AlfalfaGEDB | Msa0721150

M. sativa cultivar zhongmu-4 / Msa0721150

KEGG: K21373
GO: -
PFAM: PF00201.21

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0721150	XP_003613025.1	94.316	475	27	0	1	475	1	475	0.0	896

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0721150	sp\|U3U992\|UGT8_CATRO	50.000	478	221	7	10	474	9	481	4.13e-164	475

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0721150	G7JWC2	94.316	475	27	0	1	475	1	475	0.0	896

TFs/TRs:

Gene ID	Type	Classification

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
Msa0005350	Msa0721150	0.801774	7.684699e-49	-8.615850e-47
Msa0006700	Msa0721150	0.849360	3.400503e-60	-8.615850e-47
Msa0008850	Msa0721150	0.834760	2.486889e-56	-8.615850e-47
Msa0011720	Msa0721150	0.824177	9.294191e-54	-8.615850e-47
Msa0012740	Msa0721150	0.810368	1.193372e-50	-8.615850e-47
Msa0020630	Msa0721150	0.810899	9.164628e-51	-8.615850e-47
Msa0030000	Msa0721150	0.805918	1.058325e-49	-8.615850e-47
Msa0030030	Msa0721150	0.845873	3.095455e-59	-8.615850e-47
Msa0036580	Msa0721150	-0.805397	1.361884e-49	-8.615850e-47
Msa0038310	Msa0721150	0.844573	6.954486e-59	-8.615850e-47
Msa0039200	Msa0721150	0.846452	2.152811e-59	-8.615850e-47
Msa0040190	Msa0721150	0.840362	9.103087e-58	-8.615850e-47
Msa0043960	Msa0721150	-0.814871	1.235252e-51	-8.615850e-47
Msa0044050	Msa0721150	-0.816056	6.733310e-52	-8.615850e-47
Msa0046310	Msa0721150	0.820832	5.569651e-53	-8.615850e-47
Msa0047470	Msa0721150	0.810588	1.069931e-50	-8.615850e-47
Msa0048000	Msa0721150	0.807944	3.946533e-50	-8.615850e-47
Msa0050730	Msa0721150	0.835524	1.595863e-56	-8.615850e-47
Msa0050760	Msa0721150	0.830635	2.628863e-55	-8.615850e-47
Msa0051100	Msa0721150	0.836484	9.106562e-57	-8.615850e-47
Msa0055280	Msa0721150	0.851263	9.946505e-61	-8.615850e-47
Msa0060600	Msa0721150	0.868836	4.853634e-66	-8.615850e-47
Msa0068410	Msa0721150	0.809537	1.801935e-50	-8.615850e-47
Msa0069260	Msa0721150	0.866318	3.111802e-65	-8.615850e-47
Msa0069280	Msa0721150	0.860423	2.087740e-63	-8.615850e-47
Msa0069310	Msa0721150	0.855834	4.834162e-62	-8.615850e-47
Msa0077330	Msa0721150	0.833115	6.419797e-56	-8.615850e-47
Msa0086090	Msa0721150	0.803022	4.250200e-49	-8.615850e-47
Msa0086820	Msa0721150	0.846998	1.526982e-59	-8.615850e-47
Msa0087880	Msa0721150	0.829109	6.186968e-55	-8.615850e-47
Msa0090620	Msa0721150	-0.818493	1.904956e-52	-8.615850e-47
Msa0094100	Msa0721150	0.808575	2.894766e-50	-8.615850e-47
Msa0094420	Msa0721150	0.807353	5.267975e-50	-8.615850e-47
Msa0099730	Msa0721150	0.800634	1.314367e-48	-8.615850e-47
Msa0101060	Msa0721150	0.855524	5.956862e-62	-8.615850e-47
Msa0101650	Msa0721150	0.805443	1.331605e-49	-8.615850e-47
Msa0102750	Msa0721150	0.827990	1.152825e-54	-8.615850e-47
Msa0103060	Msa0721150	0.815674	8.189782e-52	-8.615850e-47
Msa0105340	Msa0721150	0.861740	8.293576e-64	-8.615850e-47
Msa0105420	Msa0721150	0.819627	1.051636e-52	-8.615850e-47
Msa0108850	Msa0721150	0.848253	6.896838e-60	-8.615850e-47
Msa0110520	Msa0721150	0.812933	3.304353e-51	-8.615850e-47
Msa0605230	Msa0721150	0.803197	3.910715e-49	-8.615850e-47
Msa0606060	Msa0721150	0.835896	1.284663e-56	-8.615850e-47
Msa0611550	Msa0721150	0.802996	4.303475e-49	-8.615850e-47
Msa0617370	Msa0721150	0.828189	1.032256e-54	-8.615850e-47
Msa0617830	Msa0721150	0.811822	5.777602e-51	-8.615850e-47
Msa0619060	Msa0721150	0.811382	7.199822e-51	-8.615850e-47
Msa0619330	Msa0721150	0.819441	1.159545e-52	-8.615850e-47
Msa0620640	Msa0721150	0.855047	8.198407e-62	-8.615850e-47
Msa0621890	Msa0721150	0.845556	3.772042e-59	-8.615850e-47
Msa0622340	Msa0721150	0.853262	2.683415e-61	-8.615850e-47
Msa0622390	Msa0721150	0.811253	7.677372e-51	-8.615850e-47
Msa0623170	Msa0721150	0.840759	7.166495e-58	-8.615850e-47
Msa0624730	Msa0721150	0.805025	1.629200e-49	-8.615850e-47
Msa0635350	Msa0721150	0.803044	4.205259e-49	-8.615850e-47
Msa0635470	Msa0721150	0.838212	3.287847e-57	-8.615850e-47
Msa0635990	Msa0721150	0.828927	6.849480e-55	-8.615850e-47
Msa0638040	Msa0721150	0.808876	2.497077e-50	-8.615850e-47
Msa0638320	Msa0721150	0.802579	5.247390e-49	-8.615850e-47
Msa0639030	Msa0721150	0.806359	8.548764e-50	-8.615850e-47
Msa0641020	Msa0721150	0.804964	1.677471e-49	-8.615850e-47
Msa0646390	Msa0721150	0.808789	2.605430e-50	-8.615850e-47
Msa0647000	Msa0721150	0.849188	3.795627e-60	-8.615850e-47
Msa0650650	Msa0721150	0.852992	3.207719e-61	-8.615850e-47
Msa0650740	Msa0721150	0.850174	2.013149e-60	-8.615850e-47
Msa0651790	Msa0721150	0.802036	6.788578e-49	-8.615850e-47
Msa0653710	Msa0721150	0.819321	1.235026e-52	-8.615850e-47
Msa0654060	Msa0721150	0.838428	2.892076e-57	-8.615850e-47
Msa0656270	Msa0721150	0.836427	9.418139e-57	-8.615850e-47
Msa0656680	Msa0721150	0.800157	1.644075e-48	-8.615850e-47
Msa0660880	Msa0721150	-0.825508	4.511859e-54	-8.615850e-47
Msa0669990	Msa0721150	0.820111	8.150375e-53	-8.615850e-47
Msa0672350	Msa0721150	0.809908	1.499752e-50	-8.615850e-47
Msa0674220	Msa0721150	0.802383	5.758840e-49	-8.615850e-47
Msa0677270	Msa0721150	0.802029	6.810829e-49	-8.615850e-47
Msa0678240	Msa0721150	0.830624	2.644688e-55	-8.615850e-47
Msa0681890	Msa0721150	0.808054	3.738964e-50	-8.615850e-47
Msa0686610	Msa0721150	0.834511	2.872884e-56	-8.615850e-47
Msa0690350	Msa0721150	0.800262	1.565001e-48	-8.615850e-47
Msa0694250	Msa0721150	0.814223	1.718821e-51	-8.615850e-47
Msa0697140	Msa0721150	0.810002	1.430945e-50	-8.615850e-47
Msa0697200	Msa0721150	0.809544	1.795281e-50	-8.615850e-47
Msa0700070	Msa0721150	0.838373	2.988443e-57	-8.615850e-47
Msa0701770	Msa0721150	0.847243	1.308231e-59	-8.615850e-47
Msa0707780	Msa0721150	0.808644	2.798760e-50	-8.615850e-47
Msa0714020	Msa0721150	0.824422	8.143611e-54	-8.615850e-47
Msa0714160	Msa0721150	0.814930	1.198812e-51	-8.615850e-47
Msa0714600	Msa0721150	0.802345	5.862128e-49	-8.615850e-47
Msa0716740	Msa0721150	-0.812953	3.270443e-51	-8.615850e-47
Msa0718470	Msa0721150	0.819010	1.453869e-52	-8.615850e-47
Msa0719340	Msa0721150	0.841442	4.739485e-58	-8.615850e-47
Msa0721150	Msa0722930	0.806042	9.965952e-50	-8.615850e-47
Msa0721150	Msa0723140	0.815520	8.864154e-52	-8.615850e-47
Msa0721150	Msa0724050	0.815456	9.160943e-52	-8.615850e-47
Msa0721150	Msa0724290	0.806990	6.289290e-50	-8.615850e-47
Msa0721150	Msa0726610	0.828533	8.525403e-55	-8.615850e-47
Msa0721150	Msa0730180	0.820807	5.642674e-53	-8.615850e-47
Msa0721150	Msa0731710	0.848903	4.554658e-60	-8.615850e-47
Msa0721150	Msa0733000	0.812556	3.994954e-51	-8.615850e-47
Msa0721150	Msa0736930	0.809358	1.968927e-50	-8.615850e-47
Msa0721150	Msa0739570	0.866886	2.053597e-65	-8.615850e-47
Msa0721150	Msa0739610	0.824370	8.375000e-54	-8.615850e-47
Msa0721150	Msa0740420	0.822959	1.791882e-53	-8.615850e-47
Msa0721150	Msa0743640	0.807312	5.376530e-50	-8.615850e-47
Msa0721150	Msa0744450	0.826229	3.042948e-54	-8.615850e-47
Msa0721150	Msa0752580	0.808598	2.862845e-50	-8.615850e-47
Msa0721150	Msa0754500	0.810567	1.081003e-50	-8.615850e-47
Msa0721150	Msa0754720	-0.813464	2.526043e-51	-8.615850e-47
Msa0721150	Msa0756410	0.817828	2.693726e-52	-8.615850e-47
Msa0721150	Msa0756480	0.849483	3.141448e-60	-8.615850e-47
Msa0721150	Msa0761760	0.981819	1.582830e-153	-8.615850e-47
Msa0721150	Msa0763880	0.811952	5.410556e-51	-8.615850e-47
Msa0721150	Msa0763910	0.801895	7.255224e-49	-8.615850e-47
Msa0721150	Msa0765010	0.854986	8.540826e-62	-8.615850e-47
Msa0721150	Msa0766040	0.814425	1.550572e-51	-8.615850e-47
Msa0721150	Msa0766880	0.800207	1.606376e-48	-8.615850e-47
Msa0721150	Msa0770430	0.802261	6.102445e-49	-8.615850e-47
Msa0721150	Msa0771960	0.835932	1.258044e-56	-8.615850e-47
Msa0721150	Msa0772150	0.853084	3.018331e-61	-8.615850e-47
Msa0721150	Msa0772210	0.820678	6.042720e-53	-8.615850e-47
Msa0721150	Msa0782030	0.806939	6.446052e-50	-8.615850e-47
Msa0721150	Msa0782330	0.856356	3.400726e-62	-8.615850e-47
Msa0721150	Msa0787720	0.809141	2.190616e-50	-8.615850e-47
Msa0721150	Msa0789270	0.814417	1.557498e-51	-8.615850e-47
Msa0721150	Msa0789280	0.812994	3.203788e-51	-8.615850e-47
Msa0721150	Msa0789290	0.817690	2.893444e-52	-8.615850e-47
Msa0721150	Msa0789300	0.816746	4.717430e-52	-8.615850e-47
Msa0721150	Msa0792510	0.826384	2.794448e-54	-8.615850e-47
Msa0721150	Msa0793060	0.801659	8.110846e-49	-8.615850e-47
Msa0721150	Msa0796450	0.804641	1.959195e-49	-8.615850e-47
Msa0721150	Msa0797620	0.808515	2.982349e-50	-8.615850e-47
Msa0721150	Msa0799290	-0.817481	3.224121e-52	-8.615850e-47
Msa0721150	Msa0801100	0.827240	1.744597e-54	-8.615850e-47
Msa0721150	Msa0801390	0.820641	6.160671e-53	-8.615850e-47
Msa0721150	Msa0804060	0.983039	1.144257e-156	-8.615850e-47
Msa0721150	Msa0811510	0.809882	1.518749e-50	-8.615850e-47
Msa0721150	Msa0815380	0.804408	2.191542e-49	-8.615850e-47
Msa0721150	Msa0815950	0.800959	1.128069e-48	-8.615850e-47
Msa0721150	Msa0819670	0.837714	4.415267e-57	-8.615850e-47
Msa0721150	Msa0820670	0.826566	2.528357e-54	-8.615850e-47
Msa0721150	Msa0830900	0.808342	3.245891e-50	-8.615850e-47
Msa0721150	Msa0835510	0.842563	2.395791e-58	-8.615850e-47
Msa0721150	Msa0837510	-0.819783	9.687358e-53	-8.615850e-47
Msa0721150	Msa0837990	0.818507	1.891279e-52	-8.615850e-47
Msa0721150	Msa0839730	0.806978	6.327420e-50	-8.615850e-47
Msa0721150	Msa0841980	0.807647	4.564884e-50	-8.615850e-47
Msa0721150	Msa0842240	0.978316	1.429293e-145	-8.615850e-47
Msa0721150	Msa0843280	0.801975	6.986527e-49	-8.615850e-47
Msa0721150	Msa0847200	0.820911	5.339467e-53	-8.615850e-47
Msa0721150	Msa0851740	0.809142	2.190429e-50	-8.615850e-47
Msa0721150	Msa0855520	0.838130	3.453184e-57	-8.615850e-47
Msa0721150	Msa0860270	0.881228	2.858106e-70	-8.615850e-47
Msa0721150	Msa0863760	0.809581	1.763290e-50	-8.615850e-47
Msa0721150	Msa0864950	0.831865	1.310296e-55	-8.615850e-47
Msa0721150	Msa0870630	0.808969	2.385224e-50	-8.615850e-47
Msa0721150	Msa0872660	0.808308	3.301450e-50	-8.615850e-47
Msa0721150	Msa0883450	0.809862	1.534246e-50	-8.615850e-47
Msa0721150	Msa0883660	0.811514	6.738356e-51	-8.615850e-47
Msa0721150	Msa0883670	0.800817	1.205999e-48	-8.615850e-47
Msa0721150	Msa0887000	0.824253	8.920040e-54	-8.615850e-47
Msa0721150	Msa0887070	0.822110	2.822750e-53	-8.615850e-47
Msa0721150	Msa0890250	0.806963	6.373559e-50	-8.615850e-47
Msa0721150	Msa0896210	0.800842	1.192344e-48	-8.615850e-47
Msa0721150	Msa0902140	0.800832	1.198007e-48	-8.615850e-47
Msa0721150	Msa0903730	0.857285	1.811055e-62	-8.615850e-47
Msa0721150	Msa0908170	0.875981	2.005891e-68	-8.615850e-47
Msa0721150	Msa0910980	-0.800921	1.148650e-48	-8.615850e-47
Msa0721150	Msa0921630	0.806258	8.975989e-50	-8.615850e-47
Msa0721150	Msa0922540	0.804609	1.989963e-49	-8.615850e-47
Msa0721150	Msa0925160	0.806540	7.828529e-50	-8.615850e-47
Msa0721150	Msa0926800	0.804212	2.407239e-49	-8.615850e-47
Msa0721150	Msa0934830	0.806342	8.617156e-50	-8.615850e-47
Msa0721150	Msa0937940	0.807607	4.654732e-50	-8.615850e-47
Msa0721150	Msa0946080	0.835818	1.344482e-56	-8.615850e-47
Msa0721150	Msa0950410	0.806973	6.340731e-50	-8.615850e-47
Msa0721150	Msa0950620	0.811785	5.885370e-51	-8.615850e-47
Msa0721150	Msa0951720	0.837740	4.349135e-57	-8.615850e-47
Msa0721150	Msa0952950	0.801832	7.473932e-49	-8.615850e-47
Msa0721150	Msa0952990	0.807446	5.034396e-50	-8.615850e-47
Msa0721150	Msa0961420	-0.813077	3.071794e-51	-8.615850e-47
Msa0721150	Msa0965520	0.811435	7.012961e-51	-8.615850e-47
Msa0721150	Msa0967450	0.826959	2.037817e-54	-8.615850e-47
Msa0721150	Msa0967660	0.806326	8.685350e-50	-8.615850e-47
Msa0721150	Msa0971860	0.824382	8.319770e-54	-8.615850e-47
Msa0721150	Msa0973130	0.827647	1.393830e-54	-8.615850e-47
Msa0721150	Msa0973230	0.842286	2.836416e-58	-8.615850e-47
Msa0721150	Msa0975080	0.810876	9.269786e-51	-8.615850e-47
Msa0721150	Msa0978000	0.835606	1.521303e-56	-8.615850e-47
Msa0721150	Msa0981010	0.808656	2.782965e-50	-8.615850e-47
Msa0721150	Msa0984850	0.810832	9.474747e-51	-8.615850e-47
Msa0721150	Msa0988500	0.830740	2.477590e-55	-8.615850e-47
Msa0721150	Msa0988790	0.807245	5.553400e-50	-8.615850e-47
Msa0721150	Msa1002040	0.819613	1.059516e-52	-8.615850e-47
Msa0721150	Msa1008960	0.801591	8.375934e-49	-8.615850e-47
Msa0721150	Msa1015060	0.835630	1.500792e-56	-8.615850e-47
Msa0721150	Msa1016110	0.860035	2.733972e-63	-8.615850e-47
Msa0721150	Msa1021340	0.801218	9.988006e-49	-8.615850e-47
Msa0721150	Msa1030280	0.820820	5.604195e-53	-8.615850e-47
Msa0721150	Msa1032350	0.824641	7.229070e-54	-8.615850e-47
Msa0721150	Msa1033160	0.829029	6.467601e-55	-8.615850e-47
Msa0721150	Msa1036350	0.820412	6.954366e-53	-8.615850e-47
Msa0721150	Msa1036390	0.819981	8.728585e-53	-8.615850e-47
Msa0721150	Msa1038320	0.825573	4.354726e-54	-8.615850e-47
Msa0721150	Msa1040120	0.808916	2.448650e-50	-8.615850e-47
Msa0721150	Msa1043870	0.804734	1.873933e-49	-8.615850e-47
Msa0721150	Msa1044040	0.855066	8.096130e-62	-8.615850e-47
Msa0721150	Msa1047720	0.809322	2.004099e-50	-8.615850e-47
Msa0721150	Msa1055360	0.813047	3.118873e-51	-8.615850e-47
Msa0721150	Msa1056640	0.818762	1.654642e-52	-8.615850e-47
Msa0721150	Msa1060070	0.802405	5.698648e-49	-8.615850e-47
Msa0721150	Msa1064210	0.800508	1.394830e-48	-8.615850e-47
Msa0721150	Msa1069300	0.825344	4.934657e-54	-8.615850e-47
Msa0721150	Msa1072350	0.816102	6.576055e-52	-8.615850e-47
Msa0721150	Msa1076630	0.812846	3.451271e-51	-8.615850e-47
Msa0721150	Msa1076680	0.824034	1.004610e-53	-8.615850e-47
Msa0721150	Msa1079610	0.856081	4.094852e-62	-8.615850e-47
Msa0721150	Msa1081600	0.856503	3.078617e-62	-8.615850e-47
Msa0721150	Msa1081700	0.804821	1.797074e-49	-8.615850e-47
Msa0721150	Msa1087000	0.802403	5.703546e-49	-8.615850e-47
Msa0721150	Msa1087470	0.816588	5.118414e-52	-8.615850e-47
Msa0721150	Msa1089680	0.804671	1.931762e-49	-8.615850e-47
Msa0721150	Msa1092820	0.824514	7.744251e-54	-8.615850e-47
Msa0721150	Msa1093390	0.811914	5.515945e-51	-8.615850e-47
Msa0721150	Msa1102180	0.800513	1.391370e-48	-8.615850e-47
Msa0721150	Msa1113210	0.808016	3.808880e-50	-8.615850e-47
Msa0721150	Msa1118140	0.814088	1.840928e-51	-8.615850e-47
Msa0721150	Msa1122510	0.823410	1.405960e-53	-8.615850e-47
Msa0721150	Msa1124440	0.817620	3.001035e-52	-8.615850e-47
Msa0721150	Msa1132560	-0.819289	1.255636e-52	-8.615850e-47
Msa0721150	Msa1133660	0.820831	5.572644e-53	-8.615850e-47
Msa0721150	Msa1136140	0.808432	3.106295e-50	-8.615850e-47
Msa0721150	Msa1138600	0.802212	6.244492e-49	-8.615850e-47
Msa0721150	Msa1140010	0.819923	8.999271e-53	-8.615850e-47
Msa0721150	Msa1157020	0.816451	5.492378e-52	-8.615850e-47
Msa0721150	Msa1157160	0.813275	2.779501e-51	-8.615850e-47
Msa0721150	Msa1157920	0.828394	9.213642e-55	-8.615850e-47
Msa0721150	Msa1159360	0.811757	5.967182e-51	-8.615850e-47
Msa0721150	Msa1161160	0.836055	1.170658e-56	-8.615850e-47
Msa0721150	Msa1164800	-0.810082	1.375273e-50	-8.615850e-47
Msa0721150	Msa1166370	0.844370	7.886938e-59	-8.615850e-47
Msa0721150	Msa1168130	0.812338	4.458955e-51	-8.615850e-47
Msa0721150	Msa1175590	0.830363	3.062954e-55	-8.615850e-47
Msa0721150	Msa1182830	0.809022	2.323404e-50	-8.615850e-47
Msa0721150	Msa1184050	0.816164	6.367369e-52	-8.615850e-47
Msa0721150	Msa1184580	0.822691	2.069270e-53	-8.615850e-47
Msa0721150	Msa1201610	0.836486	9.097336e-57	-8.615850e-47
Msa0721150	Msa1204120	0.826118	3.233357e-54	-8.615850e-47
Msa0721150	Msa1207480	-0.815947	7.118874e-52	-8.615850e-47
Msa0721150	Msa1208250	0.816790	4.612348e-52	-8.615850e-47
Msa0721150	Msa1208710	0.814061	1.866499e-51	-8.615850e-47
Msa0721150	Msa1208760	0.811222	7.799190e-51	-8.615850e-47
Msa0721150	Msa1211370	0.813406	2.601545e-51	-8.615850e-47
Msa0721150	Msa1211390	0.816188	6.290343e-52	-8.615850e-47
Msa0721150	Msa1212740	0.804085	2.558997e-49	-8.615850e-47
Msa0721150	Msa1214900	0.850145	2.051853e-60	-8.615850e-47
Msa0721150	Msa1217860	0.806678	7.320071e-50	-8.615850e-47
Msa0721150	Msa1218650	0.852121	5.680813e-61	-8.615850e-47
Msa0721150	Msa1220230	0.817319	3.507868e-52	-8.615850e-47
Msa0721150	Msa1221260	0.807522	4.851355e-50	-8.615850e-47
Msa0721150	Msa1221570	-0.811964	5.379861e-51	-8.615850e-47
Msa0721150	Msa1221900	0.807638	4.583205e-50	-8.615850e-47
Msa0721150	Msa1222030	-0.805230	1.475667e-49	-8.615850e-47
Msa0721150	Msa1226600	0.826966	2.029038e-54	-8.615850e-47
Msa0721150	Msa1231520	0.826643	2.424400e-54	-8.615850e-47
Msa0721150	Msa1233770	0.827365	1.629048e-54	-8.615850e-47
Msa0721150	Msa1235760	0.813415	2.589966e-51	-8.615850e-47
Msa0721150	Msa1235770	0.835401	1.714074e-56	-8.615850e-47
Msa0721150	Msa1237030	0.801155	1.029007e-48	-8.615850e-47
Msa0721150	Msa1237260	0.813604	2.352732e-51	-8.615850e-47
Msa0721150	Msa1238480	0.807024	6.184373e-50	-8.615850e-47
Msa0721150	Msa1242990	0.803936	2.747234e-49	-8.615850e-47
Msa0721150	Msa1243130	0.812004	5.273388e-51	-8.615850e-47
Msa0721150	Msa1244830	0.819063	1.413834e-52	-8.615850e-47
Msa0721150	Msa1248400	0.803016	4.261698e-49	-8.615850e-47
Msa0721150	Msa1254470	0.888506	5.559052e-73	-8.615850e-47
Msa0721150	Msa1258280	0.800813	1.208690e-48	-8.615850e-47
Msa0721150	Msa1258950	0.804249	2.365008e-49	-8.615850e-47
Msa0721150	Msa1265070	0.814815	1.271288e-51	-8.615850e-47
Msa0721150	Msa1265960	0.821465	3.980893e-53	-8.615850e-47
Msa0721150	Msa1272130	0.836702	8.015239e-57	-8.615850e-47
Msa0721150	Msa1274310	0.802142	6.456201e-49	-8.615850e-47
Msa0721150	Msa1276080	0.820373	7.097893e-53	-8.615850e-47
Msa0721150	Msa1279860	0.817571	3.077614e-52	-8.615850e-47
Msa0721150	Msa1279870	0.809077	2.261489e-50	-8.615850e-47
Msa0721150	Msa1280020	0.806920	6.506639e-50	-8.615850e-47
Msa0721150	Msa1280130	0.801765	7.714817e-49	-8.615850e-47
Msa0721150	Msa1284390	0.818588	1.812046e-52	-8.615850e-47
Msa0721150	Msa1287160	0.823617	1.257531e-53	-8.615850e-47
Msa0721150	Msa1287340	0.826968	2.027398e-54	-8.615850e-47
Msa0721150	Msa1289340	0.811166	8.021478e-51	-8.615850e-47
Msa0721150	Msa1294520	0.810194	1.300976e-50	-8.615850e-47
Msa0721150	Msa1298290	0.802583	5.237018e-49	-8.615850e-47
Msa0721150	Msa1298740	0.802059	6.714244e-49	-8.615850e-47
Msa0721150	Msa1304850	0.814695	1.351205e-51	-8.615850e-47
Msa0721150	Msa1306200	0.808603	2.855293e-50	-8.615850e-47
Msa0721150	Msa1309910	0.801764	7.720388e-49	-8.615850e-47
Msa0721150	Msa1317710	0.826492	2.633259e-54	-8.615850e-47
Msa0721150	Msa1319440	0.817643	2.965215e-52	-8.615850e-47
Msa0721150	Msa1323440	0.803493	3.395722e-49	-8.615850e-47
Msa0721150	Msa1326000	0.830444	2.927416e-55	-8.615850e-47
Msa0721150	Msa1327820	0.809855	1.539485e-50	-8.615850e-47
Msa0721150	Msa1329990	0.800357	1.496946e-48	-8.615850e-47
Msa0721150	Msa1337190	0.816435	5.538162e-52	-8.615850e-47
Msa0721150	Msa1337730	0.803791	2.944976e-49	-8.615850e-47
Msa0721150	Msa1343770	0.826069	3.321433e-54	-8.615850e-47
Msa0721150	Msa1346540	0.818466	1.932085e-52	-8.615850e-47
Msa0721150	Msa1355260	0.841691	4.075562e-58	-8.615850e-47
Msa0721150	Msa1357380	0.821722	3.470403e-53	-8.615850e-47
Msa0721150	Msa1357720	0.811845	5.709300e-51	-8.615850e-47
Msa0721150	Msa1360380	0.826915	2.086885e-54	-8.615850e-47
Msa0721150	Msa1361190	0.804157	2.472212e-49	-8.615850e-47
Msa0721150	Msa1365040	-0.838699	2.461828e-57	-8.615850e-47
Msa0721150	Msa1366700	0.824037	1.002960e-53	-8.615850e-47
Msa0721150	Msa1367390	-0.826350	2.846812e-54	-8.615850e-47
Msa0721150	Msa1367940	0.811012	8.659133e-51	-8.615850e-47
Msa0721150	Msa1373910	0.809557	1.783977e-50	-8.615850e-47
Msa0721150	Msa1373950	0.828061	1.108438e-54	-8.615850e-47
Msa0721150	Msa1386020	0.824498	7.812745e-54	-8.615850e-47
Msa0721150	Msa1386520	0.846929	1.594629e-59	-8.615850e-47
Msa0721150	Msa1387090	0.844678	6.516440e-59	-8.615850e-47
Msa0721150	Msa1388230	0.814165	1.770325e-51	-8.615850e-47
Msa0721150	Msa1390310	0.807416	5.109420e-50	-8.615850e-47
Msa0721150	Msa1390410	0.821704	3.504997e-53	-8.615850e-47
Msa0721150	Msa1395570	0.809828	1.560418e-50	-8.615850e-47
Msa0721150	Msa1395690	-0.804201	2.420654e-49	-8.615850e-47
Msa0721150	Msa1397540	0.843409	1.426600e-58	-8.615850e-47
Msa0721150	Msa1399500	0.842622	2.311370e-58	-8.615850e-47
Msa0721150	Msa1404540	0.821158	4.685036e-53	-8.615850e-47
Msa0721150	Msa1405180	0.823319	1.476653e-53	-8.615850e-47
Msa0721150	Msa1405470	0.876530	1.297912e-68	-8.615850e-47
Msa0721150	Msa1408190	0.817123	3.882182e-52	-8.615850e-47
Msa0721150	Msa1408790	0.823983	1.032271e-53	-8.615850e-47
Msa0721150	Msa1409520	0.828519	8.594302e-55	-8.615850e-47
Msa0721150	Msa1409750	0.838562	2.671430e-57	-8.615850e-47
Msa0721150	Msa1415120	0.813760	2.174098e-51	-8.615850e-47
Msa0721150	Msa1418200	0.808283	3.342164e-50	-8.615850e-47
Msa0721150	Msa1419110	0.863190	2.970953e-64	-8.615850e-47
Msa0721150	Msa1428440	0.812136	4.933903e-51	-8.615850e-47
Msa0721150	Msa1431000	0.828171	1.042967e-54	-8.615850e-47
Msa0721150	Msa1431060	0.820878	5.435935e-53	-8.615850e-47
Msa0721150	Msa1436040	0.827607	1.425116e-54	-8.615850e-47
Msa0721150	Msa1439230	0.863557	2.287150e-64	-8.615850e-47
Msa0721150	Msa1439960	0.807833	4.166775e-50	-8.615850e-47
Msa0721150	Msa1440180	0.807672	4.507577e-50	-8.615850e-47
Msa0721150	Msa1440600	0.832127	1.128533e-55	-8.615850e-47
Msa0721150	Msa1442220	-0.805266	1.450331e-49	-8.615850e-47
Msa0721150	Msa1448990	0.817338	3.472211e-52	-8.615850e-47
Msa0721150	Msa1449740	0.806669	7.353787e-50	-8.615850e-47
Msa0721150	Msa1450020	0.841972	3.434336e-58	-8.615850e-47
Msa0721150	Msa1450420	0.826076	3.308109e-54	-8.615850e-47
Msa0721150	Msa1456650	0.810434	1.154949e-50	-8.615850e-47
Msa0721150	Msa1456810	0.807502	4.899968e-50	-8.615850e-47
Msa0721150	Msa1457670	-0.825693	4.078027e-54	-8.615850e-47
Msa0721150	Msa1460310	-0.806512	7.936421e-50	-8.615850e-47
Msa0721150	Msa1460890	0.802690	4.976711e-49	-8.615850e-47
Msa0721150	Msa1464560	0.812778	3.572449e-51	-8.615850e-47
Msa0131200	Msa0721150	0.822622	2.146758e-53	-8.615850e-47
Msa0133670	Msa0721150	0.845013	5.289876e-59	-8.615850e-47
Msa0133880	Msa0721150	0.849073	4.086936e-60	-8.615850e-47
Msa0134550	Msa0721150	0.841451	4.713301e-58	-8.615850e-47
Msa0137660	Msa0721150	-0.802361	5.819388e-49	-8.615850e-47
Msa0139720	Msa0721150	-0.815321	9.815633e-52	-8.615850e-47
Msa0140910	Msa0721150	0.857075	2.088917e-62	-8.615850e-47
Msa0141550	Msa0721150	0.821303	4.338330e-53	-8.615850e-47
Msa0141670	Msa0721150	0.818266	2.144641e-52	-8.615850e-47
Msa0151690	Msa0721150	0.853167	2.856875e-61	-8.615850e-47
Msa0151950	Msa0721150	0.850768	1.371535e-60	-8.615850e-47
Msa0156650	Msa0721150	-0.806791	6.929320e-50	-8.615850e-47
Msa0159750	Msa0721150	0.808983	2.368350e-50	-8.615850e-47
Msa0162050	Msa0721150	0.817055	4.022180e-52	-8.615850e-47
Msa0162070	Msa0721150	0.807853	4.125462e-50	-8.615850e-47
Msa0164660	Msa0721150	0.839651	1.395136e-57	-8.615850e-47
Msa0169960	Msa0721150	0.869847	2.278606e-66	-8.615850e-47
Msa0172350	Msa0721150	0.815129	1.082656e-51	-8.615850e-47
Msa0175480	Msa0721150	0.806228	9.107344e-50	-8.615850e-47
Msa0176620	Msa0721150	-0.804471	2.126297e-49	-8.615850e-47
Msa0181290	Msa0721150	0.843581	1.283481e-58	-8.615850e-47
Msa0182750	Msa0721150	-0.803528	3.339895e-49	-8.615850e-47
Msa0183800	Msa0721150	-0.813798	2.132810e-51	-8.615850e-47
Msa0184120	Msa0721150	0.846191	2.535936e-59	-8.615850e-47
Msa0185390	Msa0721150	0.800271	1.558919e-48	-8.615850e-47
Msa0189050	Msa0721150	0.812650	3.809896e-51	-8.615850e-47
Msa0190980	Msa0721150	0.826005	3.439785e-54	-8.615850e-47
Msa0191630	Msa0721150	0.806578	7.685370e-50	-8.615850e-47
Msa0193200	Msa0721150	0.822772	1.981294e-53	-8.615850e-47
Msa0197750	Msa0721150	-0.860486	1.996960e-63	-8.615850e-47
Msa0203640	Msa0721150	0.815583	8.581283e-52	-8.615850e-47
Msa0208630	Msa0721150	0.801128	1.042165e-48	-8.615850e-47
Msa0211010	Msa0721150	0.853425	2.410237e-61	-8.615850e-47
Msa0212960	Msa0721150	0.804619	1.979873e-49	-8.615850e-47
Msa0213080	Msa0721150	0.849095	4.029395e-60	-8.615850e-47
Msa0213090	Msa0721150	0.863135	3.089007e-64	-8.615850e-47
Msa0213650	Msa0721150	0.802061	6.706612e-49	-8.615850e-47
Msa0216560	Msa0721150	0.836706	7.994756e-57	-8.615850e-47
Msa0217400	Msa0721150	0.813478	2.507768e-51	-8.615850e-47
Msa0217470	Msa0721150	0.810471	1.133859e-50	-8.615850e-47
Msa0219070	Msa0721150	0.809515	1.821189e-50	-8.615850e-47
Msa0221800	Msa0721150	0.805075	1.590392e-49	-8.615850e-47
Msa0223100	Msa0721150	0.863659	2.125839e-64	-8.615850e-47
Msa0223290	Msa0721150	0.856374	3.359911e-62	-8.615850e-47
Msa0223380	Msa0721150	0.868505	6.213653e-66	-8.615850e-47
Msa0226290	Msa0721150	0.845340	4.317051e-59	-8.615850e-47
Msa0231310	Msa0721150	0.813491	2.492427e-51	-8.615850e-47
Msa0232860	Msa0721150	0.802221	6.216988e-49	-8.615850e-47
Msa0233610	Msa0721150	0.801734	7.827794e-49	-8.615850e-47
Msa0365360	Msa0721150	0.816443	5.515144e-52	-8.615850e-47
Msa0369750	Msa0721150	0.808946	2.412353e-50	-8.615850e-47
Msa0370870	Msa0721150	0.821522	3.862178e-53	-8.615850e-47
Msa0371610	Msa0721150	0.849624	2.869411e-60	-8.615850e-47
Msa0376460	Msa0721150	0.805314	1.417388e-49	-8.615850e-47
Msa0377530	Msa0721150	0.852233	5.280765e-61	-8.615850e-47
Msa0380430	Msa0721150	0.815909	7.259939e-52	-8.615850e-47
Msa0389060	Msa0721150	0.815734	7.942119e-52	-8.615850e-47
Msa0389830	Msa0721150	0.827307	1.681548e-54	-8.615850e-47
Msa0398500	Msa0721150	0.806910	6.538437e-50	-8.615850e-47
Msa0409820	Msa0721150	0.816658	4.936605e-52	-8.615850e-47
Msa0411000	Msa0721150	0.819718	1.002383e-52	-8.615850e-47
Msa0413740	Msa0721150	0.835390	1.725129e-56	-8.615850e-47
Msa0414070	Msa0721150	0.856699	2.696986e-62	-8.615850e-47
Msa0414950	Msa0721150	-0.801957	7.046360e-49	-8.615850e-47
Msa0418000	Msa0721150	0.828194	1.029655e-54	-8.615850e-47
Msa0419050	Msa0721150	0.826878	2.130098e-54	-8.615850e-47
Msa0419620	Msa0721150	-0.816025	6.838834e-52	-8.615850e-47
Msa0420070	Msa0721150	0.820649	6.135648e-53	-8.615850e-47
Msa0423600	Msa0721150	0.858745	6.671811e-63	-8.615850e-47
Msa0426810	Msa0721150	0.821992	3.005760e-53	-8.615850e-47
Msa0427050	Msa0721150	0.825231	5.247681e-54	-8.615850e-47
Msa0431830	Msa0721150	0.812586	3.934243e-51	-8.615850e-47
Msa0437710	Msa0721150	0.816025	6.839301e-52	-8.615850e-47
Msa0440110	Msa0721150	0.831100	2.021189e-55	-8.615850e-47
Msa0442880	Msa0721150	0.833120	6.400059e-56	-8.615850e-47
Msa0452010	Msa0721150	0.800305	1.533646e-48	-8.615850e-47
Msa0456480	Msa0721150	0.811677	6.211050e-51	-8.615850e-47
Msa0457370	Msa0721150	0.805150	1.533803e-49	-8.615850e-47
Msa0458790	Msa0721150	0.836126	1.123148e-56	-8.615850e-47
Msa0459120	Msa0721150	0.857503	1.561833e-62	-8.615850e-47
Msa0463960	Msa0721150	0.803680	3.104945e-49	-8.615850e-47
Msa0464900	Msa0721150	0.853215	2.768420e-61	-8.615850e-47
Msa0465680	Msa0721150	-0.802670	5.026119e-49	-8.615850e-47
Msa0466100	Msa0721150	0.822227	2.652145e-53	-8.615850e-47
Msa0467920	Msa0721150	-0.805074	1.591088e-49	-8.615850e-47
Msa0470650	Msa0721150	0.815160	1.065655e-51	-8.615850e-47
Msa0471730	Msa0721150	0.806671	7.343761e-50	-8.615850e-47
Msa0473240	Msa0721150	0.860536	1.929135e-63	-8.615850e-47
Msa0475830	Msa0721150	0.803021	4.251751e-49	-8.615850e-47
Msa0480320	Msa0721150	0.811149	8.087685e-51	-8.615850e-47
Msa0240780	Msa0721150	0.801032	1.090347e-48	-8.615850e-47
Msa0251670	Msa0721150	0.825370	4.864373e-54	-8.615850e-47
Msa0252180	Msa0721150	0.834441	2.992393e-56	-8.615850e-47
Msa0253370	Msa0721150	0.892770	1.168271e-74	-8.615850e-47
Msa0256170	Msa0721150	0.837654	4.575328e-57	-8.615850e-47
Msa0256430	Msa0721150	0.836075	1.157190e-56	-8.615850e-47
Msa0260810	Msa0721150	0.811579	6.522496e-51	-8.615850e-47
Msa0264940	Msa0721150	-0.801166	1.023798e-48	-8.615850e-47
Msa0265210	Msa0721150	0.815948	7.117607e-52	-8.615850e-47
Msa0265820	Msa0721150	0.814277	1.672213e-51	-8.615850e-47
Msa0266000	Msa0721150	-0.810299	1.235372e-50	-8.615850e-47
Msa0267760	Msa0721150	0.809597	1.748897e-50	-8.615850e-47
Msa0269360	Msa0721150	0.825359	4.894676e-54	-8.615850e-47
Msa0272420	Msa0721150	0.825314	5.015054e-54	-8.615850e-47
Msa0274520	Msa0721150	0.808435	3.100996e-50	-8.615850e-47
Msa0275400	Msa0721150	-0.815322	9.812734e-52	-8.615850e-47
Msa0275670	Msa0721150	0.810609	1.058919e-50	-8.615850e-47
Msa0277280	Msa0721150	-0.865470	5.768598e-65	-8.615850e-47
Msa0282170	Msa0721150	0.839207	1.818845e-57	-8.615850e-47
Msa0284870	Msa0721150	0.818552	1.846675e-52	-8.615850e-47
Msa0288240	Msa0721150	0.820857	5.494302e-53	-8.615850e-47
Msa0288320	Msa0721150	0.886580	3.021301e-72	-8.615850e-47
Msa0290650	Msa0721150	0.836925	7.030900e-57	-8.615850e-47
Msa0292180	Msa0721150	0.887400	1.475384e-72	-8.615850e-47
Msa0295840	Msa0721150	0.835911	1.273880e-56	-8.615850e-47
Msa0296610	Msa0721150	0.815221	1.032847e-51	-8.615850e-47
Msa0296760	Msa0721150	0.802580	5.245389e-49	-8.615850e-47
Msa0299200	Msa0721150	0.836803	7.552772e-57	-8.615850e-47
Msa0302650	Msa0721150	0.824531	7.676714e-54	-8.615850e-47
Msa0302990	Msa0721150	-0.807728	4.385612e-50	-8.615850e-47
Msa0304700	Msa0721150	0.841083	5.892497e-58	-8.615850e-47
Msa0306130	Msa0721150	0.881380	2.518444e-70	-8.615850e-47
Msa0307110	Msa0721150	0.865191	7.060451e-65	-8.615850e-47
Msa0309160	Msa0721150	0.819013	1.451458e-52	-8.615850e-47
Msa0312310	Msa0721150	0.806698	7.250874e-50	-8.615850e-47
Msa0312570	Msa0721150	0.809538	1.801166e-50	-8.615850e-47
Msa0323630	Msa0721150	0.833729	4.510528e-56	-8.615850e-47
Msa0326670	Msa0721150	0.828425	9.053748e-55	-8.615850e-47
Msa0330270	Msa0721150	0.871078	8.989520e-67	-8.615850e-47
Msa0330400	Msa0721150	0.888991	3.610883e-73	-8.615850e-47
Msa0331740	Msa0721150	0.815007	1.152257e-51	-8.615850e-47
Msa0335040	Msa0721150	0.813529	2.443784e-51	-8.615850e-47
Msa0336270	Msa0721150	0.853950	1.702655e-61	-8.615850e-47
Msa0339870	Msa0721150	0.850454	1.680749e-60	-8.615850e-47
Msa0351220	Msa0721150	0.801551	8.535937e-49	-8.615850e-47
Msa0357380	Msa0721150	0.812333	4.470306e-51	-8.615850e-47
Msa0357390	Msa0721150	0.804333	2.272118e-49	-8.615850e-47
Msa0359110	Msa0721150	0.812315	4.510659e-51	-8.615850e-47
Msa0362430	Msa0721150	0.818030	2.425011e-52	-8.615850e-47
Msa0490300	Msa0721150	0.821763	3.395674e-53	-8.615850e-47
Msa0490350	Msa0721150	0.822936	1.813892e-53	-8.615850e-47
Msa0492740	Msa0721150	0.808341	3.248034e-50	-8.615850e-47
Msa0498830	Msa0721150	0.814623	1.402365e-51	-8.615850e-47
Msa0502500	Msa0721150	0.844956	5.481863e-59	-8.615850e-47
Msa0502910	Msa0721150	0.837138	6.204272e-57	-8.615850e-47
Msa0504630	Msa0721150	0.815165	1.063037e-51	-8.615850e-47
Msa0505390	Msa0721150	0.837067	6.468269e-57	-8.615850e-47
Msa0505660	Msa0721150	0.857869	1.215993e-62	-8.615850e-47
Msa0508200	Msa0721150	0.827114	1.870325e-54	-8.615850e-47
Msa0508610	Msa0721150	0.808508	2.992945e-50	-8.615850e-47
Msa0508650	Msa0721150	0.803208	3.889363e-49	-8.615850e-47
Msa0509970	Msa0721150	0.820097	8.212057e-53	-8.615850e-47
Msa0510560	Msa0721150	0.831130	1.987019e-55	-8.615850e-47
Msa0511890	Msa0721150	0.832816	7.617068e-56	-8.615850e-47
Msa0515680	Msa0721150	0.807417	5.105579e-50	-8.615850e-47
Msa0516500	Msa0721150	0.807652	4.553194e-50	-8.615850e-47
Msa0517490	Msa0721150	0.851137	1.079138e-60	-8.615850e-47
Msa0524050	Msa0721150	0.827161	1.822410e-54	-8.615850e-47
Msa0524120	Msa0721150	0.816620	5.034254e-52	-8.615850e-47
Msa0524200	Msa0721150	-0.821773	3.378442e-53	-8.615850e-47
Msa0526710	Msa0721150	0.810457	1.141640e-50	-8.615850e-47
Msa0531990	Msa0721150	-0.811749	5.991732e-51	-8.615850e-47
Msa0532100	Msa0721150	-0.813506	2.472628e-51	-8.615850e-47
Msa0535060	Msa0721150	0.810724	9.999644e-51	-8.615850e-47
Msa0542040	Msa0721150	0.808795	2.598167e-50	-8.615850e-47
Msa0546380	Msa0721150	0.812078	5.079598e-51	-8.615850e-47
Msa0549740	Msa0721150	0.820840	5.544031e-53	-8.615850e-47
Msa0553520	Msa0721150	0.812034	5.192437e-51	-8.615850e-47
Msa0558890	Msa0721150	0.814943	1.190626e-51	-8.615850e-47
Msa0563140	Msa0721150	0.818156	2.270489e-52	-8.615850e-47
Msa0565490	Msa0721150	0.836536	8.836171e-57	-8.615850e-47
Msa0574170	Msa0721150	0.805045	1.613239e-49	-8.615850e-47
Msa0576420	Msa0721150	0.806034	1.000846e-49	-8.615850e-47
Msa0576600	Msa0721150	0.803712	3.058550e-49	-8.615850e-47
Msa0577870	Msa0721150	0.808550	2.931543e-50	-8.615850e-47
Msa0579340	Msa0721150	0.853251	2.703306e-61	-8.615850e-47
Msa0581340	Msa0721150	0.802175	6.355973e-49	-8.615850e-47
Msa0582110	Msa0721150	0.804978	1.666697e-49	-8.615850e-47
Msa0587690	Msa0721150	0.833405	5.433606e-56	-8.615850e-47
Msa0598250	Msa0721150	0.854560	1.135119e-61	-8.615850e-47

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0721150	MtrunA17_Chr5g0412101	94.316	475	27	0	1	475	1	475	0.0	896
Msa0721150	MtrunA17_Chr5g0412131	85.263	475	69	1	1	475	1	474	0.0	826
Msa0721150	MtrunA17_Chr5g0412111	77.516	467	101	2	10	475	3	466	0.0	763
Msa0721150	MtrunA17_Chr5g0426431	38.494	478	271	11	8	470	8	477	1.24e-94	294
Msa0721150	MtrunA17_Chr6g0454141	35.185	486	272	11	12	470	10	479	5.21e-94	293
Msa0721150	MtrunA17_Chr3g0092641	37.917	480	271	12	8	470	8	477	5.78e-94	292
Msa0721150	MtrunA17_Chr6g0454181	34.623	491	276	12	8	470	6	479	1.58e-90	284
Msa0721150	MtrunA17_Chr6g0454131	35.934	487	270	10	8	468	6	476	4.32e-90	283
Msa0721150	MtrunA17_Chr6g0454121	35.113	487	274	11	8	468	6	476	4.65e-90	283
Msa0721150	MtrunA17_Chr6g0454261	33.333	489	287	12	7	470	5	479	5.50e-90	282
Msa0721150	MtrunA17_Chr6g0454291	35.992	489	270	11	9	470	4	476	6.11e-90	282
Msa0721150	MtrunA17_Chr2g0278711	36.998	473	277	10	12	470	11	476	7.12e-90	282
Msa0721150	MtrunA17_Chr4g0050341	34.898	490	282	11	7	471	14	491	1.65e-89	281
Msa0721150	MtrunA17_Chr7g0217881	36.268	477	261	12	12	470	10	461	2.62e-89	280
Msa0721150	MtrunA17_Chr6g0454401	34.238	479	287	10	12	470	10	480	3.27e-89	280
Msa0721150	MtrunA17_Chr6g0454331	34.298	484	287	12	9	470	4	478	5.47e-89	280
Msa0721150	MtrunA17_Chr6g0454191	35.417	480	280	12	12	470	10	480	2.97e-88	278
Msa0721150	MtrunA17_Chr3g0118671	35.685	482	273	13	12	470	6	473	4.88e-88	277
Msa0721150	MtrunA17_Chr6g0453961	33.196	485	292	11	8	470	15	489	8.94e-88	277
Msa0721150	MtrunA17_Chr3g0118661	36.076	474	277	11	12	468	13	477	1.95e-87	276
Msa0721150	MtrunA17_Chr3g0118691	35.833	480	275	12	12	470	15	482	3.81e-87	275
Msa0721150	MtrunA17_Chr8g0359821	34.096	481	282	11	12	470	10	477	6.29e-87	275
Msa0721150	MtrunA17_Chr3g0118771	34.783	483	272	12	12	468	21	486	1.27e-85	271
Msa0721150	MtrunA17_Chr6g0452771	35.438	491	272	11	8	470	6	479	1.62e-85	271
Msa0721150	MtrunA17_Chr6g0454361	34.519	478	282	10	12	468	11	478	2.40e-85	270
Msa0721150	MtrunA17_Chr6g0454301	34.728	478	283	11	12	470	263	730	4.79e-85	276
Msa0721150	MtrunA17_Chr6g0454301	40.870	230	129	4	242	468	2	227	6.41e-51	184
Msa0721150	MtrunA17_Chr6g0453951	32.500	480	293	10	12	470	57	526	7.76e-84	268
Msa0721150	MtrunA17_Chr5g0423981	34.402	468	273	11	8	470	6	444	1.16e-83	265
Msa0721150	MtrunA17_Chr3g0078841	33.820	479	288	12	9	468	7	475	2.94e-83	265
Msa0721150	MtrunA17_Chr3g0118701	35.158	475	281	13	12	468	15	480	3.72e-83	265
Msa0721150	MtrunA17_Chr8g0336331	33.264	478	291	10	11	470	9	476	1.08e-82	263
Msa0721150	MtrunA17_Chr6g0454201	34.433	485	287	11	7	470	6	480	2.61e-82	263
Msa0721150	MtrunA17_Chr3g0118711	33.742	489	296	14	1	470	1	480	6.78e-82	261
Msa0721150	MtrunA17_Chr6g0454211	34.908	487	272	13	12	470	297	766	8.00e-82	268
Msa0721150	MtrunA17_Chr6g0454211	33.840	263	135	5	132	389	8	236	1.41e-40	155
Msa0721150	MtrunA17_Chr6g0454341	32.919	483	285	12	12	470	10	477	4.38e-80	256
Msa0721150	MtrunA17_Chr6g0454151	33.401	491	282	11	7	470	5	477	9.73e-80	256
Msa0721150	MtrunA17_Chr6g0454351	32.510	486	268	13	12	470	12	464	4.74e-79	253
Msa0721150	MtrunA17_Chr6g0454321	32.770	473	279	11	12	460	10	467	8.75e-77	253
Msa0721150	MtrunA17_Chr3g0118751	32.917	480	256	12	12	468	6	442	1.24e-74	241
Msa0721150	MtrunA17_Chr3g0112771	32.640	481	287	13	1	472	1	453	2.90e-72	236
Msa0721150	MtrunA17_Chr3g0112761	33.540	483	276	13	6	474	2	453	4.63e-72	235
Msa0721150	MtrunA17_Chr5g0426401	41.118	304	167	8	173	470	13	310	1.08e-68	222
Msa0721150	MtrunA17_Chr6g0454271	37.762	286	173	3	187	470	4	286	1.78e-67	218
Msa0721150	MtrunA17_Chr6g0454251	34.483	406	222	12	12	390	7	395	1.29e-66	219
Msa0721150	MtrunA17_Chr4g0032331	32.311	489	276	15	1	472	1	451	6.92e-66	219
Msa0721150	MtrunA17_Chr8g0380531	32.990	485	284	15	4	473	2	460	2.90e-63	212
Msa0721150	MtrunA17_Chr3g0118721	36.934	287	171	5	190	470	7	289	5.51e-60	198
Msa0721150	MtrunA17_Chr6g0464871	32.008	478	268	15	11	467	22	463	1.11e-59	203
Msa0721150	MtrunA17_Chr7g0249981	30.309	485	274	16	12	474	25	467	2.67e-58	199
Msa0721150	MtrunA17_Chr5g0414321	31.762	488	263	18	12	473	11	454	9.73e-58	197
Msa0721150	MtrunA17_Chr5g0414331	31.557	488	264	17	12	473	13	456	1.38e-57	197
Msa0721150	MtrunA17_Chr7g0250001	29.350	477	278	15	12	467	6	444	3.09e-55	191
Msa0721150	MtrunA17_Chr8g0366391	30.992	484	298	17	12	472	9	479	3.86e-55	191
Msa0721150	MtrunA17_Chr6g0464841	31.458	480	268	16	11	467	10	451	8.90e-55	189
Msa0721150	MtrunA17_Chr6g0454221	41.739	230	128	4	242	468	2	228	2.73e-54	184
Msa0721150	MtrunA17_Chr7g0218831	30.064	469	281	11	12	469	6	438	1.05e-53	186
Msa0721150	MtrunA17_Chr1g0207981	31.911	492	284	21	8	473	9	475	3.13e-53	186
Msa0721150	MtrunA17_Chr6g0464921	29.522	481	296	15	1	467	1	452	5.29e-53	185
Msa0721150	MtrunA17_Chr3g0121991	30.928	485	291	13	12	470	79	545	8.85e-53	186
Msa0721150	MtrunA17_Chr7g0218841	31.013	474	271	15	12	469	6	439	9.72e-53	184
Msa0721150	MtrunA17_Chr6g0464881	30.149	471	284	16	12	467	11	451	1.48e-52	184
Msa0721150	MtrunA17_Chr6g0454171	35.897	273	148	6	205	470	57	309	1.52e-52	179
Msa0721150	MtrunA17_Chr1g0207861	29.814	483	305	13	8	472	4	470	3.30e-52	183
Msa0721150	MtrunA17_Chr8g0355011	31.507	365	192	9	115	470	46	361	1.54e-51	178
Msa0721150	MtrunA17_Chr5g0401721	28.364	483	288	15	8	459	4	459	7.87e-51	179
Msa0721150	MtrunA17_Chr7g0218811	29.449	472	281	15	12	469	15	448	6.27e-50	176
Msa0721150	MtrunA17_Chr8g0377921	27.733	494	286	15	13	470	5	463	8.96e-50	176
Msa0721150	MtrunA17_Chr6g0464861	29.878	492	278	19	1	467	1	450	9.18e-50	176
Msa0721150	MtrunA17_Chr5g0429711	30.505	495	274	20	10	473	9	464	1.73e-49	176
Msa0721150	MtrunA17_Chr8g0347281	28.942	501	297	18	3	475	9	478	1.33e-48	173
Msa0721150	MtrunA17_Chr7g0218821	29.106	481	286	13	12	471	5	451	1.41e-48	172
Msa0721150	MtrunA17_Chr7g0249931	28.131	487	302	16	1	472	29	482	1.74e-48	173
Msa0721150	MtrunA17_Chr1g0161351	28.423	482	303	13	12	471	37	498	4.54e-48	172
Msa0721150	MtrunA17_Chr1g0207971	27.859	481	300	11	8	471	4	454	4.63e-48	171
Msa0721150	MtrunA17_Chr4g0044511	28.684	509	291	18	3	472	31	506	4.87e-48	172
Msa0721150	MtrunA17_Chr8g0365811	28.542	487	308	12	8	472	491	959	6.63e-48	177
Msa0721150	MtrunA17_Chr8g0365811	28.571	420	267	11	12	414	9	412	2.63e-42	160
Msa0721150	MtrunA17_Chr3g0098111	28.184	479	310	12	12	472	9	471	1.06e-47	171
Msa0721150	MtrunA17_Chr4g0044501	30.612	490	289	20	12	472	10	477	2.56e-47	170
Msa0721150	MtrunA17_Chr1g0179901	29.518	498	298	18	9	470	13	493	8.60e-47	169
Msa0721150	MtrunA17_Chr1g0207951	28.571	476	296	11	12	471	124	571	1.55e-46	173
Msa0721150	MtrunA17_Chr1g0207951	28.216	482	297	14	2	459	641	1097	1.20e-44	167
Msa0721150	MtrunA17_Chr8g0377941	29.424	486	283	15	13	470	8	461	1.88e-46	167
Msa0721150	MtrunA17_Chr3g0122001	30.567	494	281	14	12	470	486	952	6.04e-46	171
Msa0721150	MtrunA17_Chr3g0122001	29.461	482	303	10	12	470	6	473	4.79e-45	169
Msa0721150	MtrunA17_Chr7g0265151	31.128	514	260	23	12	470	9	483	6.47e-46	166
Msa0721150	MtrunA17_Chr4g0053501	28.067	481	301	16	7	467	6	461	1.69e-45	166
Msa0721150	MtrunA17_Chr6g0462571	27.521	476	285	16	13	459	5	449	2.23e-45	165
Msa0721150	MtrunA17_Chr8g0347271	29.365	504	291	22	3	475	10	479	3.05e-45	164
Msa0721150	MtrunA17_Chr7g0265041	28.257	499	297	14	12	470	11	488	4.79e-45	164
Msa0721150	MtrunA17_Chr5g0401851	27.800	500	314	18	2	472	4	485	8.77e-45	163
Msa0721150	MtrunA17_Chr7g0265111	30.769	507	301	17	1	473	28	518	1.19e-44	164
Msa0721150	MtrunA17_Chr7g0243681	28.235	510	299	19	1	472	1	481	2.99e-44	162
Msa0721150	MtrunA17_Chr4g0053321	28.958	480	298	16	7	467	21	476	4.77e-44	161
Msa0721150	MtrunA17_Chr6g0462531	25.873	487	301	13	13	468	5	462	6.61e-44	160
Msa0721150	MtrunA17_Chr7g0243631	27.054	499	303	16	12	472	13	488	2.17e-43	160
Msa0721150	MtrunA17_Chr7g0218791	27.813	471	286	14	12	463	5	440	4.27e-43	158
Msa0721150	MtrunA17_Chr6g0454371	42.690	171	94	3	303	470	1	170	5.77e-43	150
Msa0721150	MtrunA17_Chr6g0462551	28.008	482	278	18	13	459	5	452	6.50e-43	158
Msa0721150	MtrunA17_Chr7g0243931	28.231	503	313	18	1	472	7	492	9.19e-43	158
Msa0721150	MtrunA17_Chr5g0419771	29.981	517	280	22	9	475	33	517	1.15e-42	158
Msa0721150	MtrunA17_Chr5g0431441	26.971	482	295	13	12	470	18	465	1.73e-42	157
Msa0721150	MtrunA17_Chr7g0243951	28.088	502	314	18	1	472	1	485	6.49e-42	155
Msa0721150	MtrunA17_Chr7g0275511	27.992	493	297	18	4	466	7	471	1.79e-41	154
Msa0721150	MtrunA17_Chr4g0011051	28.457	499	297	17	12	470	9	487	1.82e-41	154
Msa0721150	MtrunA17_Chr5g0429681	30.328	488	281	22	8	467	40	496	6.09e-41	153
Msa0721150	MtrunA17_Chr5g0442601	27.290	524	286	22	5	474	397	879	1.57e-40	155
Msa0721150	MtrunA17_Chr5g0442601	28.660	321	158	13	115	410	62	336	9.56e-27	114
Msa0721150	MtrunA17_Chr8g0373301	26.761	497	287	18	8	466	5	462	1.59e-40	151
Msa0721150	MtrunA17_Chr8g0382021	27.835	485	284	16	17	470	39	488	1.86e-40	151
Msa0721150	MtrunA17_Chr5g0448521	27.435	503	281	19	12	470	5	467	2.04e-40	151
Msa0721150	MtrunA17_Chr5g0431361	28.195	493	273	20	12	472	12	455	3.14e-40	150
Msa0721150	MtrunA17_Chr1g0207831	26.569	478	310	12	13	471	9	464	3.32e-40	150
Msa0721150	MtrunA17_Chr7g0275681	26.613	496	300	16	12	470	12	480	1.05e-39	149
Msa0721150	MtrunA17_Chr8g0335141	29.839	372	221	11	123	472	117	470	1.19e-39	149
Msa0721150	MtrunA17_Chr7g0243871	27.961	515	287	20	1	472	1	474	2.17e-39	148
Msa0721150	MtrunA17_Chr5g0431401	27.917	480	288	12	12	472	10	450	3.18e-39	147
Msa0721150	MtrunA17_Chr7g0265101	27.711	498	301	20	12	470	9	486	3.21e-39	148
Msa0721150	MtrunA17_Chr7g0265141	28.024	496	307	15	7	468	4	483	3.33e-39	148
Msa0721150	MtrunA17_Chr7g0249961	35.223	247	128	7	242	474	32	260	6.61e-39	142
Msa0721150	MtrunA17_Chr7g0243781	26.719	509	304	18	1	472	1	477	7.14e-39	147
Msa0721150	MtrunA17_Chr8g0335161	26.501	483	303	17	11	466	5	462	7.34e-39	147
Msa0721150	MtrunA17_Chr6g0454231	34.363	259	128	7	218	474	4	222	9.17e-39	146
Msa0721150	MtrunA17_Chr6g0454231	27.350	234	149	7	12	230	250	477	2.02e-13	72.4
Msa0721150	MtrunA17_Chr1g0159551	27.701	509	271	19	4	470	6	459	9.38e-39	146
Msa0721150	MtrunA17_Chr5g0448551	25.598	418	289	8	13	427	8	406	1.09e-38	146
Msa0721150	MtrunA17_Chr4g0060511	26.602	515	288	16	12	472	11	489	1.11e-38	147
Msa0721150	MtrunA17_Chr8g0334851	28.600	500	280	22	8	466	2	465	1.21e-38	146
Msa0721150	MtrunA17_Chr5g0442581	32.722	327	161	14	180	470	173	476	1.23e-38	147
Msa0721150	MtrunA17_Chr7g0243771	27.183	504	300	17	8	472	2	477	1.95e-38	146
Msa0721150	MtrunA17_Chr6g0459311	27.235	481	296	17	13	466	14	467	2.24e-38	145
Msa0721150	MtrunA17_Chr6g0462521	25.314	478	301	13	13	468	5	448	2.37e-38	145
Msa0721150	MtrunA17_Chr5g0393591	26.439	469	287	14	12	471	17	436	2.49e-38	145
Msa0721150	MtrunA17_Chr5g0431421	28.931	477	287	13	12	472	10	450	3.17e-38	144
Msa0721150	MtrunA17_Chr5g0442541	26.000	500	292	16	11	470	4	465	4.31e-38	144
Msa0721150	MtrunA17_Chr6g0486251	27.572	486	288	18	13	466	7	460	4.75e-38	144
Msa0721150	MtrunA17_Chr6g0486201	27.572	486	288	18	13	466	7	460	4.75e-38	144
Msa0721150	MtrunA17_Chr7g0243801	27.381	504	301	17	7	472	2	478	4.99e-38	145
Msa0721150	MtrunA17_Chr3g0106231	27.664	488	284	16	5	470	11	451	5.81e-38	144
Msa0721150	MtrunA17_Chr3g0079731	25.444	507	302	14	8	468	2	478	5.91e-38	144
Msa0721150	MtrunA17_Chr6g0463891	27.432	514	303	18	1	472	1	486	1.10e-37	144
Msa0721150	MtrunA17_Chr8g0369341	27.721	487	307	12	9	471	4	469	1.11e-37	144
Msa0721150	MtrunA17_Chr6g0462541	25.988	481	303	15	13	466	5	459	1.29e-37	143
Msa0721150	MtrunA17_Chr4g0044521	29.049	389	229	14	106	468	97	464	1.62e-37	143
Msa0721150	MtrunA17_Chr7g0265051	26.707	498	304	20	12	470	9	484	1.89e-37	143
Msa0721150	MtrunA17_Chr2g0307961	27.071	495	309	17	1	470	1	468	3.62e-37	142
Msa0721150	MtrunA17_Chr7g0243861	26.854	499	304	18	12	472	14	489	4.80e-37	142
Msa0721150	MtrunA17_Chr7g0232401	33.569	283	149	9	191	447	182	451	5.60e-37	141
Msa0721150	MtrunA17_Chr4g0014061	31.655	278	163	6	219	474	204	476	6.84e-37	141
Msa0721150	MtrunA17_Chr4g0044481	29.147	422	237	13	7	412	22	397	9.76e-37	140
Msa0721150	MtrunA17_Chr8g0336691	28.426	394	220	14	103	466	1014	1375	1.20e-36	144
Msa0721150	MtrunA17_Chr8g0336691	26.915	483	299	18	12	466	13	469	4.59e-35	139
Msa0721150	MtrunA17_Chr8g0336691	29.217	332	191	11	137	459	605	901	1.13e-31	129
Msa0721150	MtrunA17_Chr8g0336261	45.255	137	72	2	303	437	1	136	1.59e-36	131
Msa0721150	MtrunA17_Chr4g0042891	33.453	278	143	10	220	474	211	469	1.64e-36	140
Msa0721150	MtrunA17_Chr8g0339601	31.228	285	158	7	201	460	48	319	1.68e-36	137
Msa0721150	MtrunA17_Chr2g0302991	30.032	313	179	7	180	468	164	460	2.19e-36	140
Msa0721150	MtrunA17_Chr5g0442491	25.294	510	300	16	11	474	4	478	2.52e-36	140
Msa0721150	MtrunA17_Chr1g0207931	32.950	261	158	6	222	471	244	498	3.73e-36	140
Msa0721150	MtrunA17_Chr8g0361371	25.813	492	308	16	7	467	2	467	5.45e-36	139
Msa0721150	MtrunA17_Chr5g0419761	27.416	507	290	16	12	470	9	485	9.43e-36	138
Msa0721150	MtrunA17_Chr8g0339461	33.333	279	147	8	214	466	202	467	1.02e-35	138
Msa0721150	MtrunA17_Chr4g0066281	32.997	297	149	10	208	471	188	467	3.21e-35	137
Msa0721150	MtrunA17_Chr7g0243761	27.766	479	295	18	12	472	11	456	3.83e-35	136
Msa0721150	MtrunA17_Chr4g0042931	26.305	498	295	16	12	474	7	467	5.22e-35	136
Msa0721150	MtrunA17_Chr4g0066151	25.294	510	306	17	1	471	7	480	5.25e-35	136
Msa0721150	MtrunA17_Chr6g0463861	32.039	309	162	10	194	468	177	471	5.28e-35	136
Msa0721150	MtrunA17_Chr8g0336651	28.947	380	222	15	106	459	875	1232	6.26e-35	139
Msa0721150	MtrunA17_Chr8g0336651	27.913	369	223	14	106	453	100	446	1.16e-30	126
Msa0721150	MtrunA17_Chr8g0336651	30.739	257	138	6	219	466	545	770	1.60e-30	125
Msa0721150	MtrunA17_Chr4g0066221	28.106	491	292	19	17	471	16	481	7.65e-35	135
Msa0721150	MtrunA17_Chr8g0334861	29.747	316	173	9	180	467	166	460	7.75e-35	135
Msa0721150	MtrunA17_Chr4g0072771	24.632	475	312	16	12	472	25	467	8.15e-35	135
Msa0721150	MtrunA17_Chr5g0442521	25.049	515	296	20	11	474	4	479	1.39e-34	135
Msa0721150	MtrunA17_Chr6g0449931	32.941	255	128	6	219	447	206	443	1.39e-34	135
Msa0721150	MtrunA17_Chr5g0431371	27.443	481	289	15	12	472	10	450	2.06e-34	134
Msa0721150	MtrunA17_Chr6g0453941	29.907	321	154	8	12	331	11	261	2.39e-34	130
Msa0721150	MtrunA17_Chr5g0420801	27.254	488	298	16	9	471	4	459	2.74e-34	134
Msa0721150	MtrunA17_Chr6g0453981	36.408	206	120	4	132	331	8	208	4.24e-34	128
Msa0721150	MtrunA17_Chr8g0355221	27.660	376	238	12	119	472	125	488	4.67e-34	134
Msa0721150	MtrunA17_Chr4g0066261	27.092	502	284	18	17	471	16	482	6.25e-34	133
Msa0721150	MtrunA17_Chr2g0302961	27.296	392	233	14	103	468	98	463	6.97e-34	132
Msa0721150	MtrunA17_Chr4g0066201	31.488	289	150	9	216	471	202	475	7.73e-34	133
Msa0721150	MtrunA17_Chr1g0153451	28.150	373	221	14	117	466	111	459	8.00e-34	132
Msa0721150	MtrunA17_Chr1g0173121	38.164	207	112	4	280	470	256	462	1.05e-33	132
Msa0721150	MtrunA17_Chr8g0374941	30.844	308	177	10	194	473	1121	1420	1.13e-33	135
Msa0721150	MtrunA17_Chr8g0374941	30.208	288	165	11	194	453	183	462	2.39e-28	119
Msa0721150	MtrunA17_Chr8g0374941	29.110	292	170	9	191	452	642	926	2.59e-27	116
Msa0721150	MtrunA17_Chr7g0235051	25.866	491	299	15	1	467	1	450	1.84e-33	131
Msa0721150	MtrunA17_Chr8g0339451	28.032	371	221	11	115	459	102	452	1.98e-33	131
Msa0721150	MtrunA17_Chr7g0243851	25.956	497	290	15	1	472	1	444	2.48e-33	131
Msa0721150	MtrunA17_Chr2g0294921	27.163	497	290	16	17	471	165	631	2.60e-33	133
Msa0721150	MtrunA17_Chr4g0072761	26.685	371	233	11	111	472	114	454	2.61e-33	131
Msa0721150	MtrunA17_Chr5g0442561	25.636	511	295	21	11	474	4	476	2.69e-33	131
Msa0721150	MtrunA17_Chr5g0403641	32.203	295	147	12	203	463	220	495	4.95e-33	131
Msa0721150	MtrunA17_Chr8g0336741	31.902	326	185	13	106	415	107	411	5.37e-33	130
Msa0721150	MtrunA17_Chr8g0334831	27.149	442	247	15	13	415	7	412	7.60e-33	130
Msa0721150	MtrunA17_Chr7g0232391	27.100	369	229	10	119	466	112	461	8.34e-33	130
Msa0721150	MtrunA17_Chr5g0440421	29.167	504	292	24	12	470	10	493	8.85e-33	130
Msa0721150	MtrunA17_Chr5g0416741	25.247	507	321	18	1	472	2	485	1.37e-32	129
Msa0721150	MtrunA17_Chr8g0339441	37.129	202	105	6	280	459	217	418	2.69e-32	127
Msa0721150	MtrunA17_Chr5g0432731	29.260	311	186	9	171	467	3	293	2.74e-32	125
Msa0721150	MtrunA17_Chr8g0339631	31.022	274	151	10	210	459	198	457	2.86e-32	128
Msa0721150	MtrunA17_Chr7g0232411	30.233	301	167	11	191	466	179	461	3.18e-32	128
Msa0721150	MtrunA17_Chr1g0165701	35.211	213	121	5	277	472	273	485	5.46e-32	128
Msa0721150	MtrunA17_Chr6g0463851	27.168	519	263	22	17	471	16	483	1.03e-31	127
Msa0721150	MtrunA17_Chr7g0243711	35.349	215	120	4	277	472	104	318	1.22e-31	124
Msa0721150	MtrunA17_Chr8g0336731	30.820	305	173	10	128	415	147	430	1.23e-31	127
Msa0721150	MtrunA17_Chr8g0374971	29.808	312	171	10	194	471	184	481	1.54e-31	126
Msa0721150	MtrunA17_Chr8g0374901	29.126	309	177	9	194	471	182	479	1.66e-31	126
Msa0721150	MtrunA17_Chr5g0442511	26.166	493	286	18	11	471	48	494	1.77e-31	126
Msa0721150	MtrunA17_Chr2g0294931	26.877	506	292	17	13	473	12	484	1.00e-30	124
Msa0721150	MtrunA17_Chr4g0066131	27.632	304	166	9	205	471	189	475	1.84e-30	123
Msa0721150	MtrunA17_Chr2g0294941	30.218	321	194	9	117	424	17	320	2.51e-30	121
Msa0721150	MtrunA17_Chr7g0232331	25.446	448	282	16	10	431	4	425	2.58e-30	122
Msa0721150	MtrunA17_Chr8g0350881	28.664	307	185	8	194	473	184	483	4.44e-30	122
Msa0721150	MtrunA17_Chr4g0066171	31.915	282	158	8	216	471	204	477	4.88e-30	122
Msa0721150	MtrunA17_Chr7g0232311	27.348	362	215	12	130	467	123	460	1.22e-29	120
Msa0721150	MtrunA17_Chr8g0370941	27.160	405	218	17	116	470	111	488	1.94e-29	120
Msa0721150	MtrunA17_Chr5g0410941	25.697	502	289	17	16	471	27	490	4.28e-29	119
Msa0721150	MtrunA17_Chr7g0232341	30.597	268	144	10	212	452	198	450	4.94e-29	119
Msa0721150	MtrunA17_Chr7g0218311	30.903	288	153	10	217	471	210	484	5.25e-29	119
Msa0721150	MtrunA17_Chr8g0374931	29.514	288	158	8	217	471	207	482	5.83e-29	119
Msa0721150	MtrunA17_Chr5g0431431	31.855	248	144	8	163	407	99	324	6.65e-29	117
Msa0721150	MtrunA17_Chr5g0428081	26.453	499	291	16	16	471	15	480	8.63e-29	118
Msa0721150	MtrunA17_Chr1g0153461	33.981	206	117	5	280	466	3	208	8.67e-29	113
Msa0721150	MtrunA17_Chr3g0106251	29.930	284	171	6	201	473	30	296	3.24e-28	114
Msa0721150	MtrunA17_Chr7g0243611	30.272	294	164	10	130	412	8	271	3.73e-28	113
Msa0721150	MtrunA17_Chr6g0482061	27.425	299	180	10	180	458	186	467	6.89e-28	116
Msa0721150	MtrunA17_Chr5g0416821	25.000	492	330	19	1	472	3	475	1.43e-27	115
Msa0721150	MtrunA17_Chr7g0243911	34.783	207	114	5	274	465	15	215	1.56e-27	109
Msa0721150	MtrunA17_Chr2g0329111	27.166	427	247	16	13	406	7	402	1.89e-27	114
Msa0721150	MtrunA17_Chr8g0357361	43.478	138	76	2	280	416	117	253	6.10e-27	109
Msa0721150	MtrunA17_Chr5g0409591	30.403	273	163	9	221	468	212	482	1.14e-26	112
Msa0721150	MtrunA17_Chr7g0243811	30.544	239	145	6	179	410	149	373	4.56e-26	109
Msa0721150	MtrunA17_Chr7g0241781	26.226	469	267	20	1	450	1	409	6.64e-26	109
Msa0721150	MtrunA17_Chr7g0241801	26.415	477	258	19	1	462	1	399	1.73e-25	108
Msa0721150	MtrunA17_Chr8g0367221	26.047	430	262	14	1	406	1	398	7.47e-25	108
Msa0721150	MtrunA17_Chr8g0367221	38.281	128	75	2	283	406	1548	1675	4.34e-21	97.1
Msa0721150	MtrunA17_Chr8g0367221	38.000	150	87	4	283	427	1058	1206	4.92e-21	97.1
Msa0721150	MtrunA17_Chr8g0361411	25.282	443	273	15	1	424	1	404	6.26e-23	101
Msa0721150	MtrunA17_Chr6g0454111	36.111	144	88	2	180	323	44	183	2.54e-22	94.4
Msa0721150	MtrunA17_Chr8g0337381	40.000	130	71	3	350	474	2	129	4.66e-22	91.7
Msa0721150	MtrunA17_Chr7g0231631	30.739	257	165	7	223	472	11	261	4.77e-22	95.9
Msa0721150	MtrunA17_Chr7g0232351	30.698	215	118	8	191	389	179	378	5.87e-22	97.4
Msa0721150	MtrunA17_Chr8g0336251	38.168	131	77	3	278	404	265	395	1.31e-21	97.4
Msa0721150	MtrunA17_Chr1g0207881	33.987	153	94	1	326	471	233	385	2.28e-21	95.9
Msa0721150	MtrunA17_Chr8g0336321	38.168	131	77	3	278	404	265	395	2.34e-21	96.7
Msa0721150	MtrunA17_Chr5g0427571	37.600	125	75	2	283	404	105	229	2.76e-21	94.4
Msa0721150	MtrunA17_Chr3g0079711	32.065	184	103	5	307	468	3	186	2.03e-20	89.0
Msa0721150	MtrunA17_Chr1g0196851	26.024	415	266	17	12	414	49	434	2.40e-20	93.6
Msa0721150	MtrunA17_Chr4g0066141	36.076	158	84	4	332	472	196	353	3.33e-20	92.0
Msa0721150	MtrunA17_Chr3g0092031	35.714	126	79	2	282	406	5	129	3.70e-19	85.9
Msa0721150	MtrunA17_Chr6g0466831	23.333	420	275	12	2	406	8	395	6.21e-19	89.4
Msa0721150	MtrunA17_Chr5g0426411	33.918	171	103	4	6	169	6	173	1.20e-18	83.6
Msa0721150	MtrunA17_Chr7g0250021	25.915	355	226	12	1	346	1	327	2.67e-18	85.9
Msa0721150	MtrunA17_Chr2g0278721	24.706	425	284	16	6	414	511	915	2.76e-18	88.2
Msa0721150	MtrunA17_Chr2g0278721	34.127	126	81	2	282	406	273	397	5.89e-15	77.8
Msa0721150	MtrunA17_Chr4g0029151	24.512	461	269	16	9	437	17	430	2.87e-18	87.0
Msa0721150	MtrunA17_Chr4g0069611	24.574	411	261	17	12	406	15	392	3.82e-18	86.7
Msa0721150	MtrunA17_Chr2g0302851	23.301	412	265	14	12	406	16	393	7.25e-17	82.8
Msa0721150	MtrunA17_Chr6g0466841	22.128	470	312	15	2	450	8	444	9.84e-17	82.4
Msa0721150	MtrunA17_Chr2g0283041	24.274	482	314	17	12	474	7	456	1.38e-16	82.0
Msa0721150	MtrunA17_Chr4g0040711	24.667	450	283	17	9	437	5	419	1.81e-16	81.6
Msa0721150	MtrunA17_Chr6g0464091	24.455	413	266	15	12	406	18	402	2.57e-16	81.3
Msa0721150	MtrunA17_Chr4g0029131	31.325	166	103	4	283	437	257	422	3.66e-16	81.3
Msa0721150	MtrunA17_Chr2g0278741	22.014	427	257	14	12	406	97	479	4.46e-16	80.9
Msa0721150	MtrunA17_Chr4g0040691	24.348	460	297	15	9	448	5	433	1.29e-15	79.0
Msa0721150	MtrunA17_Chr4g0039881	22.906	406	254	15	22	406	2	369	3.33e-15	77.8
Msa0721150	MtrunA17_Chr8g0336271	24.812	266	163	9	11	250	9	263	3.67e-15	75.9
Msa0721150	MtrunA17_Chr8g0334841	32.895	152	82	5	180	328	1	135	8.48e-15	72.4
Msa0721150	MtrunA17_Chr6g0454381	32.593	135	79	5	132	258	8	138	3.16e-14	69.7
Msa0721150	MtrunA17_Chr5g0442501	24.556	338	196	12	11	327	4	303	1.24e-13	71.6
Msa0721150	MtrunA17_Chr5g0427561	34.524	84	54	1	388	470	1	84	2.57e-13	65.5
Msa0721150	MtrunA17_Chr6g0454391	42.857	63	36	0	366	428	13	75	4.79e-13	65.9
Msa0721150	MtrunA17_Chr6g0454281	27.103	214	118	8	12	198	10	212	1.88e-12	66.6
Msa0721150	MtrunA17_Chr7g0243731	42.857	70	40	0	345	414	4	73	6.41e-12	61.2

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0721150	AT1G22380.1	36.059	477	278	12	12	470	13	480	2.00e-94	294
Msa0721150	AT1G22400.1	34.029	479	280	10	12	467	13	478	3.05e-90	283
Msa0721150	AT1G22360.1	34.855	482	277	11	12	470	10	477	7.60e-89	280
Msa0721150	AT1G22370.2	34.937	478	277	10	12	470	13	475	6.51e-87	275
Msa0721150	AT1G22360.2	34.647	482	266	12	12	470	10	465	1.72e-85	271
Msa0721150	AT1G22340.1	34.369	483	279	13	12	470	13	481	6.97e-83	265
Msa0721150	AT1G78270.1	34.316	475	289	13	12	470	13	480	1.39e-78	253
Msa0721150	AT3G11340.1	33.612	479	278	13	1	472	1	446	3.39e-77	248
Msa0721150	AT5G05900.1	34.583	480	253	15	12	470	8	447	7.52e-73	237
Msa0721150	AT5G05880.1	33.951	486	264	15	7	472	2	450	1.17e-69	229
Msa0721150	AT3G55710.1	31.263	483	288	14	6	472	2	456	5.66e-66	219
Msa0721150	AT3G46660.1	33.539	486	275	14	1	472	6	457	1.51e-65	218
Msa0721150	AT3G55700.1	30.864	486	282	14	6	472	2	452	1.52e-65	218
Msa0721150	AT5G05860.1	33.194	479	272	12	6	470	3	447	2.12e-64	215
Msa0721150	AT3G46670.1	31.884	483	285	15	1	472	1	450	6.58e-63	211
Msa0721150	AT4G15480.1	29.522	481	304	10	12	474	19	482	1.01e-60	206
Msa0721150	AT5G05890.1	31.098	492	274	15	7	472	2	454	1.01e-60	206
Msa0721150	AT5G38010.1	32.218	478	283	14	6	470	4	453	1.62e-60	205
Msa0721150	AT5G05870.1	30.675	489	279	15	6	470	2	454	7.90e-60	203
Msa0721150	AT5G59590.1	30.063	479	282	16	6	467	4	446	2.63e-59	202
Msa0721150	AT1G22370.1	36.964	303	182	6	173	470	7	305	3.35e-59	197
Msa0721150	AT3G02100.1	30.515	485	293	13	6	474	7	463	1.33e-58	200
Msa0721150	AT3G21560.1	29.184	490	305	13	1	468	1	470	3.43e-58	200
Msa0721150	AT3G46690.1	31.707	492	268	17	6	472	3	451	3.79e-58	199
Msa0721150	AT3G46680.1	29.938	481	287	15	6	470	3	449	3.96e-58	198
Msa0721150	AT3G46650.1	29.792	480	275	14	4	470	2	432	2.40e-57	196
Msa0721150	AT5G38040.1	31.965	463	272	15	20	470	18	449	2.58e-57	196
Msa0721150	AT2G43840.2	30.689	479	285	16	7	471	2	447	1.92e-56	194
Msa0721150	AT5G59580.1	30.316	475	281	16	12	471	9	448	3.36e-56	193
Msa0721150	AT2G43840.1	30.498	482	282	17	7	471	2	447	8.62e-56	192
Msa0721150	AT3G46720.1	29.979	477	287	15	6	472	3	442	9.24e-56	192
Msa0721150	AT3G46700.1	30.228	483	282	17	6	472	3	446	1.86e-55	191
Msa0721150	AT2G31750.1	30.591	474	297	14	7	470	3	454	2.44e-55	191
Msa0721150	AT2G31750.2	30.544	478	300	14	7	474	3	458	3.48e-55	192
Msa0721150	AT2G43820.1	30.353	481	286	15	7	472	2	448	3.60e-55	191
Msa0721150	AT2G31790.1	29.498	478	293	15	7	467	3	453	1.71e-54	189
Msa0721150	AT4G15490.1	29.079	478	297	14	11	467	7	463	1.08e-53	187
Msa0721150	AT2G28080.1	29.670	455	286	16	17	454	23	460	1.12e-52	185
Msa0721150	AT4G15500.1	28.512	477	304	10	7	467	4	459	2.34e-52	184
Msa0721150	AT2G26480.1	30.085	472	291	14	12	474	8	449	3.07e-52	183
Msa0721150	AT1G05675.1	30.021	483	280	13	8	467	2	449	2.11e-51	181
Msa0721150	AT2G36970.1	29.424	486	299	16	12	474	10	474	3.68e-51	181
Msa0721150	AT5G17050.1	29.098	488	301	18	3	474	2	460	1.53e-48	173
Msa0721150	AT1G05680.1	29.796	490	272	16	8	467	2	449	6.62e-48	171
Msa0721150	AT4G15550.1	27.381	504	278	18	9	467	10	470	1.14e-46	168
Msa0721150	AT4G34138.1	28.858	499	276	14	5	459	4	467	1.88e-46	168
Msa0721150	AT5G17040.1	27.406	478	291	18	9	470	2	439	2.06e-46	167
Msa0721150	AT2G23260.1	28.992	476	299	18	7	470	5	453	1.98e-45	165
Msa0721150	AT1G30530.1	28.306	484	293	16	3	470	5	450	2.96e-45	164
Msa0721150	AT2G15490.3	29.713	488	293	17	12	468	7	475	2.44e-44	162
Msa0721150	AT2G36760.1	28.827	503	294	17	12	472	14	494	2.96e-44	162
Msa0721150	AT3G16520.3	31.989	372	208	14	115	468	113	457	3.24e-44	161
Msa0721150	AT1G05560.2	28.884	502	279	19	2	470	45	501	3.54e-44	162
Msa0721150	AT2G15480.1	28.310	491	296	18	12	468	10	478	4.02e-44	162
Msa0721150	AT2G29710.1	26.923	494	300	16	10	473	3	465	4.90e-44	161
Msa0721150	AT2G15490.1	29.532	491	293	17	12	468	7	478	5.91e-44	161
Msa0721150	AT5G17030.1	29.659	381	230	10	105	470	98	455	7.74e-44	160
Msa0721150	AT1G05560.1	29.065	492	271	19	12	470	5	451	9.94e-44	160
Msa0721150	AT1G01420.2	28.330	473	286	16	7	453	6	451	1.14e-43	160
Msa0721150	AT1G01420.1	28.330	473	286	16	7	453	3	448	1.16e-43	160
Msa0721150	AT3G16520.2	32.011	353	195	13	115	446	113	441	1.77e-43	159
Msa0721150	AT5G17040.2	31.046	306	189	10	170	470	49	337	1.98e-43	156
Msa0721150	AT2G23250.1	29.957	464	282	18	21	473	7	438	2.34e-43	159
Msa0721150	AT2G15480.2	27.745	501	296	18	12	468	10	488	2.68e-43	160
Msa0721150	AT3G16520.1	32.011	353	195	13	115	446	113	441	2.81e-43	159
Msa0721150	AT1G24100.1	29.051	506	272	20	2	470	3	458	3.81e-43	159
Msa0721150	AT1G05530.1	28.685	502	263	20	12	470	5	454	1.61e-42	157
Msa0721150	AT2G36770.1	28.257	499	302	18	12	472	14	494	8.64e-42	155
Msa0721150	AT2G29730.1	26.653	484	295	19	14	467	6	459	1.32e-41	154
Msa0721150	AT4G34131.1	27.022	507	309	20	1	472	1	481	1.67e-41	154
Msa0721150	AT5G26310.1	29.084	502	264	25	9	463	4	460	2.35e-41	154
Msa0721150	AT4G01070.1	26.638	473	291	15	6	450	2	446	3.53e-41	154
Msa0721150	AT2G36780.1	27.821	514	281	18	10	470	12	488	3.83e-41	154
Msa0721150	AT2G36750.1	28.008	507	284	20	12	470	10	483	4.29e-41	154
Msa0721150	AT5G66690.1	28.858	499	269	22	9	463	4	460	7.70e-41	152
Msa0721150	AT2G36800.1	26.515	528	289	19	1	470	1	487	1.52e-39	149
Msa0721150	AT4G14090.1	29.012	486	269	18	12	467	13	452	1.92e-39	148
Msa0721150	AT4G34135.1	28.081	495	300	15	12	472	11	483	4.66e-39	148
Msa0721150	AT2G36790.1	27.451	510	294	20	12	473	13	494	5.24e-39	148
Msa0721150	AT1G01390.1	28.000	425	252	12	7	406	3	398	5.28e-39	147
Msa0721150	AT3G53160.1	34.173	278	143	8	221	470	217	482	8.18e-39	147
Msa0721150	AT1G01390.2	28.000	425	252	12	7	406	20	415	9.05e-39	147
Msa0721150	AT3G21790.1	25.646	503	310	15	12	474	4	482	4.68e-37	142
Msa0721150	AT3G22250.1	24.943	441	292	12	13	435	9	428	1.39e-36	140
Msa0721150	AT1G73880.1	25.873	487	313	16	7	472	9	468	2.22e-36	140
Msa0721150	AT4G36770.1	27.178	482	274	18	12	454	4	447	7.59e-36	138
Msa0721150	AT3G50740.1	27.345	501	280	21	9	463	4	466	6.28e-35	136
Msa0721150	AT1G07250.1	25.615	488	293	19	11	459	5	461	8.91e-35	136
Msa0721150	AT5G03490.1	26.869	495	289	17	3	468	10	460	5.19e-34	133
Msa0721150	AT2G30140.2	26.078	487	289	18	12	473	13	453	6.24e-34	133
Msa0721150	AT2G29750.1	25.306	490	301	16	7	460	3	463	1.02e-33	133
Msa0721150	AT2G30140.1	25.873	487	291	18	12	473	13	454	1.42e-33	132
Msa0721150	AT1G07260.1	30.667	300	169	10	180	460	182	461	9.68e-33	130
Msa0721150	AT5G14860.1	27.593	511	281	26	9	470	5	475	1.46e-32	130
Msa0721150	AT1G07240.1	30.671	313	181	12	166	459	169	464	2.13e-32	129
Msa0721150	AT3G21760.1	24.594	431	280	11	12	416	4	415	5.16e-32	128
Msa0721150	AT2G29740.1	25.963	493	295	18	7	460	3	464	8.31e-32	127
Msa0721150	AT3G53150.1	27.381	504	305	20	12	470	22	509	1.09e-31	127
Msa0721150	AT2G30150.2	25.304	494	304	15	4	474	5	456	7.69e-31	124
Msa0721150	AT5G37950.2	34.035	285	152	11	113	389	81	337	1.25e-30	122
Msa0721150	AT3G21750.1	25.149	505	302	15	12	475	4	473	1.74e-30	124
Msa0721150	AT4G15260.1	29.496	278	157	7	218	470	91	354	2.08e-30	121
Msa0721150	AT2G18570.1	29.562	274	145	11	219	463	205	459	2.92e-30	123
Msa0721150	AT5G37950.1	33.916	286	157	12	113	389	81	343	1.07e-29	119
Msa0721150	AT4G15280.1	29.137	278	159	6	218	470	209	473	2.45e-29	120
Msa0721150	AT4G15280.2	29.348	276	157	6	218	468	241	503	3.31e-29	120
Msa0721150	AT3G21800.1	24.449	499	312	18	13	470	5	479	4.08e-29	120
Msa0721150	AT2G30150.1	25.364	481	294	15	17	474	2	440	8.54e-29	118
Msa0721150	AT3G21780.1	23.953	430	270	13	12	415	4	402	2.12e-28	117
Msa0721150	AT2G18560.1	29.927	274	144	11	219	463	115	369	4.69e-28	115
Msa0721150	AT1G51210.1	24.169	451	289	17	12	446	20	433	9.01e-28	115
Msa0721150	AT2G16890.2	23.395	483	322	16	12	470	9	467	1.89e-27	115
Msa0721150	AT1G10400.1	25.447	503	278	22	12	467	7	459	1.99e-27	115
Msa0721150	AT1G06000.1	28.676	272	161	8	216	467	172	430	4.20e-27	113
Msa0721150	AT2G16890.3	24.344	419	278	13	12	415	9	403	8.48e-26	109
Msa0721150	AT5G49690.1	26.150	413	259	13	6	404	4	384	2.89e-25	108
Msa0721150	AT5G12890.1	35.233	193	102	6	220	401	224	404	1.91e-23	103
Msa0721150	AT5G54010.1	24.703	421	265	13	9	415	3	385	4.57e-20	92.8
Msa0721150	AT5G65550.1	36.842	133	81	3	283	414	270	400	3.56e-19	90.5
Msa0721150	AT2G22590.1	24.272	412	270	13	12	406	15	401	1.46e-18	88.6
Msa0721150	AT4G27570.1	23.684	418	264	15	12	414	7	384	2.21e-18	87.8
Msa0721150	AT4G01070.2	24.024	333	215	11	6	328	2	306	1.43e-17	84.3
Msa0721150	AT4G27560.1	23.206	418	266	15	12	414	7	384	2.19e-17	84.7
Msa0721150	AT5G53990.1	23.871	465	288	17	12	456	6	424	1.38e-14	76.3
Msa0721150	AT4G09500.2	23.758	463	291	19	12	456	6	424	3.67e-13	71.6
Msa0721150	AT1G64910.1	22.857	420	262	16	12	415	6	379	3.73e-13	71.6
Msa0721150	AT4G34135.2	24.779	339	209	13	12	327	11	326	4.71e-13	70.5
Msa0721150	AT3G29630.1	23.191	470	294	16	9	456	3	427	1.87e-12	69.7
Msa0721150	AT4G09500.1	29.213	178	111	7	290	456	226	399	3.27e-11	65.5

Find 168 sgRNAs with CRISPR-Local

Find 291 sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
GAAAATAAGTTGCATTATTT+TGG	0.129986	5_1:-17583947	Msa0721150:CDS
CTATTAGTTCTTGCTGCTTT+TGG	0.136964	5_1:-17583855	Msa0721150:CDS
AACTTGCGCAAGGGTATATT+TGG	0.183036	5_1:+17580799	None:intergenic
AAGTATAAGTGTAGGCATTT+TGG	0.220612	5_1:-17579830	Msa0721150:three_prime_UTR
GTCTACTATCCCGTAAAATA+AGG	0.228152	5_1:-17581207	Msa0721150:exon
ATGTGATGTTTAAACTATTT+AGG	0.254247	5_1:-17581018	Msa0721150:three_prime_UTR
ACTGATTTGGCTGCTGAGTT+TGG	0.266869	5_1:-17583901	Msa0721150:CDS
GTTGCTTCTCTTGGTCAAAT+TGG	0.268661	5_1:-17580993	Msa0721150:three_prime_UTR
GGATATATATATACCTCTAA+TGG	0.273189	5_1:+17583789	None:intergenic
GGGCCTATGGTGTAGAGTTT+AGG	0.277656	5_1:+17581893	None:intergenic
AAGATTTAATTCAATATATA+AGG	0.286593	5_1:-17581229	Msa0721150:CDS
ATTTGTTGATCAGCAAAATA+AGG	0.287071	5_1:+17581446	None:intergenic
GTGAGTGAGGTTTGGAAACT+TGG	0.292117	5_1:-17581410	Msa0721150:CDS
ATTATTTCTTCTCTCTTCAT+TGG	0.297807	5_1:+17581716	None:intergenic
TACATATGCAAGAAAGTTAT+AGG	0.301470	5_1:-17584333	Msa0721150:five_prime_UTR
GAAGAGAAGCATCCTGGATT+TGG	0.314492	5_1:-17584045	Msa0721150:CDS
TCAAACATGGTACAAGAAAA+AGG	0.314881	5_1:-17581638	Msa0721150:CDS
TTTGGGTTGTAACTCAATAT+AGG	0.319605	5_1:-17579812	Msa0721150:three_prime_UTR
GGCCTATGGTGTAGAGTTTA+GGG	0.331169	5_1:+17581894	None:intergenic
CTGATTTGGCTGCTGAGTTT+GGG	0.334780	5_1:-17583900	Msa0721150:CDS
GAGAAGAAATAATTGAGATT+TGG	0.335214	5_1:-17581706	Msa0721150:CDS
AAGAAGTTGGTAAGACAAAA+TGG	0.336575	5_1:-17579527	Msa0721150:three_prime_UTR
CTGATCAACAAATAAATAGT+AGG	0.353536	5_1:-17581436	Msa0721150:CDS
ATTGTTCAACCCTCGAATTT+TGG	0.354954	5_1:+17581094	None:intergenic
TGTAAAATCAGCCATGGATA+TGG	0.357578	5_1:-17581306	Msa0721150:CDS
ACATCTTTATTCAAAGCTTA+AGG	0.360862	5_1:+17581037	None:intergenic
TGGTGACCTTGCTACTGATT+TGG	0.367535	5_1:-17583914	Msa0721150:CDS
TAAATCTTGGAAGTTGTTGT+AGG	0.370730	5_1:+17581244	None:intergenic
TTATATATTGAATTAAATCT+TGG	0.370783	5_1:+17581231	None:intergenic
TTTCCTCGTGTCAACCGTTT+AGG	0.370963	5_1:+17580459	None:intergenic
CTTCGTGAAATCAAAGTTGT+TGG	0.372610	5_1:-17579667	Msa0721150:three_prime_UTR
GTGGAGTTATATATGTATTA+AGG	0.372662	5_1:+17584369	None:intergenic
TCGGTTATATATGTTAGTTT+TGG	0.373327	5_1:-17581749	Msa0721150:CDS
GTGGTGTGCCTATGATTTGT+TGG	0.376618	5_1:-17581469	Msa0721150:CDS
TGTGGGGTATGAGAATCTTC+TGG	0.379392	5_1:+17580042	None:intergenic
ATTTGCTTTAAGTGATTGTT+TGG	0.382144	5_1:+17581982	None:intergenic
ATTTAGGTGGTTGCTTCTCT+TGG	0.384556	5_1:-17581002	Msa0721150:three_prime_UTR
TCATTGCACTCCAAGAGGTT+TGG	0.384631	5_1:+17583817	None:intergenic
GCGCAGAAATAGAACAAATC+TGG	0.385512	5_1:-17579947	Msa0721150:three_prime_UTR
AACTTCTTCGTTACGAAGAA+TGG	0.388157	5_1:+17579542	None:intergenic
CAACCTCGTCTATACGGATA+TGG	0.388459	5_1:+17582014	None:intergenic
CACGAAGAATGGCGTCGATC+AGG	0.389497	5_1:+17579618	None:intergenic
CGAAGTAAGTTTGCCATGCC+TGG	0.400958	5_1:+17582079	None:intergenic
GGTATATTTGGAACGGCTGC+AGG	0.402358	5_1:+17580811	None:intergenic
TTTCTGTGTTCCAAACCTCT+TGG	0.411613	5_1:-17583827	Msa0721150:CDS
GAAGGAACTAGCAAGGATAA+AGG	0.411764	5_1:-17581596	Msa0721150:CDS
ATAGTCTTGAATTGAAGCTT+AGG	0.412111	5_1:+17584084	None:intergenic
TAGGAAAGTTGTGGAGAATA+TGG	0.412889	5_1:-17581363	Msa0721150:CDS
GAAGTACAACCTCGTCTATA+CGG	0.414116	5_1:+17582008	None:intergenic
CCCCACAGTTATTGTACCTT+GGG	0.414340	5_1:-17580026	Msa0721150:three_prime_UTR
TGCAATGAACTTCCCATTAG+AGG	0.423671	5_1:-17583802	Msa0721150:intron
GTAGGTTTGTGAGTGAGGTT+TGG	0.428038	5_1:-17581418	Msa0721150:CDS
TCTTTCGATTTCACGAAGAA+TGG	0.438499	5_1:+17579607	None:intergenic
TGCAATGCATTATGCCTAAA+CGG	0.440515	5_1:-17580473	Msa0721150:three_prime_UTR
ACCACCAGGACTCACACTCT+TGG	0.441655	5_1:+17581271	None:intergenic
AAGGATAAAGGGTTGATTGT+TGG	0.443900	5_1:-17581584	Msa0721150:CDS
CATAGTGAAGAGAAGCATCC+TGG	0.445229	5_1:-17584051	Msa0721150:CDS
GATATATATATACCTCTAAT+GGG	0.445458	5_1:+17583790	None:intergenic
TGACTCTCAACCATTGAAAT+CGG	0.446084	5_1:-17581768	Msa0721150:CDS
GAGTCGGTTATGAATGTATT+CGG	0.451281	5_1:+17584149	None:intergenic
TTGAACAATACATATAAATA+CGG	0.456552	5_1:-17581080	Msa0721150:three_prime_UTR
TCTACTATCCCGTAAAATAA+GGG	0.457384	5_1:-17581206	Msa0721150:exon
GAAGCATATATCAGAAGATA+AGG	0.458304	5_1:-17580319	Msa0721150:three_prime_UTR
TAATGGGTGGAATTCAACTT+TGG	0.460954	5_1:-17581504	Msa0721150:CDS
CGCATCATAACAAACATTCC+AGG	0.461698	5_1:-17582097	Msa0721150:CDS
AAATAGTAGGTTTGTGAGTG+AGG	0.465097	5_1:-17581423	Msa0721150:CDS
TCATCAACTAAACTCGATCT+AGG	0.466081	5_1:+17579484	None:intergenic
GAATATGGTGAATGATGTTA+TGG	0.469748	5_1:-17581348	Msa0721150:CDS
TGAATGATGTTATGGTGAAT+AGG	0.471178	5_1:-17581340	Msa0721150:CDS
AGCATCCTGGATTTGGAGAA+AGG	0.475413	5_1:-17584038	Msa0721150:CDS
AAATAAGGCCAACAAATCAT+AGG	0.477093	5_1:+17581461	None:intergenic
ACTATTCTGAAGCACGTAGT+TGG	0.479227	5_1:-17580945	Msa0721150:three_prime_UTR
AGGGGATAAGCTGAGATTCA+TGG	0.479408	5_1:-17579571	Msa0721150:three_prime_UTR
AAGTTGTTGGTTAGACTAAG+AGG	0.480307	5_1:-17579654	Msa0721150:three_prime_UTR
GAAACTTGGGTTGGATATGA+AGG	0.480309	5_1:-17581396	Msa0721150:CDS
GAAAGAGTTGGTAACACAAA+GGG	0.482676	5_1:-17579590	Msa0721150:three_prime_UTR
GCTTTAGCATTGAATTTACA+TGG	0.483622	5_1:+17584220	None:intergenic
TGAACAATACATATAAATAC+GGG	0.486891	5_1:-17581079	Msa0721150:three_prime_UTR
GTGACAAAACTTCCTCTTGT+GGG	0.488001	5_1:+17581555	None:intergenic
GAATTTACATGGCCTTGTGC+TGG	0.491907	5_1:+17584231	None:intergenic
TAAGAGCAATTTATTCAAAG+TGG	0.492289	5_1:-17581813	Msa0721150:CDS
AGCCATGGATATGGCTAAGT+TGG	0.496465	5_1:-17581297	Msa0721150:CDS
CATCGTGAAATTGAAAGAGT+TGG	0.498732	5_1:-17579733	Msa0721150:three_prime_UTR
TGAGTGAGGTTTGGAAACTT+GGG	0.500077	5_1:-17581409	Msa0721150:CDS
ACTCATACTCAACACATTTG+AGG	0.503493	5_1:-17581957	Msa0721150:CDS
ACATATATAACCGATTTCAA+TGG	0.506428	5_1:+17581758	None:intergenic
ATTGTGTCACTGAGTTTGTA+TGG	0.506708	5_1:-17584003	Msa0721150:CDS
AGGATTATTAAGTGAGCTTG+AGG	0.508071	5_1:-17581618	Msa0721150:CDS
CCTATCCTTTCTCCAAATCC+AGG	0.509024	5_1:+17584033	None:intergenic
ACCCCACAGTTATTGTACCT+TGG	0.509387	5_1:-17580027	Msa0721150:three_prime_UTR
TAGTCTTGAATTGAAGCTTA+GGG	0.511757	5_1:+17584085	None:intergenic
CACATTGAACCAAAATTCGA+GGG	0.513459	5_1:-17581103	Msa0721150:three_prime_UTR
GAAATAATTGAGATTTGGCA+TGG	0.518839	5_1:-17581701	Msa0721150:CDS
ATATGAAGGATGTTTGTGAT+AGG	0.519622	5_1:-17581382	Msa0721150:CDS
TTACAACATGCAATGCCACT+TGG	0.521702	5_1:+17580384	None:intergenic
AAGGAACTAGCAAGGATAAA+GGG	0.522413	5_1:-17581595	Msa0721150:CDS
TAAAGGGTTGATTGTTGGAT+GGG	0.526671	5_1:-17581579	Msa0721150:CDS
TCTTTCAATTTCACGATGAG+TGG	0.527560	5_1:+17579738	None:intergenic
GGAGTTAAAAGTATAAGTGT+AGG	0.529189	5_1:-17579838	Msa0721150:three_prime_UTR
AGAGTCAAGCCACGCCATGC+AGG	0.530095	5_1:+17581784	None:intergenic
TCACATTGAACCAAAATTCG+AGG	0.533533	5_1:-17581104	Msa0721150:three_prime_UTR
ACATGGCCTTGTGCTGGACA+TGG	0.534043	5_1:+17584237	None:intergenic
CTTCGTGAAATCGAAAGAGT+TGG	0.537399	5_1:-17579602	Msa0721150:three_prime_UTR
TGAGGTTTGGAAACTTGGGT+TGG	0.537607	5_1:-17581405	Msa0721150:CDS
ATCTTGGAAGTTGTTGTAGG+AGG	0.539036	5_1:+17581247	None:intergenic
TATATGCTTCAGCTGCCGCT+TGG	0.542413	5_1:+17580332	None:intergenic
GTGGTGATGAAGAGGGCCTA+TGG	0.544580	5_1:+17581880	None:intergenic
ATTCTTCGTAACGAAGAAGT+TGG	0.546872	5_1:-17579540	Msa0721150:three_prime_UTR
ATAAAGGGTTGATTGTTGGA+TGG	0.548108	5_1:-17581580	Msa0721150:CDS
GCATCCAAGAGTGTGAGTCC+TGG	0.552305	5_1:-17581275	Msa0721150:CDS
ACTTTGGAAAGTGTGGTTTG+TGG	0.554343	5_1:-17581488	Msa0721150:CDS
AAGCATATATCAGAAGATAA+GGG	0.557340	5_1:-17580318	Msa0721150:three_prime_UTR
GAATTCAACTTTGGAAAGTG+TGG	0.562112	5_1:-17581495	Msa0721150:CDS
TATGAATGTATTCGGTGTTG+AGG	0.573279	5_1:+17584157	None:intergenic
TCGAATGTATATTTCTAACA+TGG	0.573595	5_1:-17580899	Msa0721150:three_prime_UTR
TGCGTTAGTTAACTTGCGCA+AGG	0.574544	5_1:+17580789	None:intergenic
TTATTAAGTGAGCTTGAGGA+AGG	0.576667	5_1:-17581614	Msa0721150:CDS
CATCGTTGAATTGAATGAGT+CGG	0.580012	5_1:+17584133	None:intergenic
CAACTAAACTCGATCTAGGA+AGG	0.581159	5_1:+17579488	None:intergenic
TGTGACAAAACTTCCTCTTG+TGG	0.583263	5_1:+17581554	None:intergenic
AGTAGTAATTTCTTTCCAAG+TGG	0.585014	5_1:-17580399	Msa0721150:three_prime_UTR
TCCAAGAGTGTGAGTCCTGG+TGG	0.586272	5_1:-17581272	Msa0721150:CDS
CACGTGAGTTAACTCACGCT+GGG	0.586735	5_1:-17580668	Msa0721150:three_prime_UTR
CATGGCCTTGTGCTGGACAT+GGG	0.589394	5_1:+17584238	None:intergenic
GGGTCAAAATTGTAGGCCCA+AGG	0.592306	5_1:+17580010	None:intergenic
GCCCAAGGTACAATAACTGT+GGG	0.593061	5_1:+17580025	None:intergenic
CCTGGATTTGGAGAAAGGAT+AGG	0.594736	5_1:-17584033	Msa0721150:CDS
TGTTGGATGGGTCCCACAAG+AGG	0.597020	5_1:-17581567	Msa0721150:CDS
CGAAAGAGTTGGTAACACAA+AGG	0.599412	5_1:-17579591	Msa0721150:three_prime_UTR
CCAGCGTGAGTTAACTCACG+TGG	0.604036	5_1:+17580669	None:intergenic
ATCTTCCCATGTCCAGCACA+AGG	0.604045	5_1:-17584243	Msa0721150:CDS
GCGCAAGGGTATATTTGGAA+CGG	0.604585	5_1:+17580804	None:intergenic
TGCCAACTTAGCCATATCCA+TGG	0.606456	5_1:+17581295	None:intergenic
GCGTTAGTTAACTTGCGCAA+GGG	0.607499	5_1:+17580790	None:intergenic
ATGGGTGATTAGGTCAAACA+TGG	0.609105	5_1:-17581651	Msa0721150:CDS
TTCCCTAAACTCTACACCAT+AGG	0.611308	5_1:-17581896	Msa0721150:CDS
GGAGTTTGTAAAATCAGCCA+TGG	0.612612	5_1:-17581312	Msa0721150:CDS
CATAACAAACATTCCAGGCA+TGG	0.613569	5_1:-17582092	Msa0721150:CDS
TGGATAGAACCTGCATGGCG+TGG	0.616199	5_1:-17581793	Msa0721150:CDS
GTATATTTGGAACGGCTGCA+GGG	0.618253	5_1:+17580812	None:intergenic
CAAAGTGGATAGAACCTGCA+TGG	0.622228	5_1:-17581798	Msa0721150:CDS
AATAGTTTGTGTAAATGTCG+AGG	0.623169	5_1:+17580962	None:intergenic
CATCATCATGTTGTTCCAAG+CGG	0.624291	5_1:-17580347	Msa0721150:three_prime_UTR
TTGTTGTAGGAGGAACCACC+AGG	0.625499	5_1:+17581257	None:intergenic
TAAACGGTTGACACGAGGAA+AGG	0.626244	5_1:-17580457	Msa0721150:three_prime_UTR
ACGAATTTGTGAGAGGACTG+AGG	0.626974	5_1:+17581925	None:intergenic
TGTTTGTGATAGGAAAGTTG+TGG	0.627468	5_1:-17581372	Msa0721150:CDS
TAGTTGATGAGAAACAAATG+AGG	0.628829	5_1:-17579471	Msa0721150:three_prime_UTR
CCACGTGAGTTAACTCACGC+TGG	0.631737	5_1:-17580669	Msa0721150:three_prime_UTR
CAGCAGCCAAATCAGTAGCA+AGG	0.634571	5_1:+17583908	None:intergenic
GGCCCAAGGTACAATAACTG+TGG	0.641557	5_1:+17580024	None:intergenic
TGATGTTTAAACTATTTAGG+TGG	0.641802	5_1:-17581015	Msa0721150:three_prime_UTR
GAAGTTCATTGCACTCCAAG+AGG	0.641830	5_1:+17583812	None:intergenic
GTATTGAGGTGGTGATGAAG+AGG	0.644898	5_1:+17581872	None:intergenic
AAAGAGTTGGTAACACAAAG+GGG	0.655511	5_1:-17579589	Msa0721150:three_prime_UTR
TGCATTGCATATGTACCACT+AGG	0.660656	5_1:+17580487	None:intergenic
TGTTATGGTGAATAGGAATG+AGG	0.664290	5_1:-17581333	Msa0721150:CDS
AGTGAATACGAATTTGTGAG+AGG	0.665978	5_1:+17581918	None:intergenic
GCTTGAGGAAGGAACTAGCA+AGG	0.666314	5_1:-17581603	Msa0721150:CDS
TATTGAGGTGGTGATGAAGA+GGG	0.674916	5_1:+17581873	None:intergenic
CAGCGTGAGTTAACTCACGT+GGG	0.689933	5_1:+17580670	None:intergenic
ATGCCTAAACGGTTGACACG+AGG	0.694851	5_1:-17580462	Msa0721150:three_prime_UTR
TATGTAAAATTAGTGCTGTG+TGG	0.696188	5_1:+17584350	None:intergenic
AGCGTGAGTTAACTCACGTG+GGG	0.708773	5_1:+17580671	None:intergenic
GAACCATATCCGTATAGACG+AGG	0.709030	5_1:-17582017	Msa0721150:CDS
AAAACTTAGACAAATCCTAG+TGG	0.714850	5_1:-17580502	Msa0721150:three_prime_UTR
GAACAATACATATAAATACG+GGG	0.738486	5_1:-17581078	Msa0721150:three_prime_UTR
CCCAAGGTACAATAACTGTG+GGG	0.763122	5_1:+17580026	None:intergenic

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content
!!!	AATTAAGATTTTTTGAAAAA+TGG	-	chr5_1:17579546-17579565	Msa0721150:three_prime_UTR	10.0%
!!!	TTGTTTTTTAAAATTACAAT+GGG	+	chr5_1:17580286-17580305	None:intergenic	10.0%
!!!	ATTGTTTTTTAAAATTACAA+TGG	+	chr5_1:17580287-17580306	None:intergenic	10.0%
!!!	TATTAAGCTATTTTTTTTTT+AGG	-	chr5_1:17580818-17580837	Msa0721150:three_prime_UTR	10.0%
!!!	ATTAAGCTATTTTTTTTTTA+GGG	-	chr5_1:17580819-17580838	Msa0721150:three_prime_UTR	10.0%
!!!	TATTTGTTGAATTAATTTTT+AGG	-	chr5_1:17581714-17581733	Msa0721150:CDS	10.0%
!!	TTATATATTGAATTAAATCT+TGG	+	chr5_1:17582622-17582641	None:intergenic	10.0%
!!	AAGATTTAATTCAATATATA+AGG	-	chr5_1:17582621-17582640	Msa0721150:intron	10.0%
!!!	AATATTGATTTCTTTTTTTA+GGG	+	chr5_1:17583863-17583882	None:intergenic	10.0%
!!!	AAATATTGATTTCTTTTTTT+AGG	+	chr5_1:17583864-17583883	None:intergenic	10.0%
!!	TATATCAAGAATTATGTATT+TGG	-	chr5_1:17580260-17580279	Msa0721150:three_prime_UTR	15.0%
!!!	GTTTTCTAAAAAAAACTATT+AGG	-	chr5_1:17581050-17581069	Msa0721150:three_prime_UTR	15.0%
!!	TTGAACAATACATATAAATA+CGG	-	chr5_1:17582770-17582789	Msa0721150:intron	15.0%
!!!	AGCAAAATTCATTATTTTAT+GGG	+	chr5_1:17582993-17583012	None:intergenic	15.0%
!!	TGAAGAAAAAAATACAAAAA+AGG	+	chr5_1:17583779-17583798	None:intergenic	15.0%
!!!	GAAAATAAGTTGCATTATTT+TGG	-	chr5_1:17579903-17579922	Msa0721150:three_prime_UTR	20.0%
!!!	ATTATTTTGGATGGAATATT+TGG	-	chr5_1:17579916-17579935	Msa0721150:three_prime_UTR	20.0%
!!	GATATATATATACCTCTAAT+GGG	+	chr5_1:17580063-17580082	None:intergenic	20.0%
!!	AGAATAAAATCAAGAGAATA+TGG	+	chr5_1:17580147-17580166	None:intergenic	20.0%
!!!	CTTCTTTAAACTTTTTAGTA+CGG	+	chr5_1:17580234-17580253	None:intergenic	20.0%
!!	AATAGCTTAATACTTTCATT+TGG	+	chr5_1:17580810-17580829	None:intergenic	20.0%
!!	GAGTGAACATTTAATAAATA+GGG	+	chr5_1:17580982-17581001	None:intergenic	20.0%
!!	TAAATGATAAACAAAAGTGA+TGG	+	chr5_1:17581004-17581023	None:intergenic	20.0%
!!!	TTTATCTTACCTATTTTAAG+AGG	-	chr5_1:17581020-17581039	Msa0721150:three_prime_UTR	20.0%
!!	TCTAAAAAAAACTATTAGGA+TGG	-	chr5_1:17581054-17581073	Msa0721150:three_prime_UTR	20.0%
!!	AACTATTTAGTGAAATGAAA+AGG	+	chr5_1:17581211-17581230	None:intergenic	20.0%
!!	TATTTAGTGAAATGAAAAGT+AGG	+	chr5_1:17581315-17581334	None:intergenic	20.0%
!!!	ATAGCAAAAAACAGTTTTTA+TGG	-	chr5_1:17582180-17582199	Msa0721150:intron	20.0%
!!!	TAGCAAAAAACAGTTTTTAT+GGG	-	chr5_1:17582181-17582200	Msa0721150:intron	20.0%
!!	TGAACAATACATATAAATAC+GGG	-	chr5_1:17582771-17582790	Msa0721150:intron	20.0%
!!	ATGTGATGTTTAAACTATTT+AGG	-	chr5_1:17582832-17582851	Msa0721150:intron	20.0%
!!!	GAGCAAAATTCATTATTTTA+TGG	+	chr5_1:17582994-17583013	None:intergenic	20.0%
!!!	GTAAAAATCGTTTTTTTACA+CGG	-	chr5_1:17583138-17583157	Msa0721150:intron	20.0%
!!	ATTAAAAAGCAAAAAGTCTT+GGG	+	chr5_1:17583282-17583301	None:intergenic	20.0%
!!!	TCGAAATTTTATTTTTTACG+TGG	-	chr5_1:17583951-17583970	Msa0721150:CDS	20.0%
!	GTGGAGTTATATATGTATTA+AGG	+	chr5_1:17579484-17579503	None:intergenic	25.0%
!	TACATATGCAAGAAAGTTAT+AGG	-	chr5_1:17579517-17579536	Msa0721150:three_prime_UTR	25.0%
!!!	ATAAGTTGCATTATTTTGGA+TGG	-	chr5_1:17579907-17579926	Msa0721150:three_prime_UTR	25.0%
!	GGATATATATATACCTCTAA+TGG	+	chr5_1:17580064-17580083	None:intergenic	25.0%
!!	TGAGTGAGTAATACATTTTT+GGG	+	chr5_1:17580348-17580367	None:intergenic	25.0%
!!	ATGAGTGAGTAATACATTTT+TGG	+	chr5_1:17580349-17580368	None:intergenic	25.0%
!!	TGTCCAAATTATTTCTTACA+TGG	-	chr5_1:17580476-17580495	Msa0721150:three_prime_UTR	25.0%
!!	GTCCAAATTATTTCTTACAT+GGG	-	chr5_1:17580477-17580496	Msa0721150:three_prime_UTR	25.0%
!	TTCCCATGTAAGAAATAATT+TGG	+	chr5_1:17580482-17580501	None:intergenic	25.0%
!	AAAACAATAGAGAGAGAAAA+AGG	-	chr5_1:17580586-17580605	Msa0721150:three_prime_UTR	25.0%
!	TAAAATATTTGACGAAGATG+CGG	-	chr5_1:17580711-17580730	Msa0721150:three_prime_UTR	25.0%
!	AATAGATAGATAGATAGACT+TGG	-	chr5_1:17580769-17580788	Msa0721150:three_prime_UTR	25.0%
!	GGAGTGAACATTTAATAAAT+AGG	+	chr5_1:17580983-17581002	None:intergenic	25.0%
!!!	ACTTGTTATCCTCTTAAAAT+AGG	+	chr5_1:17581032-17581051	None:intergenic	25.0%
!!!	CAAAAACGTTTAGAACTTTT+AGG	-	chr5_1:17581156-17581175	Msa0721150:three_prime_UTR	25.0%
!	ATTTAGTGAAATGAAAAGGT+TGG	+	chr5_1:17581207-17581226	None:intergenic	25.0%
!	AATGAAAAGTAGGTTCAAAA+TGG	+	chr5_1:17581305-17581324	None:intergenic	25.0%
!!	GATGGTTCAATTTTTGAATT+TGG	+	chr5_1:17581479-17581498	None:intergenic	25.0%
!	GTGTTTGTATCGAAATAATT+AGG	+	chr5_1:17581678-17581697	None:intergenic	25.0%
!!	ATTTGCTTTAAGTGATTGTT+TGG	+	chr5_1:17581871-17581890	None:intergenic	25.0%
!!!	ATGATTTTTTTGTGGTATTG+AGG	+	chr5_1:17581995-17582014	None:intergenic	25.0%
!!!	TGGAAATGATGATTTTTTTG+TGG	+	chr5_1:17582003-17582022	None:intergenic	25.0%
!	CTCTTAAAGAAAAAAGATGA+TGG	+	chr5_1:17582023-17582042	None:intergenic	25.0%
!	TAAGAGCAATTTATTCAAAG+TGG	-	chr5_1:17582037-17582056	Msa0721150:CDS	25.0%
!!	ACATATATAACCGATTTCAA+TGG	+	chr5_1:17582095-17582114	None:intergenic	25.0%
!!!	TCGGTTATATATGTTAGTTT+TGG	-	chr5_1:17582101-17582120	Msa0721150:CDS	25.0%
!!	ATTATTTCTTCTCTCTTCAT+TGG	+	chr5_1:17582137-17582156	None:intergenic	25.0%
!	GAGAAGAAATAATTGAGATT+TGG	-	chr5_1:17582144-17582163	Msa0721150:intron	25.0%
!!	ATTTGTTGATCAGCAAAATA+AGG	+	chr5_1:17582407-17582426	None:intergenic	25.0%
!	CTGATCAACAAATAAATAGT+AGG	-	chr5_1:17582414-17582433	Msa0721150:intron	25.0%
!	GAACAATACATATAAATACG+GGG	-	chr5_1:17582772-17582791	Msa0721150:intron	25.0%
!	ACATCTTTATTCAAAGCTTA+AGG	+	chr5_1:17582816-17582835	None:intergenic	25.0%
!	TGATGTTTAAACTATTTAGG+TGG	-	chr5_1:17582835-17582854	Msa0721150:intron	25.0%
!!	TCGAATGTATATTTCTAACA+TGG	-	chr5_1:17582951-17582970	Msa0721150:intron	25.0%
!	CATTAAAAAGCAAAAAGTCT+TGG	+	chr5_1:17583283-17583302	None:intergenic	25.0%
!	AAGCATATATCAGAAGATAA+GGG	-	chr5_1:17583532-17583551	Msa0721150:intron	25.0%
!	TCACACAAGTGTAAAAAAAA+CGG	-	chr5_1:17583587-17583606	Msa0721150:intron	25.0%
!	AAATACAAAAAAGGACAACA+TGG	+	chr5_1:17583770-17583789	None:intergenic	25.0%
!!!	TTTTTTAGGGTCAAAATTGT+AGG	+	chr5_1:17583850-17583869	None:intergenic	25.0%
!!	GAACAAATCTGGAAATTTTA+TGG	-	chr5_1:17583914-17583933	Msa0721150:CDS	25.0%
!!!	TGAAAGATATTTTGAGATGT+TGG	-	chr5_1:17583979-17583998	Msa0721150:CDS	25.0%
	TATGTAAAATTAGTGCTGTG+TGG	+	chr5_1:17579503-17579522	None:intergenic	30.0%
	AAAAATGGAAACACAACCTA+AGG	-	chr5_1:17579561-17579580	Msa0721150:three_prime_UTR	30.0%
!	TGTGAAGAAGATTTTTCCTT+AGG	+	chr5_1:17579580-17579599	None:intergenic	30.0%
!	GCTTTAGCATTGAATTTACA+TGG	+	chr5_1:17579633-17579652	None:intergenic	30.0%
!	TAGTCTTGAATTGAAGCTTA+GGG	+	chr5_1:17579768-17579787	None:intergenic	30.0%
!	ATAGTCTTGAATTGAAGCTT+AGG	+	chr5_1:17579769-17579788	None:intergenic	30.0%
!!!	TATTAGTTCTTGCTGCTTTT+GGG	-	chr5_1:17579996-17580015	Msa0721150:three_prime_UTR	30.0%
	TTGGGTCATGCTATTAAAAA+AGG	+	chr5_1:17580330-17580349	None:intergenic	30.0%
	ATACTAAACCTTGTGAATAC+AGG	+	chr5_1:17580388-17580407	None:intergenic	30.0%
	AAGGTTTAGTATATACCATG+AGG	-	chr5_1:17580396-17580415	Msa0721150:three_prime_UTR	30.0%
	AGGTTTAGTATATACCATGA+GGG	-	chr5_1:17580397-17580416	Msa0721150:three_prime_UTR	30.0%
	GTCAACAAAGTTGTCATAAA+TGG	+	chr5_1:17580536-17580555	None:intergenic	30.0%
!	TTCATTTTCTCTCTTCTCAT+TGG	-	chr5_1:17580560-17580579	Msa0721150:three_prime_UTR	30.0%
	AAAAAGGAAGAGAGAGAATA+TGG	-	chr5_1:17580602-17580621	Msa0721150:three_prime_UTR	30.0%
	GTCAAAAAGTTGTAAGAAAG+TGG	-	chr5_1:17580653-17580672	Msa0721150:three_prime_UTR	30.0%
	ATTTGCAAATAGCAATTGCT+AGG	-	chr5_1:17580737-17580756	Msa0721150:three_prime_UTR	30.0%
	TTCAAGTGTGTTTGTATACA+TGG	-	chr5_1:17581274-17581293	Msa0721150:CDS	30.0%
	AAAAGTAGGTTCAAAATGGA+CGG	+	chr5_1:17581301-17581320	None:intergenic	30.0%
	TTCAAGTGTGTTTGTATACA+TGG	-	chr5_1:17581274-17581293	Msa0721150:CDS	30.0%
!!	ATCGTGCGATTTTAATAAGA+TGG	+	chr5_1:17581497-17581516	None:intergenic	30.0%
!!	GAATTAATTTTTAGGAGACG+AGG	-	chr5_1:17581722-17581741	Msa0721150:CDS	30.0%
!	TTGTTTTCTCGACAAAAACT+TGG	+	chr5_1:17581810-17581829	None:intergenic	30.0%
!!!	ATTTTTTTGTGGTATTGAGG+TGG	+	chr5_1:17581992-17582011	None:intergenic	30.0%
	GAAATAATTGAGATTTGGCA+TGG	-	chr5_1:17582149-17582168	Msa0721150:intron	30.0%
!	AACAGTTTTTATGGGTGATT+AGG	-	chr5_1:17582189-17582208	Msa0721150:intron	30.0%
	TCAAACATGGTACAAGAAAA+AGG	-	chr5_1:17582212-17582231	Msa0721150:intron	30.0%
!!!	GTGCTTTTTTGACACATAAT+GGG	-	chr5_1:17582330-17582349	Msa0721150:intron	30.0%
	AAATAAGGCCAACAAATCAT+AGG	+	chr5_1:17582392-17582411	None:intergenic	30.0%
	ATATGAAGGATGTTTGTGAT+AGG	-	chr5_1:17582468-17582487	Msa0721150:intron	30.0%
	GAATATGGTGAATGATGTTA+TGG	-	chr5_1:17582502-17582521	Msa0721150:intron	30.0%
	TGAATGATGTTATGGTGAAT+AGG	-	chr5_1:17582510-17582529	Msa0721150:intron	30.0%
	TAAATCTTGGAAGTTGTTGT+AGG	+	chr5_1:17582609-17582628	None:intergenic	30.0%
	TCTACTATCCCGTAAAATAA+GGG	-	chr5_1:17582644-17582663	Msa0721150:intron	30.0%
!!!	AAAGCAATGCCCTTATTTTA+CGG	+	chr5_1:17582656-17582675	None:intergenic	30.0%
!!	AAGAGATGTTTTTACTAGTG+AGG	+	chr5_1:17582686-17582705	None:intergenic	30.0%
!	AATAGTTTGTGTAAATGTCG+AGG	+	chr5_1:17582891-17582910	None:intergenic	30.0%
	AAAACTTAGACAAATCCTAG+TGG	-	chr5_1:17583348-17583367	Msa0721150:intron	30.0%
	AGTAGTAATTTCTTTCCAAG+TGG	-	chr5_1:17583451-17583470	Msa0721150:intron	30.0%
	GAAGCATATATCAGAAGATA+AGG	-	chr5_1:17583531-17583550	Msa0721150:intron	30.0%
!!!	AACTAACGTAAGAGCATTTT+TGG	-	chr5_1:17583680-17583699	Msa0721150:intron	30.0%
!	CAAATCTGGAAATTTTATGG+AGG	-	chr5_1:17583917-17583936	Msa0721150:CDS	30.0%
!	GGAGTTAAAAGTATAAGTGT+AGG	-	chr5_1:17584012-17584031	Msa0721150:CDS	30.0%
!	AAGTATAAGTGTAGGCATTT+TGG	-	chr5_1:17584020-17584039	Msa0721150:CDS	30.0%
!	AGTATAAGTGTAGGCATTTT+GGG	-	chr5_1:17584021-17584040	Msa0721150:CDS	30.0%
!!	TTTGGGTTGTAACTCAATAT+AGG	-	chr5_1:17584038-17584057	Msa0721150:CDS	30.0%
!	AAGAGTTGGTTAGACAAAAA+AGG	-	chr5_1:17584131-17584150	Msa0721150:CDS	30.0%
!!	AAGAAGTTGGTAAGACAAAA+TGG	-	chr5_1:17584323-17584342	Msa0721150:five_prime_UTR	30.0%
!!	TAGTTGATGAGAAACAAATG+AGG	-	chr5_1:17584379-17584398	Msa0721150:five_prime_UTR	30.0%
!!	TATGAATGTATTCGGTGTTG+AGG	+	chr5_1:17579696-17579715	None:intergenic	35.0%
	GAGTCGGTTATGAATGTATT+CGG	+	chr5_1:17579704-17579723	None:intergenic	35.0%
	CATCGTTGAATTGAATGAGT+CGG	+	chr5_1:17579720-17579739	None:intergenic	35.0%
!	ATTGTGTCACTGAGTTTGTA+TGG	-	chr5_1:17579847-17579866	Msa0721150:three_prime_UTR	35.0%
!!!	CTATTAGTTCTTGCTGCTTT+TGG	-	chr5_1:17579995-17580014	Msa0721150:three_prime_UTR	35.0%
!!	CTCTAAGAGCAATTTTAGAG+TGG	+	chr5_1:17580085-17580104	None:intergenic	35.0%
	GAATACAGGTGTGAAAAAAG+TGG	+	chr5_1:17580374-17580393	None:intergenic	35.0%
!	TTTTCACACCTGTATTCACA+AGG	-	chr5_1:17580377-17580396	Msa0721150:three_prime_UTR	35.0%
	ACATGGACGGATATAACATA+AGG	-	chr5_1:17580431-17580450	Msa0721150:three_prime_UTR	35.0%
!	CGGATCGATGACTAAATTTT+TGG	+	chr5_1:17580929-17580948	None:intergenic	35.0%
	CGCAAATAATTACCTACAAC+GGG	+	chr5_1:17580959-17580978	None:intergenic	35.0%
	GCGCAAATAATTACCTACAA+CGG	+	chr5_1:17580960-17580979	None:intergenic	35.0%
	AACTGTTCGTTCAAAATGGA+CGG	+	chr5_1:17581440-17581459	None:intergenic	35.0%
	TGTGAACTGTTCGTTCAAAA+TGG	+	chr5_1:17581444-17581463	None:intergenic	35.0%
	TAAGGTCTAGTGTGTGTATA+TGG	+	chr5_1:17581566-17581585	None:intergenic	35.0%
	AGAAACATGCCAAGTGAATA+AGG	+	chr5_1:17581584-17581603	None:intergenic	35.0%
	ACTCATACTCAACACATTTG+AGG	-	chr5_1:17581893-17581912	Msa0721150:CDS	35.0%
	AGTGAATACGAATTTGTGAG+AGG	+	chr5_1:17581935-17581954	None:intergenic	35.0%
	TGACTCTCAACCATTGAAAT+CGG	-	chr5_1:17582082-17582101	Msa0721150:CDS	35.0%
	AGGATTATTAAGTGAGCTTG+AGG	-	chr5_1:17582232-17582251	Msa0721150:intron	35.0%
	TTATTAAGTGAGCTTGAGGA+AGG	-	chr5_1:17582236-17582255	Msa0721150:intron	35.0%
	AAGGAACTAGCAAGGATAAA+GGG	-	chr5_1:17582255-17582274	Msa0721150:intron	35.0%
!	AAGGATAAAGGGTTGATTGT+TGG	-	chr5_1:17582266-17582285	Msa0721150:intron	35.0%
!	ATAAAGGGTTGATTGTTGGA+TGG	-	chr5_1:17582270-17582289	Msa0721150:intron	35.0%
!	TAAAGGGTTGATTGTTGGAT+GGG	-	chr5_1:17582271-17582290	Msa0721150:intron	35.0%
!!	AGAGGAAGTTTTGTCACATA+AGG	-	chr5_1:17582301-17582320	Msa0721150:intron	35.0%
!	GTTTTGTCACATAAGGCAAT+TGG	-	chr5_1:17582308-17582327	Msa0721150:intron	35.0%
!!!	GGTGCTTTTTTGACACATAA+TGG	-	chr5_1:17582329-17582348	Msa0721150:intron	35.0%
!!!	CTTTTTTGACACATAATGGG+TGG	-	chr5_1:17582333-17582352	Msa0721150:intron	35.0%
!	TAATGGGTGGAATTCAACTT+TGG	-	chr5_1:17582346-17582365	Msa0721150:intron	35.0%
!	GAATTCAACTTTGGAAAGTG+TGG	-	chr5_1:17582355-17582374	Msa0721150:intron	35.0%
	AAATAGTAGGTTTGTGAGTG+AGG	-	chr5_1:17582427-17582446	Msa0721150:intron	35.0%
	TGTTTGTGATAGGAAAGTTG+TGG	-	chr5_1:17582478-17582497	Msa0721150:intron	35.0%
	TAGGAAAGTTGTGGAGAATA+TGG	-	chr5_1:17582487-17582506	Msa0721150:intron	35.0%
	TGTTATGGTGAATAGGAATG+AGG	-	chr5_1:17582517-17582536	Msa0721150:intron	35.0%
	TGTAAAATCAGCCATGGATA+TGG	-	chr5_1:17582544-17582563	Msa0721150:intron	35.0%
	GTCTACTATCCCGTAAAATA+AGG	-	chr5_1:17582643-17582662	Msa0721150:intron	35.0%
!!!	AAGCAATGCCCTTATTTTAC+GGG	+	chr5_1:17582655-17582674	None:intergenic	35.0%
!!	ATGTTTTTACTAGTGAGGCA+TGG	+	chr5_1:17582681-17582700	None:intergenic	35.0%
	TCACATTGAACCAAAATTCG+AGG	-	chr5_1:17582746-17582765	Msa0721150:intron	35.0%
	CACATTGAACCAAAATTCGA+GGG	-	chr5_1:17582747-17582766	Msa0721150:intron	35.0%
!	ATTGTTCAACCCTCGAATTT+TGG	+	chr5_1:17582759-17582778	None:intergenic	35.0%
!!!	CTGGGTTTCGTCTTTTTTTT+CGG	-	chr5_1:17583200-17583219	Msa0721150:intron	35.0%
!!!	TTTTTTTTCGGTTACACGCT+GGG	-	chr5_1:17583212-17583231	Msa0721150:intron	35.0%
	AAAAGCAAAAAGTCTTGGGA+TGG	+	chr5_1:17583278-17583297	None:intergenic	35.0%
	TGCAATGCATTATGCCTAAA+CGG	-	chr5_1:17583377-17583396	Msa0721150:intron	35.0%
!	GGAAATTTTATGGAGGTTTG+TGG	-	chr5_1:17583924-17583943	Msa0721150:CDS	35.0%
	TCTTTCAATTTCACGATGAG+TGG	+	chr5_1:17584115-17584134	None:intergenic	35.0%
	CATCGTGAAATTGAAAGAGT+TGG	-	chr5_1:17584117-17584136	Msa0721150:CDS	35.0%
	CTTCGTGAAATCAAAGTTGT+TGG	-	chr5_1:17584183-17584202	Msa0721150:CDS	35.0%
!	AAGTTGTTGGTTAGACTAAG+AGG	-	chr5_1:17584196-17584215	Msa0721150:CDS	35.0%
	TCTTTCGATTTCACGAAGAA+TGG	+	chr5_1:17584246-17584265	None:intergenic	35.0%
!!	GAAAGAGTTGGTAACACAAA+GGG	-	chr5_1:17584260-17584279	Msa0721150:CDS	35.0%
!!	AAAGAGTTGGTAACACAAAG+GGG	-	chr5_1:17584261-17584280	Msa0721150:CDS	35.0%
	AACTTCTTCGTTACGAAGAA+TGG	+	chr5_1:17584311-17584330	None:intergenic	35.0%
	ATTCTTCGTAACGAAGAAGT+TGG	-	chr5_1:17584310-17584329	Msa0721150:five_prime_UTR	35.0%
	TCATCAACTAAACTCGATCT+AGG	+	chr5_1:17584369-17584388	None:intergenic	35.0%
	TTTCTGTGTTCCAAACCTCT+TGG	-	chr5_1:17580023-17580042	Msa0721150:three_prime_UTR	40.0%
	TGCAATGAACTTCCCATTAG+AGG	-	chr5_1:17580048-17580067	Msa0721150:three_prime_UTR	40.0%
	GACGGATATAACATAAGGTG+TGG	-	chr5_1:17580436-17580455	Msa0721150:three_prime_UTR	40.0%
	TAATTACCTACAACGGGTCA+GGG	+	chr5_1:17580953-17580972	None:intergenic	40.0%
	ATAATTACCTACAACGGGTC+AGG	+	chr5_1:17580954-17580973	None:intergenic	40.0%
	TTGTGTCTGTCGTCCATTTA+GGG	-	chr5_1:17581179-17581198	Msa0721150:three_prime_UTR	40.0%
	CACACTAGACCTTATTCACT+TGG	-	chr5_1:17581572-17581591	Msa0721150:CDS	40.0%
!!	ATTTTTAGGAGACGAGGACA+TGG	-	chr5_1:17581728-17581747	Msa0721150:CDS	40.0%
	CGCATCATAACAAACATTCC+AGG	-	chr5_1:17581753-17581772	Msa0721150:CDS	40.0%
	CATAACAAACATTCCAGGCA+TGG	-	chr5_1:17581758-17581777	Msa0721150:CDS	40.0%
	GAAGTACAACCTCGTCTATA+CGG	+	chr5_1:17581845-17581864	None:intergenic	40.0%
	TTCCCTAAACTCTACACCAT+AGG	-	chr5_1:17581954-17581973	Msa0721150:CDS	40.0%
!	TATTGAGGTGGTGATGAAGA+GGG	+	chr5_1:17581980-17581999	None:intergenic	40.0%
	ATGGGTGATTAGGTCAAACA+TGG	-	chr5_1:17582199-17582218	Msa0721150:intron	40.0%
	GAAGGAACTAGCAAGGATAA+AGG	-	chr5_1:17582254-17582273	Msa0721150:intron	40.0%
	GTGACAAAACTTCCTCTTGT+GGG	+	chr5_1:17582298-17582317	None:intergenic	40.0%
	TGTGACAAAACTTCCTCTTG+TGG	+	chr5_1:17582299-17582318	None:intergenic	40.0%
!	ACTTTGGAAAGTGTGGTTTG+TGG	-	chr5_1:17582362-17582381	Msa0721150:intron	40.0%
	TGAGTGAGGTTTGGAAACTT+GGG	-	chr5_1:17582441-17582460	Msa0721150:intron	40.0%
!!	GAAACTTGGGTTGGATATGA+AGG	-	chr5_1:17582454-17582473	Msa0721150:intron	40.0%
	GGAGTTTGTAAAATCAGCCA+TGG	-	chr5_1:17582538-17582557	Msa0721150:intron	40.0%
	ATCTTGGAAGTTGTTGTAGG+AGG	+	chr5_1:17582606-17582625	None:intergenic	40.0%
	ATTTAGGTGGTTGCTTCTCT+TGG	-	chr5_1:17582848-17582867	Msa0721150:intron	40.0%
	GTTGCTTCTCTTGGTCAAAT+TGG	-	chr5_1:17582857-17582876	Msa0721150:intron	40.0%
!!	ACTATTCTGAAGCACGTAGT+TGG	-	chr5_1:17582905-17582924	Msa0721150:intron	40.0%
!	AACTTGCGCAAGGGTATATT+TGG	+	chr5_1:17583054-17583073	None:intergenic	40.0%
!!!	CTTTTTTTTCGGTTACACGC+TGG	-	chr5_1:17583211-17583230	Msa0721150:intron	40.0%
	TGCATTGCATATGTACCACT+AGG	+	chr5_1:17583366-17583385	None:intergenic	40.0%
	TTACAACATGCAATGCCACT+TGG	+	chr5_1:17583469-17583488	None:intergenic	40.0%
	CATCATCATGTTGTTCCAAG+CGG	-	chr5_1:17583503-17583522	Msa0721150:intron	40.0%
!!!	AGCATTTTTGGTATGTCTGC+AGG	-	chr5_1:17583692-17583711	Msa0721150:intron	40.0%
!!!	GCATTTTTGGTATGTCTGCA+GGG	-	chr5_1:17583693-17583712	Msa0721150:intron	40.0%
	GCGCAGAAATAGAACAAATC+TGG	-	chr5_1:17583903-17583922	Msa0721150:CDS	40.0%
!	TGAGATGTTGGCAGTGTTTT+TGG	-	chr5_1:17583991-17584010	Msa0721150:CDS	40.0%
	CTTCGTGAAATCGAAAGAGT+TGG	-	chr5_1:17584248-17584267	Msa0721150:CDS	40.0%
!!	CGAAAGAGTTGGTAACACAA+AGG	-	chr5_1:17584259-17584278	Msa0721150:CDS	40.0%
	CAACTAAACTCGATCTAGGA+AGG	+	chr5_1:17584365-17584384	None:intergenic	40.0%
!!	GAATTTACATGGCCTTGTGC+TGG	+	chr5_1:17579622-17579641	None:intergenic	45.0%
!!	CATAGTGAAGAGAAGCATCC+TGG	-	chr5_1:17579799-17579818	Msa0721150:intron	45.0%
!!	GAAGAGAAGCATCCTGGATT+TGG	-	chr5_1:17579805-17579824	Msa0721150:three_prime_UTR	45.0%
	AGCATCCTGGATTTGGAGAA+AGG	-	chr5_1:17579812-17579831	Msa0721150:three_prime_UTR	45.0%
	CCTATCCTTTCTCCAAATCC+AGG	+	chr5_1:17579820-17579839	None:intergenic	45.0%
	CCTGGATTTGGAGAAAGGAT+AGG	-	chr5_1:17579817-17579836	Msa0721150:three_prime_UTR	45.0%
!	TGGTGACCTTGCTACTGATT+TGG	-	chr5_1:17579936-17579955	Msa0721150:three_prime_UTR	45.0%
!!	ACTGATTTGGCTGCTGAGTT+TGG	-	chr5_1:17579949-17579968	Msa0721150:three_prime_UTR	45.0%
!!	CTGATTTGGCTGCTGAGTTT+GGG	-	chr5_1:17579950-17579969	Msa0721150:three_prime_UTR	45.0%
	TCATTGCACTCCAAGAGGTT+TGG	+	chr5_1:17580036-17580055	None:intergenic	45.0%
	GAAGTTCATTGCACTCCAAG+AGG	+	chr5_1:17580041-17580060	None:intergenic	45.0%
	TGTTTGTAGCTACTCCCTCA+TGG	+	chr5_1:17580414-17580433	None:intergenic	45.0%
	TGAGGGAGTAGCTACAAACA+TGG	-	chr5_1:17580414-17580433	Msa0721150:three_prime_UTR	45.0%
	GGAGTAGCTACAAACATGGA+CGG	-	chr5_1:17580418-17580437	Msa0721150:three_prime_UTR	45.0%
	AATTACCTACAACGGGTCAG+GGG	+	chr5_1:17580952-17580971	None:intergenic	45.0%
	GTTGTGTCTGTCGTCCATTT+AGG	-	chr5_1:17581178-17581197	Msa0721150:three_prime_UTR	45.0%
!	GAAAAGGTTGGCTCCCTAAA+TGG	+	chr5_1:17581195-17581214	None:intergenic	45.0%
	GAACCATATCCGTATAGACG+AGG	-	chr5_1:17581833-17581852	Msa0721150:CDS	45.0%
	CAACCTCGTCTATACGGATA+TGG	+	chr5_1:17581839-17581858	None:intergenic	45.0%
	ACGAATTTGTGAGAGGACTG+AGG	+	chr5_1:17581928-17581947	None:intergenic	45.0%
	GGCCTATGGTGTAGAGTTTA+GGG	+	chr5_1:17581959-17581978	None:intergenic	45.0%
!	GTATTGAGGTGGTGATGAAG+AGG	+	chr5_1:17581981-17582000	None:intergenic	45.0%
	CAAAGTGGATAGAACCTGCA+TGG	-	chr5_1:17582052-17582071	Msa0721150:CDS	45.0%
!	GTGGTGTGCCTATGATTTGT+TGG	-	chr5_1:17582381-17582400	Msa0721150:intron	45.0%
	GTAGGTTTGTGAGTGAGGTT+TGG	-	chr5_1:17582432-17582451	Msa0721150:intron	45.0%
	GTGAGTGAGGTTTGGAAACT+TGG	-	chr5_1:17582440-17582459	Msa0721150:intron	45.0%
	TGAGGTTTGGAAACTTGGGT+TGG	-	chr5_1:17582445-17582464	Msa0721150:intron	45.0%
	AGCCATGGATATGGCTAAGT+TGG	-	chr5_1:17582553-17582572	Msa0721150:intron	45.0%
	TGCCAACTTAGCCATATCCA+TGG	+	chr5_1:17582558-17582577	None:intergenic	45.0%
!	GTATATTTGGAACGGCTGCA+GGG	+	chr5_1:17583041-17583060	None:intergenic	45.0%
!	GCGCAAGGGTATATTTGGAA+CGG	+	chr5_1:17583049-17583068	None:intergenic	45.0%
!!	GCGTTAGTTAACTTGCGCAA+GGG	+	chr5_1:17583063-17583082	None:intergenic	45.0%
!!	TGCGTTAGTTAACTTGCGCA+AGG	+	chr5_1:17583064-17583083	None:intergenic	45.0%
	TTTCCTCGTGTCAACCGTTT+AGG	+	chr5_1:17583394-17583413	None:intergenic	45.0%
	TAAACGGTTGACACGAGGAA+AGG	-	chr5_1:17583393-17583412	Msa0721150:intron	45.0%
	TGTGGGGTATGAGAATCTTC+TGG	+	chr5_1:17583811-17583830	None:intergenic	45.0%
	ACCCCACAGTTATTGTACCT+TGG	-	chr5_1:17583823-17583842	Msa0721150:CDS	45.0%
	CCCAAGGTACAATAACTGTG+GGG	+	chr5_1:17583827-17583846	None:intergenic	45.0%
	CCCCACAGTTATTGTACCTT+GGG	-	chr5_1:17583824-17583843	Msa0721150:CDS	45.0%
	GCCCAAGGTACAATAACTGT+GGG	+	chr5_1:17583828-17583847	None:intergenic	45.0%
	AGGGGATAAGCTGAGATTCA+TGG	-	chr5_1:17584279-17584298	Msa0721150:CDS	45.0%
!!	TATATAATCATTAATATTAT+TGG	-	chr5_1:17580871-17580890	Msa0721150:three_prime_UTR	5.0%
	ATCTTCCCATGTCCAGCACA+AGG	-	chr5_1:17579607-17579626	Msa0721150:three_prime_UTR	50.0%
	CAGCAGCCAAATCAGTAGCA+AGG	+	chr5_1:17579945-17579964	None:intergenic	50.0%
	CGAAGTAAGTTTGCCATGCC+TGG	+	chr5_1:17581774-17581793	None:intergenic	50.0%
	GGGCCTATGGTGTAGAGTTT+AGG	+	chr5_1:17581960-17581979	None:intergenic	50.0%
	GCTTGAGGAAGGAACTAGCA+AGG	-	chr5_1:17582247-17582266	Msa0721150:intron	50.0%
	TTGTTGTAGGAGGAACCACC+AGG	+	chr5_1:17582596-17582615	None:intergenic	50.0%
!	GGTATATTTGGAACGGCTGC+AGG	+	chr5_1:17583042-17583061	None:intergenic	50.0%
	AGCGTGAGTTAACTCACGTG+GGG	+	chr5_1:17583182-17583201	None:intergenic	50.0%
	CAGCGTGAGTTAACTCACGT+GGG	+	chr5_1:17583183-17583202	None:intergenic	50.0%
	CACGTGAGTTAACTCACGCT+GGG	-	chr5_1:17583182-17583201	Msa0721150:intron	50.0%
	ATGCCTAAACGGTTGACACG+AGG	-	chr5_1:17583388-17583407	Msa0721150:intron	50.0%
	TATATGCTTCAGCTGCCGCT+TGG	+	chr5_1:17583521-17583540	None:intergenic	50.0%
	GGCCCAAGGTACAATAACTG+TGG	+	chr5_1:17583829-17583848	None:intergenic	50.0%
	GGGTCAAAATTGTAGGCCCA+AGG	+	chr5_1:17583843-17583862	None:intergenic	50.0%
!!	TCACGATGAGTGGTGTCGAT+CGG	+	chr5_1:17584105-17584124	None:intergenic	50.0%
!!	CATGGCCTTGTGCTGGACAT+GGG	+	chr5_1:17579615-17579634	None:intergenic	55.0%
!!	ACATGGCCTTGTGCTGGACA+TGG	+	chr5_1:17579616-17579635	None:intergenic	55.0%
!	GTGGTGATGAAGAGGGCCTA+TGG	+	chr5_1:17581973-17581992	None:intergenic	55.0%
	TGGATAGAACCTGCATGGCG+TGG	-	chr5_1:17582057-17582076	Msa0721150:CDS	55.0%
	TGTTGGATGGGTCCCACAAG+AGG	-	chr5_1:17582283-17582302	Msa0721150:intron	55.0%
!	GCATCCAAGAGTGTGAGTCC+TGG	-	chr5_1:17582575-17582594	Msa0721150:intron	55.0%
!	TCCAAGAGTGTGAGTCCTGG+TGG	-	chr5_1:17582578-17582597	Msa0721150:intron	55.0%
	ACCACCAGGACTCACACTCT+TGG	+	chr5_1:17582582-17582601	None:intergenic	55.0%
	CCAGCGTGAGTTAACTCACG+TGG	+	chr5_1:17583184-17583203	None:intergenic	55.0%
	CCACGTGAGTTAACTCACGC+TGG	-	chr5_1:17583181-17583200	Msa0721150:intron	55.0%
	GGGCGCGAGCGAAAAATACA+AGG	-	chr5_1:17583713-17583732	Msa0721150:intron	55.0%
!!	CACGATGAGTGGTGTCGATC+GGG	+	chr5_1:17584104-17584123	None:intergenic	55.0%
!!	CACGAAGAATGGCGTCGATC+AGG	+	chr5_1:17584235-17584254	None:intergenic	55.0%
	TACCTACAACGGGTCAGGGG+CGG	+	chr5_1:17580949-17580968	None:intergenic	60.0%
	AGAGTCAAGCCACGCCATGC+AGG	+	chr5_1:17582069-17582088	None:intergenic	60.0%
	ATCCGCCCCTGACCCGTTGT+AGG	-	chr5_1:17580944-17580963	Msa0721150:three_prime_UTR	65.0%

Chromosome	Type	Strat	End	Strand	Name
chr5_1	gene	17579457	17584415	17579457	ID=Msa0721150;Name=Msa0721150
chr5_1	mRNA	17579457	17584415	17579457	ID=Msa0721150-mRNA-1;Parent=Msa0721150;Name=Msa0721150-mRNA-1;_AED=0.05;_eAED=0.05;_QI=108\|1\|1\|1\|0.5\|0.33\|3\|1713\|475
chr5_1	exon	17579457	17579759	17579457	ID=Msa0721150-mRNA-1:exon:6673;Parent=Msa0721150-mRNA-1
chr5_1	exon	17579804	17582136	17579804	ID=Msa0721150-mRNA-1:exon:6672;Parent=Msa0721150-mRNA-1
chr5_1	exon	17583803	17584415	17583803	ID=Msa0721150-mRNA-1:exon:6671;Parent=Msa0721150-mRNA-1
chr5_1	five_prime_UTR	17584308	17584415	17584308	ID=Msa0721150-mRNA-1:five_prime_utr;Parent=Msa0721150-mRNA-1
chr5_1	CDS	17583803	17584307	17583803	ID=Msa0721150-mRNA-1:cds;Parent=Msa0721150-mRNA-1
chr5_1	CDS	17581214	17582136	17581214	ID=Msa0721150-mRNA-1:cds;Parent=Msa0721150-mRNA-1
chr5_1	three_prime_UTR	17579804	17581213	17579804	ID=Msa0721150-mRNA-1:three_prime_utr;Parent=Msa0721150-mRNA-1
chr5_1	three_prime_UTR	17579457	17579759	17579457	ID=Msa0721150-mRNA-1:three_prime_utr;Parent=Msa0721150-mRNA-1

Gene Sequence

>Msa0721150

ATGGAAACACAACCTAAGGAAAAATCTTCTTCACATGTGCTAATCTTCCCATGTCCAGCACAAGGCCATGTAAATTCAATGCTAAAGCTAGCTGAACTTCTTGCAATTCAACACATCTGCATAACTTTCCTCAACACCGAATACATTCATAACCGACTCATTCAATTCAACGATGATATTCAAGCTCTTTTAGAATGTTACCCTAAGCTTCAATTCAAGACTATCTCTGATTTTCATAGTGAAGAGAAGCATCCTGGATTTGGAGAAAGGATAGGTGATGTAATTGTGTCACTGAGTTTGTATGGTAAGTCTTTTTTGAGAGATATAATTGTCTCTGAGAAAATAAGTTGCATTATTTTGGATGGAATATTTGGTGACCTTGCTACTGATTTGGCTGCTGAGTTTGGGATACAATTGATTCATTTTCGTACTATTAGTTCTTGCTGCTTTTGGGCTTATTTCTGTGTTCCAAACCTCTTGGAGTGCAATGAACTTCCCATTAGAGGAGACGAGGACATGGATCGCATCATAACAAACATTCCAGGCATGGCAAACTTACTTCGATGTAGAGATCTTCCAAGTTTTTGTCGAGAAAACAAAAAGAACCATATCCGTATAGACGAGGTTGTACTTCGAACCAAACAATCACTTAAAGCAAATGCACTCATACTCAACACATTTGAGGATCTAGAAGCCTCAGTCCTCTCACAAATTCGTATTCACTTCCCTAAACTCTACACCATAGGCCCTCTTCATCACCACCTCAATACCACAAAAAAATCATCATTTCCATCATCTTTTTTCTTTAAGAGCAATTTATTCAAAGTGGATAGAACCTGCATGGCGTGGCTTGACTCTCAACCATTGAAATCGGTTATATATGTTAGTTTTGGAAGCACTACACCAATGAAGAGAGAAGAAATAATTGAGATTTGGCATGGTTTATTGAATAGCAAAAAACAGTTTTTATGGGTGATTAGGTCAAACATGGTACAAGAAAAAGGATTATTAAGTGAGCTTGAGGAAGGAACTAGCAAGGATAAAGGGTTGATTGTTGGATGGGTCCCACAAGAGGAAGTTTTGTCACATAAGGCAATTGGTGCTTTTTTGACACATAATGGGTGGAATTCAACTTTGGAAAGTGTGGTTTGTGGTGTGCCTATGATTTGTTGGCCTTATTTTGCTGATCAACAAATAAATAGTAGGTTTGTGAGTGAGGTTTGGAAACTTGGGTTGGATATGAAGGATGTTTGTGATAGGAAAGTTGTGGAGAATATGGTGAATGATGTTATGGTGAATAGGAATGAGGAGTTTGTAAAATCAGCCATGGATATGGCTAAGTTGGCATCCAAGAGTGTGAGTCCTGGTGGTTCCTCCTACAACAACTTCCAAGATTTAATTCAATATATAAGGTCTACTATCCCGTAA

Protein sequence

>Msa0721150

METQPKEKSSSHVLIFPCPAQGHVNSMLKLAELLAIQHICITFLNTEYIHNRLIQFNDDIQALLECYPKLQFKTISDFHSEEKHPGFGERIGDVIVSLSLYGKSFLRDIIVSEKISCIILDGIFGDLATDLAAEFGIQLIHFRTISSCCFWAYFCVPNLLECNELPIRGDEDMDRIITNIPGMANLLRCRDLPSFCRENKKNHIRIDEVVLRTKQSLKANALILNTFEDLEASVLSQIRIHFPKLYTIGPLHHHLNTTKKSSFPSSFFFKSNLFKVDRTCMAWLDSQPLKSVIYVSFGSTTPMKREEIIEIWHGLLNSKKQFLWVIRSNMVQEKGLLSELEEGTSKDKGLIVGWVPQEEVLSHKAIGAFLTHNGWNSTLESVVCGVPMICWPYFADQQINSRFVSEVWKLGLDMKDVCDRKVVENMVNDVMVNRNEEFVKSAMDMAKLASKSVSPGGSSYNNFQDLIQYIRSTIP*