143-64492162	Msa0824850:intron	40.0%
	AAAAGTGGAGCAAGCATAGA+AGG	+	chr5_3:64492853-64492872	Msa0824850:CDS	40.0%
	CATCACTAGCCAAATTCTGA+AGG	-	chr5_3:64493214-64493233	None:intergenic	40.0%
	TTGCAGGTTTGTACCTACTA+TGG	+	chr5_3:64493480-64493499	Msa0824850:intron	40.0%
	TACCTACTATGGTCAATAGG+AGG	+	chr5_3:64493491-64493510	Msa0824850:CDS	40.0%
	ATCCTCCTATTGACCATAGT+AGG	-	chr5_3:64493496-64493515	None:intergenic	40.0%
!	TCTTCTAGAGACAAACCACA+AGG	+	chr5_3:64493621-64493640	Msa0824850:CDS	40.0%
	TGCAAGTTGTTCTACTTTGC+AGG	+	chr5_3:64493706-64493725	Msa0824850:CDS	40.0%
	GCAAGTTGTTCTACTTTGCA+GGG	+	chr5_3:64493707-64493726	Msa0824850:CDS	40.0%
!	AAGGCTTTGTCACAATCATG+AGG	+	chr5_3:64493971-64493990	Msa0824850:intron	40.0%
!!	AAGCTTTAGAAAATGGCTCC+AGG	+	chr5_3:64493997-64494016	Msa0824850:intron	40.0%
!!	AGCTTTAGAAAATGGCTCCA+GGG	+	chr5_3:64493998-64494017	Msa0824850:intron	40.0%
	CTAAGGATCCTATTGTCATG+AGG	+	chr5_3:64494036-64494055	Msa0824850:intron	40.0%
	AGCTTAGACCTCATGACAAT+AGG	-	chr5_3:64494047-64494066	None:intergenic	40.0%
	TACCTCGTACTGAGACATAT+CGG	-	chr5_3:64494093-64494112	None:intergenic	40.0%
	TCCTTAGCGACGAAAAAATC+CGG	-	chr5_3:64494171-64494190	None:intergenic	40.0%
	ATATGTTAGCGGCCGAATTA+TGG	-	chr5_3:64494235-64494254	None:intergenic	40.0%
	CTACTTTAGCGACCGAAATT+TGG	-	chr5_3:64494291-64494310	None:intergenic	40.0%
	GTTTCGCGAAAGCTCAATTA+TGG	-	chr5_3:64494637-64494656	None:intergenic	40.0%
	CACCCCATAATTCACAATCA+TGG	-	chr5_3:64494737-64494756	None:intergenic	40.0%
	GGAATTTCCAAAGCAACGAA+CGG	+	chr5_3:64494795-64494814	Msa0824850:CDS	40.0%
!	TTTTGTCCAATGCAGATCCT+AGG	-	chr5_3:64494852-64494871	None:intergenic	40.0%
	TTAAGAGCAATTACTGTGGC+TGG	-	chr5_3:64494960-64494979	None:intergenic	40.0%
	TGGCTTAAGAGCAATTACTG+TGG	-	chr5_3:64494964-64494983	None:intergenic	40.0%
	ATTCCCATCATTGTGACGCT+TGG	+	chr5_3:64490834-64490853	Msa0824850:CDS	45.0%
	CAAACCAAGCGTCACAATGA+TGG	-	chr5_3:64490841-64490860	None:intergenic	45.0%
!	TTGGTTTGATATGGGCATGG+AGG	+	chr5_3:64490853-64490872	Msa0824850:CDS	45.0%
	TGCTGAATTGGTTGTGGTTG+AGG	+	chr5_3:64490877-64490896	Msa0824850:CDS	45.0%
	TGGATGTAGGGAATTACACG+TGG	-	chr5_3:64491044-64491063	None:intergenic	45.0%
!	TAGTGGTCTTGCAAGTCTTG+AGG	+	chr5_3:64492827-64492846	Msa0824850:CDS	45.0%
!	AGTGGTCTTGCAAGTCTTGA+GGG	+	chr5_3:64492828-64492847	Msa0824850:CDS	45.0%
	CAAGTCTTGAGGGAGAAAAG+TGG	+	chr5_3:64492838-64492857	Msa0824850:CDS	45.0%
	GAGGAAATGTTGTCTCCAGA+TGG	+	chr5_3:64493161-64493180	Msa0824850:CDS	45.0%
	ATGGCCTTCCCTTCAGAATT+TGG	+	chr5_3:64493202-64493221	Msa0824850:CDS	45.0%
!	CTAGCCAAATTCTGAAGGGA+AGG	-	chr5_3:64493209-64493228	None:intergenic	45.0%
	ACACGGAAACAACGTGAATG+TGG	+	chr5_3:64493654-64493673	Msa0824850:CDS	45.0%
	CACGGAAACAACGTGAATGT+GGG	+	chr5_3:64493655-64493674	Msa0824850:CDS	45.0%
	TATTGAGTAGGTACCCTGAG+TGG	+	chr5_3:64493770-64493789	Msa0824850:CDS	45.0%
	GGATCCTTAGAGCCATTTGA+GGG	-	chr5_3:64494026-64494045	None:intergenic	45.0%
	AGGATCCTTAGAGCCATTTG+AGG	-	chr5_3:64494027-64494046	None:intergenic	45.0%
	TTCCGATATGTCTCAGTACG+AGG	+	chr5_3:64494088-64494107	Msa0824850:intron	45.0%
!	ATGCATTACTTGTTGGCGAC+CGG	+	chr5_3:64494149-64494168	Msa0824850:intron	45.0%
!!!	ACCGGATTTTTTCGTCGCTA+AGG	+	chr5_3:64494167-64494186	Msa0824850:intron	45.0%
	TCGTCGCTAAGGATGAAAGT+CGG	+	chr5_3:64494178-64494197	Msa0824850:intron	45.0%
	CCAGGAATACATTTGCAGTG+TGG	-	chr5_3:64494357-64494376	None:intergenic	45.0%
	CCACACTGCAAATGTATTCC+TGG	+	chr5_3:64494354-64494373	Msa0824850:intron	45.0%
	GGAGACCTAACATTATCTGC+TGG	+	chr5_3:64494678-64494697	Msa0824850:CDS	45.0%
	CCACTCCAGCAGATAATGTT+AGG	-	chr5_3:64494686-64494705	None:intergenic	45.0%
	CCTAACATTATCTGCTGGAG+TGG	+	chr5_3:64494683-64494702	Msa0824850:CDS	45.0%
	AACATTATCTGCTGGAGTGG+AGG	+	chr5_3:64494686-64494705	Msa0824850:CDS	45.0%
	AACTCTACCGTTCGTTGCTT+TGG	-	chr5_3:64494805-64494824	None:intergenic	45.0%
!!!	GTTTTTTTTTTTAATAATTT+CGG	-	chr5_3:64491757-64491776	None:intergenic	5.0%
!!!	AAGTTTTTTTTTTAATTAAA+TGG	-	chr5_3:64492285-64492304	None:intergenic	5.0%
!!!	GTTTTTTTTTTTTAATTAAA+TGG	-	chr5_3:64492382-64492401	None:intergenic	5.0%
!!!	AAGTTTTTTTTTTAATTAAA+TGG	-	chr5_3:64492285-64492304	None:intergenic	5.0%
!!	TAATAAATAATAAAGAAATA+AGG	-	chr5_3:64493082-64493101	None:intergenic	5.0%
!!	TTTATTATTTATTATACTAT+AGG	+	chr5_3:64493088-64493107	Msa0824850:intron	5.0%
!	CGCTTGGTTTGATATGGGCA+TGG	+	chr5_3:64490850-64490869	Msa0824850:CDS	50.0%
	GGAGGATGCTGAATTGGTTG+TGG	+	chr5_3:64490871-64490890	Msa0824850:CDS	50.0%
	GGTTCTGTGAGAATCACCCT+TGG	-	chr5_3:64492732-64492751	None:intergenic	50.0%
!	GGATCCCTCAAATGGCTCTA+AGG	+	chr5_3:64494019-64494038	Msa0824850:intron	50.0%
	TTCCTGGATCTGTCCCTGAT+TGG	+	chr5_3:64494370-64494389	Msa0824850:intron	50.0%
	TTCCAATCAGGGACAGATCC+AGG	-	chr5_3:64494375-64494394	None:intergenic	50.0%
	CGCGAAAGCTCAATTATGGG+AGG	-	chr5_3:64494633-64494652	None:intergenic	50.0%
	TTCCATTTGGATGGGGTCCT+AGG	+	chr5_3:64494832-64494851	Msa0824850:CDS	50.0%
	ATCCTAGGACCCCATCCAAA+TGG	-	chr5_3:64494837-64494856	None:intergenic	50.0%
	GGGCATGGAGGATGCTGAAT+TGG	+	chr5_3:64490865-64490884	Msa0824850:CDS	55.0%
	GTACCCTGAGTGGCAAGCAA+GGG	+	chr5_3:64493780-64493799	Msa0824850:CDS	55.0%
	TTGCCCTTGCTTGCCACTCA+GGG	-	chr5_3:64493786-64493805	None:intergenic	55.0%
	TGAGTGGCAAGCAAGGGCAA+GGG	+	chr5_3:64493786-64493805	Msa0824850:CDS	55.0%
	AGAGCCATTTGAGGGATCCC+TGG	-	chr5_3:64494018-64494037	None:intergenic	55.0%
	TGGGGTCCTAGGATCTGCAT+TGG	+	chr5_3:64494843-64494862	Msa0824850:CDS	55.0%
	TGTGGCTGGAGCATGAGCAT+AGG	-	chr5_3:64494946-64494965	None:intergenic	55.0%
	GGTACCCTGAGTGGCAAGCA+AGG	+	chr5_3:64493779-64493798	Msa0824850:CDS	60.0%
	CTTGCCCTTGCTTGCCACTC+AGG	-	chr5_3:64493787-64493806	None:intergenic	60.0%
	CTGAGTGGCAAGCAAGGGCA+AGG	+	chr5_3:64493785-64493804	Msa0824850:CDS	60.0%
	GGCTCCAGGGATCCCTCAAA+TGG	+	chr5_3:64494011-64494030	Msa0824850:intron	60.0%
	GCTGGAGCATGAGCATAGGC+TGG	-	chr5_3:64494942-64494961	None:intergenic	60.0%
	GTGGCAAGCAAGGGCAAGGG+AGG	+	chr5_3:64493789-64493808	Msa0824850:CDS	65.0%

Chromosome	Type	Strat	End	Strand	Name
chr5_3	gene	64490784	64495025	64490784	ID=Msa0824850;Name=Msa0824850
chr5_3	mRNA	64490784	64495025	64490784	ID=Msa0824850-mRNA-1;Parent=Msa0824850;Name=Msa0824850-mRNA-1;_AED=0.23;_eAED=0.23;_QI=29\|1\|0.6\|1\|1\|1\|5\|0\|516
chr5_3	exon	64490784	64491083	64490784	ID=Msa0824850-mRNA-1:exon:20101;Parent=Msa0824850-mRNA-1
chr5_3	exon	64492697	64492911	64492697	ID=Msa0824850-mRNA-1:exon:20102;Parent=Msa0824850-mRNA-1
chr5_3	exon	64493110	64493354	64493110	ID=Msa0824850-mRNA-1:exon:20103;Parent=Msa0824850-mRNA-1
chr5_3	exon	64493486	64493873	64493486	ID=Msa0824850-mRNA-1:exon:20104;Parent=Msa0824850-mRNA-1
chr5_3	exon	64494594	64495025	64494594	ID=Msa0824850-mRNA-1:exon:20105;Parent=Msa0824850-mRNA-1
chr5_3	five_prime_UTR	64490784	64490812	64490784	ID=Msa0824850-mRNA-1:five_prime_utr;Parent=Msa0824850-mRNA-1
chr5_3	CDS	64490813	64491083	64490813	ID=Msa0824850-mRNA-1:cds;Parent=Msa0824850-mRNA-1
chr5_3	CDS	64492697	64492911	64492697	ID=Msa0824850-mRNA-1:cds;Parent=Msa0824850-mRNA-1
chr5_3	CDS	64493110	64493354	64493110	ID=Msa0824850-mRNA-1:cds;Parent=Msa0824850-mRNA-1
chr5_3	CDS	64493486	64493873	64493486	ID=Msa0824850-mRNA-1:cds;Parent=Msa0824850-mRNA-1
chr5_3	CDS	64494594	64495025	64494594	ID=Msa0824850-mRNA-1:cds;Parent=Msa0824850-mRNA-1

Gene Sequence

>Msa0824850

ATGGAATGGTATTCAAGCATCATTCCCATCATTGTGACGCTTGGTTTGATATGGGCATGGAGGATGCTGAATTGGTTGTGGTTGAGGCCAAAGAAGCTAGAGAAGCTGTTAAGAGAACAAGGTCTTCAAGGGAATCCATATAGGATTTTGTATGGAGACATAAAGGATCTTATTAAGATGGAAAAGGAAGCCAGGTCTAAATCCATGAATCTCACCGATGATATAACGCCACGTGTAATTCCCTACATCCAACACAATGTTAAAATTCATGGGAAGAATTTTTTTATTTGGTTTGGAACAAAACCAAGGGTGATTCTCACAGAACCTGAGCAAATCGTAGATGTATTGAACAAGATCTCTGACTTCCCAAAGAATAATCATAAAATTTTCAAGTTACTAGTTAGTGGTCTTGCAAGTCTTGAGGGAGAAAAGTGGAGCAAGCATAGAAGGCTAATCAACCCTGCTTTCCATTCAGAAAAATTGAAGGTTATGACACCAACTTTTTTCAAAAGTTGCAATGATTTAATTAGAAAATGGGAGGAAATGTTGTCTCCAGATGGATCATGTGAAATAGACATATGGCCTTCCCTTCAGAATTTGGCTAGTGATGTTATTTCTCGAACAACATTTGGAAGTAGTTATGAAGAAGGAAGAAGAATATTTCAACTTCAAATTGAGCAAGCTGAACTTATGACAAAAGTTCAAATGAATTTTTACATTCCTCTATGGAGGTTTGTACCTACTATGGTCAATAGGAGGATTAATGAAATTGGGAAAGATATAAAATCTTCACTTAAGGATATGATCAACAAAAGGGTGAAAATATTAAAGGAAGGTGGAGAAAATAAGAATGACTTATTAGGTATTCTTCTAGAGACAAACCACAAGGAAATTAAAGAACACGGAAACAACGTGAATGTGGGAATGAATATTGAAGATGTAATTCAGGAATGCAAGTTGTTCTACTTTGCAGGGCAAGAAACTACTTCAACTTTACTTGTTTGGACAATGGTATTATTGAGTAGGTACCCTGAGTGGCAAGCAAGGGCAAGGGAGGAAGTATTACAAATCTTTGGCAACAAAAAACCAAATTTTGATGGGCTAAATAACTTGAAGATTGTTACCATGATTTTGTATGAGGTTATGAGATTATATCCTCCCATAATTGAGCTTTCGCGAAACGTTGAGAAAAATGTGAAACTTGGAGACCTAACATTATCTGCTGGAGTGGAGGTTTTCTTGCCAATTATATTGTTGCACCATGATTGTGAATTATGGGGTGATGATGCTAAAATGTTCAATCCTGAAAGATTTTCTGGAGGAATTTCCAAAGCAACGAACGGTAGAGTTTCATTTTTTCCATTTGGATGGGGTCCTAGGATCTGCATTGGACAAAACTTTTCTCTATTGGAAGCAAAGATGGCAATGACGTTGATTTTACAACATTTCTCATTTGAACTTTCTCCAGCCTATGCTCATGCTCCAGCCACAGTAATTGCTCTTAAGCCACAATACGGTGCTCATATTATTCTGCGTAAATTGGAAACATAA

Protein sequence

>Msa0824850

MEWYSSIIPIIVTLGLIWAWRMLNWLWLRPKKLEKLLREQGLQGNPYRILYGDIKDLIKMEKEARSKSMNLTDDITPRVIPYIQHNVKIHGKNFFIWFGTKPRVILTEPEQIVDVLNKISDFPKNNHKIFKLLVSGLASLEGEKWSKHRRLINPAFHSEKLKVMTPTFFKSCNDLIRKWEEMLSPDGSCEIDIWPSLQNLASDVISRTTFGSSYEEGRRIFQLQIEQAELMTKVQMNFYIPLWRFVPTMVNRRINEIGKDIKSSLKDMINKRVKILKEGGENKNDLLGILLETNHKEIKEHGNNVNVGMNIEDVIQECKLFYFAGQETTSTLLVWTMVLLSRYPEWQARAREEVLQIFGNKKPNFDGLNNLKIVTMILYEVMRLYPPIIELSRNVEKNVKLGDLTLSAGVEVFLPIILLHHDCELWGDDAKMFNPERFSGGISKATNGRVSFFPFGWGPRICIGQNFSLLEAKMAMTLILQHFSFELSPAYAHAPATVIALKPQYGAHIILRKLET*