AlfalfaGEDB | Msa0144010

M. sativa cultivar zhongmu-4 / Msa0144010

KEGG: -
GO: GO:0003674 GO:0003824 GO:0005488 GO:0006950 GO:0006952 GO:0008150 GO:0016787 GO:0016788 GO:0019863 GO:0019865 GO:0044877 GO:0050896
PFAM: PF00657.25

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0144010	XP_012570621.1	60.158	379	126	3	214	567	11	389	1.95e-146	462
Msa0144010	XP_012570621.1	62.312	666	151	7	2	568	135	799	0.0	811
Msa0144010	XP_012570621.1	66.411	652	131	8	2	567	543	1192	0.0	823

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0144010	sp\|Q7Y1X1\|EST_HEVBR	59.626	374	125	6	218	567	10	381	2.45e-152	445
Msa0144010	sp\|Q7Y1X1\|EST_HEVBR	55.469	256	70	4	2	214	127	381	1.29e-87	279

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0144010	A0A1S3E6H1	60.158	379	126	3	214	567	11	389	9.31e-147	462
Msa0144010	A0A1S3E6H1	62.312	666	151	7	2	568	135	799	0.0	811
Msa0144010	A0A1S3E6H1	66.411	652	131	8	2	567	543	1192	0.0	823

TFs/TRs:

Gene ID	Type	Classification

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
Msa0004340	Msa0144010	-0.808323	3.277717e-50	-8.615850e-47
Msa0011060	Msa0144010	-0.813474	2.513598e-51	-8.615850e-47
Msa0011100	Msa0144010	-0.807286	5.444581e-50	-8.615850e-47
Msa0011510	Msa0144010	0.829657	4.553830e-55	-8.615850e-47
Msa0017710	Msa0144010	0.824573	7.502834e-54	-8.615850e-47
Msa0024280	Msa0144010	0.820373	7.099913e-53	-8.615850e-47
Msa0024320	Msa0144010	-0.800508	1.394525e-48	-8.615850e-47
Msa0024650	Msa0144010	0.800406	1.462870e-48	-8.615850e-47
Msa0027030	Msa0144010	-0.815737	7.931638e-52	-8.615850e-47
Msa0030760	Msa0144010	-0.825508	4.512574e-54	-8.615850e-47
Msa0036550	Msa0144010	0.801710	7.920479e-49	-8.615850e-47
Msa0038010	Msa0144010	0.807076	6.030805e-50	-8.615850e-47
Msa0038750	Msa0144010	-0.800746	1.246978e-48	-8.615850e-47
Msa0039590	Msa0144010	-0.820555	6.447114e-53	-8.615850e-47
Msa0045620	Msa0144010	0.819031	1.437813e-52	-8.615850e-47
Msa0047560	Msa0144010	-0.823485	1.350487e-53	-8.615850e-47
Msa0048410	Msa0144010	-0.811812	5.805024e-51	-8.615850e-47
Msa0050320	Msa0144010	-0.808378	3.188986e-50	-8.615850e-47
Msa0053260	Msa0144010	-0.801569	8.465243e-49	-8.615850e-47
Msa0053360	Msa0144010	-0.811197	7.897417e-51	-8.615850e-47
Msa0056230	Msa0144010	-0.802086	6.627387e-49	-8.615850e-47
Msa0059880	Msa0144010	0.817216	3.699735e-52	-8.615850e-47
Msa0060080	Msa0144010	-0.803048	4.198296e-49	-8.615850e-47
Msa0060370	Msa0144010	0.820796	5.676452e-53	-8.615850e-47
Msa0060380	Msa0144010	0.983989	2.845890e-159	-8.615850e-47
Msa0061060	Msa0144010	-0.813618	2.337145e-51	-8.615850e-47
Msa0070580	Msa0144010	-0.810456	1.142427e-50	-8.615850e-47
Msa0078160	Msa0144010	-0.838196	3.319158e-57	-8.615850e-47
Msa0078170	Msa0144010	-0.825960	3.524359e-54	-8.615850e-47
Msa0081290	Msa0144010	-0.803661	3.133747e-49	-8.615850e-47
Msa0081700	Msa0144010	-0.806748	7.076180e-50	-8.615850e-47
Msa0084190	Msa0144010	0.813776	2.157184e-51	-8.615850e-47
Msa0089470	Msa0144010	-0.803616	3.202176e-49	-8.615850e-47
Msa0094900	Msa0144010	-0.822073	2.878401e-53	-8.615850e-47
Msa0098800	Msa0144010	-0.822015	2.969085e-53	-8.615850e-47
Msa0099090	Msa0144010	-0.803299	3.725469e-49	-8.615850e-47
Msa0105190	Msa0144010	0.807199	5.679529e-50	-8.615850e-47
Msa0105590	Msa0144010	-0.820781	5.722164e-53	-8.615850e-47
Msa0106540	Msa0144010	0.801930	7.137014e-49	-8.615850e-47
Msa0121320	Msa0144010	0.815046	1.130051e-51	-8.615850e-47
Msa0130360	Msa0144010	0.804621	1.978769e-49	-8.615850e-47
Msa0132080	Msa0144010	-0.840095	1.068933e-57	-8.615850e-47
Msa0138340	Msa0144010	-0.807906	4.020384e-50	-8.615850e-47
Msa0140270	Msa0144010	0.807765	4.306815e-50	-8.615850e-47
Msa0140870	Msa0144010	-0.821634	3.636929e-53	-8.615850e-47
Msa0143940	Msa0144010	0.979792	9.417344e-149	-8.615850e-47
Msa0143950	Msa0144010	0.817413	3.339802e-52	-8.615850e-47
Msa0144000	Msa0144010	0.830457	2.905592e-55	-8.615850e-47
Msa0144010	Msa0147540	-0.805618	1.223654e-49	-8.615850e-47
Msa0144010	Msa0147680	0.812931	3.307501e-51	-8.615850e-47
Msa0144010	Msa0147960	-0.806039	9.981412e-50	-8.615850e-47
Msa0144010	Msa0150910	0.807135	5.860843e-50	-8.615850e-47
Msa0144010	Msa0154720	-0.808727	2.687141e-50	-8.615850e-47
Msa0144010	Msa0154750	0.808392	3.167402e-50	-8.615850e-47
Msa0144010	Msa0163340	0.836090	1.147265e-56	-8.615850e-47
Msa0144010	Msa0163400	-0.801270	9.746096e-49	-8.615850e-47
Msa0144010	Msa0166180	0.817446	3.283468e-52	-8.615850e-47
Msa0144010	Msa0167150	-0.816637	4.990752e-52	-8.615850e-47
Msa0144010	Msa0170730	-0.807518	4.861594e-50	-8.615850e-47
Msa0144010	Msa0176600	0.811806	5.823511e-51	-8.615850e-47
Msa0144010	Msa0186380	-0.809002	2.346795e-50	-8.615850e-47
Msa0144010	Msa0186510	-0.800656	1.301093e-48	-8.615850e-47
Msa0144010	Msa0188560	0.814363	1.600476e-51	-8.615850e-47
Msa0144010	Msa0189150	-0.819557	1.090930e-52	-8.615850e-47
Msa0144010	Msa0190400	-0.804598	2.000238e-49	-8.615850e-47
Msa0144010	Msa0190470	-0.805905	1.065379e-49	-8.615850e-47
Msa0144010	Msa0190670	0.816585	5.125676e-52	-8.615850e-47
Msa0144010	Msa0191100	0.821749	3.421462e-53	-8.615850e-47
Msa0144010	Msa0194750	-0.816289	5.972502e-52	-8.615850e-47
Msa0144010	Msa0195140	-0.806761	7.031001e-50	-8.615850e-47
Msa0144010	Msa0196260	0.801152	1.030460e-48	-8.615850e-47
Msa0144010	Msa0206370	0.815251	1.017327e-51	-8.615850e-47
Msa0144010	Msa0208040	-0.813970	1.954443e-51	-8.615850e-47
Msa0144010	Msa0208710	-0.804382	2.219102e-49	-8.615850e-47
Msa0144010	Msa0209370	-0.810885	9.227641e-51	-8.615850e-47
Msa0144010	Msa0211460	0.837034	6.592708e-57	-8.615850e-47
Msa0144010	Msa0219720	-0.814098	1.831495e-51	-8.615850e-47
Msa0144010	Msa0219840	0.816616	5.045427e-52	-8.615850e-47
Msa0144010	Msa0223590	0.824849	6.457005e-54	-8.615850e-47
Msa0144010	Msa0225070	-0.827751	1.315921e-54	-8.615850e-47
Msa0144010	Msa0227970	-0.826997	1.995118e-54	-8.615850e-47
Msa0144010	Msa0229350	-0.806116	9.615735e-50	-8.615850e-47
Msa0144010	Msa0230920	0.814237	1.706178e-51	-8.615850e-47
Msa0144010	Msa0232660	-0.819551	1.094388e-52	-8.615850e-47
Msa0144010	Msa0235080	0.829996	3.766014e-55	-8.615850e-47
Msa0144010	Msa0236690	-0.818128	2.303939e-52	-8.615850e-47
Msa0144010	Msa0237440	-0.836805	7.544626e-57	-8.615850e-47
Msa0144010	Msa0238140	0.803092	4.111757e-49	-8.615850e-47
Msa0144010	Msa0239610	-0.804351	2.252111e-49	-8.615850e-47
Msa0144010	Msa0240590	-0.817958	2.517457e-52	-8.615850e-47
Msa0144010	Msa0261020	-0.809334	1.992117e-50	-8.615850e-47
Msa0144010	Msa0264890	0.824972	6.041902e-54	-8.615850e-47
Msa0144010	Msa0266140	-0.819591	1.071571e-52	-8.615850e-47
Msa0144010	Msa0267450	-0.813470	2.519077e-51	-8.615850e-47
Msa0144010	Msa0267510	-0.810264	1.256448e-50	-8.615850e-47
Msa0144010	Msa0269430	-0.803020	4.255398e-49	-8.615850e-47
Msa0144010	Msa0269660	-0.813093	3.046784e-51	-8.615850e-47
Msa0144010	Msa0270390	0.839656	1.390770e-57	-8.615850e-47
Msa0144010	Msa0270730	-0.820777	5.734272e-53	-8.615850e-47
Msa0144010	Msa0273360	0.804043	2.610319e-49	-8.615850e-47
Msa0144010	Msa0276800	-0.807881	4.069710e-50	-8.615850e-47
Msa0144010	Msa0278940	0.806397	8.392236e-50	-8.615850e-47
Msa0144010	Msa0279090	-0.821483	3.942853e-53	-8.615850e-47
Msa0144010	Msa0279810	0.818372	2.029147e-52	-8.615850e-47
Msa0144010	Msa0285510	-0.810805	9.601579e-51	-8.615850e-47
Msa0144010	Msa0290800	0.827975	1.162178e-54	-8.615850e-47
Msa0144010	Msa0302220	0.805857	1.090179e-49	-8.615850e-47
Msa0144010	Msa0304060	-0.819876	9.223741e-53	-8.615850e-47
Msa0144010	Msa0304350	-0.823003	1.749934e-53	-8.615850e-47
Msa0144010	Msa0305910	-0.821583	3.737563e-53	-8.615850e-47
Msa0144010	Msa0307430	0.817775	2.767715e-52	-8.615850e-47
Msa0144010	Msa0307630	0.809554	1.786503e-50	-8.615850e-47
Msa0144010	Msa0309490	-0.800475	1.416644e-48	-8.615850e-47
Msa0144010	Msa0311130	-0.803172	3.958245e-49	-8.615850e-47
Msa0144010	Msa0311540	0.803991	2.675689e-49	-8.615850e-47
Msa0144010	Msa0316720	-0.805829	1.105145e-49	-8.615850e-47
Msa0144010	Msa0319220	0.816294	5.957363e-52	-8.615850e-47
Msa0144010	Msa0328870	0.840352	9.155885e-58	-8.615850e-47
Msa0144010	Msa0330770	-0.814640	1.389994e-51	-8.615850e-47
Msa0144010	Msa0331070	-0.819439	1.160650e-52	-8.615850e-47
Msa0144010	Msa0333770	0.802058	6.718426e-49	-8.615850e-47
Msa0144010	Msa0336430	0.812861	3.426232e-51	-8.615850e-47
Msa0144010	Msa0336460	0.803082	4.130003e-49	-8.615850e-47
Msa0144010	Msa0336520	0.824419	8.153442e-54	-8.615850e-47
Msa0144010	Msa0336550	-0.824903	6.271935e-54	-8.615850e-47
Msa0144010	Msa0340270	0.830593	2.691406e-55	-8.615850e-47
Msa0144010	Msa0340830	-0.816018	6.864490e-52	-8.615850e-47
Msa0144010	Msa0340870	-0.808274	3.356814e-50	-8.615850e-47
Msa0144010	Msa0343230	-0.800795	1.218883e-48	-8.615850e-47
Msa0144010	Msa0349910	0.826360	2.831593e-54	-8.615850e-47
Msa0144010	Msa0349930	0.801461	8.907124e-49	-8.615850e-47
Msa0144010	Msa0364030	-0.825172	5.417064e-54	-8.615850e-47
Msa0144010	Msa0364910	-0.810482	1.127447e-50	-8.615850e-47
Msa0144010	Msa0367590	-0.831798	1.360468e-55	-8.615850e-47
Msa0144010	Msa0370350	-0.805851	1.093295e-49	-8.615850e-47
Msa0144010	Msa0371350	-0.803440	3.482027e-49	-8.615850e-47
Msa0144010	Msa0372100	0.802396	5.721998e-49	-8.615850e-47
Msa0144010	Msa0375570	-0.833459	5.269107e-56	-8.615850e-47
Msa0144010	Msa0380680	0.804684	1.919716e-49	-8.615850e-47
Msa0144010	Msa0384150	-0.810600	1.063509e-50	-8.615850e-47
Msa0144010	Msa0403740	-0.826100	3.264453e-54	-8.615850e-47
Msa0144010	Msa0404880	-0.802836	4.644795e-49	-8.615850e-47
Msa0144010	Msa0412580	-0.808073	3.704242e-50	-8.615850e-47
Msa0144010	Msa0419420	-0.832630	8.472119e-56	-8.615850e-47
Msa0144010	Msa0422230	-0.800146	1.652504e-48	-8.615850e-47
Msa0144010	Msa0424220	-0.835530	1.590428e-56	-8.615850e-47
Msa0144010	Msa0426030	0.804108	2.530189e-49	-8.615850e-47
Msa0144010	Msa0426170	0.806327	8.681460e-50	-8.615850e-47
Msa0144010	Msa0427260	-0.807666	4.521255e-50	-8.615850e-47
Msa0144010	Msa0428300	-0.808795	2.598822e-50	-8.615850e-47
Msa0144010	Msa0428720	-0.805003	1.645986e-49	-8.615850e-47
Msa0144010	Msa0430040	-0.812770	3.586220e-51	-8.615850e-47
Msa0144010	Msa0430320	0.811398	7.141449e-51	-8.615850e-47
Msa0144010	Msa0430460	0.829171	5.974422e-55	-8.615850e-47
Msa0144010	Msa0433090	0.811480	6.856250e-51	-8.615850e-47
Msa0144010	Msa0434820	-0.831157	1.957166e-55	-8.615850e-47
Msa0144010	Msa0444200	0.821060	4.933653e-53	-8.615850e-47
Msa0144010	Msa0444210	0.804117	2.519075e-49	-8.615850e-47
Msa0144010	Msa0450890	-0.810322	1.221054e-50	-8.615850e-47
Msa0144010	Msa0456450	-0.824690	7.040124e-54	-8.615850e-47
Msa0144010	Msa0457070	-0.824295	8.722908e-54	-8.615850e-47
Msa0144010	Msa0460220	-0.805932	1.051120e-49	-8.615850e-47
Msa0144010	Msa0471130	-0.834040	3.771016e-56	-8.615850e-47
Msa0144010	Msa0472390	0.801563	8.487512e-49	-8.615850e-47
Msa0144010	Msa0478730	-0.828306	9.675135e-55	-8.615850e-47
Msa0144010	Msa0481670	0.807620	4.624645e-50	-8.615850e-47
Msa0144010	Msa0483090	-0.826552	2.547630e-54	-8.615850e-47
Msa0144010	Msa0485260	-0.813481	2.504910e-51	-8.615850e-47
Msa0144010	Msa0491770	0.835289	1.830119e-56	-8.615850e-47
Msa0144010	Msa0516340	-0.805097	1.573118e-49	-8.615850e-47
Msa0144010	Msa0519070	-0.803738	3.021002e-49	-8.615850e-47
Msa0144010	Msa0521940	0.802153	6.420885e-49	-8.615850e-47
Msa0144010	Msa0522810	-0.824057	9.921901e-54	-8.615850e-47
Msa0144010	Msa0523400	-0.807430	5.075206e-50	-8.615850e-47
Msa0144010	Msa0524710	0.811118	8.214546e-51	-8.615850e-47
Msa0144010	Msa0527210	-0.806294	8.821104e-50	-8.615850e-47
Msa0144010	Msa0529360	0.803756	2.994621e-49	-8.615850e-47
Msa0144010	Msa0530220	-0.817571	3.077894e-52	-8.615850e-47
Msa0144010	Msa0530250	-0.806324	8.694466e-50	-8.615850e-47
Msa0144010	Msa0531030	0.805423	1.344690e-49	-8.615850e-47
Msa0144010	Msa0531080	0.806658	7.391343e-50	-8.615850e-47
Msa0144010	Msa0533140	-0.820973	5.167005e-53	-8.615850e-47
Msa0144010	Msa0538050	-0.821258	4.443523e-53	-8.615850e-47
Msa0144010	Msa0538520	0.800331	1.515627e-48	-8.615850e-47
Msa0144010	Msa0552660	-0.808704	2.716812e-50	-8.615850e-47
Msa0144010	Msa0559640	-0.811020	8.626257e-51	-8.615850e-47
Msa0144010	Msa0565150	-0.819041	1.430320e-52	-8.615850e-47
Msa0144010	Msa0566090	-0.817277	3.584785e-52	-8.615850e-47
Msa0144010	Msa0567330	0.812527	4.053428e-51	-8.615850e-47
Msa0144010	Msa0567570	0.827624	1.411267e-54	-8.615850e-47
Msa0144010	Msa0568460	-0.817162	3.804389e-52	-8.615850e-47
Msa0144010	Msa0575950	0.827934	1.189174e-54	-8.615850e-47
Msa0144010	Msa0576320	0.816476	5.422748e-52	-8.615850e-47
Msa0144010	Msa0576500	-0.824499	7.810271e-54	-8.615850e-47
Msa0144010	Msa0577050	-0.802571	5.266894e-49	-8.615850e-47
Msa0144010	Msa0580410	-0.806025	1.004898e-49	-8.615850e-47
Msa0144010	Msa0582270	-0.803902	2.793013e-49	-8.615850e-47
Msa0144010	Msa0585720	-0.826538	2.567876e-54	-8.615850e-47
Msa0144010	Msa0587180	0.819317	1.237300e-52	-8.615850e-47
Msa0144010	Msa0587730	0.838389	2.961475e-57	-8.615850e-47
Msa0144010	Msa0601470	-0.805812	1.114378e-49	-8.615850e-47
Msa0144010	Msa0605400	0.815806	7.653126e-52	-8.615850e-47
Msa0144010	Msa0605470	0.819647	1.040426e-52	-8.615850e-47
Msa0144010	Msa0608940	-0.803910	2.781989e-49	-8.615850e-47
Msa0144010	Msa0612880	-0.845506	3.893578e-59	-8.615850e-47
Msa0144010	Msa0619300	0.827410	1.588638e-54	-8.615850e-47
Msa0144010	Msa0619390	-0.800315	1.526805e-48	-8.615850e-47
Msa0144010	Msa0619690	-0.804860	1.763444e-49	-8.615850e-47
Msa0144010	Msa0622800	-0.825209	5.311592e-54	-8.615850e-47
Msa0144010	Msa0623310	0.816562	5.187790e-52	-8.615850e-47
Msa0144010	Msa0623980	0.806260	8.965935e-50	-8.615850e-47
Msa0144010	Msa0624930	0.813524	2.450654e-51	-8.615850e-47
Msa0144010	Msa0625900	-0.820790	5.692648e-53	-8.615850e-47
Msa0144010	Msa0638300	-0.813417	2.586576e-51	-8.615850e-47
Msa0144010	Msa0649250	-0.807871	4.089345e-50	-8.615850e-47
Msa0144010	Msa0651090	0.804356	2.247203e-49	-8.615850e-47
Msa0144010	Msa0653500	-0.801087	1.062115e-48	-8.615850e-47
Msa0144010	Msa0654560	-0.804925	1.709242e-49	-8.615850e-47
Msa0144010	Msa0656570	-0.802470	5.525800e-49	-8.615850e-47
Msa0144010	Msa0659020	-0.819171	1.335860e-52	-8.615850e-47
Msa0144010	Msa0663580	-0.817731	2.832542e-52	-8.615850e-47
Msa0144010	Msa0663690	-0.821134	4.745443e-53	-8.615850e-47
Msa0144010	Msa0667840	-0.801407	9.138089e-49	-8.615850e-47
Msa0144010	Msa0670360	0.809178	2.151148e-50	-8.615850e-47
Msa0144010	Msa0671400	0.820908	5.349755e-53	-8.615850e-47
Msa0144010	Msa0673940	0.819979	8.737122e-53	-8.615850e-47
Msa0144010	Msa0678620	0.804258	2.355327e-49	-8.615850e-47
Msa0144010	Msa0685390	-0.823470	1.361491e-53	-8.615850e-47
Msa0144010	Msa0689840	0.800673	1.290491e-48	-8.615850e-47
Msa0144010	Msa0691740	-0.810072	1.382074e-50	-8.615850e-47
Msa0144010	Msa0696600	-0.813066	3.089430e-51	-8.615850e-47
Msa0144010	Msa0701460	-0.814751	1.313715e-51	-8.615850e-47
Msa0144010	Msa0701530	-0.810153	1.327893e-50	-8.615850e-47
Msa0144010	Msa0702020	-0.813572	2.391995e-51	-8.615850e-47
Msa0144010	Msa0702360	-0.811824	5.772037e-51	-8.615850e-47
Msa0144010	Msa0702560	-0.813281	2.771559e-51	-8.615850e-47
Msa0144010	Msa0702690	-0.813531	2.441728e-51	-8.615850e-47
Msa0144010	Msa0704690	0.817201	3.728990e-52	-8.615850e-47
Msa0144010	Msa0705810	-0.827350	1.642139e-54	-8.615850e-47
Msa0144010	Msa0707880	-0.812465	4.182622e-51	-8.615850e-47
Msa0144010	Msa0708020	0.822726	2.030848e-53	-8.615850e-47
Msa0144010	Msa0711240	0.823319	1.476628e-53	-8.615850e-47
Msa0144010	Msa0714060	-0.805265	1.450921e-49	-8.615850e-47
Msa0144010	Msa0714200	-0.801768	7.704078e-49	-8.615850e-47
Msa0144010	Msa0714230	-0.804116	2.520351e-49	-8.615850e-47
Msa0144010	Msa0717030	0.803993	2.674102e-49	-8.615850e-47
Msa0144010	Msa0717540	-0.805094	1.576101e-49	-8.615850e-47
Msa0144010	Msa0727480	0.827617	1.416837e-54	-8.615850e-47
Msa0144010	Msa0730250	-0.815311	9.864544e-52	-8.615850e-47
Msa0144010	Msa0732970	0.813152	2.958330e-51	-8.615850e-47
Msa0144010	Msa0734700	0.816269	6.033728e-52	-8.615850e-47
Msa0144010	Msa0741600	-0.801010	1.101440e-48	-8.615850e-47
Msa0144010	Msa0742690	-0.800660	1.298293e-48	-8.615850e-47
Msa0144010	Msa0750490	-0.806629	7.497523e-50	-8.615850e-47
Msa0144010	Msa0750790	0.813818	2.110756e-51	-8.615850e-47
Msa0144010	Msa0754020	-0.805970	1.032118e-49	-8.615850e-47
Msa0144010	Msa0756440	-0.808950	2.407441e-50	-8.615850e-47
Msa0144010	Msa0756670	-0.809926	1.486414e-50	-8.615850e-47
Msa0144010	Msa0758000	0.800297	1.539373e-48	-8.615850e-47
Msa0144010	Msa0758880	-0.804130	2.503642e-49	-8.615850e-47
Msa0144010	Msa0761830	0.813743	2.192778e-51	-8.615850e-47
Msa0144010	Msa0768670	0.812632	3.844908e-51	-8.615850e-47
Msa0144010	Msa0768720	0.801196	1.009067e-48	-8.615850e-47
Msa0144010	Msa0769910	-0.803690	3.090868e-49	-8.615850e-47
Msa0144010	Msa0770540	-0.810063	1.388534e-50	-8.615850e-47
Msa0144010	Msa0772160	-0.805126	1.551415e-49	-8.615850e-47
Msa0144010	Msa0773960	0.801159	1.027180e-48	-8.615850e-47
Msa0144010	Msa0775220	0.800136	1.660223e-48	-8.615850e-47
Msa0144010	Msa0787860	0.806417	8.309689e-50	-8.615850e-47
Msa0144010	Msa0792410	0.813798	2.132545e-51	-8.615850e-47
Msa0144010	Msa0795910	-0.805298	1.427925e-49	-8.615850e-47
Msa0144010	Msa0801920	-0.803594	3.235422e-49	-8.615850e-47
Msa0144010	Msa0802950	-0.809793	1.587674e-50	-8.615850e-47
Msa0144010	Msa0806930	0.800333	1.513968e-48	-8.615850e-47
Msa0144010	Msa0812610	0.811273	7.603078e-51	-8.615850e-47
Msa0144010	Msa0813840	0.805274	1.445045e-49	-8.615850e-47
Msa0144010	Msa0816140	0.800964	1.125439e-48	-8.615850e-47
Msa0144010	Msa0822680	-0.807538	4.812500e-50	-8.615850e-47
Msa0144010	Msa0824850	0.806547	7.802754e-50	-8.615850e-47
Msa0144010	Msa0828350	0.845377	4.218758e-59	-8.615850e-47
Msa0144010	Msa0829770	-0.817883	2.616619e-52	-8.615850e-47
Msa0144010	Msa0831890	0.804529	2.067491e-49	-8.615850e-47
Msa0144010	Msa0833030	-0.801347	9.397098e-49	-8.615850e-47
Msa0144010	Msa0833360	-0.804930	1.705077e-49	-8.615850e-47
Msa0144010	Msa0836060	-0.809224	2.103241e-50	-8.615850e-47
Msa0144010	Msa0838120	-0.801158	1.027498e-48	-8.615850e-47
Msa0144010	Msa0842180	0.810380	1.186364e-50	-8.615850e-47
Msa0144010	Msa0847140	0.839059	1.986875e-57	-8.615850e-47
Msa0144010	Msa0848720	-0.805146	1.536787e-49	-8.615850e-47
Msa0144010	Msa0849290	-0.804000	2.665355e-49	-8.615850e-47
Msa0144010	Msa0852890	0.808759	2.645462e-50	-8.615850e-47
Msa0144010	Msa0861400	-0.809327	1.998802e-50	-8.615850e-47
Msa0144010	Msa0863860	0.800725	1.259338e-48	-8.615850e-47
Msa0144010	Msa0864160	0.807183	5.723355e-50	-8.615850e-47
Msa0144010	Msa0871420	0.823524	1.322633e-53	-8.615850e-47
Msa0144010	Msa0876030	-0.812757	3.610354e-51	-8.615850e-47
Msa0144010	Msa0883640	0.803378	3.586402e-49	-8.615850e-47
Msa0144010	Msa0888900	-0.803745	3.011067e-49	-8.615850e-47
Msa0144010	Msa0896920	0.819906	9.079632e-53	-8.615850e-47
Msa0144010	Msa0896950	0.801037	1.087417e-48	-8.615850e-47
Msa0144010	Msa0898830	-0.801058	1.076835e-48	-8.615850e-47
Msa0144010	Msa0902340	0.808881	2.490285e-50	-8.615850e-47
Msa0144010	Msa0906100	-0.812550	4.006680e-51	-8.615850e-47
Msa0144010	Msa0906680	0.801258	9.803247e-49	-8.615850e-47
Msa0144010	Msa0910830	0.817328	3.491449e-52	-8.615850e-47
Msa0144010	Msa0913520	0.805747	1.149876e-49	-8.615850e-47
Msa0144010	Msa0931370	0.804421	2.177466e-49	-8.615850e-47
Msa0144010	Msa0933610	0.802858	4.595277e-49	-8.615850e-47
Msa0144010	Msa0936630	0.813999	1.926059e-51	-8.615850e-47
Msa0144010	Msa0938150	-0.806013	1.010649e-49	-8.615850e-47
Msa0144010	Msa0941150	-0.822318	2.526400e-53	-8.615850e-47
Msa0144010	Msa0941520	0.803324	3.681448e-49	-8.615850e-47
Msa0144010	Msa0943870	-0.806634	7.479407e-50	-8.615850e-47
Msa0144010	Msa0960090	0.806333	8.654692e-50	-8.615850e-47
Msa0144010	Msa0967900	-0.822444	2.361209e-53	-8.615850e-47
Msa0144010	Msa0975440	-0.807812	4.208984e-50	-8.615850e-47
Msa0144010	Msa0978290	-0.814950	1.186694e-51	-8.615850e-47
Msa0144010	Msa0978980	0.802012	6.866137e-49	-8.615850e-47
Msa0144010	Msa0985700	0.802051	6.737983e-49	-8.615850e-47
Msa0144010	Msa0987670	0.811959	5.392958e-51	-8.615850e-47
Msa0144010	Msa1003110	0.848060	7.795270e-60	-8.615850e-47
Msa0144010	Msa1006170	0.804039	2.615340e-49	-8.615850e-47
Msa0144010	Msa1007930	0.801021	1.095835e-48	-8.615850e-47
Msa0144010	Msa1021620	0.849844	2.490978e-60	-8.615850e-47
Msa0144010	Msa1022580	0.804616	1.983450e-49	-8.615850e-47
Msa0144010	Msa1024350	0.802457	5.560069e-49	-8.615850e-47
Msa0144010	Msa1025440	-0.815438	9.246276e-52	-8.615850e-47
Msa0144010	Msa1031530	-0.809663	1.693057e-50	-8.615850e-47
Msa0144010	Msa1036020	0.823729	1.184242e-53	-8.615850e-47
Msa0144010	Msa1036260	-0.810937	8.992534e-51	-8.615850e-47
Msa0144010	Msa1036590	0.807002	6.252693e-50	-8.615850e-47
Msa0144010	Msa1039150	-0.809257	2.069499e-50	-8.615850e-47
Msa0144010	Msa1040330	0.817407	3.351880e-52	-8.615850e-47
Msa0144010	Msa1042300	0.801330	9.472509e-49	-8.615850e-47
Msa0144010	Msa1043020	-0.801613	8.291294e-49	-8.615850e-47
Msa0144010	Msa1044050	-0.802124	6.510099e-49	-8.615850e-47
Msa0144010	Msa1044790	-0.822736	2.019758e-53	-8.615850e-47
Msa0144010	Msa1057940	-0.805903	1.066065e-49	-8.615850e-47
Msa0144010	Msa1061670	0.807736	4.369291e-50	-8.615850e-47
Msa0144010	Msa1066790	-0.800657	1.300475e-48	-8.615850e-47
Msa0144010	Msa1070630	-0.819228	1.296716e-52	-8.615850e-47
Msa0144010	Msa1076280	0.801703	7.946372e-49	-8.615850e-47
Msa0144010	Msa1076830	0.833314	5.727206e-56	-8.615850e-47
Msa0144010	Msa1076900	0.806183	9.309436e-50	-8.615850e-47
Msa0144010	Msa1078300	0.818949	1.500700e-52	-8.615850e-47
Msa0144010	Msa1078590	-0.816899	4.358309e-52	-8.615850e-47
Msa0144010	Msa1078600	-0.826511	2.606031e-54	-8.615850e-47
Msa0144010	Msa1078760	-0.814145	1.788161e-51	-8.615850e-47
Msa0144010	Msa1078770	-0.824380	8.327353e-54	-8.615850e-47
Msa0144010	Msa1083660	-0.810355	1.201256e-50	-8.615850e-47
Msa0144010	Msa1085560	0.828234	1.006636e-54	-8.615850e-47
Msa0144010	Msa1085820	0.805491	1.301143e-49	-8.615850e-47
Msa0144010	Msa1087380	0.802473	5.517767e-49	-8.615850e-47
Msa0144010	Msa1091000	0.803640	3.165274e-49	-8.615850e-47
Msa0144010	Msa1093190	-0.810983	8.786873e-51	-8.615850e-47
Msa0144010	Msa1096520	-0.804154	2.474787e-49	-8.615850e-47
Msa0144010	Msa1096570	-0.809144	2.188009e-50	-8.615850e-47
Msa0144010	Msa1107330	0.801254	9.821885e-49	-8.615850e-47
Msa0144010	Msa1109500	-0.837989	3.752096e-57	-8.615850e-47
Msa0144010	Msa1109540	0.819976	8.751607e-53	-8.615850e-47
Msa0144010	Msa1109880	0.815398	9.436554e-52	-8.615850e-47
Msa0144010	Msa1109890	0.804990	1.656670e-49	-8.615850e-47
Msa0144010	Msa1122550	0.802605	5.181545e-49	-8.615850e-47
Msa0144010	Msa1122710	-0.812044	5.168967e-51	-8.615850e-47
Msa0144010	Msa1124220	0.807468	4.981345e-50	-8.615850e-47
Msa0144010	Msa1127200	0.818582	1.818415e-52	-8.615850e-47
Msa0144010	Msa1130770	0.803026	4.241735e-49	-8.615850e-47
Msa0144010	Msa1132880	-0.807320	5.354155e-50	-8.615850e-47
Msa0144010	Msa1133860	0.844275	8.361106e-59	-8.615850e-47
Msa0144010	Msa1136770	-0.807138	5.852070e-50	-8.615850e-47
Msa0144010	Msa1136890	-0.805692	1.180453e-49	-8.615850e-47
Msa0144010	Msa1136970	-0.809503	1.832323e-50	-8.615850e-47
Msa0144010	Msa1143860	-0.818442	1.956259e-52	-8.615850e-47
Msa0144010	Msa1149020	0.825590	4.313385e-54	-8.615850e-47
Msa0144010	Msa1156430	-0.802038	6.779643e-49	-8.615850e-47
Msa0144010	Msa1158450	-0.817461	3.259137e-52	-8.615850e-47
Msa0144010	Msa1163670	0.826975	2.019578e-54	-8.615850e-47
Msa0144010	Msa1165860	0.800449	1.433459e-48	-8.615850e-47
Msa0144010	Msa1169590	-0.807071	6.046994e-50	-8.615850e-47
Msa0144010	Msa1169600	-0.826506	2.613541e-54	-8.615850e-47
Msa0144010	Msa1170320	0.820209	7.740134e-53	-8.615850e-47
Msa0144010	Msa1186670	0.801832	7.474606e-49	-8.615850e-47
Msa0144010	Msa1187750	0.811409	7.104751e-51	-8.615850e-47
Msa0144010	Msa1190350	-0.804026	2.631751e-49	-8.615850e-47
Msa0144010	Msa1191530	-0.821133	4.746452e-53	-8.615850e-47
Msa0144010	Msa1191960	-0.818407	1.991940e-52	-8.615850e-47
Msa0144010	Msa1194480	-0.827152	1.831812e-54	-8.615850e-47
Msa0144010	Msa1199540	-0.803118	4.060813e-49	-8.615850e-47
Msa0144010	Msa1202220	-0.800398	1.468239e-48	-8.615850e-47
Msa0144010	Msa1205120	0.804120	2.515524e-49	-8.615850e-47
Msa0144010	Msa1205270	-0.812377	4.371319e-51	-8.615850e-47
Msa0144010	Msa1206030	0.820845	5.529992e-53	-8.615850e-47
Msa0144010	Msa1209990	-0.805003	1.645982e-49	-8.615850e-47
Msa0144010	Msa1214960	0.802437	5.613331e-49	-8.615850e-47
Msa0144010	Msa1217890	0.817894	2.602370e-52	-8.615850e-47
Msa0144010	Msa1220720	0.821263	4.430266e-53	-8.615850e-47
Msa0144010	Msa1224820	-0.813205	2.880397e-51	-8.615850e-47
Msa0144010	Msa1225140	-0.818204	2.214360e-52	-8.615850e-47
Msa0144010	Msa1228600	-0.814875	1.232837e-51	-8.615850e-47
Msa0144010	Msa1240240	-0.805666	1.195506e-49	-8.615850e-47
Msa0144010	Msa1243630	-0.805018	1.634361e-49	-8.615850e-47
Msa0144010	Msa1244220	-0.803058	4.177786e-49	-8.615850e-47
Msa0144010	Msa1255030	-0.810603	1.061701e-50	-8.615850e-47
Msa0144010	Msa1255710	0.803903	2.791583e-49	-8.615850e-47
Msa0144010	Msa1263520	0.805076	1.589620e-49	-8.615850e-47
Msa0144010	Msa1265570	0.828651	7.983775e-55	-8.615850e-47
Msa0144010	Msa1266120	-0.811757	5.968968e-51	-8.615850e-47
Msa0144010	Msa1269500	0.813540	2.431093e-51	-8.615850e-47
Msa0144010	Msa1270860	-0.814068	1.859451e-51	-8.615850e-47
Msa0144010	Msa1273320	0.814456	1.526232e-51	-8.615850e-47
Msa0144010	Msa1279200	-0.808890	2.479708e-50	-8.615850e-47
Msa0144010	Msa1283980	0.801054	1.079001e-48	-8.615850e-47
Msa0144010	Msa1286860	-0.825061	5.755777e-54	-8.615850e-47
Msa0144010	Msa1288970	-0.830286	3.199654e-55	-8.615850e-47
Msa0144010	Msa1290090	-0.832681	8.226452e-56	-8.615850e-47
Msa0144010	Msa1291070	-0.814376	1.590204e-51	-8.615850e-47
Msa0144010	Msa1295210	-0.808393	3.166992e-50	-8.615850e-47
Msa0144010	Msa1296270	-0.811344	7.338755e-51	-8.615850e-47
Msa0144010	Msa1297220	-0.818780	1.639479e-52	-8.615850e-47
Msa0144010	Msa1298480	-0.806039	9.981814e-50	-8.615850e-47
Msa0144010	Msa1301610	-0.817860	2.648095e-52	-8.615850e-47
Msa0144010	Msa1308010	-0.804681	1.922539e-49	-8.615850e-47
Msa0144010	Msa1320660	-0.831519	1.594430e-55	-8.615850e-47
Msa0144010	Msa1323120	0.846322	2.335869e-59	-8.615850e-47
Msa0144010	Msa1323260	-0.825599	4.293441e-54	-8.615850e-47
Msa0144010	Msa1327690	-0.803528	3.339310e-49	-8.615850e-47
Msa0144010	Msa1328680	-0.804818	1.799731e-49	-8.615850e-47
Msa0144010	Msa1328860	0.822609	2.161577e-53	-8.615850e-47
Msa0144010	Msa1330910	-0.802537	5.351957e-49	-8.615850e-47
Msa0144010	Msa1331530	-0.801398	9.173911e-49	-8.615850e-47
Msa0144010	Msa1334670	0.829420	5.199574e-55	-8.615850e-47
Msa0144010	Msa1335200	-0.810689	1.017345e-50	-8.615850e-47
Msa0144010	Msa1335210	-0.800449	1.433522e-48	-8.615850e-47
Msa0144010	Msa1339530	0.805812	1.114191e-49	-8.615850e-47
Msa0144010	Msa1342360	-0.824962	6.075332e-54	-8.615850e-47
Msa0144010	Msa1343450	-0.826780	2.247591e-54	-8.615850e-47
Msa0144010	Msa1346220	-0.804324	2.281346e-49	-8.615850e-47
Msa0144010	Msa1346340	-0.815241	1.022341e-51	-8.615850e-47
Msa0144010	Msa1348860	-0.832760	7.865770e-56	-8.615850e-47
Msa0144010	Msa1349420	0.822767	1.985718e-53	-8.615850e-47
Msa0144010	Msa1350580	-0.817465	3.251285e-52	-8.615850e-47
Msa0144010	Msa1352630	-0.802472	5.519315e-49	-8.615850e-47
Msa0144010	Msa1357840	0.809162	2.168262e-50	-8.615850e-47
Msa0144010	Msa1362590	0.832287	1.030130e-55	-8.615850e-47
Msa0144010	Msa1364690	0.813335	2.696385e-51	-8.615850e-47
Msa0144010	Msa1365130	-0.822840	1.909772e-53	-8.615850e-47
Msa0144010	Msa1365230	0.826696	2.354775e-54	-8.615850e-47
Msa0144010	Msa1365850	0.802449	5.580454e-49	-8.615850e-47
Msa0144010	Msa1366140	-0.801446	8.969224e-49	-8.615850e-47
Msa0144010	Msa1367900	-0.821040	4.987616e-53	-8.615850e-47
Msa0144010	Msa1369180	-0.820999	5.096479e-53	-8.615850e-47
Msa0144010	Msa1369390	-0.806049	9.935545e-50	-8.615850e-47
Msa0144010	Msa1369400	-0.810050	1.397517e-50	-8.615850e-47
Msa0144010	Msa1371540	-0.811541	6.649397e-51	-8.615850e-47
Msa0144010	Msa1371800	0.825405	4.773707e-54	-8.615850e-47
Msa0144010	Msa1375640	0.805004	1.645227e-49	-8.615850e-47
Msa0144010	Msa1376010	-0.816371	5.725621e-52	-8.615850e-47
Msa0144010	Msa1376070	0.846158	2.589201e-59	-8.615850e-47
Msa0144010	Msa1376310	0.822070	2.883772e-53	-8.615850e-47
Msa0144010	Msa1377460	0.811421	7.060713e-51	-8.615850e-47
Msa0144010	Msa1377520	0.839015	2.039835e-57	-8.615850e-47
Msa0144010	Msa1378840	-0.820758	5.792103e-53	-8.615850e-47
Msa0144010	Msa1379270	-0.835362	1.753866e-56	-8.615850e-47
Msa0144010	Msa1381300	-0.808268	3.365964e-50	-8.615850e-47
Msa0144010	Msa1382100	-0.812880	3.393681e-51	-8.615850e-47
Msa0144010	Msa1384410	-0.809213	2.114153e-50	-8.615850e-47
Msa0144010	Msa1384970	-0.808271	3.361636e-50	-8.615850e-47
Msa0144010	Msa1387100	-0.830242	3.279646e-55	-8.615850e-47
Msa0144010	Msa1388270	-0.806263	8.956733e-50	-8.615850e-47
Msa0144010	Msa1392570	-0.832579	8.724410e-56	-8.615850e-47
Msa0144010	Msa1395720	0.800014	1.757677e-48	-8.615850e-47
Msa0144010	Msa1405830	0.802434	5.619531e-49	-8.615850e-47
Msa0144010	Msa1407810	0.818206	2.212227e-52	-8.615850e-47
Msa0144010	Msa1408860	-0.800024	1.749335e-48	-8.615850e-47
Msa0144010	Msa1409600	0.802022	6.832062e-49	-8.615850e-47
Msa0144010	Msa1412740	-0.804508	2.089061e-49	-8.615850e-47
Msa0144010	Msa1412810	-0.803897	2.799489e-49	-8.615850e-47
Msa0144010	Msa1414000	-0.835075	2.071855e-56	-8.615850e-47
Msa0144010	Msa1418210	-0.815920	7.218123e-52	-8.615850e-47
Msa0144010	Msa1418840	-0.817348	3.454776e-52	-8.615850e-47
Msa0144010	Msa1421130	0.833379	5.517399e-56	-8.615850e-47
Msa0144010	Msa1421540	0.811545	6.636327e-51	-8.615850e-47
Msa0144010	Msa1422150	-0.833944	3.986726e-56	-8.615850e-47
Msa0144010	Msa1427600	-0.819340	1.222520e-52	-8.615850e-47
Msa0144010	Msa1430630	-0.823653	1.233533e-53	-8.615850e-47
Msa0144010	Msa1434700	0.828937	6.808123e-55	-8.615850e-47
Msa0144010	Msa1436660	-0.817848	2.665020e-52	-8.615850e-47
Msa0144010	Msa1437590	0.809158	2.172677e-50	-8.615850e-47
Msa0144010	Msa1437780	0.818256	2.155553e-52	-8.615850e-47
Msa0144010	Msa1449770	0.803976	2.695318e-49	-8.615850e-47
Msa0144010	Msa1450630	-0.802129	6.495047e-49	-8.615850e-47
Msa0144010	Msa1450780	-0.809246	2.079914e-50	-8.615850e-47
Msa0144010	Msa1453180	-0.804869	1.755934e-49	-8.615850e-47
Msa0144010	Msa1456620	-0.801928	7.141724e-49	-8.615850e-47
Msa0144010	Msa1458270	0.801048	1.082298e-48	-8.615850e-47
Msa0144010	Msa1459610	0.812153	4.891898e-51	-8.615850e-47
Msa0144010	Msa1461660	0.800519	1.387206e-48	-8.615850e-47
Msa0144010	Msa1462610	0.810414	1.166469e-50	-8.615850e-47
Msa0144010	Msa1463500	-0.805071	1.593115e-49	-8.615850e-47
Msa0144010	Msa1464470	-0.812424	4.269192e-51	-8.615850e-47

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0144010	MtrunA17_Chr1g0160011	88.172	372	23	2	215	565	11	382	0.0	657
Msa0144010	MtrunA17_Chr1g0160011	73.413	252	27	2	1	212	131	382	6.16e-120	359
Msa0144010	MtrunA17_Chr1g0160031	81.283	374	50	1	215	568	11	384	0.0	622
Msa0144010	MtrunA17_Chr1g0160031	70.079	254	36	2	2	215	131	384	2.13e-114	345
Msa0144010	MtrunA17_Chr1g0159991	78.836	378	58	2	213	568	6	383	0.0	597
Msa0144010	MtrunA17_Chr1g0159991	78.599	257	13	2	1	215	127	383	5.48e-132	390
Msa0144010	MtrunA17_Chr1g0159981	73.657	391	75	3	206	568	3	393	0.0	567
Msa0144010	MtrunA17_Chr1g0159981	75.486	257	21	2	1	215	137	393	1.24e-129	384
Msa0144010	MtrunA17_Chr1g0159971	63.243	370	112	3	222	567	24	393	1.08e-167	481
Msa0144010	MtrunA17_Chr1g0159971	60.784	255	58	2	2	214	139	393	1.01e-102	315
Msa0144010	MtrunA17_Chr1g0160101	56.878	378	138	4	214	567	13	389	7.60e-146	426
Msa0144010	MtrunA17_Chr1g0160101	55.118	254	72	2	3	214	136	389	1.38e-86	273
Msa0144010	MtrunA17_Chr7g0254461	52.800	375	151	5	219	567	19	393	5.50e-135	398
Msa0144010	MtrunA17_Chr7g0254461	48.450	258	88	4	2	214	136	393	9.79e-75	243
Msa0144010	MtrunA17_Chr8g0381581	51.902	368	152	5	219	561	16	383	2.25e-129	384
Msa0144010	MtrunA17_Chr8g0381581	46.032	252	91	4	2	208	132	383	3.16e-69	228
Msa0144010	MtrunA17_Chr7g0226941	46.089	358	166	5	235	567	25	380	6.05e-102	313
Msa0144010	MtrunA17_Chr7g0226941	40.625	256	107	5	3	214	126	380	1.78e-53	186
Msa0144010	MtrunA17_Chr6g0450701	42.659	361	168	8	233	565	29	378	7.71e-87	274
Msa0144010	MtrunA17_Chr6g0450701	36.965	257	114	6	2	212	124	378	2.44e-41	153
Msa0144010	MtrunA17_Chr7g0273101	43.767	361	168	10	232	563	18	372	1.24e-84	268
Msa0144010	MtrunA17_Chr7g0273101	36.800	250	109	6	4	206	121	368	1.92e-39	148
Msa0144010	MtrunA17_Chr7g0226931	39.075	389	188	8	223	565	13	398	3.72e-81	259
Msa0144010	MtrunA17_Chr7g0226931	31.868	273	127	6	3	216	130	402	3.70e-37	142
Msa0144010	MtrunA17_Chr7g0275291	39.211	380	195	8	214	565	4	375	6.28e-81	258
Msa0144010	MtrunA17_Chr7g0275291	32.812	256	120	6	3	212	126	375	1.45e-32	129
Msa0144010	MtrunA17_Chr7g0226911	37.008	381	203	8	219	565	7	384	2.89e-80	257
Msa0144010	MtrunA17_Chr7g0226911	32.319	263	128	6	3	216	127	388	1.93e-37	142
Msa0144010	MtrunA17_Chr6g0450711	40.669	359	174	8	236	566	115	462	6.12e-76	248
Msa0144010	MtrunA17_Chr6g0450711	36.434	258	116	6	2	213	207	462	2.65e-40	152
Msa0144010	MtrunA17_Chr1g0191461	39.084	371	190	10	219	560	7	370	2.00e-74	241
Msa0144010	MtrunA17_Chr1g0191461	34.000	250	117	5	3	206	122	369	2.63e-34	133
Msa0144010	MtrunA17_Chr8g0352901	39.005	382	187	10	217	565	4	372	5.74e-74	240
Msa0144010	MtrunA17_Chr8g0352901	36.328	256	114	6	6	212	117	372	9.66e-40	149
Msa0144010	MtrunA17_Chr6g0450731	39.216	357	173	9	235	566	25	362	6.28e-74	239
Msa0144010	MtrunA17_Chr6g0450731	34.959	246	125	6	2	213	118	362	9.91e-42	154
Msa0144010	MtrunA17_Chr8g0347751	38.997	359	179	7	239	565	32	382	7.51e-74	240
Msa0144010	MtrunA17_Chr8g0347751	29.924	264	123	7	2	212	128	382	2.01e-26	111
Msa0144010	MtrunA17_Chr6g0450721	37.097	372	200	8	217	566	1	360	5.25e-72	234
Msa0144010	MtrunA17_Chr6g0450721	35.950	242	120	5	5	213	121	360	1.25e-40	150
Msa0144010	MtrunA17_Chr7g0271551	36.676	349	177	9	243	566	36	365	8.75e-66	218
Msa0144010	MtrunA17_Chr7g0271551	32.653	245	127	4	4	213	124	365	8.17e-33	129
Msa0144010	MtrunA17_Chr8g0339251	37.059	340	168	10	217	530	4	323	1.14e-54	188
Msa0144010	MtrunA17_Chr8g0339251	37.931	174	86	4	7	166	118	283	1.38e-24	105
Msa0144010	MtrunA17_Chr2g0283481	34.574	376	189	14	223	560	27	383	6.83e-45	163
Msa0144010	MtrunA17_Chr2g0283481	28.947	228	117	8	5	196	154	372	6.55e-15	77.0
Msa0144010	MtrunA17_Chr2g0283531	33.708	356	181	12	241	559	29	366	3.86e-41	152
Msa0144010	MtrunA17_Chr2g0283501	31.892	370	195	13	231	561	18	369	1.02e-39	149
Msa0144010	MtrunA17_Chr3g0104821	32.123	358	185	13	241	559	42	380	1.15e-39	149
Msa0144010	MtrunA17_Chr2g0317261	31.921	354	176	12	241	559	28	351	1.82e-39	147
Msa0144010	MtrunA17_Chr2g0317261	28.889	225	106	9	27	206	136	351	8.48e-14	73.2
Msa0144010	MtrunA17_Chr2g0317271	31.921	354	176	12	241	559	28	351	1.98e-39	147
Msa0144010	MtrunA17_Chr2g0317271	29.279	222	109	9	27	206	136	351	1.46e-13	72.4
Msa0144010	MtrunA17_Chr0c01g0489571	31.356	354	178	12	241	559	28	351	1.46e-38	145
Msa0144010	MtrunA17_Chr0c01g0489571	27.928	222	112	9	27	206	136	351	3.34e-12	68.2
Msa0144010	MtrunA17_Chr0c01g0489581	31.356	354	178	12	241	559	28	351	1.58e-38	145
Msa0144010	MtrunA17_Chr0c01g0489581	27.928	222	112	9	27	206	136	351	3.40e-12	68.2
Msa0144010	MtrunA17_Chr2g0283511	30.460	348	193	10	248	560	36	369	3.40e-36	139
Msa0144010	MtrunA17_Chr2g0283511	28.866	194	102	5	49	206	175	368	3.71e-16	80.5
Msa0144010	MtrunA17_Chr3g0112821	32.958	355	178	14	241	559	28	358	9.90e-36	137
Msa0144010	MtrunA17_Chr4g0057991	29.443	377	208	11	221	561	17	371	1.80e-35	137
Msa0144010	MtrunA17_Chr4g0057991	25.600	250	139	9	3	216	141	379	2.12e-11	65.9
Msa0144010	MtrunA17_Chr2g0301581	31.129	363	206	13	222	559	10	353	7.06e-35	135
Msa0144010	MtrunA17_Chr2g0301581	29.461	241	113	10	3	206	133	353	2.62e-11	65.5
Msa0144010	MtrunA17_Chr3g0093031	32.222	360	179	14	241	559	28	363	7.60e-34	132
Msa0144010	MtrunA17_Chr2g0301541	30.854	363	207	13	222	559	10	353	1.21e-33	131
Msa0144010	MtrunA17_Chr3g0096551	31.707	369	181	14	241	559	27	374	1.42e-33	132
Msa0144010	MtrunA17_Chr3g0112691	30.682	352	193	10	241	559	28	361	8.97e-33	129
Msa0144010	MtrunA17_Chr8g0344941	30.245	367	190	14	220	549	18	355	6.22e-30	121
Msa0144010	MtrunA17_Chr2g0330781	31.138	334	186	14	242	549	30	345	1.47e-29	119
Msa0144010	MtrunA17_Chr2g0330781	25.424	236	125	8	4	202	130	351	6.65e-12	67.4
Msa0144010	MtrunA17_Chr8g0349321	30.060	336	186	10	243	552	37	349	2.75e-29	119
Msa0144010	MtrunA17_Chr4g0027521	31.065	338	193	14	242	554	26	348	2.46e-27	113
Msa0144010	MtrunA17_Chr4g0027521	26.695	236	128	8	2	201	122	348	2.71e-12	68.6
Msa0144010	MtrunA17_Chr8g0341001	30.120	332	192	13	242	549	31	346	2.93e-27	113
Msa0144010	MtrunA17_Chr8g0341001	25.877	228	122	8	4	196	131	346	4.84e-12	67.8
Msa0144010	MtrunA17_Chr8g0349341	28.358	335	193	10	243	552	37	349	3.34e-27	113
Msa0144010	MtrunA17_Chr5g0438631	29.429	350	203	15	223	545	6	338	1.29e-26	111
Msa0144010	MtrunA17_Chr5g0396511	31.287	342	174	15	245	552	48	362	4.75e-26	110
Msa0144010	MtrunA17_Chr2g0301591	31.338	284	157	8	222	491	10	269	4.83e-26	108
Msa0144010	MtrunA17_Chr7g0274991	31.232	349	171	16	243	553	33	350	1.24e-25	108
Msa0144010	MtrunA17_Chr5g0432101	27.401	354	210	15	222	545	8	344	6.13e-25	106
Msa0144010	MtrunA17_Chr5g0432101	26.230	244	130	8	5	212	133	362	2.57e-12	68.6
Msa0144010	MtrunA17_Chr5g0438621	27.841	352	202	15	219	544	13	338	8.48e-25	105
Msa0144010	MtrunA17_Chr7g0275011	30.460	348	173	14	243	552	34	350	8.65e-25	106
Msa0144010	MtrunA17_Chr2g0294311	28.173	394	205	17	206	556	3	361	9.07e-25	106
Msa0144010	MtrunA17_Chr4g0068441	28.448	348	195	12	240	556	32	356	1.22e-24	105
Msa0144010	MtrunA17_Chr8g0374101	28.134	359	193	15	233	552	28	360	3.11e-24	104
Msa0144010	MtrunA17_Chr2g0294301	28.324	346	192	13	243	556	35	356	3.81e-24	104
Msa0144010	MtrunA17_Chr1g0156911	28.691	359	208	14	218	545	4	345	4.65e-24	103
Msa0144010	MtrunA17_Chr1g0182811	30.458	371	193	16	217	552	11	351	7.30e-24	103
Msa0144010	MtrunA17_Chr6g0457921	29.459	370	210	18	219	557	4	353	9.48e-24	103
Msa0144010	MtrunA17_Chr2g0301641	29.179	329	178	11	243	539	43	348	1.21e-23	103
Msa0144010	MtrunA17_Chr7g0275001	29.971	347	179	14	243	553	25	343	1.28e-23	102
Msa0144010	MtrunA17_Chr8g0371481	26.781	351	189	16	237	549	35	355	8.82e-23	100
Msa0144010	MtrunA17_Chr3g0120861	28.070	342	205	16	237	554	32	356	1.46e-22	99.8
Msa0144010	MtrunA17_Chr1g0156891	28.889	360	214	14	222	556	21	363	1.54e-22	99.8
Msa0144010	MtrunA17_Chr1g0156891	26.126	222	119	6	3	190	140	350	1.15e-11	66.6
Msa0144010	MtrunA17_Chr5g0438641	28.650	363	195	17	219	545	7	341	1.94e-22	99.0
Msa0144010	MtrunA17_Chr2g0320671	27.811	338	191	12	242	549	29	343	2.35e-22	99.0
Msa0144010	MtrunA17_Chr1g0189891	28.863	343	182	15	243	553	29	341	2.79e-22	98.6
Msa0144010	MtrunA17_Chr8g0380041	24.409	381	234	11	213	564	3	358	4.55e-22	98.2
Msa0144010	MtrunA17_Chr4g0008851	27.249	378	205	16	214	552	4	350	8.75e-22	97.4
Msa0144010	MtrunA17_Chr8g0349301	30.034	293	159	11	243	509	37	309	1.04e-21	96.3
Msa0144010	MtrunA17_Chr3g0086641	27.049	366	204	14	214	545	10	346	1.10e-21	97.1
Msa0144010	MtrunA17_Chr3g0099151	28.940	349	182	13	242	552	86	406	1.13e-21	97.8
Msa0144010	MtrunA17_Chr3g0131321	25.269	372	218	11	220	558	11	355	1.63e-21	96.7
Msa0144010	MtrunA17_Chr8g0344931	29.586	338	181	9	243	552	37	345	1.70e-21	96.3
Msa0144010	MtrunA17_Chr1g0156921	27.298	359	212	14	213	543	12	349	1.93e-21	96.3
Msa0144010	MtrunA17_Chr8g0349331	27.195	353	176	11	222	545	10	310	2.33e-21	95.5
Msa0144010	MtrunA17_Chr1g0156901	27.190	331	197	14	238	543	45	356	5.26e-21	95.1
Msa0144010	MtrunA17_Chr7g0275021	26.513	347	190	13	243	553	34	351	5.87e-21	95.1
Msa0144010	MtrunA17_Chr2g0285061	24.931	361	212	12	217	545	8	341	1.16e-20	94.0
Msa0144010	MtrunA17_Chr1g0156931	26.822	343	194	13	238	549	36	352	1.52e-20	93.6
Msa0144010	MtrunA17_Chr1g0156931	30.282	142	75	3	76	196	214	352	8.17e-12	67.0
Msa0144010	MtrunA17_Chr3g0105401	28.875	329	192	14	242	545	27	338	3.46e-20	92.4
Msa0144010	MtrunA17_Chr4g0046151	28.763	372	203	20	222	552	16	366	3.60e-20	92.4
Msa0144010	MtrunA17_Chr3g0142921	26.844	339	185	13	238	541	31	341	3.67e-20	92.4
Msa0144010	MtrunA17_Chr3g0077571	26.453	344	189	12	235	545	22	334	4.92e-20	92.0
Msa0144010	MtrunA17_Chr5g0420811	28.614	339	206	12	222	544	12	330	8.74e-20	91.3
Msa0144010	MtrunA17_Chr2g0301551	28.082	292	170	11	289	559	37	309	2.34e-19	89.4
Msa0144010	MtrunA17_Chr2g0301551	29.461	241	113	10	3	206	89	309	2.65e-11	65.1
Msa0144010	MtrunA17_Chr3g0104831	26.644	289	161	10	304	559	29	299	2.40e-19	89.0
Msa0144010	MtrunA17_Chr3g0099231	26.590	346	192	12	242	552	27	345	4.47e-19	89.4
Msa0144010	MtrunA17_Chr3g0085881	27.389	314	200	10	242	544	32	328	5.01e-19	89.0
Msa0144010	MtrunA17_Chr5g0444401	27.350	351	186	17	242	553	27	347	9.03e-19	88.2
Msa0144010	MtrunA17_Chr2g0284991	25.294	340	228	8	219	545	9	335	9.27e-19	88.6
Msa0144010	MtrunA17_Chr1g0189901	27.874	348	184	16	243	553	31	348	1.09e-18	88.2
Msa0144010	MtrunA17_Chr8g0371471	26.000	350	192	16	237	549	35	354	1.98e-18	87.4
Msa0144010	MtrunA17_Chr4g0017431	25.000	380	213	13	222	561	10	357	2.56e-18	87.0
Msa0144010	MtrunA17_Chr2g0284951	25.284	352	207	10	219	544	9	330	6.68e-18	85.9
Msa0144010	MtrunA17_Chr3g0077581	25.538	325	210	11	242	545	35	348	8.87e-18	85.5
Msa0144010	MtrunA17_Chr2g0301571	27.740	292	171	11	289	559	37	309	1.24e-17	84.3
Msa0144010	MtrunA17_Chr8g0380031	27.044	318	198	11	242	544	83	381	1.31e-17	85.1
Msa0144010	MtrunA17_Chr3g0142941	27.168	346	191	15	227	541	36	351	1.68e-17	84.3
Msa0144010	MtrunA17_Chr5g0434621	26.910	301	178	13	275	554	62	341	2.05e-17	84.0
Msa0144010	MtrunA17_Chr3g0085231	25.982	331	200	9	242	552	30	335	2.51e-17	83.6
Msa0144010	MtrunA17_Chr2g0284921	29.245	212	132	6	242	443	33	236	4.07e-17	83.2
Msa0144010	MtrunA17_Chr2g0285001	26.480	321	203	14	242	545	32	336	5.36e-17	83.2
Msa0144010	MtrunA17_Chr5g0405821	27.901	362	215	17	218	547	13	360	1.49e-16	81.6
Msa0144010	MtrunA17_Chr2g0283541	29.464	224	126	7	361	559	76	292	2.73e-16	79.7
Msa0144010	MtrunA17_Chr3g0092131	25.914	301	167	11	278	549	63	336	3.59e-16	80.5
Msa0144010	MtrunA17_Chr3g0104801	40.299	134	70	5	241	366	42	173	5.52e-16	76.3
Msa0144010	MtrunA17_Chr1g0157001	27.303	304	181	13	267	549	63	347	6.48e-16	79.7
Msa0144010	MtrunA17_Chr7g0266061	24.412	340	185	12	244	549	43	344	5.34e-15	76.6
Msa0144010	MtrunA17_Chr8g0370951	25.066	379	215	15	214	552	3	352	2.57e-14	74.7
Msa0144010	MtrunA17_Chr4g0027571	28.037	214	114	5	20	196	3	213	2.79e-14	72.4
Msa0144010	MtrunA17_Chr4g0027571	26.667	225	127	8	351	549	1	213	1.96e-12	67.0
Msa0144010	MtrunA17_Chr5g0437421	24.776	335	219	13	242	555	31	353	2.05e-13	72.0
Msa0144010	MtrunA17_Chr6g0459921	24.060	266	151	8	333	562	106	356	7.94e-13	70.1
Msa0144010	MtrunA17_Chr8g0370981	25.000	420	206	16	214	553	14	404	1.13e-12	70.1
Msa0144010	MtrunA17_Chr2g0301561	28.899	218	127	8	288	491	36	239	1.40e-12	68.2
Msa0144010	MtrunA17_Chr1g0178931	22.881	354	206	14	235	556	27	345	2.16e-12	68.6
Msa0144010	MtrunA17_Chr7g0229581	31.469	143	73	3	76	196	7	146	3.82e-12	64.7
Msa0144010	MtrunA17_Chr3g0106911	34.395	157	81	7	268	421	7	144	5.51e-12	65.9
Msa0144010	MtrunA17_Chr2g0284941	26.180	233	154	7	219	442	9	232	6.70e-12	67.4
Msa0144010	MtrunA17_Chr1g0198351	24.551	334	182	12	235	536	35	330	1.37e-11	66.2

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0144010	AT3G26430.1	48.285	379	171	4	214	567	2	380	5.53e-125	372
Msa0144010	AT3G26430.1	42.023	257	104	4	3	214	124	380	1.83e-62	210
Msa0144010	AT1G67830.1	48.315	356	151	6	238	568	25	372	1.57e-113	343
Msa0144010	AT1G67830.1	40.927	259	100	5	2	215	122	372	1.30e-60	205
Msa0144010	AT5G14450.1	45.968	372	174	5	222	568	20	389	7.08e-108	329
Msa0144010	AT5G14450.1	39.300	257	111	5	3	215	134	389	2.17e-52	184
Msa0144010	AT3G27950.1	43.548	372	175	7	220	565	8	370	9.46e-90	281
Msa0144010	AT3G27950.1	39.689	257	104	6	2	212	119	370	1.53e-44	162
Msa0144010	AT1G54790.3	39.247	372	192	10	220	563	10	375	1.66e-77	250
Msa0144010	AT1G54790.3	34.940	249	115	5	3	205	123	370	1.10e-37	144
Msa0144010	AT4G01130.1	40.267	375	188	9	221	565	12	380	3.74e-76	246
Msa0144010	AT4G01130.1	28.627	255	136	5	3	212	127	380	2.91e-23	102
Msa0144010	AT1G54790.1	37.669	369	197	9	223	563	11	374	7.14e-74	240
Msa0144010	AT1G54790.1	34.940	249	115	5	3	205	122	369	5.95e-38	144
Msa0144010	AT3G05180.1	38.352	352	184	8	240	563	33	379	1.21e-70	232
Msa0144010	AT3G05180.1	33.992	253	121	4	2	209	127	378	6.24e-34	133
Msa0144010	AT1G56670.1	38.032	376	190	9	217	567	16	373	7.32e-70	229
Msa0144010	AT1G56670.1	32.927	246	130	4	4	214	128	373	2.96e-33	131
Msa0144010	AT1G54790.2	35.190	395	197	9	223	563	11	400	1.47e-69	230
Msa0144010	AT1G54790.2	39.645	169	89	4	3	159	122	289	1.92e-27	115
Msa0144010	AT1G09390.1	36.968	376	195	9	216	565	9	368	1.78e-66	221
Msa0144010	AT1G09390.1	32.520	246	131	3	2	212	123	368	9.41e-33	129
Msa0144010	AT4G01130.2	44.203	276	141	7	221	489	12	281	6.78e-63	210
Msa0144010	AT4G01130.2	32.716	162	91	6	3	150	127	284	7.83e-17	82.4
Msa0144010	AT3G62280.1	38.202	356	157	14	242	562	35	362	1.36e-61	207
Msa0144010	AT3G62280.1	32.377	244	124	7	5	210	123	363	6.47e-25	107
Msa0144010	AT1G56670.2	40.727	275	151	5	217	489	16	280	8.16e-55	187
Msa0144010	AT1G56670.2	35.329	167	99	1	4	161	128	294	3.05e-25	106
Msa0144010	AT1G28600.1	34.896	384	188	14	221	567	14	372	3.99e-48	172
Msa0144010	AT1G28600.1	30.986	213	106	6	49	222	170	380	1.81e-18	88.2
Msa0144010	AT4G01130.3	36.667	300	154	9	296	565	1	294	4.10e-48	169
Msa0144010	AT4G01130.3	28.627	255	136	5	3	212	41	294	7.90e-24	102
Msa0144010	AT3G62280.2	40.769	260	122	10	242	489	35	274	5.76e-47	166
Msa0144010	AT3G62280.2	34.783	161	90	4	5	153	123	280	3.13e-17	83.2
Msa0144010	AT1G28590.1	32.095	377	206	9	217	558	10	371	2.86e-44	162
Msa0144010	AT1G28590.1	26.531	196	105	5	49	205	176	371	6.38e-11	65.1
Msa0144010	AT1G31550.1	33.241	361	185	12	240	565	33	372	6.86e-44	161
Msa0144010	AT1G31550.1	26.943	193	105	6	49	205	175	367	4.21e-11	65.5
Msa0144010	AT1G31550.2	32.967	364	185	12	240	565	33	375	1.66e-43	160
Msa0144010	AT1G28580.1	31.606	386	208	11	219	565	9	377	2.40e-43	159
Msa0144010	AT1G28640.1	31.606	386	207	11	219	565	8	375	4.96e-43	158
Msa0144010	AT1G28570.1	31.186	388	209	12	217	565	6	374	6.78e-43	158
Msa0144010	AT1G28670.1	33.420	386	201	13	219	565	8	376	7.69e-43	158
Msa0144010	AT1G28610.2	33.245	376	196	12	219	557	7	364	2.40e-42	156
Msa0144010	AT2G27360.1	32.021	381	203	12	216	558	7	369	7.28e-42	155
Msa0144010	AT1G28660.2	32.041	387	203	14	219	565	8	374	2.97e-41	153
Msa0144010	AT1G28650.1	31.538	390	209	12	217	565	5	377	3.99e-41	153
Msa0144010	AT1G28660.1	32.216	388	202	15	219	565	8	375	2.24e-40	151
Msa0144010	AT5G45910.1	32.199	382	196	15	219	557	8	369	4.34e-39	147
Msa0144010	AT3G48460.1	28.796	382	206	10	220	560	15	371	5.24e-37	142
Msa0144010	AT5G40990.1	29.565	345	190	11	243	555	37	360	1.63e-27	114
Msa0144010	AT3G16370.1	30.793	328	187	14	242	545	29	340	3.70e-27	113
Msa0144010	AT1G28580.2	27.832	309	177	8	286	565	5	296	1.03e-26	110
Msa0144010	AT5G03820.1	27.697	343	187	14	242	549	32	348	7.86e-26	109
Msa0144010	AT4G26790.1	28.324	346	181	16	241	549	27	342	1.11e-25	108
Msa0144010	AT4G26790.2	28.324	346	181	16	241	549	27	342	1.11e-25	108
Msa0144010	AT5G03820.2	27.697	343	187	14	242	549	60	376	1.15e-25	109
Msa0144010	AT4G10950.2	28.530	347	191	14	242	556	70	391	3.76e-25	108
Msa0144010	AT1G20130.2	28.488	344	190	13	237	545	178	500	1.77e-23	104
Msa0144010	AT1G20130.1	28.488	344	190	13	237	545	198	520	1.77e-23	104
Msa0144010	AT2G42990.1	26.997	363	199	15	221	548	9	340	2.10e-23	102
Msa0144010	AT1G71120.1	27.042	355	197	12	230	552	18	342	4.16e-23	101
Msa0144010	AT5G03810.1	25.656	343	193	13	242	549	29	344	5.81e-23	100
Msa0144010	AT5G63170.1	31.541	279	155	11	219	482	4	261	6.03e-23	100
Msa0144010	AT3G14225.2	29.480	346	183	11	243	552	37	357	7.96e-23	100
Msa0144010	AT5G22810.1	29.326	341	185	14	242	549	33	350	8.45e-23	100
Msa0144010	AT1G53920.1	27.350	351	204	12	219	539	22	351	8.56e-23	100
Msa0144010	AT4G10950.1	28.242	347	188	15	242	556	70	387	1.28e-22	100
Msa0144010	AT3G14225.1	30.347	346	184	13	243	552	37	361	1.38e-22	100
Msa0144010	AT5G42170.1	27.778	342	191	13	238	549	45	360	2.45e-22	99.4
Msa0144010	AT1G59406.1	27.195	353	217	12	219	549	6	340	2.92e-22	99.0
Msa0144010	AT1G59030.1	27.195	353	217	12	219	549	6	340	2.92e-22	99.0
Msa0144010	AT1G58725.1	27.195	353	217	12	219	549	6	340	2.92e-22	99.0
Msa0144010	AT5G15720.1	26.611	357	198	12	242	561	29	358	2.99e-22	99.0
Msa0144010	AT3G04290.1	29.947	374	190	17	218	553	7	346	5.56e-22	98.2
Msa0144010	AT1G28600.2	37.379	206	104	8	221	416	14	204	6.41e-22	95.1
Msa0144010	AT2G23540.1	25.414	362	192	14	237	552	42	371	1.53e-21	97.4
Msa0144010	AT1G29670.1	25.496	353	227	12	214	545	2	339	1.78e-21	96.7
Msa0144010	AT1G58520.3	26.946	334	197	11	238	549	25	333	4.47e-21	95.1
Msa0144010	AT1G58525.1	26.946	334	197	11	238	549	25	333	4.47e-21	95.1
Msa0144010	AT1G75900.1	26.911	327	199	13	242	545	42	351	4.61e-21	95.5
Msa0144010	AT1G29670.2	26.087	345	219	12	222	545	78	407	4.61e-21	96.3
Msa0144010	AT1G71691.2	27.811	338	203	14	231	545	41	360	5.70e-21	95.5
Msa0144010	AT4G28780.1	27.954	347	185	15	243	553	31	348	5.87e-21	95.1
Msa0144010	AT5G45670.1	24.857	350	230	9	217	545	1	338	8.01e-21	94.7
Msa0144010	AT4G18970.1	25.231	325	208	9	242	545	27	337	8.21e-21	94.7
Msa0144010	AT4G18970.2	25.077	323	211	8	242	545	27	337	1.02e-20	95.1
Msa0144010	AT3G50400.1	26.404	356	189	16	241	552	32	358	1.11e-20	94.7
Msa0144010	AT5G08460.1	26.301	346	217	10	241	561	47	379	2.04e-20	94.0
Msa0144010	AT1G53940.2	28.406	345	194	12	243	555	39	362	2.09e-20	94.0
Msa0144010	AT3G43550.1	29.151	271	162	9	223	481	10	262	2.29e-20	92.0
Msa0144010	AT5G33370.1	27.429	350	183	15	243	553	30	347	2.31e-20	93.6
Msa0144010	AT3G53100.1	26.703	367	211	16	215	549	2	342	3.12e-20	92.8
Msa0144010	AT1G06990.1	26.647	334	187	14	241	541	35	343	3.14e-20	93.2
Msa0144010	AT1G73610.1	26.567	335	194	11	238	549	30	335	3.71e-20	92.4
Msa0144010	AT2G04570.1	25.272	368	215	14	219	554	7	346	4.23e-20	92.4
Msa0144010	AT2G30310.1	28.228	333	196	14	235	541	26	341	5.57e-20	92.4
Msa0144010	AT1G28610.1	36.058	208	113	7	219	416	7	204	6.70e-20	89.7
Msa0144010	AT1G33811.1	25.070	359	226	11	215	545	5	348	1.54e-19	91.3
Msa0144010	AT1G53990.1	28.161	348	186	14	243	558	35	350	1.92e-19	90.9
Msa0144010	AT1G54020.2	25.215	349	198	12	222	543	12	324	2.14e-19	90.9
Msa0144010	AT1G54030.1	28.276	290	162	10	267	542	80	337	2.91e-19	90.9
Msa0144010	AT5G45950.1	24.926	337	192	14	243	548	40	346	4.61e-19	89.4
Msa0144010	AT2G19060.1	27.164	335	203	13	242	557	29	341	6.14e-19	89.0
Msa0144010	AT1G71250.1	26.400	375	232	12	209	558	4	359	6.52e-19	89.4
Msa0144010	AT1G71691.3	28.044	271	166	10	231	489	41	294	7.58e-19	88.2
Msa0144010	AT2G30220.1	27.660	329	195	15	241	543	31	342	1.24e-18	88.2
Msa0144010	AT2G19010.1	25.697	323	197	10	242	545	29	327	1.77e-18	87.4
Msa0144010	AT2G19010.2	25.697	323	197	10	242	545	59	357	2.24e-18	87.8
Msa0144010	AT2G03980.2	26.748	329	194	15	240	542	40	347	4.71e-18	86.7
Msa0144010	AT2G03980.3	26.748	329	194	15	240	542	40	347	4.71e-18	86.7
Msa0144010	AT2G03980.1	26.748	329	194	15	240	542	40	347	4.71e-18	86.7
Msa0144010	AT2G03980.4	26.748	329	194	15	240	542	40	347	4.71e-18	86.7
Msa0144010	AT1G20120.1	28.090	356	196	15	236	556	71	401	5.83e-18	86.7
Msa0144010	AT2G24560.1	25.982	331	202	13	235	539	26	339	1.23e-17	85.1
Msa0144010	AT1G58430.1	27.134	328	190	14	241	539	33	340	1.37e-17	85.1
Msa0144010	AT5G15720.2	27.376	263	158	8	242	488	29	274	1.71e-17	84.0
Msa0144010	AT1G29660.1	25.000	352	230	11	213	545	4	340	2.17e-17	84.7
Msa0144010	AT1G28570.2	25.974	231	137	6	361	565	80	302	2.21e-17	84.0
Msa0144010	AT5G37690.1	26.536	358	218	13	217	549	1	338	3.00e-17	84.0
Msa0144010	AT1G28570.3	26.316	209	121	5	382	565	11	211	3.05e-17	81.6
Msa0144010	AT2G31540.1	26.074	349	212	14	235	554	27	358	4.43e-17	83.6
Msa0144010	AT1G23500.1	30.116	259	151	10	243	489	35	275	5.91e-17	82.8
Msa0144010	AT1G75930.1	26.374	273	172	9	213	474	2	256	6.17e-17	82.8
Msa0144010	AT2G24560.2	27.407	270	163	10	235	488	26	278	6.17e-17	82.4
Msa0144010	AT1G53940.1	29.893	281	162	9	221	481	7	272	7.35e-17	82.0
Msa0144010	AT1G75920.2	27.701	361	219	16	213	552	2	341	1.13e-16	82.0
Msa0144010	AT2G19050.1	25.449	334	208	9	242	557	30	340	1.63e-16	81.6
Msa0144010	AT2G19050.1	24.775	222	128	5	16	204	125	340	8.98e-11	64.3
Msa0144010	AT2G04020.1	29.004	231	139	8	240	459	40	256	2.08e-16	79.7
Msa0144010	AT1G20135.1	25.648	347	213	11	220	546	6	327	2.88e-16	80.5
Msa0144010	AT4G30140.1	27.273	330	201	10	242	557	32	336	3.96e-16	80.5
Msa0144010	AT2G40250.1	24.159	327	211	13	243	545	36	349	1.02e-15	79.3
Msa0144010	AT1G54030.2	29.412	221	118	7	267	481	80	268	1.25e-15	78.6
Msa0144010	AT2G04020.2	29.907	214	126	7	240	443	40	239	1.30e-15	78.6
Msa0144010	AT1G75880.2	25.698	358	218	14	222	549	26	365	2.22e-15	78.6
Msa0144010	AT2G19050.2	27.237	257	158	7	242	489	30	266	2.82e-15	77.0
Msa0144010	AT5G41890.1	26.571	350	192	16	245	552	33	359	3.08e-15	78.2
Msa0144010	AT5G45960.1	26.984	252	157	9	243	481	47	284	3.56e-15	77.8
Msa0144010	AT1G75880.1	25.627	359	218	15	222	549	26	366	4.11e-15	77.8
Msa0144010	AT4G16230.1	30.682	264	143	13	219	462	4	247	9.46e-15	74.7
Msa0144010	AT1G54000.1	23.077	364	200	13	219	544	12	333	1.00e-14	76.6
Msa0144010	AT5G03980.1	26.842	190	103	4	382	545	127	306	1.02e-14	75.9
Msa0144010	AT5G03980.1	28.022	182	91	6	49	192	127	306	7.23e-14	73.2
Msa0144010	AT1G75890.2	26.000	350	214	14	224	545	25	357	1.05e-14	76.3
Msa0144010	AT1G75890.3	26.000	350	214	14	224	545	54	386	1.08e-14	76.6
Msa0144010	AT5G15720.3	24.510	306	171	10	290	561	48	327	1.23e-14	75.9
Msa0144010	AT1G54010.1	23.120	359	206	11	219	544	12	333	1.74e-14	75.9
Msa0144010	AT1G75890.1	25.414	362	214	16	224	545	25	370	1.43e-13	73.2
Msa0144010	AT1G71691.1	25.993	277	169	12	287	545	1	259	4.65e-13	70.5
Msa0144010	AT5G03600.1	24.324	333	187	14	242	546	13	308	7.94e-13	70.1
Msa0144010	AT5G03600.2	24.324	333	187	14	242	546	48	343	1.04e-12	70.1
Msa0144010	AT5G37690.2	25.419	358	214	14	217	549	1	330	1.87e-12	69.3
Msa0144010	AT1G74460.1	26.644	289	172	12	278	545	63	332	3.05e-12	68.9
Msa0144010	AT3G14220.1	23.615	343	194	15	242	552	31	337	2.36e-11	66.2

Find 138 sgRNAs with CRISPR-Local

Find 439 sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
GATCTTATTGGTGGTTATTT+TGG	0.124216	1_4:-3286079	Msa0144010:CDS
CAATTCTTTGTAGCAAATAT+TGG	0.178924	1_4:+3286942	None:intergenic
TACCCAAAACAAAGTTTATT+AGG	0.181436	1_4:-3292221	Msa0144010:CDS
TGGATGTGTGCCTTTAATTT+TGG	0.224209	1_4:-3291205	Msa0144010:CDS
AACCATCTACTAGAATAATA+TGG	0.227325	1_4:-3290739	Msa0144010:CDS
ATCCCTAATAAACTTTGTTT+TGG	0.232433	1_4:+3292218	None:intergenic
ATTTAGGGGCTAGGTCATTT+TGG	0.232450	1_4:-3285218	Msa0144010:CDS
ACCTATATCAAATGTGTATA+AGG	0.246812	1_4:+3292020	None:intergenic
TGGTTGCACTCCTACGATTT+TGG	0.248180	1_4:-3285175	Msa0144010:CDS
TTTGGAATAATAATCTTCTT+TGG	0.255011	1_4:+3292044	None:intergenic
ATCTCTAATGAGATTTGTTT+TGG	0.255196	1_4:+3286297	None:intergenic
TATGAAATTGTTTACTATAT+CGG	0.256970	1_4:+3286021	None:intergenic
ATCTAGAATATATACAATTT+AGG	0.259358	1_4:-3285234	Msa0144010:intron
AATTAGGGGCCAGGTCATTT+TGG	0.264269	1_4:-3291248	Msa0144010:CDS
TACTGAATCTGAAGGGAAAA+TGG	0.272154	1_4:+3292264	None:intergenic
GGAAAATTGGCCAAAATTAA+AGG	0.273646	1_4:+3291195	None:intergenic
TATGAAATTCTTTACTATAT+CGG	0.274874	1_4:+3291933	None:intergenic
ATCTAGAATATATACAAATT+AGG	0.275565	1_4:-3291264	Msa0144010:intron
ACCAATATCAAATGTGTATA+AGG	0.276105	1_4:+3286108	None:intergenic
AATTCTTTGTAGCAAATATT+GGG	0.277876	1_4:+3286943	None:intergenic
TCTAGAATATATACAAATTA+GGG	0.278589	1_4:-3291263	Msa0144010:intron
CTTTATAGCAGATGGAAAAT+TGG	0.280511	1_4:+3291182	None:intergenic
TCTAGAATATATACAATTTA+GGG	0.282298	1_4:-3285233	Msa0144010:intron
CATGCCATATCTAGAGAAAT+AGG	0.282392	1_4:+3284517	None:intergenic
TACTGAATTTGAAGAGAAAA+TGG	0.283865	1_4:+3286343	None:intergenic
ATCCTCCCATTCCACTAAAT+AGG	0.284287	1_4:-3290646	Msa0144010:CDS
TTGGAATAATAATCTTCTTT+GGG	0.286703	1_4:+3292045	None:intergenic
TCCCATATTATTCTAGTAGA+TGG	0.294746	1_4:+3290737	None:intergenic
CGAATCATTATTGATTTCAT+AGG	0.296923	1_4:-3286786	Msa0144010:intron
GCCTTATACACATTTGATAT+TGG	0.302387	1_4:-3286109	Msa0144010:CDS
TCCCAAATGATTCTAGTAGA+TGG	0.307386	1_4:+3284613	None:intergenic
CCTAATAGTATTATACCTAA+TGG	0.308302	1_4:-3286376	Msa0144010:CDS
ATTAAGATATGGACTTAGAT+AGG	0.318215	1_4:+3286462	None:intergenic
ATTAAGATATGGACTTAGAT+AGG	0.318215	1_4:+3292383	None:intergenic
ACAAATCTCATTAGAGATAA+AGG	0.323654	1_4:-3286292	Msa0144010:intron
CCATTAGGTATAATGTTGTT+AGG	0.325094	1_4:+3292297	None:intergenic
GGAGAAATCATAAACATAAA+TGG	0.328429	1_4:-3290791	Msa0144010:CDS
ACCCAAAACAAAGTTTATTA+GGG	0.328879	1_4:-3292220	Msa0144010:CDS
GGAGCAACTATAAACATAAA+TGG	0.333844	1_4:-3284667	Msa0144010:CDS
TAATTTCCCATCTGCAATAA+AGG	0.336425	1_4:-3285151	Msa0144010:CDS
CCATTAGGTATAATACTATT+AGG	0.336828	1_4:+3286376	None:intergenic
ATTGGTCAAAATGATCTTAT+TGG	0.337079	1_4:-3286091	Msa0144010:CDS
AGTCCATATCTTAATTCTCT+TGG	0.339126	1_4:-3286454	Msa0144010:CDS
AGTCCATATCTTAATTCTCT+TGG	0.339126	1_4:-3292375	Msa0144010:five_prime_UTR
TTGTAACATGCCCTATTTAG+TGG	0.352126	1_4:+3290635	None:intergenic
ACCCATCTACTAGAATCATT+TGG	0.354951	1_4:-3284615	Msa0144010:CDS
GTCTTTGATCAAATCTCTAC+TGG	0.362400	1_4:-3284556	Msa0144010:CDS
ATGAAATTCTTTACTATATC+GGG	0.369299	1_4:+3291934	None:intergenic
TCCTCCCATTCCACTAAATA+GGG	0.373102	1_4:-3290645	Msa0144010:CDS
TCCTCCTATTTCTCTAGATA+TGG	0.373294	1_4:-3284521	Msa0144010:CDS
ATCAAATGTGTATAAGGCTT+TGG	0.374053	1_4:+3292026	None:intergenic
TTTCCTGCCATATTTAGCTT+TGG	0.374076	1_4:-3286915	Msa0144010:CDS
ATGAAATTGTTTACTATATC+GGG	0.374442	1_4:+3286022	None:intergenic
TGAAGCACCAAAGCTAAATA+TGG	0.376452	1_4:+3286908	None:intergenic
CCTAACAACATTATACCTAA+TGG	0.377474	1_4:-3292297	Msa0144010:five_prime_UTR
CCCATCTACTAGAATCATTT+GGG	0.387794	1_4:-3284614	Msa0144010:CDS
TTAAAACAAATTTAAATATG+AGG	0.391253	1_4:+3292518	None:intergenic
AAACGTTGACACTGGTGGTT+TGG	0.395539	1_4:-3286886	Msa0144010:CDS
AATTATTTCTATATTTATGA+AGG	0.400759	1_4:-3292453	Msa0144010:five_prime_UTR
GTCCATATCTTAATTCTCTT+GGG	0.407003	1_4:-3286453	Msa0144010:CDS
GACCCAAGAGAATTAAGATA+TGG	0.409299	1_4:+3292372	None:intergenic
ACAAAGTTTATTAGGGATCA+AGG	0.410667	1_4:-3292213	Msa0144010:intron
GTCCATATCTTAATTCTCTT+GGG	0.414439	1_4:-3292374	Msa0144010:five_prime_UTR
GTAATTTCAGCACAGAGCTT+TGG	0.415339	1_4:-3286490	Msa0144010:intron
AATGGACTAAATATCCCATT+AGG	0.416788	1_4:+3286361	None:intergenic
CTAATAGTATTATACCTAAT+GGG	0.423195	1_4:-3286375	Msa0144010:CDS
CAAGCACCACCTTCTCCATA+TGG	0.425672	1_4:-3286852	Msa0144010:CDS
TTGTATATGTTGAGCTTACA+TGG	0.426780	1_4:-3292491	Msa0144010:five_prime_UTR
ATACACAACACTGGACCAAT+TGG	0.429145	1_4:-3291225	Msa0144010:CDS
AATGGTACAAACATTGTTGT+TGG	0.431505	1_4:-3290773	Msa0144010:CDS
TGAAAATATGTCTCTCCATA+TGG	0.436936	1_4:+3286837	None:intergenic
TAACTATCCTTTATTGCAGA+TGG	0.441895	1_4:+3285144	None:intergenic
ACCATCTACTAGAATAATAT+GGG	0.442115	1_4:-3290738	Msa0144010:CDS
CATGGTGCAAACTTCGCAAC+AGG	0.459101	1_4:-3286418	Msa0144010:CDS
AATGGACTGAACATTCCATT+AGG	0.460673	1_4:+3292282	None:intergenic
GCCTTATACACATTTGATAT+AGG	0.463073	1_4:-3292021	Msa0144010:CDS
GACCCAAGAGAATTAAGATA+TGG	0.468859	1_4:+3286451	None:intergenic
TGGCTATCCTTTATAGCAGA+TGG	0.469012	1_4:+3291174	None:intergenic
CATGCCCTATTTAGTGGAAT+GGG	0.472312	1_4:+3290641	None:intergenic
ATATATACAATTTAGGGGCT+AGG	0.474694	1_4:-3285227	Msa0144010:CDS
GGTCAAAATGATCTTACTGC+TGG	0.478092	1_4:-3292000	Msa0144010:CDS
ATTAAAGGCACACATCCAAT+TGG	0.488389	1_4:+3291210	None:intergenic
ACATGCCCTATTTAGTGGAA+TGG	0.489175	1_4:+3290640	None:intergenic
CCCAAATGATTCTAGTAGAT+GGG	0.491642	1_4:+3284614	None:intergenic
GGTCAAAATGATCTTATTGG+TGG	0.492651	1_4:-3286088	Msa0144010:CDS
ATCAAATGTGTATAAGGCGT+TGG	0.500122	1_4:+3286114	None:intergenic
GATCGCTACGAAGTTGAGCT+AGG	0.500570	1_4:+3285061	None:intergenic
TGTATTGCTTTGCACAACCT+TGG	0.503056	1_4:+3291154	None:intergenic
TTAAGATATGGACTTAGATA+GGG	0.503696	1_4:+3286463	None:intergenic
TTAAGATATGGACTTAGATA+GGG	0.503696	1_4:+3292384	None:intergenic
TGGAGAAGGTGGTGCTTGAA+AGG	0.512450	1_4:+3286857	None:intergenic
GATCCACACGAAGTTGAGCT+AGG	0.516606	1_4:+3291091	None:intergenic
CACGTGGCATGTTGTGGCTA+TGG	0.516845	1_4:-3284718	Msa0144010:CDS
ATATATACAAATTAGGGGCC+AGG	0.517339	1_4:-3291257	Msa0144010:CDS
TACAACATTCATGTTGGATG+TGG	0.534376	1_4:-3284688	Msa0144010:CDS
AACTATCCTTTATTGCAGAT+GGG	0.538312	1_4:+3285145	None:intergenic
TCTGCAATAAAGGATAGTTA+TGG	0.538464	1_4:-3285141	Msa0144010:CDS
ATTCTTTGTAGCAAATATTG+GGG	0.543366	1_4:+3286944	None:intergenic
ATTATTTCTATATTTATGAA+GGG	0.546660	1_4:-3292452	Msa0144010:five_prime_UTR
CTTGGGTCTAACTTCACACA+TGG	0.547798	1_4:-3286436	Msa0144010:CDS
GTTAGCTGTCTCTGTGAAGT+GGG	0.552378	1_4:+3284585	None:intergenic
GGAAAGTACAACATTCATGT+TGG	0.552770	1_4:-3284694	Msa0144010:CDS
ATCGTAGGAGTGCAACCACT+TGG	0.554426	1_4:+3285180	None:intergenic
TGGAATAATAATCTTCTTTG+GGG	0.555591	1_4:+3292046	None:intergenic
ACATATGTGATTGCAGCTAG+TGG	0.560723	1_4:+3291066	None:intergenic
GGTGCAAACTTTGCAACAGC+AGG	0.564350	1_4:-3292336	Msa0144010:five_prime_UTR
GCACCAAAGCTAAATATGGC+AGG	0.569703	1_4:+3286912	None:intergenic
GGTGCTTCAAACGTTGACAC+TGG	0.571755	1_4:-3286894	Msa0144010:CDS
CTTCCACACGTGGCATGTTG+TGG	0.572010	1_4:-3284724	Msa0144010:CDS
GTCTCTCCATATGGAGAAGG+TGG	0.572633	1_4:+3286846	None:intergenic
TCTACTAGAATCATTTGGGA+TGG	0.589271	1_4:-3284610	Msa0144010:CDS
AGCCCTAGCTCAACTTCGTG+TGG	0.589422	1_4:-3291094	Msa0144010:CDS
ATCGCTACGAAGTTGAGCTA+GGG	0.590736	1_4:+3285062	None:intergenic
TATGTCTCTCCATATGGAGA+AGG	0.594276	1_4:+3286843	None:intergenic
TGTTAGCTGTCTCTGTGAAG+TGG	0.596585	1_4:+3284584	None:intergenic
ACATATGCGATTGCAGCAAG+AGG	0.597236	1_4:+3285036	None:intergenic
GCCCTATTTAGTGGAATGGG+AGG	0.602436	1_4:+3290644	None:intergenic
ATCCACACGAAGTTGAGCTA+GGG	0.606515	1_4:+3291092	None:intergenic
AGGATTTGAGCTTCCACACG+TGG	0.609396	1_4:-3284734	Msa0144010:intron
CAATTTCATAGAGAGTATCA+AGG	0.612160	1_4:-3286008	Msa0144010:intron
GGGAAATTAGCCAAAATCGT+AGG	0.621519	1_4:+3285165	None:intergenic
AGCACAATCAAAGACACAAG+TGG	0.622514	1_4:+3286984	None:intergenic
ATTGAATGTACTGAATCTGA+AGG	0.624133	1_4:+3292256	None:intergenic
GCTTCAAACGTTGACACTGG+TGG	0.626758	1_4:-3286891	Msa0144010:CDS
TCAACTGGAAGATACTCTGA+TGG	0.630816	1_4:-3286810	Msa0144010:CDS
TAGCCACAACATGCCACGTG+TGG	0.635122	1_4:+3284721	None:intergenic
TCTACTAGAATAATATGGGA+TGG	0.641361	1_4:-3290734	Msa0144010:CDS
TTCTTTGTAGCAAATATTGG+GGG	0.645637	1_4:+3286945	None:intergenic
GGTGCAAACTTCGCAACAGG+AGG	0.653307	1_4:-3286415	Msa0144010:CDS
GCCATATCTAGAGAAATAGG+AGG	0.655655	1_4:+3284520	None:intergenic
GTGGCATGTTGTGGCTATGG+AGG	0.666464	1_4:-3284715	Msa0144010:CDS
CTAGAATATATACAATTTAG+GGG	0.671423	1_4:-3285232	Msa0144010:intron
TTGAATGTACTGAATCTGAA+GGG	0.676543	1_4:+3292257	None:intergenic
TCTGCTATAAAGGATAGCCA+AGG	0.676832	1_4:-3291171	Msa0144010:CDS
CTAGAATATATACAAATTAG+GGG	0.698873	1_4:-3291262	Msa0144010:intron
ATACACAACACAGGGCCAAG+TGG	0.718066	1_4:-3285195	Msa0144010:CDS
GTTGTGTATCCAAAATGACC+TGG	0.720607	1_4:+3291239	None:intergenic
GGATGGTACACATTACACAG+AGG	0.801423	1_4:-3290717	Msa0144010:CDS

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content
!!!	ATCATTATTTTATTTTTTTG+AGG	-	chr1_4:3284532-3284551	Msa0144010:CDS	10.0%
!!!	TTTTACTTAACAAAAAAAAA+AGG	+	chr1_4:3284600-3284619	None:intergenic	10.0%
!!	TTAAAACAAATTTAAATATG+AGG	+	chr1_4:3284662-3284681	None:intergenic	10.0%
!!!	AATTATTTCTATATTTATGA+AGG	-	chr1_4:3284724-3284743	Msa0144010:CDS	10.0%
!!!	ATTATTTCTATATTTATGAA+GGG	-	chr1_4:3284725-3284744	Msa0144010:CDS	10.0%
!!	GAAATTAAAAAAGAAAAAAT+TGG	+	chr1_4:3285073-3285092	None:intergenic	10.0%
!!!	ATTAAACAAAATTTTATGTT+TGG	-	chr1_4:3285427-3285446	Msa0144010:intron	10.0%
!!!	ATATTTTAATTTAAAGTTGA+AGG	-	chr1_4:3286059-3286078	Msa0144010:CDS	10.0%
!!	TAAAGAATAAAAAGAATTAA+TGG	+	chr1_4:3288836-3288855	None:intergenic	10.0%
!!	AATTTAATTAAGGAAAATTT+AGG	+	chr1_4:3289465-3289484	None:intergenic	10.0%
!!!	ATCTCATATTTTTTTATTTA+TGG	-	chr1_4:3289289-3289308	Msa0144010:intron	10.0%
!!	AATTTAATTAAGGAAAATTT+AGG	-	chr1_4:3289465-3289484	Msa0144010:intron	10.0%
!!	TATTAAACAATAAACATATT+CGG	-	chr1_4:3290055-3290074	Msa0144010:intron	10.0%
!!	ATTAAAATAGAATATGTAAT+GGG	+	chr1_4:3290474-3290493	None:intergenic	10.0%
!!!	TAATATTTTTTAAATCACAA+TGG	-	chr1_4:3292325-3292344	Msa0144010:five_prime_UTR	10.0%
!!!	GTAATTTTACTAAAATACTA+TGG	-	chr1_4:3284624-3284643	Msa0144010:CDS	15.0%
!!	TATGAAATTCTTTACTATAT+CGG	+	chr1_4:3285247-3285266	None:intergenic	15.0%
!!	ATAATTACTAAAATAGACAT+AGG	-	chr1_4:3285480-3285499	Msa0144010:intron	15.0%
!!	ATTAATAAAATGCAACTTAA+TGG	-	chr1_4:3285888-3285907	Msa0144010:intron	15.0%
!!!	ATCTAGAATATATACAAATT+AGG	-	chr1_4:3285913-3285932	Msa0144010:intron	15.0%
!!!	TCTAGAATATATACAAATTA+GGG	-	chr1_4:3285914-3285933	Msa0144010:intron	15.0%
!!	TTAAATCTTCATTAATATGT+AGG	-	chr1_4:3286293-3286312	Msa0144010:CDS	15.0%
!!	TTCTTTATATTAGACATATA+TGG	-	chr1_4:3286641-3286660	Msa0144010:intron	15.0%
!!	TATATTTACAACAAGTTTAT+TGG	-	chr1_4:3286698-3286717	Msa0144010:intron	15.0%
!!	ATACTTATTAAATCAACTTA+AGG	-	chr1_4:3287477-3287496	Msa0144010:intron	15.0%
!!	TACTTATTAAATCAACTTAA+GGG	-	chr1_4:3287478-3287497	Msa0144010:intron	15.0%
!!	ATATGATAAATCAAACTTAA+GGG	-	chr1_4:3287514-3287533	Msa0144010:intron	15.0%
!!!	ATTACTAATTTGTTTCAAAA+TGG	+	chr1_4:3287757-3287776	None:intergenic	15.0%
!!	AAATTAGTAATTTCTATGAA+TGG	-	chr1_4:3287766-3287785	Msa0144010:intron	15.0%
!!!	TAAACAAAATTTCACTTTTT+AGG	+	chr1_4:3288356-3288375	None:intergenic	15.0%
!!!	TTCAACACATATTTTTTTAT+TGG	-	chr1_4:3288554-3288573	Msa0144010:intron	15.0%
!!!	TTAATTCTTTAATCCTTTTA+AGG	-	chr1_4:3288880-3288899	Msa0144010:intron	15.0%
!!	ATTATGTTTAATTCCTTAAA+AGG	+	chr1_4:3288896-3288915	None:intergenic	15.0%
!!!	TTTTATTGAATCATCATTTT+AGG	+	chr1_4:3289007-3289026	None:intergenic	15.0%
!!!	GTTTTATTTGTACAAAAAAA+AGG	+	chr1_4:3289198-3289217	None:intergenic	15.0%
!!!	TTTTTTTAAGAATAGAAAAG+TGG	+	chr1_4:3289220-3289239	None:intergenic	15.0%
!!	ATTGAATATGTAGTAATTAT+AGG	-	chr1_4:3289266-3289285	Msa0144010:intron	15.0%
!!!	ATTTAGGTTTAAAGAATTAA+TGG	-	chr1_4:3289481-3289500	Msa0144010:intron	15.0%
!!	GTCAAAAAAAAAAAAAAAAC+AGG	-	chr1_4:3289509-3289528	Msa0144010:intron	15.0%
!!!	GACATTTTATCAAAAAAAAT+TGG	+	chr1_4:3289864-3289883	None:intergenic	15.0%
!!	GATTAAAATAGAATATGTAA+TGG	+	chr1_4:3290475-3290494	None:intergenic	15.0%
!!!	TATTTCAAAATTTTCTTATC+AGG	-	chr1_4:3290999-3291018	Msa0144010:intron	15.0%
!!	TATGAAATTGTTTACTATAT+CGG	+	chr1_4:3291159-3291178	None:intergenic	15.0%
!!	AAAAAAAAACATTATAGTTG+AGG	-	chr1_4:3291396-3291415	Msa0144010:intron	15.0%
!!!	ATCTAGAATATATACAATTT+AGG	-	chr1_4:3291943-3291962	Msa0144010:intron	15.0%
!!!	TCTAGAATATATACAATTTA+GGG	-	chr1_4:3291944-3291963	Msa0144010:intron	15.0%
!!!	GTATTTTAATTTAAAGTTGA+AGG	-	chr1_4:3292089-3292108	Msa0144010:intron	15.0%
!!!	TTTTTTTGGATTTTGAAAAA+GGG	+	chr1_4:3292190-3292209	None:intergenic	15.0%
!!!	ATTTTTTTGGATTTTGAAAA+AGG	+	chr1_4:3292191-3292210	None:intergenic	15.0%
!!	TTTCAAAATCCAAAAAAATA+TGG	-	chr1_4:3292192-3292211	Msa0144010:intron	15.0%
!!!	TATATGTTATTGATTTGATT+TGG	-	chr1_4:3292403-3292422	Msa0144010:five_prime_UTR	15.0%
!!	TTGGAATAATAATCTTCTTT+GGG	+	chr1_4:3285135-3285154	None:intergenic	20.0%
!!!	TTTGGAATAATAATCTTCTT+TGG	+	chr1_4:3285136-3285155	None:intergenic	20.0%
!!	ATGAAATTCTTTACTATATC+GGG	+	chr1_4:3285246-3285265	None:intergenic	20.0%
!!	TAAAGAATGAGAATTGATAA+AGG	-	chr1_4:3285517-3285536	Msa0144010:intron	20.0%
!!	GATTATGTAATTGTATTGTT+TGG	+	chr1_4:3285778-3285797	None:intergenic	20.0%
!!	CTAGAATATATACAAATTAG+GGG	-	chr1_4:3285915-3285934	Msa0144010:intron	20.0%
!!	TCCAAAATCCAAAAAAAATA+CGG	-	chr1_4:3286163-3286182	Msa0144010:intron	20.0%
!!!	ATCGATCATATTTTTTAGTT+AGG	-	chr1_4:3286199-3286218	Msa0144010:intron	20.0%
!!!	TCGATCATATTTTTTAGTTA+GGG	-	chr1_4:3286200-3286219	Msa0144010:intron	20.0%
!!!	TTTTTTAGTTAGGGTATATT+TGG	-	chr1_4:3286209-3286228	Msa0144010:intron	20.0%
!!!	TTTCATTGATAATTCCAAAA+AGG	+	chr1_4:3286678-3286697	None:intergenic	20.0%
!!	TATGTTTACATCAAGAATAT+TGG	-	chr1_4:3286766-3286785	Msa0144010:intron	20.0%
!!	ATTTGTAATGATCTAATGAA+GGG	+	chr1_4:3287090-3287109	None:intergenic	20.0%
!!	TCTATAAATAAAACACACTA+GGG	+	chr1_4:3287355-3287374	None:intergenic	20.0%
!!	AAATTATGAAATTAAGAACC+CGG	+	chr1_4:3287446-3287465	None:intergenic	20.0%
!!	CATATGATAAATCAAACTTA+AGG	-	chr1_4:3287513-3287532	Msa0144010:intron	20.0%
!!!	TAATGCAAAAGTATAACTAA+GGG	+	chr1_4:3287615-3287634	None:intergenic	20.0%
!!!	TTAGTTATACTTTTGCATTA+GGG	-	chr1_4:3287615-3287634	Msa0144010:intron	20.0%
!!	TTAGTAAAAAAGAACTAATG+TGG	-	chr1_4:3287638-3287657	Msa0144010:intron	20.0%
!!	TAAACCAACTGTTAATTTAA+TGG	-	chr1_4:3287665-3287684	Msa0144010:intron	20.0%
!!!	TATGAATGGATTCTTTAAAT+AGG	-	chr1_4:3287780-3287799	Msa0144010:intron	20.0%
!!	TTTAATTCATAAAATGTCGT+TGG	-	chr1_4:3287887-3287906	Msa0144010:intron	20.0%
!!!	TTTTGTATGGTTTCTTAAAT+TGG	+	chr1_4:3287962-3287981	None:intergenic	20.0%
!!!	GCAATTTTCGTTATTTTTTT+TGG	+	chr1_4:3288618-3288637	None:intergenic	20.0%
!!	AAAAAGAATCGTGTATTTAA+TGG	-	chr1_4:3289347-3289366	Msa0144010:intron	20.0%
!!	AAATCCATATTTCTTCATTA+TGG	-	chr1_4:3289375-3289394	Msa0144010:intron	20.0%
!!	AAAAAAAAAAAACAGGTTTG+AGG	-	chr1_4:3289516-3289535	Msa0144010:intron	20.0%
!!	TTTACTGAGTAAATTTATGT+TGG	+	chr1_4:3289730-3289749	None:intergenic	20.0%
!!	ATGTTTGTATCACTAAAATT+TGG	-	chr1_4:3289776-3289795	Msa0144010:intron	20.0%
!!	ACTAAATACAATTACTAGAA+AGG	-	chr1_4:3289951-3289970	Msa0144010:intron	20.0%
!!	TATTAAGTAGAAGAAAACTT+GGG	+	chr1_4:3289979-3289998	None:intergenic	20.0%
!!!	TATTATTCTTTTGTTTAGTG+AGG	+	chr1_4:3290015-3290034	None:intergenic	20.0%
!!	AATTCTTTGTAGCAAATATT+GGG	+	chr1_4:3290237-3290256	None:intergenic	20.0%
!!	CTAATAGTATTATACCTAAT+GGG	-	chr1_4:3290802-3290821	Msa0144010:intron	20.0%
!!	GAAATAAAGAAAGAAAAAAG+AGG	+	chr1_4:3290985-3291004	None:intergenic	20.0%
!!	ATGAAATTGTTTACTATATC+GGG	+	chr1_4:3291158-3291177	None:intergenic	20.0%
!!	ATCTAATAGTTGAAATCTAT+TGG	+	chr1_4:3291286-3291305	None:intergenic	20.0%
!!	TACTATACTATTTATCAAAG+TGG	+	chr1_4:3291441-3291460	None:intergenic	20.0%
!!	TGTCAATTCAACAAAAATAA+AGG	-	chr1_4:3291597-3291616	Msa0144010:intron	20.0%
!!	TGTATGAATTATATGTATTG+AGG	-	chr1_4:3291626-3291645	Msa0144010:intron	20.0%
!!!	TTCCTATGTTCTTTTTTAAA+TGG	-	chr1_4:3291663-3291682	Msa0144010:intron	20.0%
!!	ATCCATTTAAAAAAGAACAT+AGG	+	chr1_4:3291668-3291687	None:intergenic	20.0%
!!	ATATCATGAGAATCTATTAT+AGG	+	chr1_4:3291839-3291858	None:intergenic	20.0%
!!	CTAGAATATATACAATTTAG+GGG	-	chr1_4:3291945-3291964	Msa0144010:intron	20.0%
!!!	TTTAGCTTACCATATTTTTT+TGG	+	chr1_4:3292204-3292223	None:intergenic	20.0%
!	TTAAGATATGGACTTAGATA+GGG	+	chr1_4:3284796-3284815	None:intergenic	25.0%
!	ATTAAGATATGGACTTAGAT+AGG	+	chr1_4:3284797-3284816	None:intergenic	25.0%
!	TACCCAAAACAAAGTTTATT+AGG	-	chr1_4:3284956-3284975	Msa0144010:intron	25.0%
!	ACCCAAAACAAAGTTTATTA+GGG	-	chr1_4:3284957-3284976	Msa0144010:intron	25.0%
!!!	TCCCTAATAAACTTTGTTTT+GGG	+	chr1_4:3284961-3284980	None:intergenic	25.0%
!!!	ATCCCTAATAAACTTTGTTT+TGG	+	chr1_4:3284962-3284981	None:intergenic	25.0%
!!	GAAATCTTTTAGTGATTTTG+AGG	-	chr1_4:3285026-3285045	Msa0144010:intron	25.0%
!!!	AGTGATTTTGAGGTTAATTA+AGG	-	chr1_4:3285036-3285055	Msa0144010:intron	25.0%
!!	AATTTCAAAATTTTCTTGCC+AGG	-	chr1_4:3285087-3285106	Msa0144010:CDS	25.0%
!	TGGAATAATAATCTTCTTTG+GGG	+	chr1_4:3285134-3285153	None:intergenic	25.0%
!	ACCTATATCAAATGTGTATA+AGG	+	chr1_4:3285160-3285179	None:intergenic	25.0%
!	GAATTTCATAGAGAATATCA+AGG	-	chr1_4:3285257-3285276	Msa0144010:intron	25.0%
!!	TGAGAGAATTGATTTATGTT+TGG	-	chr1_4:3285385-3285404	Msa0144010:intron	25.0%
!	ACTAAAATAGACATAGGTAA+AGG	-	chr1_4:3285486-3285505	Msa0144010:intron	25.0%
!	TGTAATTGTATTGTTTGGTT+TGG	+	chr1_4:3285773-3285792	None:intergenic	25.0%
!!!	ACCGTATTTTTTTTGGATTT+TGG	+	chr1_4:3286167-3286186	None:intergenic	25.0%
!	GGAGAAATCATAAACATAAA+TGG	-	chr1_4:3286386-3286405	Msa0144010:CDS	25.0%
!	AACCATCTACTAGAATAATA+TGG	-	chr1_4:3286438-3286457	Msa0144010:CDS	25.0%
!	ACCATCTACTAGAATAATAT+GGG	-	chr1_4:3286439-3286458	Msa0144010:CDS	25.0%
!	AGAACAACTTTACATTCTAA+AGG	-	chr1_4:3286890-3286909	Msa0144010:CDS	25.0%
!	AACAAGAATAATTCTCTGAA+AGG	-	chr1_4:3286979-3286998	Msa0144010:CDS	25.0%
!!	AATCAATTTTCCCTTCATTT+TGG	+	chr1_4:3287027-3287046	None:intergenic	25.0%
!	CATTTGTAATGATCTAATGA+AGG	+	chr1_4:3287091-3287110	None:intergenic	25.0%
!!	TGAGAGAAATTTTGTTCATT+TGG	+	chr1_4:3287238-3287257	None:intergenic	25.0%
!	GTCTATAAATAAAACACACT+AGG	+	chr1_4:3287356-3287375	None:intergenic	25.0%
!!	ACTTTTATCTTAGTCAAGTT+AGG	-	chr1_4:3287580-3287599	Msa0144010:intron	25.0%
!!	CTAATGCAAAAGTATAACTA+AGG	+	chr1_4:3287616-3287635	None:intergenic	25.0%
!!	CTTAGTTATACTTTTGCATT+AGG	-	chr1_4:3287614-3287633	Msa0144010:intron	25.0%
!!	TAGTCTGGTTTAATTCAAAA+CGG	+	chr1_4:3287713-3287732	None:intergenic	25.0%
!	GTTTCAAAATGGTTCATTAA+CGG	+	chr1_4:3287746-3287765	None:intergenic	25.0%
!!	TTAAATCGAACTCTATTTTC+TGG	+	chr1_4:3288010-3288029	None:intergenic	25.0%
!!!	TCGATTTAAAATGTCGATTT+AGG	-	chr1_4:3288021-3288040	Msa0144010:intron	25.0%
!!!	TTAAAATGTCGATTTAGGTT+TGG	-	chr1_4:3288026-3288045	Msa0144010:intron	25.0%
!!!	TAAAATGTCGATTTAGGTTT+GGG	-	chr1_4:3288027-3288046	Msa0144010:intron	25.0%
!	AAATTGGACAATATTGTTTG+TGG	+	chr1_4:3288119-3288138	None:intergenic	25.0%
!!!	TTTGGTTTTCTTCCAAAAAT+TGG	-	chr1_4:3288163-3288182	Msa0144010:intron	25.0%
!	TCGTTCATTAAATGAAAAGT+AGG	+	chr1_4:3288200-3288219	None:intergenic	25.0%
!!!	ATTGAACAGTTGATGTATTT+TGG	+	chr1_4:3288330-3288349	None:intergenic	25.0%
!!	GGTTTTTGTCAAAAAAAAAC+AGG	+	chr1_4:3288815-3288834	None:intergenic	25.0%
!	ACGTTTCTTAGTTAAAAAGA+GGG	+	chr1_4:3289245-3289264	None:intergenic	25.0%
!	TTTGTATCACTAAAATTTGG+TGG	-	chr1_4:3289779-3289798	Msa0144010:intron	25.0%
!	CAAAAAAAATTGGACACATA+TGG	+	chr1_4:3289854-3289873	None:intergenic	25.0%
!	TGTATTTAGTTAATCACCTT+TGG	+	chr1_4:3289941-3289960	None:intergenic	25.0%
!	GTATTAAGTAGAAGAAAACT+TGG	+	chr1_4:3289980-3289999	None:intergenic	25.0%
!	ATTCTTTGTAGCAAATATTG+GGG	+	chr1_4:3290236-3290255	None:intergenic	25.0%
!	CAATTCTTTGTAGCAAATAT+TGG	+	chr1_4:3290238-3290257	None:intergenic	25.0%
!!	ACATATTTTCATAGATCAAC+TGG	-	chr1_4:3290352-3290371	Msa0144010:intron	25.0%
!!!	CGAATCATTATTGATTTCAT+AGG	-	chr1_4:3290391-3290410	Msa0144010:intron	25.0%
!	TTAAGATATGGACTTAGATA+GGG	+	chr1_4:3284796-3284815	None:intergenic	25.0%
!	ATTAAGATATGGACTTAGAT+AGG	+	chr1_4:3284797-3284816	None:intergenic	25.0%
!	CCATTAGGTATAATACTATT+AGG	+	chr1_4:3290804-3290823	None:intergenic	25.0%
!	CCTAATAGTATTATACCTAA+TGG	-	chr1_4:3290801-3290820	Msa0144010:intron	25.0%
!	TACTGAATTTGAAGAGAAAA+TGG	+	chr1_4:3290837-3290856	None:intergenic	25.0%
!!!	ATCTCTAATGAGATTTGTTT+TGG	+	chr1_4:3290883-3290902	None:intergenic	25.0%
!	ACAAATCTCATTAGAGATAA+AGG	-	chr1_4:3290885-3290904	Msa0144010:intron	25.0%
!!	TTCAAAATTTTCTTATCAGG+AGG	-	chr1_4:3291002-3291021	Msa0144010:intron	25.0%
!	TTGGAAAAATAGTCTTCTTT+GGG	+	chr1_4:3291047-3291066	None:intergenic	25.0%
!	ACCAATATCAAATGTGTATA+AGG	+	chr1_4:3291072-3291091	None:intergenic	25.0%
!	ATTGGTCAAAATGATCTTAT+TGG	-	chr1_4:3291086-3291105	Msa0144010:CDS	25.0%
!	CTAGAAATTACTCATGATAT+CGG	+	chr1_4:3291750-3291769	None:intergenic	25.0%
!!!	TTTGAGATATTTTCAAGTGT+TGG	-	chr1_4:3291772-3291791	Msa0144010:intron	25.0%
!!!	TTACTGTTTGTTTTGATTGA+CGG	-	chr1_4:3292245-3292264	Msa0144010:CDS	25.0%
!	AAATGGTACAAAAATTGTTG+CGG	-	chr1_4:3292527-3292546	Msa0144010:five_prime_UTR	25.0%
	TTGTATATGTTGAGCTTACA+TGG	-	chr1_4:3284686-3284705	Msa0144010:CDS	30.0%
	AGTCCATATCTTAATTCTCT+TGG	-	chr1_4:3284802-3284821	Msa0144010:intron	30.0%
	GTCCATATCTTAATTCTCTT+GGG	-	chr1_4:3284803-3284822	Msa0144010:intron	30.0%
	CCATTAGGTATAATGTTGTT+AGG	+	chr1_4:3284883-3284902	None:intergenic	30.0%
	CCTAACAACATTATACCTAA+TGG	-	chr1_4:3284880-3284899	Msa0144010:intron	30.0%
	TTGAATGTACTGAATCTGAA+GGG	+	chr1_4:3284923-3284942	None:intergenic	30.0%
	ATTGAATGTACTGAATCTGA+AGG	+	chr1_4:3284924-3284943	None:intergenic	30.0%
	ACAAAGTTTATTAGGGATCA+AGG	-	chr1_4:3284964-3284983	Msa0144010:intron	30.0%
	ATCAAATGTGTATAAGGCTT+TGG	+	chr1_4:3285154-3285173	None:intergenic	30.0%
	GCCTTATACACATTTGATAT+AGG	-	chr1_4:3285156-3285175	Msa0144010:CDS	30.0%
	ATATTCAAAGCTGAACCAAA+CGG	+	chr1_4:3285311-3285330	None:intergenic	30.0%
!!!	TTTTTGGCTAGAATTGCTTT+TGG	-	chr1_4:3285704-3285723	Msa0144010:intron	30.0%
!!	CACTGTAGAGAATTGATTTT+GGG	-	chr1_4:3285727-3285746	Msa0144010:intron	30.0%
	GGAAAATTGGCCAAAATTAA+AGG	+	chr1_4:3285985-3286004	None:intergenic	30.0%
	CTTTATAGCAGATGGAAAAT+TGG	+	chr1_4:3285998-3286017	None:intergenic	30.0%
!	CAATTTTCCATCTGCTATAA+AGG	-	chr1_4:3285996-3286015	Msa0144010:intron	30.0%
!!!	TTTTGGAAAAGAGAGTACTT+AGG	+	chr1_4:3286150-3286169	None:intergenic	30.0%
!!!	TTGTCTCACCGTATTTTTTT+TGG	+	chr1_4:3286174-3286193	None:intergenic	30.0%
	AATGGTACAAACATTGTTGT+TGG	-	chr1_4:3286404-3286423	Msa0144010:CDS	30.0%
	TCCCATATTATTCTAGTAGA+TGG	+	chr1_4:3286443-3286462	None:intergenic	30.0%
	TCTACTAGAATAATATGGGA+TGG	-	chr1_4:3286443-3286462	Msa0144010:CDS	30.0%
	CAAGTTTATTGGAACAATCA+TGG	-	chr1_4:3286709-3286728	Msa0144010:intron	30.0%
	TTTATTGGAACAATCATGGA+AGG	-	chr1_4:3286713-3286732	Msa0144010:intron	30.0%
!!!	TGGCAACTTTAGTTTTTACT+TGG	-	chr1_4:3286786-3286805	Msa0144010:intron	30.0%
!!!	TTTAGTTTTTACTTGGCCTT+GGG	-	chr1_4:3286793-3286812	Msa0144010:CDS	30.0%
	TCATCAAAACCAAAAACTAG+AGG	+	chr1_4:3286856-3286875	None:intergenic	30.0%
!!	TAGAATCGATTTGACTACAA+TGG	+	chr1_4:3287157-3287176	None:intergenic	30.0%
!	AGCATGCACATCATATTTTA+TGG	-	chr1_4:3287379-3287398	Msa0144010:intron	30.0%
	CTTAAATACACAGTTCCTTA+CGG	-	chr1_4:3287416-3287435	Msa0144010:intron	30.0%
	AAGAATGAAAGAGAAACCAT+GGG	+	chr1_4:3287555-3287574	None:intergenic	30.0%
	AAAGAATGAAAGAGAAACCA+TGG	+	chr1_4:3287556-3287575	None:intergenic	30.0%
	ACGACCATTAAATTAACAGT+TGG	+	chr1_4:3287672-3287691	None:intergenic	30.0%
!	AATTCAAAACGGTTTGTTCA+TGG	+	chr1_4:3287702-3287721	None:intergenic	30.0%
!!!	CTCAGTTGTGTTTTTTTGTA+TGG	+	chr1_4:3287975-3287994	None:intergenic	30.0%
!!	AAAATGTCGATTTAGGTTTG+GGG	-	chr1_4:3288028-3288047	Msa0144010:intron	30.0%
	CTGAATCATAAACTCTTGTT+CGG	-	chr1_4:3288077-3288096	Msa0144010:intron	30.0%
	GACAATATTGTTTGTGGTTT+AGG	+	chr1_4:3288113-3288132	None:intergenic	30.0%
	ATTAAATGAAAAGTAGGCCT+GGG	+	chr1_4:3288194-3288213	None:intergenic	30.0%
	TTGTTTATGATTGAGACCAA+AGG	-	chr1_4:3288369-3288388	Msa0144010:intron	30.0%
	TGTTTATGATTGAGACCAAA+GGG	-	chr1_4:3288370-3288389	Msa0144010:intron	30.0%
	ATCAATCAACTTTCCATTGA+CGG	+	chr1_4:3288415-3288434	None:intergenic	30.0%
	TGTCTTTCAATCGATTAAGA+AGG	-	chr1_4:3288460-3288479	Msa0144010:intron	30.0%
	GTCAAAAAAAAACAGGTTTG+AGG	+	chr1_4:3288808-3288827	None:intergenic	30.0%
	CTCTCGTATTTCTTCATTTA+TGG	+	chr1_4:3288952-3288971	None:intergenic	30.0%
	TATCTGCAATCAGTAGTTAA+TGG	-	chr1_4:3288980-3288999	Msa0144010:intron	30.0%
	CACGTTTCTTAGTTAAAAAG+AGG	+	chr1_4:3289246-3289265	None:intergenic	30.0%
	GTTGCCATAATGAAGAAATA+TGG	+	chr1_4:3289382-3289401	None:intergenic	30.0%
	TAACTGCCGAATTATAAAAC+CGG	+	chr1_4:3289623-3289642	None:intergenic	30.0%
!	TATCACTAAAATTTGGTGGA+AGG	-	chr1_4:3289783-3289802	Msa0144010:intron	30.0%
	TTAATCACCTTTGGTTGAAA+AGG	+	chr1_4:3289932-3289951	None:intergenic	30.0%
	GATCATATCATATAGTCCAT+AGG	-	chr1_4:3290117-3290136	Msa0144010:intron	30.0%
	ATGAATTTCATGAAGCACAA+AGG	+	chr1_4:3290145-3290164	None:intergenic	30.0%
	TTTGTGCTTCATGAAATTCA+TGG	-	chr1_4:3290144-3290163	Msa0144010:intron	30.0%
	TTCTTTGTAGCAAATATTGG+GGG	+	chr1_4:3290235-3290254	None:intergenic	30.0%
	TGAAAATATGTCTCTCCATA+TGG	+	chr1_4:3290343-3290362	None:intergenic	30.0%
	TAGAACTCTCAAATAGAGTT+TGG	+	chr1_4:3290441-3290460	None:intergenic	30.0%
	GTCTACTTGGAGAAAAATAA+TGG	+	chr1_4:3290513-3290532	None:intergenic	30.0%
	GTATGTATTCTATGGAAGTT+TGG	+	chr1_4:3290556-3290575	None:intergenic	30.0%
	TGTTATCGGTATGTATTCTA+TGG	+	chr1_4:3290564-3290583	None:intergenic	30.0%
	TCACAGTATTACAATACTGA+AGG	-	chr1_4:3290617-3290636	Msa0144010:intron	30.0%
	AGTCCATATCTTAATTCTCT+TGG	-	chr1_4:3284802-3284821	Msa0144010:intron	30.0%
	GTCCATATCTTAATTCTCTT+GGG	-	chr1_4:3284803-3284822	Msa0144010:intron	30.0%
!!	AATGGACTAAATATCCCATT+AGG	+	chr1_4:3290819-3290838	None:intergenic	30.0%
	AAAGATATCAACGAGAACAA+CGG	+	chr1_4:3290927-3290946	None:intergenic	30.0%
!	TTGTTCTCGTTGATATCTTT+TGG	-	chr1_4:3290927-3290946	Msa0144010:intron	30.0%
!!	GGTGATTTCGAGTTTAATTA+AGG	-	chr1_4:3290948-3290967	Msa0144010:intron	30.0%
	TGGAAAAATAGTCTTCTTTG+GGG	+	chr1_4:3291046-3291065	None:intergenic	30.0%
	GTTGGAAAAATAGTCTTCTT+TGG	+	chr1_4:3291048-3291067	None:intergenic	30.0%
	GCCTTATACACATTTGATAT+TGG	-	chr1_4:3285156-3285175	Msa0144010:CDS	30.0%
!!	GATCTTATTGGTGGTTATTT+TGG	-	chr1_4:3291098-3291117	Msa0144010:CDS	30.0%
!!	CAATTTCATAGAGAGTATCA+AGG	-	chr1_4:3291169-3291188	Msa0144010:CDS	30.0%
	TTATTTAGACACTATAGTCG+AGG	-	chr1_4:3291350-3291369	Msa0144010:intron	30.0%
	ACTGATGAAATGAAACTTGT+TGG	-	chr1_4:3291918-3291937	Msa0144010:intron	30.0%
	ATATATACAATTTAGGGGCT+AGG	-	chr1_4:3291950-3291969	Msa0144010:CDS	30.0%
	TAATTTCCCATCTGCAATAA+AGG	-	chr1_4:3292026-3292045	Msa0144010:CDS	30.0%
	AACTATCCTTTATTGCAGAT+GGG	+	chr1_4:3292035-3292054	None:intergenic	30.0%
	TAACTATCCTTTATTGCAGA+TGG	+	chr1_4:3292036-3292055	None:intergenic	30.0%
	TCTGCAATAAAGGATAGTTA+TGG	-	chr1_4:3292036-3292055	Msa0144010:CDS	30.0%
!!!	TTTTGAAAAAGGGAGTACTT+AGG	+	chr1_4:3292180-3292199	None:intergenic	30.0%
	GGAGCAACTATAAACATAAA+TGG	-	chr1_4:3292510-3292529	Msa0144010:five_prime_UTR	30.0%
	AATGGTACAAAAATTGTTGC+GGG	-	chr1_4:3292528-3292547	Msa0144010:five_prime_UTR	30.0%
	GACCCAAGAGAATTAAGATA+TGG	+	chr1_4:3284808-3284827	None:intergenic	35.0%
!	CTTGGGTCAAATTTTACACA+TGG	-	chr1_4:3284820-3284839	Msa0144010:intron	35.0%
!!	AATGGACTGAACATTCCATT+AGG	+	chr1_4:3284898-3284917	None:intergenic	35.0%
	TACTGAATCTGAAGGGAAAA+TGG	+	chr1_4:3284916-3284935	None:intergenic	35.0%
!	TTCAAAATTTTCTTGCCAGG+AGG	-	chr1_4:3285090-3285109	Msa0144010:CDS	35.0%
!	GATCTTACTGCTGGATTTTT+CGG	-	chr1_4:3285186-3285205	Msa0144010:CDS	35.0%
	TATTCAAAGCTGAACCAAAC+GGG	+	chr1_4:3285310-3285329	None:intergenic	35.0%
	AAACCTATACACGTTGTTCA+AGG	-	chr1_4:3285580-3285599	Msa0144010:intron	35.0%
!	TTCTAGAAAAGCTAGAAGCT+AGG	-	chr1_4:3285611-3285630	Msa0144010:intron	35.0%
!!	TGAACCAAACACGTTGTTTT+TGG	-	chr1_4:3285688-3285707	Msa0144010:intron	35.0%
!!	GCACTGTAGAGAATTGATTT+TGG	-	chr1_4:3285726-3285745	Msa0144010:intron	35.0%
	ATATATACAAATTAGGGGCC+AGG	-	chr1_4:3285920-3285939	Msa0144010:intron	35.0%
!	TCATTTTGGATACACAACAC+TGG	-	chr1_4:3285943-3285962	Msa0144010:intron	35.0%
!	ATTAAAGGCACACATCCAAT+TGG	+	chr1_4:3285970-3285989	None:intergenic	35.0%
!!	TGGATGTGTGCCTTTAATTT+TGG	-	chr1_4:3285972-3285991	Msa0144010:intron	35.0%
	GTTAGGGTATATTTGGATTG+CGG	-	chr1_4:3286216-3286235	Msa0144010:intron	35.0%
	TATAACATTCGTGCTAGATG+TGG	-	chr1_4:3286365-3286384	Msa0144010:CDS	35.0%
	TTGTAACATGCCCTATTTAG+TGG	+	chr1_4:3286545-3286564	None:intergenic	35.0%
!!!	TGGTTTTGTAGCAACCTTTT+TGG	-	chr1_4:3286661-3286680	Msa0144010:intron	35.0%
	TCTAGAAGTTGGCAAATATG+CGG	+	chr1_4:3286744-3286763	None:intergenic	35.0%
!!	GTAAACATAGCTCTAGAAGT+TGG	+	chr1_4:3286755-3286774	None:intergenic	35.0%
!!!	CTTTAGTTTTTACTTGGCCT+TGG	-	chr1_4:3286792-3286811	Msa0144010:CDS	35.0%
	CATTGTTCTTCAAACCACTT+TGG	+	chr1_4:3286832-3286851	None:intergenic	35.0%
!!!	GAACAATGACCTCTAGTTTT+TGG	-	chr1_4:3286844-3286863	Msa0144010:CDS	35.0%
!!	CTCTGAAAGGTTTTTACAGA+AGG	-	chr1_4:3286992-3287011	Msa0144010:CDS	35.0%
!	GAAAGGTTTTTACAGAAGGA+AGG	-	chr1_4:3286996-3287015	Msa0144010:intron	35.0%
	ATGAGATTCAAAGAGTAGCT+AGG	-	chr1_4:3287296-3287315	Msa0144010:intron	35.0%
	TGAGATTCAAAGAGTAGCTA+GGG	-	chr1_4:3287297-3287316	Msa0144010:intron	35.0%
!	GCAATGTCAATTTTATCCCA+TGG	-	chr1_4:3287536-3287555	Msa0144010:intron	35.0%
!	TCCAATTTTCCTGAACCATT+AGG	-	chr1_4:3288131-3288150	Msa0144010:intron	35.0%
	TCCTAATGGTTCAGGAAAAT+TGG	+	chr1_4:3288135-3288154	None:intergenic	35.0%
!	ATTTTCCTGAACCATTAGGA+TGG	-	chr1_4:3288135-3288154	Msa0144010:intron	35.0%
	CATTAAATGAAAAGTAGGCC+TGG	+	chr1_4:3288195-3288214	None:intergenic	35.0%
	TGAACGATTTCAAAGTCAAC+AGG	-	chr1_4:3288213-3288232	Msa0144010:intron	35.0%
!!	ACCAAAGGGAGTATTAAAGA+TGG	-	chr1_4:3288384-3288403	Msa0144010:intron	35.0%
	TCCATCTTTAATACTCCCTT+TGG	+	chr1_4:3288388-3288407	None:intergenic	35.0%
	GAAGGACTTTCACAAGAATT+TGG	-	chr1_4:3288478-3288497	Msa0144010:intron	35.0%
	CTAAACTGTGAGATACACAA+TGG	+	chr1_4:3288586-3288605	None:intergenic	35.0%
!	AAAGACGTTTTTACCCCTTT+CGG	-	chr1_4:3288674-3288693	Msa0144010:intron	35.0%
	TAACTGCCGAATTATGAAAC+CGG	-	chr1_4:3288701-3288720	Msa0144010:intron	35.0%
	TTAACTACCGAGGAAAACTT+CGG	-	chr1_4:3288730-3288749	Msa0144010:intron	35.0%
	CTGAGGAAATCTGAAAACTT+CGG	-	chr1_4:3288763-3288782	Msa0144010:intron	35.0%
	CCGAGGAAAATTGAAAACTT+CGG	+	chr1_4:3289561-3289580	None:intergenic	35.0%
!	CCGAAGTTTTCAATTTTCCT+CGG	-	chr1_4:3289558-3289577	Msa0144010:intron	35.0%
	TTAACTACCGAGGAAAACTT+CGG	+	chr1_4:3288730-3288749	None:intergenic	35.0%
!	AAAAGACGTTTTTACCCCTT+CGG	+	chr1_4:3288673-3288692	None:intergenic	35.0%
!	TGTTTGACCTTTTCAACCAA+AGG	-	chr1_4:3289922-3289941	Msa0144010:intron	35.0%
	TGGCAAAATTTGAGCTTCTT+AGG	-	chr1_4:3290164-3290183	Msa0144010:intron	35.0%
!	TTTCCTGCCATATTTAGCTT+TGG	-	chr1_4:3290262-3290281	Msa0144010:intron	35.0%
!	TGAAGCACCAAAGCTAAATA+TGG	+	chr1_4:3290272-3290291	None:intergenic	35.0%
!!	GATGTGTTGAGGTTTGTTAT+CGG	+	chr1_4:3290578-3290597	None:intergenic	35.0%
	AAGCTATATGTGATGTGTTG+AGG	+	chr1_4:3290589-3290608	None:intergenic	35.0%
	GACCCAAGAGAATTAAGATA+TGG	+	chr1_4:3284808-3284827	None:intergenic	35.0%
	ATCAAATGTGTATAAGGCGT+TGG	+	chr1_4:3291066-3291085	None:intergenic	35.0%
	GGTCAAAATGATCTTATTGG+TGG	-	chr1_4:3291089-3291108	Msa0144010:CDS	35.0%
	CATAAGAACGATGATGATTG+TGG	+	chr1_4:3291531-3291550	None:intergenic	35.0%
	CGTTCTTATGAGTAAGATTG+TGG	-	chr1_4:3291541-3291560	Msa0144010:intron	35.0%
	TCGTTAACCACTCATTAAAG+TGG	-	chr1_4:3291799-3291818	Msa0144010:intron	35.0%
	CGTTAACCACTCATTAAAGT+GGG	-	chr1_4:3291800-3291819	Msa0144010:intron	35.0%
!	TCATTTTGGATACACAACAC+AGG	-	chr1_4:3285943-3285962	Msa0144010:intron	35.0%
!	CATTTTGGATACACAACACA+GGG	-	chr1_4:3291974-3291993	Msa0144010:CDS	35.0%
	TGGAAGCTTGATTAACATGT+AGG	-	chr1_4:3292423-3292442	Msa0144010:five_prime_UTR	35.0%
!	GGAAAGTACAACATTCATGT+TGG	-	chr1_4:3292483-3292502	Msa0144010:five_prime_UTR	35.0%
	TACAACATTCATGTTGGATG+TGG	-	chr1_4:3292489-3292508	Msa0144010:five_prime_UTR	35.0%
	ACCCATCTACTAGAATCATT+TGG	-	chr1_4:3292562-3292581	Msa0144010:five_prime_UTR	35.0%
	CCCAAATGATTCTAGTAGAT+GGG	+	chr1_4:3292566-3292585	None:intergenic	35.0%
	CCCATCTACTAGAATCATTT+GGG	-	chr1_4:3292563-3292582	Msa0144010:five_prime_UTR	35.0%
	TCCCAAATGATTCTAGTAGA+TGG	+	chr1_4:3292567-3292586	None:intergenic	35.0%
	TCTACTAGAATCATTTGGGA+TGG	-	chr1_4:3292567-3292586	Msa0144010:five_prime_UTR	35.0%
	GTCTTTGATCAAATCTCTAC+TGG	-	chr1_4:3286497-3286516	Msa0144010:intron	35.0%
!	TCCTCCTATTTCTCTAGATA+TGG	-	chr1_4:3292656-3292675	Msa0144010:five_prime_UTR	35.0%
	CATGCCATATCTAGAGAAAT+AGG	+	chr1_4:3292663-3292682	None:intergenic	35.0%
	AATGTTGCAAATACACCTCC+TGG	+	chr1_4:3285108-3285127	None:intergenic	40.0%
	GGTCAAAATGATCTTACTGC+TGG	-	chr1_4:3285177-3285196	Msa0144010:CDS	40.0%
	AACGGGCACATAGCAAAAAT+GGG	+	chr1_4:3285293-3285312	None:intergenic	40.0%
	AAACGGGCACATAGCAAAAA+TGG	+	chr1_4:3285294-3285313	None:intergenic	40.0%
!!	ATTTTTGCTATGTGCCCGTT+TGG	-	chr1_4:3285293-3285312	Msa0144010:intron	40.0%
	TCTCCTTGAACAACGTGTAT+AGG	+	chr1_4:3285586-3285605	None:intergenic	40.0%
	AGCTAGGATTTGTAGCTTCA+TGG	-	chr1_4:3285627-3285646	Msa0144010:intron	40.0%
!	GCTTCATGGAGAATTGCTTT+TGG	-	chr1_4:3285641-3285660	Msa0144010:intron	40.0%
!!	TCATGGAGAATTGCTTTTGG+AGG	-	chr1_4:3285644-3285663	Msa0144010:intron	40.0%
	CTAGCCAAAAACAACGTGTT+TGG	+	chr1_4:3285695-3285714	None:intergenic	40.0%
	GTTGTGTATCCAAAATGACC+TGG	+	chr1_4:3285941-3285960	None:intergenic	40.0%
	ATACACAACACTGGACCAAT+TGG	-	chr1_4:3285952-3285971	Msa0144010:intron	40.0%
	TGGCTATCCTTTATAGCAGA+TGG	+	chr1_4:3286006-3286025	None:intergenic	40.0%
	TCTGCTATAAAGGATAGCCA+AGG	-	chr1_4:3286006-3286025	Msa0144010:intron	40.0%
	TGTATTGCTTTGCACAACCT+TGG	+	chr1_4:3286026-3286045	None:intergenic	40.0%
	ACATATGTGATTGCAGCTAG+TGG	+	chr1_4:3286114-3286133	None:intergenic	40.0%
	ATCCTCCCATTCCACTAAAT+AGG	-	chr1_4:3286531-3286550	Msa0144010:intron	40.0%
	TCCTCCCATTCCACTAAATA+GGG	-	chr1_4:3286532-3286551	Msa0144010:intron	40.0%
	CATGCCCTATTTAGTGGAAT+GGG	+	chr1_4:3286539-3286558	None:intergenic	40.0%
	ACATGCCCTATTTAGTGGAA+TGG	+	chr1_4:3286540-3286559	None:intergenic	40.0%
	TTGGAACAATCATGGAAGGT+AGG	-	chr1_4:3286717-3286736	Msa0144010:intron	40.0%
	CTAGAAGTTGGCAAATATGC+GGG	+	chr1_4:3286743-3286762	None:intergenic	40.0%
	GAAGGTGAGACCAAAATGAA+GGG	-	chr1_4:3287014-3287033	Msa0144010:intron	40.0%
!!	TCCATTCGATTTGGCTAACA+CGG	+	chr1_4:3287264-3287283	None:intergenic	40.0%
!!	CTTTGAAGCTCCATTCGATT+TGG	+	chr1_4:3287273-3287292	None:intergenic	40.0%
	AACGGTTCGACAAAATAGTC+TGG	+	chr1_4:3287728-3287747	None:intergenic	40.0%
	AACACAACTGAGTTCGCAAA+AGG	-	chr1_4:3287983-3288002	Msa0144010:intron	40.0%
	ATCAACTTTCCATTGACGGT+CGG	+	chr1_4:3288411-3288430	None:intergenic	40.0%
!	TGCTGTTGACACATTAGCTT+TGG	-	chr1_4:3288635-3288654	Msa0144010:intron	40.0%
!!	TTGACACATTAGCTTTGGCT+AGG	-	chr1_4:3288640-3288659	Msa0144010:intron	40.0%
!	TTAACTGCCGAAGTTTTCCT+CGG	+	chr1_4:3288740-3288759	None:intergenic	40.0%
!	AAACAGGTTTGAGGTTTCCT+CGG	+	chr1_4:3289525-3289544	None:intergenic	40.0%
!	AAACAGGTTTGAGGTTTCCT+CGG	-	chr1_4:3289525-3289544	Msa0144010:intron	40.0%
!	TTTACTGCCGAAGTTTTCCT+CGG	-	chr1_4:3289584-3289603	Msa0144010:intron	40.0%
!!	CTGCAGCCGGTTTTATAATT+CGG	-	chr1_4:3289614-3289633	Msa0144010:intron	40.0%
!!	TTGACACATTAGCTTTGGCT+AGG	+	chr1_4:3288640-3288659	None:intergenic	40.0%
!	TGCTGTTGACACATTAGCTT+TGG	+	chr1_4:3288635-3288654	None:intergenic	40.0%
	ATGAAGCACAAAGGAACCTA+TGG	+	chr1_4:3290136-3290155	None:intergenic	40.0%
	AGCACAATCAAAGACACAAG+TGG	+	chr1_4:3290196-3290215	None:intergenic	40.0%
	TATGTCTCTCCATATGGAGA+AGG	+	chr1_4:3290337-3290356	None:intergenic	40.0%
	TCAACTGGAAGATACTCTGA+TGG	-	chr1_4:3290367-3290386	Msa0144010:intron	40.0%
	AAGTACTTGAGAGGTCTACT+TGG	+	chr1_4:3290526-3290545	None:intergenic	40.0%
	GGATCTTCTAAGTACTTGAG+AGG	+	chr1_4:3290535-3290554	None:intergenic	40.0%
	GTAATTTCAGCACAGAGCTT+TGG	-	chr1_4:3290687-3290706	Msa0144010:CDS	40.0%
!	TGGGTATTGTGAGTTGTCAT+TGG	+	chr1_4:3291492-3291511	None:intergenic	40.0%
!	ATTTAGGGGCTAGGTCATTT+TGG	-	chr1_4:3291959-3291978	Msa0144010:CDS	40.0%
	GGGAAATTAGCCAAAATCGT+AGG	+	chr1_4:3292015-3292034	None:intergenic	40.0%
	GCCATATCTAGAGAAATAGG+AGG	+	chr1_4:3292660-3292679	None:intergenic	40.0%
!	AATTAGGGGCCAGGTCATTT+TGG	-	chr1_4:3285929-3285948	Msa0144010:intron	45.0%
	ATCCACACGAAGTTGAGCTA+GGG	+	chr1_4:3286088-3286107	None:intergenic	45.0%
	AGGATTTGAGCTACCACATG+TGG	-	chr1_4:3286313-3286332	Msa0144010:CDS	45.0%
	GGATGGTACACATTACACAG+AGG	-	chr1_4:3286460-3286479	Msa0144010:CDS	45.0%
	GCGTTACTGTTGAACCAAAG+TGG	-	chr1_4:3286815-3286834	Msa0144010:CDS	45.0%
	GGAAGGTGAGACCAAAATGA+AGG	-	chr1_4:3287013-3287032	Msa0144010:intron	45.0%
	ACCGTGTTAGCCAAATCGAA+TGG	-	chr1_4:3287260-3287279	Msa0144010:intron	45.0%
	CCTGAACCATTAGGATGGTT+CGG	-	chr1_4:3288140-3288159	Msa0144010:intron	45.0%
!!	ACCATTAGGATGGTTCGGTT+TGG	-	chr1_4:3288145-3288164	Msa0144010:intron	45.0%
	ACCAAACCGAACCATCCTAA+TGG	+	chr1_4:3288149-3288168	None:intergenic	45.0%
	AACAGGCGTATTACTCTCTC+TGG	-	chr1_4:3288230-3288249	Msa0144010:intron	45.0%
	TCGGCAGTTAACTACCGAAA+GGG	+	chr1_4:3288691-3288710	None:intergenic	45.0%
	TTCGGCAGTTAACTACCGAA+AGG	+	chr1_4:3289632-3289651	None:intergenic	45.0%
!	CTGCAGCCGGTTTCATAATT+CGG	+	chr1_4:3288710-3288729	None:intergenic	45.0%
	ATTCGGCAGTTAACTACCGA+AGG	-	chr1_4:3289631-3289650	Msa0144010:intron	45.0%
	TTCGGCAGTTAACTACCGAA+GGG	-	chr1_4:3289632-3289651	Msa0144010:intron	45.0%
	TGTCATGCTCTAGCCAAATG+TGG	-	chr1_4:3289807-3289826	Msa0144010:intron	45.0%
	TGTATCAAGCGTGCCACATT+TGG	+	chr1_4:3289823-3289842	None:intergenic	45.0%
	GCACCAAAGCTAAATATGGC+AGG	+	chr1_4:3290268-3290287	None:intergenic	45.0%
	AAACGTTGACACTGGTGGTT+TGG	-	chr1_4:3290291-3290310	Msa0144010:intron	45.0%
	CTTGGGTCTAACTTCACACA+TGG	-	chr1_4:3290741-3290760	Msa0144010:CDS	45.0%
	TGACAACTCACAATACCCAC+TGG	-	chr1_4:3291493-3291512	Msa0144010:intron	45.0%
	GACAACTCACAATACCCACT+GGG	-	chr1_4:3291494-3291513	Msa0144010:intron	45.0%
	TGGATTTCTACACTCCCAGT+GGG	+	chr1_4:3291511-3291530	None:intergenic	45.0%
	CTACTGCCCACTTTAATGAG+TGG	+	chr1_4:3291809-3291828	None:intergenic	45.0%
!	TGGTTGCACTCCTACGATTT+TGG	-	chr1_4:3292002-3292021	Msa0144010:CDS	45.0%
	ATCGCTACGAAGTTGAGCTA+GGG	+	chr1_4:3292118-3292137	None:intergenic	45.0%
	ACATATGCGATTGCAGCAAG+AGG	+	chr1_4:3292144-3292163	None:intergenic	45.0%
	GTTAGCTGTCTCTGTGAAGT+GGG	+	chr1_4:3292595-3292614	None:intergenic	45.0%
	TGTTAGCTGTCTCTGTGAAG+TGG	+	chr1_4:3292596-3292615	None:intergenic	45.0%
!!	TTTATTAATATATATAACAA+GGG	+	chr1_4:3285877-3285896	None:intergenic	5.0%
!!!	TTTTATTAATATATATAACA+AGG	+	chr1_4:3285878-3285897	None:intergenic	5.0%
!!	TAAAGAATTAAATTTAATTA+AGG	+	chr1_4:3289455-3289474	None:intergenic	5.0%
!!!	TTAATTCTTTAATTATTTTA+TGG	+	chr1_4:3289446-3289465	None:intergenic	5.0%
!!	TAAAGAATTAAATTTAATTA+AGG	-	chr1_4:3289455-3289474	Msa0144010:intron	5.0%
	GGTGCAAACTTTGCAACAGC+AGG	-	chr1_4:3284841-3284860	Msa0144010:intron	50.0%
	GATCCACACGAAGTTGAGCT+AGG	+	chr1_4:3286089-3286108	None:intergenic	50.0%
	CTACCACATGTGGCATGTTG+TGG	-	chr1_4:3286323-3286342	Msa0144010:CDS	50.0%
	TAGCCACAACATGCCACATG+TGG	+	chr1_4:3286329-3286348	None:intergenic	50.0%
	CATGTGGCATGTTGTGGCTA+TGG	-	chr1_4:3286329-3286348	Msa0144010:CDS	50.0%
	GCCCTATTTAGTGGAATGGG+AGG	+	chr1_4:3286536-3286555	None:intergenic	50.0%
	TGGTTCAACAGTAACGCCCA+AGG	+	chr1_4:3286812-3286831	None:intergenic	50.0%
	CACAGTTCCTTACGGTGTAC+CGG	-	chr1_4:3287424-3287443	Msa0144010:intron	50.0%
	ACAGTTCCTTACGGTGTACC+GGG	-	chr1_4:3287425-3287444	Msa0144010:intron	50.0%
	TAAGAACCCGGTACACCGTA+AGG	+	chr1_4:3287434-3287453	None:intergenic	50.0%
	CCGAACCATCCTAATGGTTC+AGG	+	chr1_4:3288143-3288162	None:intergenic	50.0%
	TCCAAAAATTGGACCAGCCC+AGG	-	chr1_4:3288174-3288193	Msa0144010:intron	50.0%
	AATGAAAAGTAGGCCTGGGC+TGG	+	chr1_4:3288190-3288209	None:intergenic	50.0%
	AAAGATGGACCGACCGTCAA+TGG	-	chr1_4:3288399-3288418	Msa0144010:intron	50.0%
	CGGCAGTTAACTACCGAAAG+GGG	+	chr1_4:3288690-3288709	None:intergenic	50.0%
	ACTTCGGCAGTTAACTGCTG+AGG	-	chr1_4:3288746-3288765	Msa0144010:intron	50.0%
	ACTTCGGCAATTAACTGCCG+AGG	-	chr1_4:3288779-3288798	Msa0144010:intron	50.0%
	ACTTCGGCAATTAACTGCCG+AGG	+	chr1_4:3288779-3288798	None:intergenic	50.0%
	ACTTCGGCAGTAAACTACCG+AGG	+	chr1_4:3289578-3289597	None:intergenic	50.0%
	TCGGCAGTTAACTACCGAAG+GGG	-	chr1_4:3289633-3289652	Msa0144010:intron	50.0%
	GGCACGCTTGATACACATCA+TGG	-	chr1_4:3289828-3289847	Msa0144010:intron	50.0%
	GGTGCTTCAAACGTTGACAC+TGG	-	chr1_4:3290283-3290302	Msa0144010:intron	50.0%
	GCTTCAAACGTTGACACTGG+TGG	-	chr1_4:3290286-3290305	Msa0144010:intron	50.0%
	TGGAGAAGGTGGTGCTTGAA+AGG	+	chr1_4:3290323-3290342	None:intergenic	50.0%
	CAAGCACCACCTTCTCCATA+TGG	-	chr1_4:3290325-3290344	Msa0144010:intron	50.0%
	GTCTCTCCATATGGAGAAGG+TGG	+	chr1_4:3290334-3290353	None:intergenic	50.0%
	CATGGTGCAAACTTCGCAAC+AGG	-	chr1_4:3290759-3290778	Msa0144010:CDS	50.0%
	GTGGATTTCTACACTCCCAG+TGG	+	chr1_4:3291512-3291531	None:intergenic	50.0%
	ATACACAACACAGGGCCAAG+TGG	-	chr1_4:3291982-3292001	Msa0144010:CDS	50.0%
!	ATCGTAGGAGTGCAACCACT+TGG	+	chr1_4:3292000-3292019	None:intergenic	50.0%
	GATCGCTACGAAGTTGAGCT+AGG	+	chr1_4:3292119-3292138	None:intergenic	50.0%
	AGGATTTGAGCTTCCACACG+TGG	-	chr1_4:3292443-3292462	Msa0144010:five_prime_UTR	50.0%
	AGCCCTAGCTCAACTTCGTG+TGG	-	chr1_4:3286083-3286102	Msa0144010:CDS	55.0%
	GTGGCATGTTGTGGCTATGG+AGG	-	chr1_4:3286332-3286351	Msa0144010:CDS	55.0%
!!!	GCCTGGGCTGGTCCAATTTT+TGG	+	chr1_4:3288178-3288197	None:intergenic	55.0%
	CCTCGGTAGTTAACTGCAGC+CGG	+	chr1_4:3289601-3289620	None:intergenic	55.0%
	CCTCGGTAGTTAACTGCAGC+CGG	-	chr1_4:3289601-3289620	Msa0144010:intron	55.0%
	GGTGCAAACTTCGCAACAGG+AGG	-	chr1_4:3290762-3290781	Msa0144010:CDS	55.0%
	CTTCCACACGTGGCATGTTG+TGG	-	chr1_4:3292453-3292472	Msa0144010:five_prime_UTR	55.0%
	TAGCCACAACATGCCACGTG+TGG	+	chr1_4:3292459-3292478	None:intergenic	55.0%
	CACGTGGCATGTTGTGGCTA+TGG	-	chr1_4:3292459-3292478	Msa0144010:five_prime_UTR	55.0%
	GTGGCATGTTGTGGCTATGG+AGG	-	chr1_4:3286332-3286351	Msa0144010:CDS	55.0%
	CCGGCTGCAGTTAACTACCG+AGG	-	chr1_4:3288720-3288739	Msa0144010:intron	60.0%
	CCGGCTGCAGTTAACTACCG+AGG	+	chr1_4:3288720-3288739	None:intergenic	60.0%

Chromosome	Type	Strat	End	Strand	Name
chr1_4	gene	3284507	3292692	3284507	ID=Msa0144010;Name=Msa0144010
chr1_4	mRNA	3284507	3292692	3284507	ID=Msa0144010-mRNA-1;Parent=Msa0144010;Name=Msa0144010-mRNA-1;_AED=0.14;_eAED=0.14;_QI=397\|0.5\|0.33\|1\|0.37\|0.22\|9\|0\|568
chr1_4	exon	3284507	3284746	3284507	ID=Msa0144010-mRNA-1:exon:1427;Parent=Msa0144010-mRNA-1
chr1_4	exon	3285038	3285250	3285038	ID=Msa0144010-mRNA-1:exon:1426;Parent=Msa0144010-mRNA-1
chr1_4	exon	3286009	3286178	3286009	ID=Msa0144010-mRNA-1:exon:1425;Parent=Msa0144010-mRNA-1
chr1_4	exon	3286293	3286502	3286293	ID=Msa0144010-mRNA-1:exon:1424;Parent=Msa0144010-mRNA-1
chr1_4	exon	3286787	3287013	3286787	ID=Msa0144010-mRNA-1:exon:1423;Parent=Msa0144010-mRNA-1
chr1_4	exon	3290632	3290817	3290632	ID=Msa0144010-mRNA-1:exon:1422;Parent=Msa0144010-mRNA-1
chr1_4	exon	3291048	3291280	3291048	ID=Msa0144010-mRNA-1:exon:1421;Parent=Msa0144010-mRNA-1
chr1_4	exon	3291948	3292090	3291948	ID=Msa0144010-mRNA-1:exon:1420;Parent=Msa0144010-mRNA-1
chr1_4	exon	3292214	3292692	3292214	ID=Msa0144010-mRNA-1:exon:1419;Parent=Msa0144010-mRNA-1
chr1_4	five_prime_UTR	3292296	3292692	3292296	ID=Msa0144010-mRNA-1:five_prime_utr;Parent=Msa0144010-mRNA-1
chr1_4	CDS	3292214	3292295	3292214	ID=Msa0144010-mRNA-1:cds;Parent=Msa0144010-mRNA-1
chr1_4	CDS	3291948	3292090	3291948	ID=Msa0144010-mRNA-1:cds;Parent=Msa0144010-mRNA-1
chr1_4	CDS	3291048	3291280	3291048	ID=Msa0144010-mRNA-1:cds;Parent=Msa0144010-mRNA-1
chr1_4	CDS	3290632	3290817	3290632	ID=Msa0144010-mRNA-1:cds;Parent=Msa0144010-mRNA-1
chr1_4	CDS	3286787	3287013	3286787	ID=Msa0144010-mRNA-1:cds;Parent=Msa0144010-mRNA-1
chr1_4	CDS	3286293	3286502	3286293	ID=Msa0144010-mRNA-1:cds;Parent=Msa0144010-mRNA-1
chr1_4	CDS	3286009	3286178	3286009	ID=Msa0144010-mRNA-1:cds;Parent=Msa0144010-mRNA-1
chr1_4	CDS	3285038	3285250	3285038	ID=Msa0144010-mRNA-1:cds;Parent=Msa0144010-mRNA-1
chr1_4	CDS	3284507	3284746	3284507	ID=Msa0144010-mRNA-1:cds;Parent=Msa0144010-mRNA-1

Gene Sequence

>Msa0144010

ATGTTCAGTCCATTTTCCCTTCAGATTCAGTACATTCAATTCAAAGATTTCATACCCAAAACAAAGTTTATTAGGGATCAAGGAGGTGTATTTGCAACATTGATCCCCAAAGAAGATTATTATTCCAAAGCCTTATACACATTTGATATAGGTCAAAATGATCTTACTGCTGGATTTTTCGGTAATAAGACTATACAACAAGTCAACGCTACTGTGCCCGATATAAATATATACAAATTAGGGGCCAGGTCATTTTGGATACACAACACTGGACCAATTGGATGTGTGCCTTTAATTTTGGCCAATTTTCCATCTGCTATAAAGGATAGCCAAGGTTGTGCAAAGCAATACAATGAAGTATCTCAATATTTTAATTTAAAGTTGAAGGAAGCCCTAGCTCAACTTCGTGTGGATCTTCCACTAGCTGCAATCACATATGTTGATATCTACTCTCCTAAATGTGGAGAAATCATAAACATAAATGGTACAAACATTGTTGTTGGTTCATGTAAAAAACCATCTACTAGAATAATATGGGATGGTACACATTACACAGAGGCAGCTAACAAGATTGTCTTTGATCAAATCTCTACTGAAGCTTTTACAAATCCTCCCATTCCACTAAATAGGGCATGTTACAAAAAGCACATGCCACTTGTGTCTTTGATTGTGCTTATTTTATGTTCTACACCCCCAATATTTGCTACAAAGAATTGTGATTTTCCTGCCATATTTAGCTTTGGTGCTTCAAACGTTGACACTGGTGGTTTGGCTGCTGCCTTTCAAGCACCACCTTCTCCATATGGAGAGACATATTTTCATAGATCAACTGGAAGATACTCTGATGGTCGAATCATTATTGATTTCATAGCACAGAGCTTTGGACTTCCCTATCTAAGTCCATATCTTAATTCTCTTGGGTCTAACTTCACACATGGTGCAAACTTCGCAACAGGAGGATCAACAATCAATATTCCTAATAGTATTATACCTAATGGGATATTTAGTCCATTTTCTCTTCAAATTCAGTACATTCAATTCAAAGATTTCATATCCAAAACAAATCTCATTAGAGATAAAGGAGGTGTATTTGCAACGTTGATCCCCAAAGAAGACTATTTTTCCAACGCCTTATACACATTTGATATTGGTCAAAATGATCTTATTGGTGGTTATTTTGGTAATGCGACTATAAAACAAGTCAATGCTACTGTACCCGATATAGTAAACAATTTCATAGAGAGTATCAAGAATATATACAATTTAGGGGCTAGGTCATTTTGGATACACAACACAGGGCCAAGTGGTTGCACTCCTACGATTTTGGCTAATTTCCCATCTGCAATAAAGGATAGTTATGGTTGTGCAAAGCAACACAATGAAGTATCTCAGTATTTTAATTTAAAGTTGAAGGAAGCCCTAGCTCAACTTCGTAGCGATCTTCCTCTTGCTGCAATCGCATATCTTCCACACGTGGCATGTTGTGGCTATGGAGGAAAGTACAACATTCATGTTGGATGTGGAGCAACTATAAACATAAATGGTACAAAAATTGTTGCGGGTTCATGTAAAAACCCATCTACTAGAATCATTTGGGATGGTTCCCACTTCACAGAGACAGCTAACAAGATTGTCTTTGATCAAATCTCTACTGGAGCTTTCAATGATCCTCCTATTTCTCTAGATATGGCATGTTATAGAAAG

Protein sequence

>Msa0144010

MFSPFSLQIQYIQFKDFIPKTKFIRDQGGVFATLIPKEDYYSKALYTFDIGQNDLTAGFFGNKTIQQVNATVPDINIYKLGARSFWIHNTGPIGCVPLILANFPSAIKDSQGCAKQYNEVSQYFNLKLKEALAQLRVDLPLAAITYVDIYSPKCGEIININGTNIVVGSCKKPSTRIIWDGTHYTEAANKIVFDQISTEAFTNPPIPLNRACYKKHMPLVSLIVLILCSTPPIFATKNCDFPAIFSFGASNVDTGGLAAAFQAPPSPYGETYFHRSTGRYSDGRIIIDFIAQSFGLPYLSPYLNSLGSNFTHGANFATGGSTINIPNSIIPNGIFSPFSLQIQYIQFKDFISKTNLIRDKGGVFATLIPKEDYFSNALYTFDIGQNDLIGGYFGNATIKQVNATVPDIVNNFIESIKNIYNLGARSFWIHNTGPSGCTPTILANFPSAIKDSYGCAKQHNEVSQYFNLKLKEALAQLRSDLPLAAIAYLPHVACCGYGGKYNIHVGCGATININGTKIVAGSCKNPSTRIIWDGSHFTETANKIVFDQISTGAFNDPPISLDMACYRK