Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049019.01.T01 | XP_003618753.2 | 94.737 | 285 | 8 | 3 | 1 | 285 | 1 | 278 | 0 | 524 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049019.01.T01 | G7KMT1 | 94.737 | 285 | 8 | 3 | 1 | 285 | 1 | 278 | 0.0 | 524 |
Gene ID | Type | Classification |
---|
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsG0080047831.01 | MsG0080049019.01 | -0.814966 | 1.176773e-51 | 8.009235e-49 |
MsG0080047967.01 | MsG0080049019.01 | 0.853305 | 2.609459e-61 | 5.612642e-58 |
MsG0080048059.01 | MsG0080049019.01 | 0.877882 | 4.399260e-69 | 2.249199e-65 |
MsG0080048691.01 | MsG0080049019.01 | 0.803507 | 3.373212e-49 | 1.698179e-46 |
MsG0080048694.01 | MsG0080049019.01 | 0.871665 | 5.746175e-67 | 2.337151e-63 |
MsG0080048695.01 | MsG0080049019.01 | 0.871732 | 5.460690e-67 | 2.226297e-63 |
MsG0080048697.01 | MsG0080049019.01 | 0.843581 | 1.283390e-58 | 2.017159e-55 |
MsG0080048800.01 | MsG0080049019.01 | 0.835992 | 1.214587e-56 | 1.510223e-53 |
MsG0080048813.01 | MsG0080049019.01 | 0.817894 | 2.602466e-52 | 1.919054e-49 |
MsG0080048887.01 | MsG0080049019.01 | 0.843742 | 1.162089e-58 | 1.835634e-55 |
MsG0080048889.01 | MsG0080049019.01 | -0.839213 | 1.812912e-57 | 2.486398e-54 |
MsG0080048896.01 | MsG0080049019.01 | 0.839698 | 1.356152e-57 | 1.887674e-54 |
MsG0080048917.01 | MsG0080049019.01 | 0.851738 | 7.297083e-61 | 1.491298e-57 |
MsG0080048918.01 | MsG0080049019.01 | 0.836383 | 9.665833e-57 | 1.216111e-53 |
MsG0080048919.01 | MsG0080049019.01 | 0.877300 | 7.019329e-69 | 3.512054e-65 |
MsG0080048929.01 | MsG0080049019.01 | 0.813673 | 2.271799e-51 | 1.493114e-48 |
MsG0080048948.01 | MsG0080049019.01 | 0.822248 | 2.622334e-53 | 2.183003e-50 |
MsG0080048978.01 | MsG0080049019.01 | 0.872383 | 3.317428e-67 | 1.385494e-63 |
MsG0080048986.01 | MsG0080049019.01 | 0.842427 | 2.603538e-58 | 3.946612e-55 |
MsG0080048987.01 | MsG0080049019.01 | 0.823536 | 1.313740e-53 | 1.134290e-50 |
MsG0080048992.01 | MsG0080049019.01 | 0.809153 | 2.178245e-50 | 1.269241e-47 |
MsG0080049015.01 | MsG0080049019.01 | 0.810949 | 8.936328e-51 | 5.461281e-48 |
MsG0080049018.01 | MsG0080049019.01 | 0.818962 | 1.490885e-52 | 1.132345e-49 |
MsG0080049019.01 | MsG0080049023.01 | 0.854616 | 1.093323e-61 | 2.456136e-58 |
MsG0080049019.01 | MsG0080049024.01 | 0.840738 | 7.257229e-58 | 1.043409e-54 |
MsG0080049019.01 | MsG0080049038.01 | 0.885305 | 9.117701e-72 | 6.226171e-68 |
MsG0080049019.01 | MsG0080049062.01 | 0.864084 | 1.567724e-64 | 4.861391e-61 |
MsG0080049019.01 | MsG0080049066.01 | 0.893042 | 9.082218e-75 | 8.514924e-71 |
MsG0080049019.01 | MsG0080049076.01 | 0.857644 | 1.417909e-62 | 3.523973e-59 |
MsG0080049019.01 | MsG0080049133.01 | 0.885837 | 5.763389e-72 | 4.018039e-68 |
MsG0080049019.01 | MsG0180000193.01 | 0.807775 | 4.286008e-50 | 2.408256e-47 |
MsG0080049019.01 | MsG0180000194.01 | 0.825778 | 3.893467e-54 | 3.583570e-51 |
MsG0080049019.01 | MsG0180000306.01 | 0.810093 | 1.367979e-50 | 8.171652e-48 |
MsG0080049019.01 | MsG0180000322.01 | 0.870587 | 1.303777e-66 | 5.098500e-63 |
MsG0080049019.01 | MsG0180000325.01 | 0.819237 | 1.290805e-52 | 9.877456e-50 |
MsG0080049019.01 | MsG0180000337.01 | -0.814984 | 1.166137e-51 | 7.940810e-49 |
MsG0080049019.01 | MsG0180000352.01 | 0.804369 | 2.233362e-49 | 1.149483e-46 |
MsG0080049019.01 | MsG0180000367.01 | -0.815469 | 9.098561e-52 | 6.278805e-49 |
MsG0080049019.01 | MsG0180000417.01 | 0.840340 | 9.224135e-58 | 1.309810e-54 |
MsG0080049019.01 | MsG0180000423.01 | 0.821929 | 3.109013e-53 | 2.564697e-50 |
MsG0080049019.01 | MsG0180000467.01 | 0.910832 | 1.204311e-82 | 2.506348e-78 |
MsG0080049019.01 | MsG0180000583.01 | -0.817755 | 2.796796e-52 | 2.054613e-49 |
MsG0080049019.01 | MsG0180000719.01 | 0.849353 | 3.415761e-60 | 6.458160e-57 |
MsG0080049019.01 | MsG0180000846.01 | 0.813040 | 3.130150e-51 | 2.022097e-48 |
MsG0080049019.01 | MsG0180001054.01 | 0.830385 | 3.024953e-55 | 3.182225e-52 |
MsG0080049019.01 | MsG0180001072.01 | 0.851521 | 8.405791e-61 | 1.705929e-57 |
MsG0080049019.01 | MsG0180001111.01 | 0.824210 | 9.131662e-54 | 8.035918e-51 |
MsG0080049019.01 | MsG0180001113.01 | 0.823374 | 1.433825e-53 | 1.232212e-50 |
MsG0080049019.01 | MsG0180001137.01 | 0.836873 | 7.247990e-57 | 9.254692e-54 |
MsG0080049019.01 | MsG0180001264.01 | -0.801201 | 1.006821e-48 | 4.779570e-46 |
MsG0080049019.01 | MsG0180001484.01 | 0.839170 | 1.859859e-57 | 2.547152e-54 |
MsG0080049019.01 | MsG0180001507.01 | 0.800817 | 1.206307e-48 | 5.670968e-46 |
MsG0080049019.01 | MsG0180001614.01 | 0.861273 | 1.151655e-63 | 3.240699e-60 |
MsG0080049019.01 | MsG0180001827.01 | 0.813952 | 1.972712e-51 | 1.306295e-48 |
MsG0080049019.01 | MsG0180001925.01 | 0.881071 | 3.255127e-70 | 1.879741e-66 |
MsG0080049019.01 | MsG0180002021.01 | 0.825119 | 5.575783e-54 | 5.036527e-51 |
MsG0080049019.01 | MsG0180002099.01 | 0.912085 | 2.916079e-83 | 6.442110e-79 |
MsG0080049019.01 | MsG0180002214.01 | 0.874466 | 6.606636e-68 | 2.977475e-64 |
MsG0080049019.01 | MsG0180002227.01 | 0.803501 | 3.383068e-49 | 1.702868e-46 |
MsG0080049019.01 | MsG0180002425.01 | 0.862311 | 5.543819e-64 | 1.616279e-60 |
MsG0080049019.01 | MsG0180002426.01 | 0.851302 | 9.693266e-61 | 1.953560e-57 |
MsG0080049019.01 | MsG0180002439.01 | 0.830321 | 3.136758e-55 | 3.293518e-52 |
MsG0080049019.01 | MsG0180002454.01 | 0.830226 | 3.307920e-55 | 3.464075e-52 |
MsG0080049019.01 | MsG0180002463.01 | 0.803899 | 2.796665e-49 | 1.422211e-46 |
MsG0080049019.01 | MsG0180002546.01 | 0.863584 | 2.242212e-64 | 6.831858e-61 |
MsG0080049019.01 | MsG0180002809.01 | 0.899101 | 2.764610e-77 | 3.366937e-73 |
MsG0080049019.01 | MsG0180002935.01 | -0.804885 | 1.742826e-49 | 9.091229e-47 |
MsG0080049019.01 | MsG0180002982.01 | 0.827380 | 1.615272e-54 | 1.556997e-51 |
MsG0080049019.01 | MsG0180003114.01 | 0.885082 | 1.104450e-71 | 7.475390e-68 |
MsG0080049019.01 | MsG0180003296.01 | 0.840072 | 1.083852e-57 | 1.526599e-54 |
MsG0080049019.01 | MsG0180003324.01 | 0.830544 | 2.766750e-55 | 2.923836e-52 |
MsG0080049019.01 | MsG0180003350.01 | 0.835408 | 1.707886e-56 | 2.086642e-53 |
MsG0080049019.01 | MsG0180003351.01 | 0.843021 | 1.809723e-58 | 2.794154e-55 |
MsG0080049019.01 | MsG0180003405.01 | 0.812975 | 3.235220e-51 | 2.086268e-48 |
MsG0080049019.01 | MsG0180003757.01 | 0.889238 | 2.895776e-73 | 2.317041e-69 |
MsG0080049019.01 | MsG0180003758.01 | 0.883510 | 4.220659e-71 | 2.683514e-67 |
MsG0080049019.01 | MsG0180003759.01 | 0.869757 | 2.437248e-66 | 9.249442e-63 |
MsG0080049019.01 | MsG0180003779.01 | 0.884553 | 1.738122e-71 | 1.151825e-67 |
MsG0080049019.01 | MsG0180003880.01 | 0.869269 | 3.514537e-66 | 1.310810e-62 |
MsG0080049019.01 | MsG0180003904.01 | 0.861233 | 1.184680e-63 | 3.328655e-60 |
MsG0080049019.01 | MsG0180003908.01 | 0.830841 | 2.339724e-55 | 2.494524e-52 |
MsG0080049019.01 | MsG0180003980.01 | 0.875103 | 4.009419e-68 | 1.849521e-64 |
MsG0080049019.01 | MsG0180003985.01 | 0.887868 | 9.773065e-73 | 7.394791e-69 |
MsG0080049019.01 | MsG0180004018.01 | 0.845719 | 3.407664e-59 | 5.731167e-56 |
MsG0080049019.01 | MsG0180004124.01 | 0.856678 | 2.735727e-62 | 6.580482e-59 |
MsG0080049019.01 | MsG0180004125.01 | 0.856356 | 3.399496e-62 | 8.092326e-59 |
MsG0080049019.01 | MsG0180004177.01 | 0.862849 | 3.786608e-64 | 1.124982e-60 |
MsG0080049019.01 | MsG0180004226.01 | 0.826577 | 2.514099e-54 | 2.366974e-51 |
MsG0080049019.01 | MsG0180004292.01 | 0.852692 | 3.907841e-61 | 8.232772e-58 |
MsG0080049019.01 | MsG0180004301.01 | 0.840214 | 9.951282e-58 | 1.407739e-54 |
MsG0080049019.01 | MsG0180004322.01 | 0.891608 | 3.400840e-74 | 3.003006e-70 |
MsG0080049019.01 | MsG0180004386.01 | 0.833709 | 4.562488e-56 | 5.296727e-53 |
MsG0080049019.01 | MsG0180004458.01 | 0.810521 | 1.106049e-50 | 6.681681e-48 |
MsG0080049019.01 | MsG0180004502.01 | 0.894228 | 3.002951e-75 | 2.959108e-71 |
MsG0080049019.01 | MsG0180004504.01 | 0.803337 | 3.657954e-49 | 1.833388e-46 |
MsG0080049019.01 | MsG0180004553.01 | 0.889038 | 3.462568e-73 | 2.748528e-69 |
MsG0080049019.01 | MsG0180004580.01 | 0.865761 | 4.671411e-65 | 1.537404e-61 |
MsG0080049019.01 | MsG0180004581.01 | 0.879699 | 1.006601e-69 | 5.511779e-66 |
MsG0080049019.01 | MsG0180004586.01 | 0.846076 | 2.725935e-59 | 4.637169e-56 |
MsG0080049019.01 | MsG0180004634.01 | 0.846267 | 2.418200e-59 | 4.138943e-56 |
MsG0080049019.01 | MsG0180004731.01 | 0.838652 | 2.532415e-57 | 3.414279e-54 |
MsG0080049019.01 | MsG0180004737.01 | 0.832931 | 7.134010e-56 | 8.091711e-53 |
MsG0080049019.01 | MsG0180004747.01 | 0.836126 | 1.123419e-56 | 1.402535e-53 |
MsG0080049019.01 | MsG0180004761.01 | 0.841941 | 3.501469e-58 | 5.226261e-55 |
MsG0080049019.01 | MsG0180004773.01 | 0.849031 | 4.196061e-60 | 7.850956e-57 |
MsG0080049019.01 | MsG0180004787.01 | 0.828066 | 1.104911e-54 | 1.086438e-51 |
MsG0080049019.01 | MsG0180004957.01 | 0.839467 | 1.557198e-57 | 2.152383e-54 |
MsG0080049019.01 | MsG0180005016.01 | 0.815144 | 1.074320e-51 | 7.347107e-49 |
MsG0080049019.01 | MsG0180005242.01 | 0.809503 | 1.832015e-50 | 1.077489e-47 |
MsG0080049019.01 | MsG0180005272.01 | -0.803081 | 4.131935e-49 | 2.057351e-46 |
MsG0080049019.01 | MsG0180005291.01 | 0.849738 | 2.666779e-60 | 5.104815e-57 |
MsG0080049019.01 | MsG0180005328.01 | -0.839532 | 1.497921e-57 | 2.074449e-54 |
MsG0080049019.01 | MsG0180005369.01 | 0.873621 | 1.275818e-67 | 5.572852e-64 |
MsG0080049019.01 | MsG0180005431.01 | 0.838064 | 3.589879e-57 | 4.753647e-54 |
MsG0080049019.01 | MsG0180005474.01 | 0.842510 | 2.474263e-58 | 3.760120e-55 |
MsG0080049019.01 | MsG0180005516.01 | 0.822822 | 1.928345e-53 | 1.631811e-50 |
MsG0080049019.01 | MsG0180005672.01 | 0.828874 | 7.053764e-55 | 7.099731e-52 |
MsG0080049019.01 | MsG0180005791.01 | 0.850827 | 1.320442e-60 | 2.619947e-57 |
MsG0080049019.01 | MsG0180005817.01 | 0.872451 | 3.148589e-67 | 1.318276e-63 |
MsG0080049019.01 | MsG0180005833.01 | 0.847693 | 9.842357e-60 | 1.763839e-56 |
MsG0080049019.01 | MsG0180005848.01 | 0.867579 | 1.232984e-65 | 4.326569e-62 |
MsG0080049019.01 | MsG0180006159.01 | 0.817842 | 2.674078e-52 | 1.969112e-49 |
MsG0080049019.01 | MsG0180006212.01 | 0.907352 | 5.561653e-81 | 9.831412e-77 |
MsG0080049019.01 | MsG0180006227.01 | 0.884200 | 2.348255e-71 | 1.535318e-67 |
MsG0080049019.01 | MsG0280006307.01 | 0.828949 | 6.762771e-55 | 6.822347e-52 |
MsG0080049019.01 | MsG0280006336.01 | 0.876896 | 9.697858e-69 | 4.782364e-65 |
MsG0080049019.01 | MsG0280006381.01 | 0.913663 | 4.739069e-84 | 1.133142e-79 |
MsG0080049019.01 | MsG0280006452.01 | 0.871155 | 8.475747e-67 | 3.383627e-63 |
MsG0080049019.01 | MsG0280006475.01 | 0.810969 | 8.846978e-51 | 5.409511e-48 |
MsG0080049019.01 | MsG0280006534.01 | 0.830910 | 2.249990e-55 | 2.403852e-52 |
MsG0080049019.01 | MsG0280006883.01 | -0.839924 | 1.184307e-57 | 1.660296e-54 |
MsG0080049019.01 | MsG0280006973.01 | 0.855854 | 4.770592e-62 | 1.116728e-58 |
MsG0080049019.01 | MsG0280007016.01 | 0.820672 | 6.060187e-53 | 4.825981e-50 |
MsG0080049019.01 | MsG0280007017.01 | 0.863239 | 2.868232e-64 | 8.635991e-61 |
MsG0080049019.01 | MsG0280007021.01 | 0.819262 | 1.274009e-52 | 9.755712e-50 |
MsG0080049019.01 | MsG0280007052.01 | -0.800894 | 1.163515e-48 | 5.480895e-46 |
MsG0080049019.01 | MsG0280007136.01 | 0.876537 | 1.290918e-68 | 6.281323e-65 |
MsG0080049019.01 | MsG0280007201.01 | -0.805807 | 1.117114e-49 | 5.966472e-47 |
MsG0080049019.01 | MsG0280007216.01 | -0.812764 | 3.597475e-51 | 2.306996e-48 |
MsG0080049019.01 | MsG0280007233.01 | 0.821863 | 3.220408e-53 | 2.651737e-50 |
MsG0080049019.01 | MsG0280007247.01 | 0.874142 | 8.505340e-68 | 3.786270e-64 |
MsG0080049019.01 | MsG0280007288.01 | 0.879336 | 1.353693e-69 | 7.311042e-66 |
MsG0080049019.01 | MsG0280007291.01 | 0.873124 | 1.875328e-67 | 8.046730e-64 |
MsG0080049019.01 | MsG0280007322.01 | 0.838583 | 2.638928e-57 | 3.550376e-54 |
MsG0080049019.01 | MsG0280007426.01 | -0.837416 | 5.265438e-57 | 6.834825e-54 |
MsG0080049019.01 | MsG0280007427.01 | -0.826157 | 3.164655e-54 | 2.944181e-51 |
MsG0080049019.01 | MsG0280007576.01 | 0.835394 | 1.721239e-56 | 2.102178e-53 |
MsG0080049019.01 | MsG0280007649.01 | 0.883829 | 3.221128e-71 | 2.074765e-67 |
MsG0080049019.01 | MsG0280007650.01 | 0.882320 | 1.149885e-70 | 6.973572e-67 |
MsG0080049019.01 | MsG0280007653.01 | 0.830359 | 3.070374e-55 | 3.227631e-52 |
MsG0080049019.01 | MsG0280007786.01 | -0.866249 | 3.272858e-65 | 1.095773e-61 |
MsG0080049019.01 | MsG0280008015.01 | 0.824073 | 9.835284e-54 | 8.621350e-51 |
MsG0080049019.01 | MsG0280008405.01 | -0.801087 | 1.062311e-48 | 5.028834e-46 |
MsG0080049019.01 | MsG0280008430.01 | 0.874532 | 6.275126e-68 | 2.834309e-64 |
MsG0080049019.01 | MsG0280008820.01 | 0.850023 | 2.220227e-60 | 4.290510e-57 |
MsG0080049019.01 | MsG0280008912.01 | 0.852082 | 5.829665e-61 | 1.204398e-57 |
MsG0080049019.01 | MsG0280008935.01 | 0.809082 | 2.256059e-50 | 1.312062e-47 |
MsG0080049019.01 | MsG0280009008.01 | 0.828765 | 7.492553e-55 | 7.517916e-52 |
MsG0080049019.01 | MsG0280009079.01 | 0.873779 | 1.128955e-67 | 4.959545e-64 |
MsG0080049019.01 | MsG0280009094.01 | 0.879746 | 9.687665e-70 | 5.314243e-66 |
MsG0080049019.01 | MsG0280009103.01 | 0.812698 | 3.719219e-51 | 2.381036e-48 |
MsG0080049019.01 | MsG0280009167.01 | -0.833963 | 3.942580e-56 | 4.612772e-53 |
MsG0080049019.01 | MsG0280009287.01 | 0.828497 | 8.698883e-55 | 8.661432e-52 |
MsG0080049019.01 | MsG0280009518.01 | 0.819241 | 1.287763e-52 | 9.855661e-50 |
MsG0080049019.01 | MsG0280009526.01 | -0.826706 | 2.341157e-54 | 2.212419e-51 |
MsG0080049019.01 | MsG0280009541.01 | 0.833209 | 6.082466e-56 | 6.957074e-53 |
MsG0080049019.01 | MsG0280009579.01 | 0.848564 | 5.655525e-60 | 1.042116e-56 |
MsG0080049019.01 | MsG0280009742.01 | 0.893493 | 5.973057e-75 | 5.702598e-71 |
MsG0080049019.01 | MsG0280009776.01 | 0.881000 | 3.450862e-70 | 1.987572e-66 |
MsG0080049019.01 | MsG0280009864.01 | 0.871559 | 6.230465e-67 | 2.524401e-63 |
MsG0080049019.01 | MsG0280010019.01 | -0.801778 | 7.669619e-49 | 3.694246e-46 |
MsG0080049019.01 | MsG0280010047.01 | -0.805883 | 1.076348e-49 | 5.760101e-47 |
MsG0080049019.01 | MsG0280010142.01 | 0.866235 | 3.306354e-65 | 1.106361e-61 |
MsG0080049019.01 | MsG0280010143.01 | 0.823876 | 1.093643e-53 | 9.534436e-51 |
MsG0080049019.01 | MsG0280010149.01 | 0.888411 | 6.049578e-73 | 4.681787e-69 |
MsG0080049019.01 | MsG0280010227.01 | 0.838232 | 3.250539e-57 | 4.325870e-54 |
MsG0080049019.01 | MsG0280010240.01 | -0.816262 | 6.055866e-52 | 4.270680e-49 |
MsG0080049019.01 | MsG0280010281.01 | 0.825667 | 4.136431e-54 | 3.795008e-51 |
MsG0080049019.01 | MsG0280010356.01 | 0.855505 | 6.032305e-62 | 1.395694e-58 |
MsG0080049019.01 | MsG0280010583.01 | 0.805788 | 1.127192e-49 | 6.017451e-47 |
MsG0080049019.01 | MsG0280010606.01 | 0.850412 | 1.727072e-60 | 3.380293e-57 |
MsG0080049019.01 | MsG0280010695.01 | 0.802614 | 5.160120e-49 | 2.539031e-46 |
MsG0080049019.01 | MsG0280010704.01 | 0.857599 | 1.462311e-62 | 3.629179e-59 |
MsG0080049019.01 | MsG0280010780.01 | 0.833408 | 5.426119e-56 | 6.243283e-53 |
MsG0080049019.01 | MsG0280010944.01 | -0.803161 | 3.978687e-49 | 1.985209e-46 |
MsG0080049019.01 | MsG0280010994.01 | 0.808233 | 3.425600e-50 | 1.948173e-47 |
MsG0080049019.01 | MsG0280011162.01 | 0.816308 | 5.913571e-52 | 4.175629e-49 |
MsG0080049019.01 | MsG0280011189.01 | 0.807139 | 5.847467e-50 | 3.231682e-47 |
MsG0080049019.01 | MsG0280011197.01 | 0.828517 | 8.604548e-55 | 8.572412e-52 |
MsG0080049019.01 | MsG0280011200.01 | 0.861147 | 1.257999e-63 | 3.524002e-60 |
MsG0080049019.01 | MsG0280011240.01 | 0.834837 | 2.378579e-56 | 2.856695e-53 |
MsG0080049019.01 | MsG0280011267.01 | -0.803839 | 2.877653e-49 | 1.461124e-46 |
MsG0080049019.01 | MsG0280011269.01 | -0.813976 | 1.948454e-51 | 1.291076e-48 |
MsG0080049019.01 | MsG0280011276.01 | 0.840717 | 7.350352e-58 | 1.056098e-54 |
MsG0080049019.01 | MsG0280011279.01 | 0.810117 | 1.352154e-50 | 8.082337e-48 |
MsG0080049019.01 | MsG0280011281.01 | 0.857164 | 1.967100e-62 | 4.810668e-59 |
MsG0080049019.01 | MsG0280011299.01 | 0.899723 | 1.493534e-77 | 1.869640e-73 |
MsG0080049019.01 | MsG0280011301.01 | 0.883022 | 6.377549e-71 | 3.975566e-67 |
MsG0080049019.01 | MsG0280011475.01 | 0.896013 | 5.541933e-76 | 5.883685e-72 |
MsG0080049019.01 | MsG0380012065.01 | 0.867729 | 1.103829e-65 | 3.893579e-62 |
MsG0080049019.01 | MsG0380012148.01 | 0.868874 | 4.719222e-66 | 1.734569e-62 |
MsG0080049019.01 | MsG0380012157.01 | 0.849843 | 2.493310e-60 | 4.789277e-57 |
MsG0080049019.01 | MsG0380012281.01 | 0.906240 | 1.833349e-80 | 3.075840e-76 |
MsG0080049019.01 | MsG0380012444.01 | 0.805550 | 1.264648e-49 | 6.709714e-47 |
MsG0080049019.01 | MsG0380013063.01 | 0.807886 | 4.059662e-50 | 2.287617e-47 |
MsG0080049019.01 | MsG0380013114.01 | 0.883835 | 3.203947e-71 | 2.064149e-67 |
MsG0080049019.01 | MsG0380013272.01 | -0.817787 | 2.751408e-52 | 2.023018e-49 |
MsG0080049019.01 | MsG0380013378.01 | 0.825478 | 4.585579e-54 | 4.184338e-51 |
MsG0080049019.01 | MsG0380013473.01 | 0.876792 | 1.053069e-68 | 5.173512e-65 |
MsG0080049019.01 | MsG0380013501.01 | 0.840807 | 6.962466e-58 | 1.003214e-54 |
MsG0080049019.01 | MsG0380013506.01 | 0.886894 | 2.297154e-72 | 1.671557e-68 |
MsG0080049019.01 | MsG0380013892.01 | 0.810370 | 1.192355e-50 | 7.174303e-48 |
MsG0080049019.01 | MsG0380013921.01 | 0.826991 | 2.001826e-54 | 1.907482e-51 |
MsG0080049019.01 | MsG0380013925.01 | 0.806415 | 8.319833e-50 | 4.512970e-47 |
MsG0080049019.01 | MsG0380013928.01 | 0.874882 | 4.771547e-68 | 2.184220e-64 |
MsG0080049019.01 | MsG0380013940.01 | 0.814342 | 1.617407e-51 | 1.082494e-48 |
MsG0080049019.01 | MsG0380013943.01 | 0.826952 | 2.045738e-54 | 1.947119e-51 |
MsG0080049019.01 | MsG0380013945.01 | 0.834742 | 2.514246e-56 | 3.010548e-53 |
MsG0080049019.01 | MsG0380013953.01 | 0.822361 | 2.468180e-53 | 2.061476e-50 |
MsG0080049019.01 | MsG0380013956.01 | 0.866297 | 3.159878e-65 | 1.059748e-61 |
MsG0080049019.01 | MsG0380013957.01 | 0.829367 | 5.355197e-55 | 5.470078e-52 |
MsG0080049019.01 | MsG0380013966.01 | 0.807992 | 3.854638e-50 | 2.178230e-47 |
MsG0080049019.01 | MsG0380013967.01 | 0.831418 | 1.688369e-55 | 1.831022e-52 |
MsG0080049019.01 | MsG0380013971.01 | 0.859110 | 5.189382e-63 | 1.354909e-59 |
MsG0080049019.01 | MsG0380013975.01 | 0.838810 | 2.305411e-57 | 3.123027e-54 |
MsG0080049019.01 | MsG0380013977.01 | 0.835529 | 1.591615e-56 | 1.951509e-53 |
MsG0080049019.01 | MsG0380013984.01 | 0.804433 | 2.165547e-49 | 1.116393e-46 |
MsG0080049019.01 | MsG0380013985.01 | 0.824182 | 9.269550e-54 | 8.150876e-51 |
MsG0080049019.01 | MsG0380013986.01 | 0.835480 | 1.637795e-56 | 2.005266e-53 |
MsG0080049019.01 | MsG0380013997.01 | 0.833274 | 5.858225e-56 | 6.713398e-53 |
MsG0080049019.01 | MsG0380014005.01 | 0.832979 | 6.940163e-56 | 7.883745e-53 |
MsG0080049019.01 | MsG0380014006.01 | 0.808035 | 3.774591e-50 | 2.135392e-47 |
MsG0080049019.01 | MsG0380014016.01 | 0.849162 | 3.858552e-60 | 7.251299e-57 |
MsG0080049019.01 | MsG0380014020.01 | 0.823588 | 1.277518e-53 | 1.104683e-50 |
MsG0080049019.01 | MsG0380014021.01 | 0.807117 | 5.911691e-50 | 3.265254e-47 |
MsG0080049019.01 | MsG0380014023.01 | 0.820011 | 8.591487e-53 | 6.718370e-50 |
MsG0080049019.01 | MsG0380014024.01 | 0.867579 | 1.233590e-65 | 4.328672e-62 |
MsG0080049019.01 | MsG0380014029.01 | 0.869155 | 3.826544e-66 | 1.421416e-62 |
MsG0080049019.01 | MsG0380014032.01 | 0.836334 | 9.947920e-57 | 1.249858e-53 |
MsG0080049019.01 | MsG0380014129.01 | 0.807139 | 5.849771e-50 | 3.232844e-47 |
MsG0080049019.01 | MsG0380014231.01 | 0.851201 | 1.035150e-60 | 2.079228e-57 |
MsG0080049019.01 | MsG0380014410.01 | -0.838431 | 2.888118e-57 | 3.867623e-54 |
MsG0080049019.01 | MsG0380014639.01 | 0.870032 | 1.981517e-66 | 7.596728e-63 |
MsG0080049019.01 | MsG0380014642.01 | 0.891510 | 3.718697e-74 | 3.269961e-70 |
MsG0080049019.01 | MsG0380014735.01 | 0.866865 | 2.085636e-65 | 7.136572e-62 |
MsG0080049019.01 | MsG0380014795.01 | 0.825863 | 3.716374e-54 | 3.428957e-51 |
MsG0080049019.01 | MsG0380015077.01 | 0.804103 | 2.536610e-49 | 1.296686e-46 |
MsG0080049019.01 | MsG0380015081.01 | 0.821706 | 3.500572e-53 | 2.869545e-50 |
MsG0080049019.01 | MsG0380015111.01 | 0.839136 | 1.897994e-57 | 2.596686e-54 |
MsG0080049019.01 | MsG0380015121.01 | 0.829340 | 5.438150e-55 | 5.550607e-52 |
MsG0080049019.01 | MsG0380015129.01 | 0.803542 | 3.316601e-49 | 1.671204e-46 |
MsG0080049019.01 | MsG0380015200.01 | 0.851821 | 6.915539e-61 | 1.416874e-57 |
MsG0080049019.01 | MsG0380015201.01 | 0.878823 | 2.056024e-69 | 1.088889e-65 |
MsG0080049019.01 | MsG0380015271.01 | 0.893641 | 5.200321e-75 | 4.997486e-71 |
MsG0080049019.01 | MsG0380015348.01 | 0.879098 | 1.643350e-69 | 8.797567e-66 |
MsG0080049019.01 | MsG0380015369.01 | -0.800787 | 1.223429e-48 | 5.747054e-46 |
MsG0080049019.01 | MsG0380015417.01 | 0.866206 | 3.377596e-65 | 1.128961e-61 |
MsG0080049019.01 | MsG0380015439.01 | 0.887891 | 9.579595e-73 | 7.255428e-69 |
MsG0080049019.01 | MsG0380015572.01 | -0.824933 | 6.169618e-54 | 5.543562e-51 |
MsG0080049019.01 | MsG0380015619.01 | 0.869396 | 3.196265e-66 | 1.197888e-62 |
MsG0080049019.01 | MsG0380015654.01 | 0.844108 | 9.270618e-59 | 1.481379e-55 |
MsG0080049019.01 | MsG0380015719.01 | 0.890352 | 1.065257e-73 | 8.925647e-70 |
MsG0080049019.01 | MsG0380015752.01 | 0.895494 | 9.086809e-76 | 9.450719e-72 |
MsG0080049019.01 | MsG0380015795.01 | 0.838925 | 2.152283e-57 | 2.925812e-54 |
MsG0080049019.01 | MsG0380015828.01 | 0.824967 | 6.057297e-54 | 5.447931e-51 |
MsG0080049019.01 | MsG0380015971.01 | 0.869607 | 2.727487e-66 | 1.029756e-62 |
MsG0080049019.01 | MsG0380015974.01 | 0.854121 | 1.519510e-61 | 3.359025e-58 |
MsG0080049019.01 | MsG0380015985.01 | 0.870074 | 1.919786e-66 | 7.370747e-63 |
MsG0080049019.01 | MsG0380016056.01 | 0.889044 | 3.443177e-73 | 2.733869e-69 |
MsG0080049019.01 | MsG0380016089.01 | 0.845264 | 4.525228e-59 | 7.499676e-56 |
MsG0080049019.01 | MsG0380016166.01 | 0.853984 | 1.664934e-61 | 3.663418e-58 |
MsG0080049019.01 | MsG0380016229.01 | 0.886435 | 3.429767e-72 | 2.449598e-68 |
MsG0080049019.01 | MsG0380016231.01 | 0.844922 | 5.599681e-59 | 9.179083e-56 |
MsG0080049019.01 | MsG0380016241.01 | 0.898995 | 3.068545e-77 | 3.719300e-73 |
MsG0080049019.01 | MsG0380016354.01 | 0.847810 | 9.137942e-60 | 1.643520e-56 |
MsG0080049019.01 | MsG0380016362.01 | 0.829990 | 3.778603e-55 | 3.929839e-52 |
MsG0080049019.01 | MsG0380016380.01 | 0.809089 | 2.248216e-50 | 1.307756e-47 |
MsG0080049019.01 | MsG0380016424.01 | 0.843772 | 1.140836e-58 | 1.803618e-55 |
MsG0080049019.01 | MsG0380016456.01 | 0.875023 | 4.270447e-68 | 1.964400e-64 |
MsG0080049019.01 | MsG0380016476.01 | -0.818871 | 1.563436e-52 | 1.184396e-49 |
MsG0080049019.01 | MsG0380016478.01 | 0.832945 | 7.073411e-56 | 8.026673e-53 |
MsG0080049019.01 | MsG0380016700.01 | -0.827551 | 1.469468e-54 | 1.423244e-51 |
MsG0080049019.01 | MsG0380016790.01 | 0.889156 | 3.115444e-73 | 2.484590e-69 |
MsG0080049019.01 | MsG0380016801.01 | -0.819916 | 9.032127e-53 | 7.044136e-50 |
MsG0080049019.01 | MsG0380016835.01 | 0.904470 | 1.186976e-79 | 1.838926e-75 |
MsG0080049019.01 | MsG0380016881.01 | 0.867189 | 1.643877e-65 | 5.688188e-62 |
MsG0080049019.01 | MsG0380016889.01 | 0.876256 | 1.613717e-68 | 7.769799e-65 |
MsG0080049019.01 | MsG0380016896.01 | 0.859945 | 2.910102e-63 | 7.821428e-60 |
MsG0080049019.01 | MsG0380016931.01 | 0.877886 | 4.385899e-69 | 2.242756e-65 |
MsG0080049019.01 | MsG0380016932.01 | 0.818361 | 2.039967e-52 | 1.523886e-49 |
MsG0080049019.01 | MsG0380016934.01 | 0.906932 | 8.736438e-81 | 1.513614e-76 |
MsG0080049019.01 | MsG0380016935.01 | 0.904498 | 1.152819e-79 | 1.788739e-75 |
MsG0080049019.01 | MsG0380016960.01 | 0.896878 | 2.414932e-76 | 2.662478e-72 |
MsG0080049019.01 | MsG0380017018.01 | 0.824937 | 6.157892e-54 | 5.533487e-51 |
MsG0080049019.01 | MsG0380017141.01 | 0.821207 | 4.563469e-53 | 3.689106e-50 |
MsG0080049019.01 | MsG0380017317.01 | 0.835466 | 1.651058e-56 | 2.020683e-53 |
MsG0080049019.01 | MsG0380017405.01 | 0.907288 | 5.960770e-81 | 1.050743e-76 |
MsG0080049019.01 | MsG0380017406.01 | 0.894111 | 3.351616e-75 | 3.287339e-71 |
MsG0080049019.01 | MsG0380017472.01 | 0.854793 | 9.711603e-62 | 2.194812e-58 |
MsG0080049019.01 | MsG0380017474.01 | 0.852791 | 3.661168e-61 | 7.739481e-58 |
MsG0080049019.01 | MsG0380017566.01 | 0.836453 | 9.277952e-57 | 1.169791e-53 |
MsG0080049019.01 | MsG0380017647.01 | 0.825328 | 4.975906e-54 | 4.521527e-51 |
MsG0080049019.01 | MsG0380017773.01 | 0.849113 | 3.982335e-60 | 7.471426e-57 |
MsG0080049019.01 | MsG0380017804.01 | 0.820760 | 5.783943e-53 | 4.617685e-50 |
MsG0080049019.01 | MsG0380017812.01 | 0.868742 | 5.208049e-66 | 1.905143e-62 |
MsG0080049019.01 | MsG0380017895.01 | 0.896464 | 3.598602e-76 | 3.896952e-72 |
MsG0080049019.01 | MsG0380017904.01 | 0.826590 | 2.495505e-54 | 2.350372e-51 |
MsG0080049019.01 | MsG0380017928.01 | 0.903869 | 2.218765e-79 | 3.345334e-75 |
MsG0080049019.01 | MsG0380017962.01 | 0.905885 | 2.675025e-80 | 4.419977e-76 |
MsG0080049019.01 | MsG0380017966.01 | 0.828190 | 1.031922e-54 | 1.018316e-51 |
MsG0080049019.01 | MsG0380017972.01 | 0.802697 | 4.960329e-49 | 2.445954e-46 |
MsG0080049019.01 | MsG0380018035.01 | 0.821878 | 3.193801e-53 | 2.630973e-50 |
MsG0080049019.01 | MsG0380018058.01 | 0.831441 | 1.666816e-55 | 1.808903e-52 |
MsG0080049019.01 | MsG0380018066.01 | 0.850921 | 1.242272e-60 | 2.472222e-57 |
MsG0080049019.01 | MsG0380018072.01 | 0.881609 | 2.082908e-70 | 1.228490e-66 |
MsG0080049019.01 | MsG0480018088.01 | 0.809877 | 1.522394e-50 | 9.043015e-48 |
MsG0080049019.01 | MsG0480018098.01 | 0.823719 | 1.190596e-53 | 1.033454e-50 |
MsG0080049019.01 | MsG0480018101.01 | 0.803450 | 3.465400e-49 | 1.742003e-46 |
MsG0080049019.01 | MsG0480018108.01 | 0.833861 | 4.180742e-56 | 4.876464e-53 |
MsG0080049019.01 | MsG0480018112.01 | 0.850315 | 1.838751e-60 | 3.587339e-57 |
MsG0080049019.01 | MsG0480018190.01 | 0.865301 | 6.521659e-65 | 2.111320e-61 |
MsG0080049019.01 | MsG0480018196.01 | 0.806297 | 8.809416e-50 | 4.764327e-47 |
MsG0080049019.01 | MsG0480018201.01 | 0.894740 | 1.856200e-75 | 1.869475e-71 |
MsG0080049019.01 | MsG0480018202.01 | 0.892279 | 1.838286e-74 | 1.668426e-70 |
MsG0080049019.01 | MsG0480018203.01 | 0.895604 | 8.187625e-76 | 8.557813e-72 |
MsG0080049019.01 | MsG0480018328.01 | 0.827274 | 1.712822e-54 | 1.645738e-51 |
MsG0080049019.01 | MsG0480018329.01 | 0.801832 | 7.474969e-49 | 3.605596e-46 |
MsG0080049019.01 | MsG0480018330.01 | 0.829872 | 4.035827e-55 | 4.183745e-52 |
MsG0080049019.01 | MsG0480018440.01 | -0.812308 | 4.525555e-51 | 2.867402e-48 |
MsG0080049019.01 | MsG0480018463.01 | 0.889253 | 2.856931e-73 | 2.287225e-69 |
MsG0080049019.01 | MsG0480018494.01 | 0.872110 | 4.091033e-67 | 1.690872e-63 |
MsG0080049019.01 | MsG0480018626.01 | 0.881650 | 2.012083e-70 | 1.188449e-66 |
MsG0080049019.01 | MsG0480018628.01 | 0.881765 | 1.828884e-70 | 1.084936e-66 |
MsG0080049019.01 | MsG0480018658.01 | 0.817867 | 2.639016e-52 | 1.944582e-49 |
MsG0080049019.01 | MsG0480018788.01 | 0.837662 | 4.553166e-57 | 5.956123e-54 |
MsG0080049019.01 | MsG0480018840.01 | 0.867516 | 1.291610e-65 | 4.521716e-62 |
MsG0080049019.01 | MsG0480019017.01 | -0.829470 | 5.057570e-55 | 5.180950e-52 |
MsG0080049019.01 | MsG0480019028.01 | 0.839381 | 1.639025e-57 | 2.259670e-54 |
MsG0080049019.01 | MsG0480019046.01 | 0.813835 | 2.093520e-51 | 1.381914e-48 |
MsG0080049019.01 | MsG0480019183.01 | 0.903944 | 2.053966e-79 | 3.105260e-75 |
MsG0080049019.01 | MsG0480019376.01 | 0.887498 | 1.353940e-72 | 1.009327e-68 |
MsG0080049019.01 | MsG0480019484.01 | 0.800836 | 1.195646e-48 | 5.623755e-46 |
MsG0080049019.01 | MsG0480019485.01 | 0.823136 | 1.629600e-53 | 1.391313e-50 |
MsG0080049019.01 | MsG0480019726.01 | -0.811400 | 7.134945e-51 | 4.412322e-48 |
MsG0080049019.01 | MsG0480019836.01 | 0.879125 | 1.608356e-69 | 8.616743e-66 |
MsG0080049019.01 | MsG0480019838.01 | 0.865364 | 6.230413e-65 | 2.021653e-61 |
MsG0080049019.01 | MsG0480019852.01 | 0.846986 | 1.538400e-59 | 2.694884e-56 |
MsG0080049019.01 | MsG0480019861.01 | 0.874062 | 9.056610e-68 | 4.019541e-64 |
MsG0080049019.01 | MsG0480019975.01 | 0.818770 | 1.647692e-52 | 1.244751e-49 |
MsG0080049019.01 | MsG0480020076.01 | 0.810384 | 1.184174e-50 | 7.127446e-48 |
MsG0080049019.01 | MsG0480020253.01 | 0.805784 | 1.129532e-49 | 6.029339e-47 |
MsG0080049019.01 | MsG0480020269.01 | 0.850220 | 1.954385e-60 | 3.801243e-57 |
MsG0080049019.01 | MsG0480020498.01 | 0.808170 | 3.533243e-50 | 2.006124e-47 |
MsG0080049019.01 | MsG0480020539.01 | -0.817560 | 3.095925e-52 | 2.262123e-49 |
MsG0080049019.01 | MsG0480020550.01 | 0.845533 | 3.826770e-59 | 6.396777e-56 |
MsG0080049019.01 | MsG0480020838.01 | 0.824332 | 8.547483e-54 | 7.547658e-51 |
MsG0080049019.01 | MsG0480020841.01 | 0.854447 | 1.223235e-61 | 2.732541e-58 |
MsG0080049019.01 | MsG0480020842.01 | 0.863828 | 1.884412e-64 | 5.790983e-61 |
MsG0080049019.01 | MsG0480020938.01 | 0.809311 | 2.015018e-50 | 1.179058e-47 |
MsG0080049019.01 | MsG0480020957.01 | -0.821873 | 3.203446e-53 | 2.638448e-50 |
MsG0080049019.01 | MsG0480020958.01 | -0.844310 | 8.184744e-59 | 1.315996e-55 |
MsG0080049019.01 | MsG0480021005.01 | -0.801247 | 9.850717e-49 | 4.681825e-46 |
MsG0080049019.01 | MsG0480021039.01 | 0.857568 | 1.493818e-62 | 3.703101e-59 |
MsG0080049019.01 | MsG0480021054.01 | 0.833522 | 5.080401e-56 | 5.865683e-53 |
MsG0080049019.01 | MsG0480021143.01 | 0.865149 | 7.280462e-65 | 2.344459e-61 |
MsG0080049019.01 | MsG0480021169.01 | 0.856885 | 2.376322e-62 | 5.756528e-59 |
MsG0080049019.01 | MsG0480021205.01 | 0.892004 | 2.365966e-74 | 2.122553e-70 |
MsG0080049019.01 | MsG0480021308.01 | 0.807459 | 5.003505e-50 | 2.788460e-47 |
MsG0080049019.01 | MsG0480021312.01 | 0.834237 | 3.367134e-56 | 3.971660e-53 |
MsG0080049019.01 | MsG0480021327.01 | 0.889450 | 2.396485e-73 | 1.934292e-69 |
MsG0080049019.01 | MsG0480021331.01 | 0.887859 | 9.849343e-73 | 7.449439e-69 |
MsG0080049019.01 | MsG0480021483.01 | 0.825358 | 4.896673e-54 | 4.452970e-51 |
MsG0080049019.01 | MsG0480021497.01 | 0.800326 | 1.519006e-48 | 7.053089e-46 |
MsG0080049019.01 | MsG0480021553.01 | -0.814430 | 1.547233e-51 | 1.037965e-48 |
MsG0080049019.01 | MsG0480021667.01 | 0.810825 | 9.509349e-51 | 5.791699e-48 |
MsG0080049019.01 | MsG0480021912.01 | 0.862334 | 5.455620e-64 | 1.591849e-60 |
MsG0080049019.01 | MsG0480022088.01 | 0.814170 | 1.765999e-51 | 1.176355e-48 |
MsG0080049019.01 | MsG0480022142.01 | -0.811947 | 5.424747e-51 | 3.403619e-48 |
MsG0080049019.01 | MsG0480022201.01 | 0.832317 | 1.012745e-55 | 1.127758e-52 |
MsG0080049019.01 | MsG0480022295.01 | 0.836572 | 8.652678e-57 | 1.094727e-53 |
MsG0080049019.01 | MsG0480022366.01 | 0.831773 | 1.380239e-55 | 1.513019e-52 |
MsG0080049019.01 | MsG0480022411.01 | 0.807880 | 4.072877e-50 | 2.294656e-47 |
MsG0080049019.01 | MsG0480022412.01 | 0.856737 | 2.627019e-62 | 6.331028e-59 |
MsG0080049019.01 | MsG0480022458.01 | 0.818558 | 1.841217e-52 | 1.382772e-49 |
MsG0080049019.01 | MsG0480022459.01 | 0.853335 | 2.557500e-61 | 5.507278e-58 |
MsG0080049019.01 | MsG0480022581.01 | 0.832831 | 7.551943e-56 | 8.540102e-53 |
MsG0080049019.01 | MsG0480022584.01 | 0.855540 | 5.890129e-62 | 1.364397e-58 |
MsG0080049019.01 | MsG0480022591.01 | 0.883124 | 5.851795e-71 | 3.663110e-67 |
MsG0080049019.01 | MsG0480022626.01 | 0.866474 | 2.778132e-65 | 9.374677e-62 |
MsG0080049019.01 | MsG0480022655.01 | -0.810244 | 1.269402e-50 | 7.612759e-48 |
MsG0080049019.01 | MsG0480022665.01 | 0.810644 | 1.040168e-50 | 6.304584e-48 |
MsG0080049019.01 | MsG0480022687.01 | 0.881658 | 1.999464e-70 | 1.181355e-66 |
MsG0080049019.01 | MsG0480022721.01 | -0.862396 | 5.220480e-64 | 1.526588e-60 |
MsG0080049019.01 | MsG0480022765.01 | 0.824534 | 7.663554e-54 | 6.806904e-51 |
MsG0080049019.01 | MsG0480022837.01 | 0.864414 | 1.237113e-64 | 3.881174e-61 |
MsG0080049019.01 | MsG0480023006.01 | 0.805187 | 1.506512e-49 | 7.919029e-47 |
MsG0080049019.01 | MsG0480023056.01 | 0.848300 | 6.693358e-60 | 1.222930e-56 |
MsG0080049019.01 | MsG0480023067.01 | -0.849170 | 3.839921e-60 | 7.218201e-57 |
MsG0080049019.01 | MsG0480023103.01 | 0.865422 | 5.974172e-65 | 1.942420e-61 |
MsG0080049019.01 | MsG0480023104.01 | 0.806327 | 8.681159e-50 | 4.698585e-47 |
MsG0080049019.01 | MsG0480023152.01 | 0.890034 | 1.418079e-73 | 1.172424e-69 |
MsG0080049019.01 | MsG0480023173.01 | 0.829500 | 4.973233e-55 | 5.098881e-52 |
MsG0080049019.01 | MsG0480023187.01 | 0.847844 | 8.942938e-60 | 1.610236e-56 |
MsG0080049019.01 | MsG0480023211.01 | 0.823774 | 1.155767e-53 | 1.004773e-50 |
MsG0080049019.01 | MsG0480023217.01 | 0.880249 | 6.411628e-70 | 3.586001e-66 |
MsG0080049019.01 | MsG0480023242.01 | 0.842128 | 3.123400e-58 | 4.689812e-55 |
MsG0080049019.01 | MsG0480023244.01 | 0.856136 | 3.944812e-62 | 9.321001e-59 |
MsG0080049019.01 | MsG0480023264.01 | 0.814515 | 1.481568e-51 | 9.962256e-49 |
MsG0080049019.01 | MsG0480023319.01 | 0.844438 | 7.560888e-59 | 1.220578e-55 |
MsG0080049019.01 | MsG0480023332.01 | 0.817340 | 3.469947e-52 | 2.520211e-49 |
MsG0080049019.01 | MsG0480023376.01 | 0.886657 | 2.825697e-72 | 2.036605e-68 |
MsG0080049019.01 | MsG0480023469.01 | 0.846916 | 1.608070e-59 | 2.810699e-56 |
MsG0080049019.01 | MsG0480023480.01 | 0.828018 | 1.134755e-54 | 1.114273e-51 |
MsG0080049019.01 | MsG0480023481.01 | 0.884663 | 1.582425e-71 | 1.053257e-67 |
MsG0080049019.01 | MsG0480023482.01 | 0.893837 | 4.333733e-75 | 4.201401e-71 |
MsG0080049019.01 | MsG0480023483.01 | 0.850989 | 1.188639e-60 | 2.370873e-57 |
MsG0080049019.01 | MsG0480023531.01 | 0.830677 | 2.566178e-55 | 2.722847e-52 |
MsG0080049019.01 | MsG0480023695.01 | 0.900887 | 4.669605e-78 | 6.153732e-74 |
MsG0080049019.01 | MsG0480023704.01 | 0.815294 | 9.950235e-52 | 6.833096e-49 |
MsG0080049019.01 | MsG0480023705.01 | 0.850519 | 1.611567e-60 | 3.164791e-57 |
MsG0080049019.01 | MsG0480023717.01 | 0.826903 | 2.101372e-54 | 1.997297e-51 |
MsG0080049019.01 | MsG0480023749.01 | 0.863864 | 1.835772e-64 | 5.648629e-61 |
MsG0080049019.01 | MsG0480023818.01 | 0.882945 | 6.804085e-71 | 4.227887e-67 |
MsG0080049019.01 | MsG0480023850.01 | 0.847128 | 1.406299e-59 | 2.475180e-56 |
MsG0080049019.01 | MsG0480023851.01 | 0.811950 | 5.416324e-51 | 3.398635e-48 |
MsG0080049019.01 | MsG0480023993.01 | 0.877036 | 8.671482e-69 | 4.296917e-65 |
MsG0080049019.01 | MsG0580024128.01 | 0.812006 | 5.267495e-51 | 3.310256e-48 |
MsG0080049019.01 | MsG0580024135.01 | 0.867266 | 1.553727e-65 | 5.390819e-62 |
MsG0080049019.01 | MsG0580024140.01 | 0.850248 | 1.919740e-60 | 3.737216e-57 |
MsG0080049019.01 | MsG0580024278.01 | 0.898473 | 5.128549e-77 | 6.071130e-73 |
MsG0080049019.01 | MsG0580024309.01 | 0.892224 | 1.932209e-74 | 1.750351e-70 |
MsG0080049019.01 | MsG0580024372.01 | 0.814341 | 1.618655e-51 | 1.083267e-48 |
MsG0080049019.01 | MsG0580024398.01 | -0.857218 | 1.896216e-62 | 4.645757e-59 |
MsG0080049019.01 | MsG0580024442.01 | 0.885368 | 8.636158e-72 | 5.912664e-68 |
MsG0080049019.01 | MsG0580024488.01 | -0.831734 | 1.411069e-55 | 1.544974e-52 |
MsG0080049019.01 | MsG0580024493.01 | 0.905847 | 2.782517e-80 | 4.587108e-76 |
MsG0080049019.01 | MsG0580024571.01 | 0.863776 | 1.955362e-64 | 5.999553e-61 |
MsG0080049019.01 | MsG0580024678.01 | 0.898531 | 4.845399e-77 | 5.750157e-73 |
MsG0080049019.01 | MsG0580024688.01 | 0.824317 | 8.617700e-54 | 7.606224e-51 |
MsG0080049019.01 | MsG0580024804.01 | 0.829976 | 3.808106e-55 | 3.958936e-52 |
MsG0080049019.01 | MsG0580024875.01 | 0.846265 | 2.420402e-59 | 4.142540e-56 |
MsG0080049019.01 | MsG0580025105.01 | 0.904406 | 1.269061e-79 | 1.960378e-75 |
MsG0080049019.01 | MsG0580025259.01 | 0.841051 | 6.004786e-58 | 8.716879e-55 |
MsG0080049019.01 | MsG0580025315.01 | 0.840265 | 9.648943e-58 | 1.367062e-54 |
MsG0080049019.01 | MsG0580025317.01 | 0.808270 | 3.362819e-50 | 1.914423e-47 |
MsG0080049019.01 | MsG0580025355.01 | 0.831254 | 1.852430e-55 | 1.999093e-52 |
MsG0080049019.01 | MsG0580025392.01 | 0.890998 | 5.931639e-74 | 5.107522e-70 |
MsG0080049019.01 | MsG0580025447.01 | 0.841175 | 5.572729e-58 | 8.121120e-55 |
MsG0080049019.01 | MsG0580025480.01 | 0.871251 | 7.880869e-67 | 3.157473e-63 |
MsG0080049019.01 | MsG0580025486.01 | 0.890429 | 9.936980e-74 | 8.350659e-70 |
MsG0080049019.01 | MsG0580025573.01 | -0.802387 | 5.746348e-49 | 2.811366e-46 |
MsG0080049019.01 | MsG0580025620.01 | -0.857239 | 1.868584e-62 | 4.581244e-59 |
MsG0080049019.01 | MsG0580025983.01 | 0.820802 | 5.659179e-53 | 4.523284e-50 |
MsG0080049019.01 | MsG0580026073.01 | 0.869105 | 3.973347e-66 | 1.473122e-62 |
MsG0080049019.01 | MsG0580026211.01 | 0.832006 | 1.209307e-55 | 1.334600e-52 |
MsG0080049019.01 | MsG0580026362.01 | 0.878135 | 3.585913e-69 | 1.850880e-65 |
MsG0080049019.01 | MsG0580026492.01 | -0.802935 | 4.430838e-49 | 2.198024e-46 |
MsG0080049019.01 | MsG0580027095.01 | 0.864772 | 9.558468e-65 | 3.036840e-61 |
MsG0080049019.01 | MsG0580027249.01 | 0.812749 | 3.624838e-51 | 2.323700e-48 |
MsG0080049019.01 | MsG0580027276.01 | 0.854921 | 8.920500e-62 | 2.024247e-58 |
MsG0080049019.01 | MsG0580027325.01 | 0.882781 | 7.809497e-71 | 4.821511e-67 |
MsG0080049019.01 | MsG0580027646.01 | -0.820896 | 5.381964e-53 | 4.313192e-50 |
MsG0080049019.01 | MsG0580027677.01 | 0.823432 | 1.389808e-53 | 1.196398e-50 |
MsG0080049019.01 | MsG0580027750.01 | 0.812694 | 3.726273e-51 | 2.385321e-48 |
MsG0080049019.01 | MsG0580028159.01 | 0.841880 | 3.632639e-58 | 5.411886e-55 |
MsG0080049019.01 | MsG0580029172.01 | 0.855021 | 8.339405e-62 | 1.898754e-58 |
MsG0080049019.01 | MsG0580029177.01 | 0.861219 | 1.196738e-63 | 3.360938e-60 |
MsG0080049019.01 | MsG0580029623.01 | -0.813692 | 2.250218e-51 | 1.479663e-48 |
MsG0080049019.01 | MsG0580029792.01 | 0.859068 | 5.340316e-63 | 1.392327e-59 |
MsG0080049019.01 | MsG0580029816.01 | 0.818310 | 2.095511e-52 | 1.563036e-49 |
MsG0080049019.01 | MsG0580029820.01 | 0.802327 | 5.913437e-49 | 2.888681e-46 |
MsG0080049019.01 | MsG0580029991.01 | 0.808421 | 3.122300e-50 | 1.784514e-47 |
MsG0080049019.01 | MsG0580030014.01 | 0.874551 | 6.184842e-68 | 2.795443e-64 |
MsG0080049019.01 | MsG0580030067.01 | 0.807132 | 5.869179e-50 | 3.242998e-47 |
MsG0080049019.01 | MsG0580030197.01 | 0.889061 | 3.393260e-73 | 2.695621e-69 |
MsG0080049019.01 | MsG0580030203.01 | 0.806909 | 6.540808e-50 | 3.593427e-47 |
MsG0080049019.01 | MsG0580030237.01 | 0.883575 | 3.993868e-71 | 2.546535e-67 |
MsG0080049019.01 | MsG0680030315.01 | -0.803154 | 3.992159e-49 | 1.991589e-46 |
MsG0080049019.01 | MsG0680030439.01 | 0.890491 | 9.389949e-74 | 7.911198e-70 |
MsG0080049019.01 | MsG0680030441.01 | 0.830167 | 3.419853e-55 | 3.575102e-52 |
MsG0080049019.01 | MsG0680030545.01 | -0.817520 | 3.159775e-52 | 2.306345e-49 |
MsG0080049019.01 | MsG0680030635.01 | 0.880376 | 5.778850e-70 | 3.248486e-66 |
MsG0080049019.01 | MsG0680030658.01 | 0.838140 | 3.432664e-57 | 4.555617e-54 |
MsG0080049019.01 | MsG0680030756.01 | 0.804672 | 1.930436e-49 | 1.001374e-46 |
MsG0080049019.01 | MsG0680030875.01 | 0.867916 | 9.617297e-66 | 3.414527e-62 |
MsG0080049019.01 | MsG0680030878.01 | 0.855698 | 5.298974e-62 | 1.234016e-58 |
MsG0080049019.01 | MsG0680030960.01 | -0.827771 | 1.301680e-54 | 1.268818e-51 |
MsG0080049019.01 | MsG0680030961.01 | -0.826119 | 3.230323e-54 | 3.002067e-51 |
MsG0080049019.01 | MsG0680031178.01 | -0.810634 | 1.045397e-50 | 6.334563e-48 |
MsG0080049019.01 | MsG0680031204.01 | 0.858901 | 5.992368e-63 | 1.553578e-59 |
MsG0080049019.01 | MsG0680031449.01 | 0.800152 | 1.648021e-48 | 7.617917e-46 |
MsG0080049019.01 | MsG0680031813.01 | 0.888358 | 6.337965e-73 | 4.894718e-69 |
MsG0080049019.01 | MsG0680031866.01 | 0.847254 | 1.298965e-59 | 2.295333e-56 |
MsG0080049019.01 | MsG0680032197.01 | 0.865287 | 6.587042e-65 | 2.131553e-61 |
MsG0080049019.01 | MsG0680032840.01 | 0.807461 | 4.999310e-50 | 2.786214e-47 |
MsG0080049019.01 | MsG0680033902.01 | 0.805768 | 1.138139e-49 | 6.072930e-47 |
MsG0080049019.01 | MsG0680034139.01 | -0.804933 | 1.702962e-49 | 8.893891e-47 |
MsG0080049019.01 | MsG0680034229.01 | 0.876420 | 1.416937e-68 | 6.865268e-65 |
MsG0080049019.01 | MsG0680035368.01 | 0.833778 | 4.385394e-56 | 5.102258e-53 |
MsG0080049019.01 | MsG0680035584.01 | 0.883422 | 4.547390e-71 | 2.880690e-67 |
MsG0080049019.01 | MsG0680035841.01 | -0.823858 | 1.104330e-53 | 9.622829e-51 |
MsG0080049019.01 | MsG0680035870.01 | 0.869516 | 2.919426e-66 | 1.098939e-62 |
MsG0080049019.01 | MsG0780035993.01 | -0.820699 | 5.975973e-53 | 4.762627e-50 |
MsG0080049019.01 | MsG0780035994.01 | 0.897483 | 1.346349e-76 | 1.524027e-72 |
MsG0080049019.01 | MsG0780036064.01 | 0.870543 | 1.348137e-66 | 5.264432e-63 |
MsG0080049019.01 | MsG0780036067.01 | 0.874417 | 6.863566e-68 | 3.087354e-64 |
MsG0080049019.01 | MsG0780036068.01 | 0.873847 | 1.070648e-67 | 4.714949e-64 |
MsG0080049019.01 | MsG0780036236.01 | 0.811652 | 6.289970e-51 | 3.915282e-48 |
MsG0080049019.01 | MsG0780036909.01 | 0.872958 | 2.131492e-67 | 9.088867e-64 |
MsG0080049019.01 | MsG0780037458.01 | 0.854229 | 1.414329e-61 | 3.137490e-58 |
MsG0080049019.01 | MsG0780037698.01 | 0.878157 | 3.522763e-69 | 1.819908e-65 |
MsG0080049019.01 | MsG0780037734.01 | 0.861853 | 7.662820e-64 | 2.198484e-60 |
MsG0080049019.01 | MsG0780037751.01 | -0.801726 | 7.858446e-49 | 3.780204e-46 |
MsG0080049019.01 | MsG0780038030.01 | 0.822349 | 2.484762e-53 | 2.074561e-50 |
MsG0080049019.01 | MsG0780038047.01 | 0.902622 | 8.028423e-79 | 1.146892e-74 |
MsG0080049019.01 | MsG0780038108.01 | 0.816116 | 6.525933e-52 | 4.583767e-49 |
MsG0080049019.01 | MsG0780038197.01 | 0.840768 | 7.128118e-58 | 1.025788e-54 |
MsG0080049019.01 | MsG0780038305.01 | -0.835091 | 2.053210e-56 | 2.484512e-53 |
MsG0080049019.01 | MsG0780038496.01 | 0.803173 | 3.954884e-49 | 1.973977e-46 |
MsG0080049019.01 | MsG0780038573.01 | 0.858545 | 7.652117e-63 | 1.959965e-59 |
MsG0080049019.01 | MsG0780038834.01 | 0.847846 | 8.928658e-60 | 1.607780e-56 |
MsG0080049019.01 | MsG0780038848.01 | 0.813663 | 2.284393e-51 | 1.500934e-48 |
MsG0080049019.01 | MsG0780038922.01 | -0.808904 | 2.462714e-50 | 1.425373e-47 |
MsG0080049019.01 | MsG0780039287.01 | 0.871204 | 8.164067e-67 | 3.265493e-63 |
MsG0080049019.01 | MsG0780039382.01 | 0.809284 | 2.041748e-50 | 1.193874e-47 |
MsG0080049019.01 | MsG0780039431.01 | -0.850139 | 2.059882e-60 | 3.995322e-57 |
MsG0080049019.01 | MsG0780039593.01 | -0.845369 | 4.239881e-59 | 7.049661e-56 |
MsG0080049019.01 | MsG0780039596.01 | 0.808432 | 3.106884e-50 | 1.776194e-47 |
MsG0080049019.01 | MsG0780039702.01 | -0.816544 | 5.236623e-52 | 3.721164e-49 |
MsG0080049019.01 | MsG0780039704.01 | 0.840131 | 1.046173e-57 | 1.476155e-54 |
MsG0080049019.01 | MsG0780039816.01 | 0.836679 | 8.125929e-57 | 1.031440e-53 |
MsG0080049019.01 | MsG0780039821.01 | 0.890559 | 8.826857e-74 | 7.460916e-70 |
MsG0080049019.01 | MsG0780039836.01 | 0.877530 | 5.838408e-69 | 2.945361e-65 |
MsG0080049019.01 | MsG0780039838.01 | 0.889019 | 3.521393e-73 | 2.792907e-69 |
MsG0080049019.01 | MsG0780039839.01 | 0.890076 | 1.365981e-73 | 1.131291e-69 |
MsG0080049019.01 | MsG0780039859.01 | 0.816870 | 4.425211e-52 | 3.173029e-49 |
MsG0080049019.01 | MsG0780039860.01 | 0.887043 | 2.018044e-72 | 1.476979e-68 |
MsG0080049019.01 | MsG0780039879.01 | 0.832297 | 1.024430e-55 | 1.140088e-52 |
MsG0080049019.01 | MsG0780040072.01 | 0.874326 | 7.368900e-68 | 3.303057e-64 |
MsG0080049019.01 | MsG0780040121.01 | 0.902854 | 6.328292e-79 | 9.135816e-75 |
MsG0080049019.01 | MsG0780040158.01 | 0.851629 | 7.837522e-61 | 1.596095e-57 |
MsG0080049019.01 | MsG0780040159.01 | 0.871538 | 6.332049e-67 | 2.563482e-63 |
MsG0080049019.01 | MsG0780040167.01 | 0.809016 | 2.330391e-50 | 1.352852e-47 |
MsG0080049019.01 | MsG0780040283.01 | 0.861203 | 1.210062e-63 | 3.396210e-60 |
MsG0080049019.01 | MsG0780040321.01 | 0.848467 | 6.016205e-60 | 1.105260e-56 |
MsG0080049019.01 | MsG0780040352.01 | 0.850006 | 2.243779e-60 | 4.333498e-57 |
MsG0080049019.01 | MsG0780040429.01 | 0.885360 | 8.692825e-72 | 5.949723e-68 |
MsG0080049019.01 | MsG0780040437.01 | 0.837487 | 5.049032e-57 | 6.568718e-54 |
MsG0080049019.01 | MsG0780040640.01 | 0.850496 | 1.635371e-60 | 3.209082e-57 |
MsG0080049019.01 | MsG0780040644.01 | 0.821909 | 3.142083e-53 | 2.590553e-50 |
MsG0080049019.01 | MsG0780040649.01 | 0.811473 | 6.878919e-51 | 4.262154e-48 |
MsG0080049019.01 | MsG0780040685.01 | 0.895782 | 6.905383e-76 | 7.263719e-72 |
MsG0080049019.01 | MsG0780040702.01 | 0.811953 | 5.409163e-51 | 3.394342e-48 |
MsG0080049019.01 | MsG0780040804.01 | 0.845116 | 4.963859e-59 | 8.186566e-56 |
MsG0080049019.01 | MsG0780040805.01 | -0.821878 | 3.194160e-53 | 2.631256e-50 |
MsG0080049019.01 | MsG0780040806.01 | -0.808740 | 2.669667e-50 | 1.538447e-47 |
MsG0080049019.01 | MsG0780040833.01 | 0.833882 | 4.130000e-56 | 4.820346e-53 |
MsG0080049019.01 | MsG0780040838.01 | 0.863877 | 1.819289e-64 | 5.600395e-61 |
MsG0080049019.01 | MsG0780040892.01 | 0.890862 | 6.711643e-74 | 5.743799e-70 |
MsG0080049019.01 | MsG0780040894.01 | 0.806898 | 6.578529e-50 | 3.613014e-47 |
MsG0080049019.01 | MsG0780040977.01 | -0.812014 | 5.245286e-51 | 3.296966e-48 |
MsG0080049019.01 | MsG0780041007.01 | 0.823953 | 1.049206e-53 | 9.166870e-51 |
MsG0080049019.01 | MsG0780041035.01 | 0.833638 | 4.754161e-56 | 5.507507e-53 |
MsG0080049019.01 | MsG0780041075.01 | 0.833802 | 4.325700e-56 | 5.036574e-53 |
MsG0080049019.01 | MsG0780041079.01 | -0.809477 | 1.855741e-50 | 1.090678e-47 |
MsG0080049019.01 | MsG0780041106.01 | 0.870875 | 1.047973e-66 | 4.142363e-63 |
MsG0080049019.01 | MsG0780041121.01 | 0.859841 | 3.128413e-63 | 8.378233e-60 |
MsG0080049019.01 | MsG0780041173.01 | 0.877423 | 6.358273e-69 | 3.195695e-65 |
MsG0080049019.01 | MsG0780041254.01 | 0.888696 | 4.696258e-73 | 3.676003e-69 |
MsG0080049019.01 | MsG0780041296.01 | 0.807798 | 4.238718e-50 | 2.383134e-47 |
MsG0080049019.01 | MsG0780041316.01 | -0.821693 | 3.525736e-53 | 2.889054e-50 |
MsG0080049019.01 | MsG0780041478.01 | 0.893701 | 4.919564e-75 | 4.739806e-71 |
MsG0080049019.01 | MsG0780041492.01 | 0.849179 | 3.818298e-60 | 7.179519e-57 |
MsG0080049019.01 | MsG0780041531.01 | 0.853545 | 2.226448e-61 | 4.827994e-58 |
MsG0080049019.01 | MsG0780041620.01 | 0.905207 | 5.477260e-80 | 8.765312e-76 |
MsG0080049019.01 | MsG0780041637.01 | 0.903174 | 4.553946e-79 | 6.661282e-75 |
MsG0080049019.01 | MsG0780041663.01 | -0.824876 | 6.363519e-54 | 5.708582e-51 |
MsG0080049019.01 | MsG0780041691.01 | 0.877519 | 5.888356e-69 | 2.969392e-65 |
MsG0080049019.01 | MsG0780041720.01 | 0.897248 | 1.689358e-76 | 1.891797e-72 |
MsG0080049019.01 | MsG0780041768.01 | 0.803976 | 2.695247e-49 | 1.373352e-46 |
MsG0080049019.01 | MsG0780041783.01 | 0.908078 | 2.531856e-81 | 4.619623e-77 |
MsG0080049019.01 | MsG0780041809.01 | 0.897653 | 1.141483e-76 | 1.302579e-72 |
MsG0080049019.01 | MsG0880041835.01 | 0.882935 | 6.862077e-71 | 4.262207e-67 |
MsG0080049019.01 | MsG0880041855.01 | 0.895474 | 9.262503e-76 | 9.627264e-72 |
MsG0080049019.01 | MsG0880041908.01 | 0.889404 | 2.497162e-73 | 2.012065e-69 |
MsG0080049019.01 | MsG0880042043.01 | 0.841174 | 5.576150e-58 | 8.125848e-55 |
MsG0080049019.01 | MsG0880042122.01 | -0.819069 | 1.409033e-52 | 1.073262e-49 |
MsG0080049019.01 | MsG0880042291.01 | 0.843691 | 1.198926e-58 | 1.890877e-55 |
MsG0080049019.01 | MsG0880042495.01 | -0.812701 | 3.712821e-51 | 2.377157e-48 |
MsG0080049019.01 | MsG0880042588.01 | 0.871038 | 9.264390e-67 | 3.683043e-63 |
MsG0080049019.01 | MsG0880042694.01 | -0.809109 | 2.225718e-50 | 1.295401e-47 |
MsG0080049019.01 | MsG0880042858.01 | 0.880906 | 3.731351e-70 | 2.141684e-66 |
MsG0080049019.01 | MsG0880042889.01 | 0.833009 | 6.819631e-56 | 7.753860e-53 |
MsG0080049019.01 | MsG0880042895.01 | 0.821235 | 4.496676e-53 | 3.637761e-50 |
MsG0080049019.01 | MsG0880043032.01 | 0.802367 | 5.801495e-49 | 2.836874e-46 |
MsG0080049019.01 | MsG0880043069.01 | 0.880975 | 3.523552e-70 | 2.027549e-66 |
MsG0080049019.01 | MsG0880043109.01 | -0.813676 | 2.268572e-51 | 1.491115e-48 |
MsG0080049019.01 | MsG0880043343.01 | 0.814268 | 1.680264e-51 | 1.122264e-48 |
MsG0080049019.01 | MsG0880043364.01 | -0.848341 | 6.518750e-60 | 1.192541e-56 |
MsG0080049019.01 | MsG0880043472.01 | -0.840473 | 8.511763e-58 | 1.213720e-54 |
MsG0080049019.01 | MsG0880043786.01 | -0.803253 | 3.808109e-49 | 1.904578e-46 |
MsG0080049019.01 | MsG0880044339.01 | 0.913029 | 9.868981e-84 | 2.286787e-79 |
MsG0080049019.01 | MsG0880044352.01 | 0.820205 | 7.756112e-53 | 6.097661e-50 |
MsG0080049019.01 | MsG0880044387.01 | 0.845325 | 4.357972e-59 | 7.236488e-56 |
MsG0080049019.01 | MsG0880044548.01 | 0.842830 | 2.034931e-58 | 3.123177e-55 |
MsG0080049019.01 | MsG0880044713.01 | 0.826682 | 2.372150e-54 | 2.240156e-51 |
MsG0080049019.01 | MsG0880044715.01 | 0.824884 | 6.337449e-54 | 5.686509e-51 |
MsG0080049019.01 | MsG0880044968.01 | 0.856006 | 4.305312e-62 | 1.012971e-58 |
MsG0080049019.01 | MsG0880045063.01 | 0.875995 | 1.984223e-68 | 9.462385e-65 |
MsG0080049019.01 | MsG0880045073.01 | 0.816005 | 6.910357e-52 | 4.838980e-49 |
MsG0080049019.01 | MsG0880045188.01 | 0.900641 | 5.975316e-78 | 7.797348e-74 |
MsG0080049019.01 | MsG0880045252.01 | 0.814114 | 1.816328e-51 | 1.208079e-48 |
MsG0080049019.01 | MsG0880045274.01 | 0.830989 | 2.152500e-55 | 2.304959e-52 |
MsG0080049019.01 | MsG0880045321.01 | 0.842411 | 2.629017e-58 | 3.983192e-55 |
MsG0080049019.01 | MsG0880045369.01 | 0.888937 | 3.787937e-73 | 2.994632e-69 |
MsG0080049019.01 | MsG0880045374.01 | 0.859102 | 5.216507e-63 | 1.361651e-59 |
MsG0080049019.01 | MsG0880045385.01 | 0.894300 | 2.807251e-75 | 2.774712e-71 |
MsG0080049019.01 | MsG0880045413.01 | 0.895095 | 1.327015e-75 | 1.357073e-71 |
MsG0080049019.01 | MsG0880045414.01 | 0.867341 | 1.469470e-65 | 5.113198e-62 |
MsG0080049019.01 | MsG0880045457.01 | 0.859290 | 4.582616e-63 | 1.204038e-59 |
MsG0080049019.01 | MsG0880045458.01 | -0.832741 | 7.948794e-56 | 8.965272e-53 |
MsG0080049019.01 | MsG0880045630.01 | 0.815530 | 8.818898e-52 | 6.095664e-49 |
MsG0080049019.01 | MsG0880045683.01 | -0.810691 | 1.016316e-50 | 6.167780e-48 |
MsG0080049019.01 | MsG0880045697.01 | 0.820607 | 6.273799e-53 | 4.987028e-50 |
MsG0080049019.01 | MsG0880045698.01 | 0.804204 | 2.417236e-49 | 1.238793e-46 |
MsG0080049019.01 | MsG0880045703.01 | 0.865957 | 4.049125e-65 | 1.341737e-61 |
MsG0080049019.01 | MsG0880045755.01 | 0.826544 | 2.559714e-54 | 2.407648e-51 |
MsG0080049019.01 | MsG0880045778.01 | 0.876359 | 1.486664e-68 | 7.186154e-65 |
MsG0080049019.01 | MsG0880045968.01 | 0.889684 | 1.942597e-73 | 1.583225e-69 |
MsG0080049019.01 | MsG0880046010.01 | 0.854273 | 1.373474e-61 | 3.051212e-58 |
MsG0080049019.01 | MsG0880046040.01 | 0.873323 | 1.607854e-67 | 6.948513e-64 |
MsG0080049019.01 | MsG0880046104.01 | 0.822944 | 1.806025e-53 | 1.533553e-50 |
MsG0080049019.01 | MsG0880046105.01 | 0.852141 | 5.608140e-61 | 1.160808e-57 |
MsG0080049019.01 | MsG0880046149.01 | 0.811545 | 6.634582e-51 | 4.118583e-48 |
MsG0080049019.01 | MsG0880046150.01 | 0.839205 | 1.821035e-57 | 2.496919e-54 |
MsG0080049019.01 | MsG0880046151.01 | 0.891359 | 4.268223e-74 | 3.730353e-70 |
MsG0080049019.01 | MsG0880046167.01 | 0.908320 | 1.943949e-81 | 3.590192e-77 |
MsG0080049019.01 | MsG0880046174.01 | 0.849564 | 2.981981e-60 | 5.675677e-57 |
MsG0080049019.01 | MsG0880046189.01 | 0.853277 | 2.657633e-61 | 5.711561e-58 |
MsG0080049019.01 | MsG0880046219.01 | 0.908236 | 2.131380e-81 | 3.920057e-77 |
MsG0080049019.01 | MsG0880046341.01 | 0.887009 | 2.078770e-72 | 1.519461e-68 |
MsG0080049019.01 | MsG0880046462.01 | 0.818346 | 2.056492e-52 | 1.535553e-49 |
MsG0080049019.01 | MsG0880046469.01 | 0.904087 | 1.769097e-79 | 2.693272e-75 |
MsG0080049019.01 | MsG0880046584.01 | 0.840718 | 7.346008e-58 | 1.055496e-54 |
MsG0080049019.01 | MsG0880046630.01 | 0.870050 | 1.954569e-66 | 7.498531e-63 |
MsG0080049019.01 | MsG0880046639.01 | 0.836376 | 9.701551e-57 | 1.220391e-53 |
MsG0080049019.01 | MsG0880046759.01 | 0.823095 | 1.665730e-53 | 1.420486e-50 |
MsG0080049019.01 | MsG0880046838.01 | 0.821346 | 4.239780e-53 | 3.440462e-50 |
MsG0080049019.01 | MsG0880046863.01 | -0.830390 | 3.016831e-55 | 3.174069e-52 |
MsG0080049019.01 | MsG0880046876.01 | 0.898075 | 7.567107e-77 | 8.806065e-73 |
MsG0080049019.01 | MsG0880047318.01 | 0.912627 | 1.568357e-83 | 3.561043e-79 |
MsG0080049019.01 | MsG0880047363.01 | 0.830233 | 3.296228e-55 | 3.452474e-52 |
MsG0080049019.01 | MsG0880047406.01 | 0.813828 | 2.100206e-51 | 1.386105e-48 |
MsG0080049019.01 | MsG0880047465.01 | -0.815117 | 1.089456e-51 | 7.445120e-49 |
MsG0080049019.01 | MsG0880047493.01 | -0.864854 | 9.009217e-65 | 2.870036e-61 |
MsG0080049019.01 | MsG0880047578.01 | 0.804756 | 1.853721e-49 | 9.637145e-47 |
MsG0080049019.01 | MsG0880047627.01 | 0.845662 | 3.530480e-59 | 5.926597e-56 |
MsG0080049019.01 | MsG0880047628.01 | 0.865655 | 5.043806e-65 | 1.654045e-61 |
MsG0080049019.01 | MsG0880047661.01 | 0.868573 | 5.905197e-66 | 2.146731e-62 |
MsG0080049019.01 | MsG0880047727.01 | 0.807769 | 4.300193e-50 | 2.415792e-47 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049019.01.T01 | MTR_6g021510 | 94.737 | 285 | 8 | 3 | 1 | 285 | 1 | 278 | 0.0 | 524 |
MsG0080049019.01.T01 | MTR_6g021510 | 88.732 | 213 | 17 | 3 | 1 | 213 | 1 | 206 | 1.61e-120 | 345 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsG0080049019.01.T01 | AT1G26180 | 59.926 | 272 | 95 | 5 | 25 | 285 | 21 | 289 | 1.21e-108 | 317 |
MsG0080049019.01.T01 | AT1G26180 | 55.307 | 179 | 66 | 5 | 25 | 192 | 21 | 196 | 3.64e-58 | 185 |
Find 35 sgRNAs with CRISPR-Local
Find 303 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TCCATGTTTGCTGCTCTTAC+TGG | 0.140429 | contig611end:-14856 | MsG0080049019.01.T01:exon |
TTCTGATACACTTCCCCTTC+TGG | 0.257259 | contig611end:+14901 | MsG0080049019.01.T01:intergenic |
CAACAATGATGAAGAAGTTA+AGG | 0.331621 | contig611end:-14932 | MsG0080049019.01.T01:exon |
GAGAAAGTGGGAAGTGGGTT+TGG | 0.355078 | contig611end:+15072 | MsG0080049019.01.T01:intergenic |
ATTAGAGCTCAATACATATA+TGG | 0.355314 | contig611end:+15196 | MsG0080049019.01.T01:intergenic |
AAGTGGGTTTGGTTTGGAAA+TGG | 0.378361 | contig611end:+15083 | MsG0080049019.01.T01:intergenic |
AGTGGGAAGTGGGTTTGGTT+TGG | 0.383262 | contig611end:+15077 | MsG0080049019.01.T01:intergenic |
GAGTAATGCTCTTGCTATTG+AGG | 0.388464 | contig611end:-14818 | MsG0080049019.01.T01:intron |
CAAGGTCGTGTTTGGTTCGT+TGG | 0.393160 | contig611end:+15168 | MsG0080049019.01.T01:intergenic |
AAAGATTTCAAGGTCGTGTT+TGG | 0.396799 | contig611end:+15160 | MsG0080049019.01.T01:intergenic |
CCATGTTTGCTGCTCTTACT+GGG | 0.408995 | contig611end:-14855 | MsG0080049019.01.T01:exon |
CACGTTCATTCTCTCTTCAA+AGG | 0.430651 | contig611end:-14981 | MsG0080049019.01.T01:exon |
TGGAGAGAGAAAGTGGGAAG+TGG | 0.431283 | contig611end:+15066 | MsG0080049019.01.T01:intergenic |
GGAGAGAGAAAGTGGGAAGT+GGG | 0.447148 | contig611end:+15067 | MsG0080049019.01.T01:intergenic |
AGTTTGAGAGGAAGTTTCAA+TGG | 0.456612 | contig611end:+15009 | MsG0080049019.01.T01:intergenic |
GTAAGAGTGGAGAGAGAAAG+TGG | 0.456947 | contig611end:+15059 | MsG0080049019.01.T01:intergenic |
GTTTGCTGCTCTTACTGGGT+TGG | 0.463808 | contig611end:-14851 | MsG0080049019.01.T01:exon |
AGGAGAAGATGAAGGGAGAA+TGG | 0.470771 | contig611end:+15106 | MsG0080049019.01.T01:intergenic |
ACGTTCATTCTCTCTTCAAA+GGG | 0.480590 | contig611end:-14980 | MsG0080049019.01.T01:exon |
TGGGTTTGGTTTGGAAATGG+AGG | 0.489626 | contig611end:+15086 | MsG0080049019.01.T01:intergenic |
CCCAGTAAGAGCAGCAAACA+TGG | 0.492125 | contig611end:+14855 | MsG0080049019.01.T01:intergenic |
GGAAATGGAGGAGAAGATGA+AGG | 0.492474 | contig611end:+15098 | MsG0080049019.01.T01:intergenic |
ATCATGGAGAAAAGATTTCA+AGG | 0.510342 | contig611end:+15150 | MsG0080049019.01.T01:intergenic |
GAAGAGAGAGAAAGTAAGAG+TGG | 0.523518 | contig611end:+15046 | MsG0080049019.01.T01:intergenic |
TAAGAGTGGAGAGAGAAAGT+GGG | 0.524810 | contig611end:+15060 | MsG0080049019.01.T01:intergenic |
GAACGTGGTTTGAGTTTGAG+AGG | 0.526236 | contig611end:+14997 | MsG0080049019.01.T01:intergenic |
TAAGGATTTGTCACCAGAAG+GGG | 0.547246 | contig611end:-14914 | MsG0080049019.01.T01:exon |
AGTTTCAATGGTGGTGATGA+TGG | 0.561851 | contig611end:+15021 | MsG0080049019.01.T01:intergenic |
GTTAAGGATTTGTCACCAGA+AGG | 0.563643 | contig611end:-14916 | MsG0080049019.01.T01:exon |
TTGAGAGGAAGTTTCAATGG+TGG | 0.574319 | contig611end:+15012 | MsG0080049019.01.T01:intergenic |
GAAATGGAGGAGAAGATGAA+GGG | 0.581880 | contig611end:+15099 | MsG0080049019.01.T01:intergenic |
TTAAGGATTTGTCACCAGAA+GGG | 0.582153 | contig611end:-14915 | MsG0080049019.01.T01:exon |
CTTTGAAGAGAGAATGAACG+TGG | 0.604224 | contig611end:+14982 | MsG0080049019.01.T01:intergenic |
GTATCAGAAGACACTTCAGT+TGG | 0.638228 | contig611end:-14887 | MsG0080049019.01.T01:exon |
TTCAATGGTGGTGATGATGG+CGG | 0.713813 | contig611end:+15024 | MsG0080049018.01.T01:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!!! | GTTATTTTGAATTTAAATTT+GGG | - | contig611end:10408-10427 | MsG0080049019.01.T01:intron | 10.0% |
!!! | TGTTATTTTGAATTTAAATT+TGG | - | contig611end:10407-10426 | MsG0080049019.01.T01:intron | 10.0% |
!!! | TTTTCACAATATTTTTATAA+TGG | - | contig611end:14145-14164 | MsG0080049019.01.T01:intron | 10.0% |
!! | GAATAATAAGTTTACAAAAA+TGG | - | contig611end:11965-11984 | MsG0080049019.01.T01:intron | 15.0% |
!! | GATTATATTTATATTTGATG+AGG | - | contig611end:12914-12933 | MsG0080049019.01.T01:intron | 15.0% |
!! | GTTATTGTGAATAAAATATT+GGG | - | contig611end:11350-11369 | MsG0080049019.01.T01:intron | 15.0% |
!! | GTTTATAAATGATTAGTATA+TGG | + | contig611end:12951-12970 | MsG0080049019.01.T01:intergenic | 15.0% |
!! | TGTTATTATATATGTTTGTT+TGG | - | contig611end:11844-11863 | MsG0080049019.01.T01:intron | 15.0% |
!! | TGTTATTGTGAATAAAATAT+TGG | - | contig611end:11349-11368 | MsG0080049019.01.T01:intron | 15.0% |
!! | TTAATTCATATGCAAAATAT+TGG | + | contig611end:13424-13443 | MsG0080049019.01.T01:intergenic | 15.0% |
!!! | CATAAATGTCATAATTTTAT+TGG | + | contig611end:13103-13122 | MsG0080049019.01.T01:intergenic | 15.0% |
!!! | GTTATAAAGAATCAAATTTT+GGG | - | contig611end:11022-11041 | MsG0080049019.01.T01:intron | 15.0% |
!!! | TACTGTTTTCTTTATTTTTT+AGG | - | contig611end:12376-12395 | MsG0080049019.01.T01:intron | 15.0% |
!!! | TATGTTTTTTTTATAGTTGT+CGG | - | contig611end:12808-12827 | MsG0080049019.01.T01:intron | 15.0% |
!!! | TGTTATAAAGAATCAAATTT+TGG | - | contig611end:11021-11040 | MsG0080049019.01.T01:intron | 15.0% |
!!! | TTAGGTATTTCATTTATTTT+TGG | - | contig611end:12454-12473 | MsG0080049019.01.T01:intron | 15.0% |
!!! | TTGCAATATAAAGATTTTAA+AGG | + | contig611end:12179-12198 | MsG0080049019.01.T01:intergenic | 15.0% |
!!! | TTTATTTTTTAGGTTAGAAT+TGG | - | contig611end:12386-12405 | MsG0080049019.01.T01:intron | 15.0% |
!! | AAAATTAGGAGATAAAATTG+TGG | + | contig611end:14274-14293 | MsG0080049019.01.T01:intergenic | 20.0% |
!! | AAAGTATAATCACATCAAAT+GGG | + | contig611end:14127-14146 | MsG0080049019.01.T01:intergenic | 20.0% |
!! | AAATTGGATATTTGTTTGTA+AGG | - | contig611end:11926-11945 | MsG0080049019.01.T01:intron | 20.0% |
!! | AATACAAAACTGAACTTAAT+CGG | + | contig611end:13250-13269 | MsG0080049019.01.T01:intergenic | 20.0% |
!! | AATGAGATTCAAATTGAATA+TGG | + | contig611end:15016-15035 | MsG0080049019.01.T01:intergenic | 20.0% |
!! | CTTATTATATTATGTCAAAC+AGG | + | contig611end:12989-13008 | MsG0080049019.01.T01:intergenic | 20.0% |
!! | GTTATTGTGAATCAAAATTT+GGG | - | contig611end:10875-10894 | MsG0080049019.01.T01:intron | 20.0% |
!! | GTTATTGTTAGTCAAAATTT+GGG | - | contig611end:10590-10609 | MsG0080049019.01.T01:intron | 20.0% |
!! | TAAAATCTAAATGTTTGAGA+CGG | - | contig611end:12033-12052 | MsG0080049019.01.T01:intron | 20.0% |
!! | TAGCTTATTTCAACTAAAAA+AGG | + | contig611end:13918-13937 | MsG0080049019.01.T01:intergenic | 20.0% |
!! | TGATAAGCTATAGAAAAAAT+TGG | - | contig611end:10509-10528 | MsG0080049019.01.T01:intron | 20.0% |
!! | TGGTTAGTATTAACAAAAAT+GGG | - | contig611end:12406-12425 | MsG0080049019.01.T01:intron | 20.0% |
!! | TGTTATTGTGAATCAAAATT+TGG | - | contig611end:10874-10893 | MsG0080049019.01.T01:intron | 20.0% |
!! | TGTTATTGTTAGTCAAAATT+TGG | - | contig611end:10589-10608 | MsG0080049019.01.T01:intron | 20.0% |
!! | TGTTTATGTTATGTATTCAA+GGG | + | contig611end:15190-15209 | MsG0080049019.01.T01:intergenic | 20.0% |
!! | TTCTTACAAAAAATGGTTTA+TGG | + | contig611end:13458-13477 | MsG0080049019.01.T01:intergenic | 20.0% |
!! | TTGGTTAGTATTAACAAAAA+TGG | - | contig611end:12405-12424 | MsG0080049019.01.T01:intron | 20.0% |
!! | TTGTTTATGTTATGTATTCA+AGG | + | contig611end:15191-15210 | MsG0080049019.01.T01:intergenic | 20.0% |
!!! | AAAAGTATAATCACATCAAA+TGG | + | contig611end:14128-14147 | MsG0080049019.01.T01:intergenic | 20.0% |
!!! | AAATGAAAAAGAAAAGCATA+TGG | - | contig611end:13207-13226 | MsG0080049019.01.T01:intron | 20.0% |
!!! | AAATTGGATTTTTATTTGTG+TGG | - | contig611end:10525-10544 | MsG0080049019.01.T01:intron | 20.0% |
!!! | AATTAACTACCAATTTTGAT+TGG | - | contig611end:15107-15126 | MsG0080049019.01.T01:exon | 20.0% |
!!! | ATTAACTACCAATTTTGATT+GGG | - | contig611end:15108-15127 | MsG0080049019.01.T01:exon | 20.0% |
!!! | CGATTTTCTCAAATATTTAT+CGG | - | contig611end:14763-14782 | MsG0080049019.01.T01:intron | 20.0% |
!!! | TAATAATTTTGGTTGAGAAT+TGG | - | contig611end:10648-10667 | MsG0080049019.01.T01:CDS | 20.0% |
!!! | TAATGGGTTTGTAATAATTT+TGG | - | contig611end:10637-10656 | MsG0080049019.01.T01:CDS | 20.0% |
!!! | TAATGGTCTTATATTGATTT+TGG | - | contig611end:10922-10941 | MsG0080049019.01.T01:intron | 20.0% |
!!! | TAATGTGTTTGTATTCTTTT+TGG | - | contig611end:11723-11742 | MsG0080049019.01.T01:intron | 20.0% |
!!! | TATTCTTTTTGGTTGAAAAT+TGG | - | contig611end:11734-11753 | MsG0080049019.01.T01:intron | 20.0% |
!!! | TGAATTTAAATTTGGGTTTT+TGG | - | contig611end:10415-10434 | MsG0080049019.01.T01:intron | 20.0% |
!!! | TGTTTTTTGTTTTTGTTTTC+TGG | - | contig611end:12488-12507 | MsG0080049019.01.T01:CDS | 20.0% |
!!! | TTTACAAAAATGGATTTTCA+GGG | - | contig611end:11975-11994 | MsG0080049019.01.T01:intron | 20.0% |
!!! | TTTATTTTTTGCATCTTATC+AGG | - | contig611end:14026-14045 | MsG0080049019.01.T01:intron | 20.0% |
! | AAACAAAAAACAGAAAAGTG+AGG | + | contig611end:12480-12499 | MsG0080049019.01.T01:intergenic | 25.0% |
! | AAACTCGAATATTTGTTTGT+GGG | - | contig611end:12322-12341 | MsG0080049019.01.T01:intron | 25.0% |
! | AACTTCATATATACCCTATT+TGG | - | contig611end:14584-14603 | MsG0080049019.01.T01:intron | 25.0% |
! | AAGGAAATAGAATAGGATAA+TGG | - | contig611end:11403-11422 | MsG0080049019.01.T01:intron | 25.0% |
! | AAGGAACTAGAATAGAATAA+TGG | - | contig611end:10461-10480 | MsG0080049019.01.T01:intron | 25.0% |
! | AAGTATCAATGATTTAGTGT+CGG | + | contig611end:11140-11159 | MsG0080049019.01.T01:intergenic | 25.0% |
! | ACTATGATGTACGAAAAATT+AGG | + | contig611end:14288-14307 | MsG0080049019.01.T01:intergenic | 25.0% |
! | ACTTCATATATACCCTATTT+GGG | - | contig611end:14585-14604 | MsG0080049019.01.T01:intron | 25.0% |
! | AGGAAATAGAATAGGATAAT+GGG | - | contig611end:11404-11423 | MsG0080049019.01.T01:intron | 25.0% |
! | AGGAACTAGAATAGAATAAT+GGG | - | contig611end:10462-10481 | MsG0080049019.01.T01:intron | 25.0% |
! | AGGGTAAAATTGTACATAAA+AGG | + | contig611end:15135-15154 | MsG0080049019.01.T01:intergenic | 25.0% |
! | ATTAGAGCTCAATACATATA+TGG | + | contig611end:10007-10026 | MsG0080049019.01.T01:intergenic | 25.0% |
! | CACTTTGTGAATCAAAATTT+GGG | - | contig611end:11816-11835 | MsG0080049019.01.T01:intron | 25.0% |
! | GAAATGTTCAAACTATCAAA+AGG | + | contig611end:13835-13854 | MsG0080049019.01.T01:intergenic | 25.0% |
! | GGATAAGGAAATAGAATAAT+GGG | - | contig611end:10621-10640 | MsG0080049019.01.T01:CDS | 25.0% |
! | GGTATAAACTATGTCAATTT+AGG | + | contig611end:15066-15085 | MsG0080049019.01.T01:intergenic | 25.0% |
! | GGTTAAGTAACTAGAATAAT+GGG | - | contig611end:11865-11884 | MsG0080049019.01.T01:intron | 25.0% |
! | GTATATATGAAGTTCATTGA+AGG | + | contig611end:14578-14597 | MsG0080049019.01.T01:intergenic | 25.0% |
! | TCAAGTTAATCACAATACTT+AGG | - | contig611end:13797-13816 | MsG0080049019.01.T01:intron | 25.0% |
! | TCACTTTGTGAATCAAAATT+TGG | - | contig611end:11815-11834 | MsG0080049019.01.T01:intron | 25.0% |
! | TGGATAAGGAAATAGAATAA+TGG | - | contig611end:10620-10639 | MsG0080049019.01.T01:CDS | 25.0% |
! | TGGTTAAGGAAATAGATTAA+TGG | - | contig611end:10905-10924 | MsG0080049019.01.T01:intron | 25.0% |
! | TGGTTAAGGAATTAGAATAA+TGG | - | contig611end:11068-11087 | MsG0080049019.01.T01:intron | 25.0% |
! | TGGTTAAGTAACTAGAATAA+TGG | - | contig611end:11864-11883 | MsG0080049019.01.T01:intron | 25.0% |
! | TTAGAGTTCACTTTACATTA+TGG | + | contig611end:15087-15106 | MsG0080049019.01.T01:intergenic | 25.0% |
! | TTCAACTAAAAAAGGATCAA+TGG | + | contig611end:13910-13929 | MsG0080049019.01.T01:intergenic | 25.0% |
! | TTCATAGCTTATATTTCTTG+AGG | - | contig611end:14833-14852 | MsG0080049019.01.T01:exon | 25.0% |
! | TTCTTTATAACAAACCTCTT+TGG | + | contig611end:11013-11032 | MsG0080049019.01.T01:intergenic | 25.0% |
! | TTTATTAAAAGCTTCCATGA+AGG | - | contig611end:12842-12861 | MsG0080049019.01.T01:intron | 25.0% |
! | TTTGGTTAAGGAAATAGAAT+AGG | - | contig611end:11396-11415 | MsG0080049019.01.T01:intron | 25.0% |
!! | AAATTAGATCTTTGTTTGTG+TGG | - | contig611end:11286-11305 | MsG0080049019.01.T01:intron | 25.0% |
!! | AACAAAGATCCAATTTTTGT+CGG | + | contig611end:10807-10826 | MsG0080049019.01.T01:intergenic | 25.0% |
!! | CAATTTTCTCAAATTATCAC+TGG | + | contig611end:11167-11186 | MsG0080049019.01.T01:intergenic | 25.0% |
!! | GAAGTTTCATTTCATGTTTT+AGG | - | contig611end:12436-12455 | MsG0080049019.01.T01:intron | 25.0% |
!! | GATATATCAGCTTATAGTTT+TGG | + | contig611end:13145-13164 | MsG0080049019.01.T01:intergenic | 25.0% |
!! | GATTTCATCCTTTTTGATAA+GGG | - | contig611end:14221-14240 | MsG0080049019.01.T01:intron | 25.0% |
!! | GTGATTTTATTAAAGATCCA+AGG | + | contig611end:14379-14398 | MsG0080049019.01.T01:intergenic | 25.0% |
!! | TATGTTTTCCCTTATCAAAA+AGG | + | contig611end:14232-14251 | MsG0080049019.01.T01:intergenic | 25.0% |
!! | TGATTTCATCCTTTTTGATA+AGG | - | contig611end:14220-14239 | MsG0080049019.01.T01:intron | 25.0% |
!! | TTTGTTTGATAAGGTTTGTT+TGG | - | contig611end:11048-11067 | MsG0080049019.01.T01:intron | 25.0% |
!!! | AAATTGCATTTTTGTTTGTG+TGG | - | contig611end:10958-10977 | MsG0080049019.01.T01:intron | 25.0% |
!!! | ATTTTTGTTGTTCTTGTTGT+AGG | - | contig611end:12669-12688 | MsG0080049019.01.T01:CDS | 25.0% |
!!! | GGATTTTTGTTTGTATTGTT+TGG | - | contig611end:11775-11794 | MsG0080049019.01.T01:intron | 25.0% |
!!! | GGGTCTTTTGTTTTTATATA+GGG | - | contig611end:11370-11389 | MsG0080049019.01.T01:intron | 25.0% |
!!! | GGTTTTTATATTGGTTTGTT+TGG | - | contig611end:10436-10455 | MsG0080049019.01.T01:intron | 25.0% |
!!! | GTTTACAAAAATGGATTTTC+AGG | - | contig611end:11974-11993 | MsG0080049019.01.T01:intron | 25.0% |
!!! | TAATGGGTTTGTATTCATTT+TGG | - | contig611end:11881-11900 | MsG0080049019.01.T01:intron | 25.0% |
!!! | TATATTGGTTTGTTTGGTTA+AGG | - | contig611end:10442-10461 | MsG0080049019.01.T01:intron | 25.0% |
!!! | TCTGTTTTTCTTACTAGAAT+GGG | - | contig611end:14939-14958 | MsG0080049019.01.T01:exon | 25.0% |
!!! | TGGGTCTTTTGTTTTTATAT+AGG | - | contig611end:11369-11388 | MsG0080049019.01.T01:intron | 25.0% |
!!! | TGGGTTTTTGGTTTTTATAT+TGG | - | contig611end:10427-10446 | MsG0080049019.01.T01:intron | 25.0% |
!!! | TGTTTTTATATAGGGTTGTT+TGG | - | contig611end:11378-11397 | MsG0080049019.01.T01:intron | 25.0% |
!!! | TTACAAAAATGGATTTTCAG+GGG | - | contig611end:11976-11995 | MsG0080049019.01.T01:intron | 25.0% |
!!! | TTCTGTTTTTCTTACTAGAA+TGG | - | contig611end:14938-14957 | MsG0080049019.01.T01:exon | 25.0% |
!!! | TTGATTTGCTTTTTTGTTTC+AGG | - | contig611end:14869-14888 | MsG0080049019.01.T01:exon | 25.0% |
AAAGAACAGCATTGTAATCA+AGG | + | contig611end:15155-15174 | MsG0080049018.01.T01:intergenic | 30.0% | |
AACATACCAAAATCCCAAAT+AGG | + | contig611end:14601-14620 | MsG0080049019.01.T01:intergenic | 30.0% | |
AAGAAATTCTCTTACCATTG+AGG | - | contig611end:11632-11651 | MsG0080049019.01.T01:intron | 30.0% | |
AAGAACAGCATTGTAATCAA+GGG | + | contig611end:15154-15173 | MsG0080049019.01.T01:intergenic | 30.0% | |
ACACAAGTATTTACCACAAA+AGG | + | contig611end:13548-13567 | MsG0080049019.01.T01:intergenic | 30.0% | |
ACATACCAAAATCCCAAATA+GGG | + | contig611end:14600-14619 | MsG0080049019.01.T01:intergenic | 30.0% | |
AGTTGCTTAACAAAATGCAA+TGG | - | contig611end:12610-12629 | MsG0080049019.01.T01:intron | 30.0% | |
ATAAGATTCGAGTCACAAAT+TGG | + | contig611end:13063-13082 | MsG0080049019.01.T01:intergenic | 30.0% | |
ATCAAATGGGTATAAGATTG+AGG | + | contig611end:14114-14133 | MsG0080049019.01.T01:intergenic | 30.0% | |
ATCATGGAGAAAAGATTTCA+AGG | + | contig611end:10053-10072 | MsG0080049019.01.T01:intergenic | 30.0% | |
ATGATTAGTATATGGTAAGC+AGG | + | contig611end:12943-12962 | MsG0080049019.01.T01:intergenic | 30.0% | |
ATTGTTAGCTATGGGAAAAT+TGG | - | contig611end:11910-11929 | MsG0080049019.01.T01:intron | 30.0% | |
CAAACTCGAATATTTGTTTG+TGG | - | contig611end:12321-12340 | MsG0080049019.01.T01:intron | 30.0% | |
CAACAATGATGAAGAAGTTA+AGG | - | contig611end:10268-10287 | MsG0080049019.01.T01:CDS | 30.0% | |
CAAGTTCAATGCATAGTAAT+AGG | + | contig611end:13320-13339 | MsG0080049019.01.T01:intergenic | 30.0% | |
CAGGTGATAATTTGAGAAAA+TGG | - | contig611end:11518-11537 | MsG0080049019.01.T01:intron | 30.0% | |
CTCAGTGTAATTATATGTGT+CGG | + | contig611end:14738-14757 | MsG0080049019.01.T01:intergenic | 30.0% | |
GAAAAACAGAATACAACATG+TGG | + | contig611end:14929-14948 | MsG0080049019.01.T01:intergenic | 30.0% | |
GAAATATAAGCTATGAAGCA+TGG | + | contig611end:14830-14849 | MsG0080049019.01.T01:intergenic | 30.0% | |
GGATATTTGTTTGTAAGGTT+TGG | - | contig611end:11931-11950 | MsG0080049019.01.T01:intron | 30.0% | |
GGTTGAAAATTGTTAGCTAT+GGG | - | contig611end:11902-11921 | MsG0080049019.01.T01:intron | 30.0% | |
GTACCTGTAAAACATGAATA+AGG | + | contig611end:14173-14192 | MsG0080049019.01.T01:intergenic | 30.0% | |
TAAAAGGTCCCAATCAAAAT+TGG | + | contig611end:15119-15138 | MsG0080049019.01.T01:intergenic | 30.0% | |
TATATAGGGTTGTTTGGTTA+AGG | - | contig611end:11384-11403 | MsG0080049019.01.T01:intron | 30.0% | |
TCAGCAGTTCTTACAAAAAA+TGG | + | contig611end:13465-13484 | MsG0080049019.01.T01:intergenic | 30.0% | |
TCTCAAATATTTATCGGTGT+CGG | - | contig611end:14769-14788 | MsG0080049019.01.T01:intron | 30.0% | |
TGGTTGAAAATTGTTAGCTA+TGG | - | contig611end:11901-11920 | MsG0080049019.01.T01:intron | 30.0% | |
TTCACAATAACAAACCTCAA+TGG | + | contig611end:10866-10885 | MsG0080049019.01.T01:intergenic | 30.0% | |
TTCTAAATTGCAACAAAACG+CGG | - | contig611end:12113-12132 | MsG0080049019.01.T01:intron | 30.0% | |
TTGAATGTAATCACGTGTAT+CGG | - | contig611end:11193-11212 | MsG0080049019.01.T01:intron | 30.0% | |
TTGTGGTATAAGTACATGTT+TGG | + | contig611end:14436-14455 | MsG0080049019.01.T01:intergenic | 30.0% | |
TTTATTAAAGATCCAAGGTG+TGG | + | contig611end:14374-14393 | MsG0080049019.01.T01:intergenic | 30.0% | |
! | ACAAGAACATTTTATGAGAC+TGG | - | contig611end:12890-12909 | MsG0080049019.01.T01:intron | 30.0% |
! | ACTATCAAAAGGTGTAGATA+AGG | + | contig611end:13824-13843 | MsG0080049019.01.T01:intergenic | 30.0% |
! | ATAAGTTTTCAGTGGAATCA+TGG | + | contig611end:10069-10088 | MsG0080049019.01.T01:intergenic | 30.0% |
! | CACAAACAAATATTCGAGTT+TGG | + | contig611end:12323-12342 | MsG0080049019.01.T01:intergenic | 30.0% |
! | CTATCAAAAGGTGTAGATAA+GGG | + | contig611end:13823-13842 | MsG0080049019.01.T01:intergenic | 30.0% |
! | GAACCTTATTCATGTTTTAC+AGG | - | contig611end:14167-14186 | MsG0080049019.01.T01:intron | 30.0% |
! | GGTTTTTATGTAGGTTTATC+CGG | - | contig611end:11686-11705 | MsG0080049019.01.T01:intron | 30.0% |
! | GTTTTTATGTAGGTTTATCC+GGG | - | contig611end:11687-11706 | MsG0080049019.01.T01:intron | 30.0% |
! | TGATAAGGTTTGTTTGGTTA+AGG | - | contig611end:11054-11073 | MsG0080049019.01.T01:intron | 30.0% |
!! | AAAAGTGTCAATGCAACAAT+GGG | - | contig611end:11254-11273 | MsG0080049019.01.T01:intron | 30.0% |
!! | ATACTTTTGTTTGTCTTGTC+CGG | - | contig611end:12703-12722 | MsG0080049019.01.T01:intron | 30.0% |
!! | ATATACCCTATTTGGGATTT+TGG | - | contig611end:14592-14611 | MsG0080049019.01.T01:intron | 30.0% |
!! | ATCAAAATTTGGGTCTTGTT+TGG | - | contig611end:10885-10904 | MsG0080049019.01.T01:intron | 30.0% |
!! | CTGTTTTTCTTACTAGAATG+GGG | - | contig611end:14940-14959 | MsG0080049019.01.T01:exon | 30.0% |
!! | TGACACTAACTTGTTGAAAT+TGG | - | contig611end:10693-10712 | MsG0080049019.01.T01:intron | 30.0% |
!!! | CTGTTTTTTTCTTCCTTTTG+TGG | - | contig611end:13532-13551 | MsG0080049019.01.T01:intron | 30.0% |
!!! | CTTTTTTTGGGGTTGAAAAT+TGG | - | contig611end:12287-12306 | MsG0080049019.01.T01:intron | 30.0% |
!!! | GGTCTTATATTGATTTTGGT+TGG | - | contig611end:10926-10945 | MsG0080049019.01.T01:intron | 30.0% |
!!! | TAATGGGTTTGTGTTCTTTT+TGG | - | contig611end:10478-10497 | MsG0080049019.01.T01:intron | 30.0% |
!!! | TTTGGGTGTTTTGTTTGATA+AGG | - | contig611end:11039-11058 | MsG0080049019.01.T01:intron | 30.0% |
!!! | TTTTTTGCATCTTATCAGGT+TGG | - | contig611end:14030-14049 | MsG0080049019.01.T01:intron | 30.0% |
AAAGATTTCAAGGTCGTGTT+TGG | + | contig611end:10043-10062 | MsG0080049018.01.T01:intergenic | 35.0% | |
AAATAAGCTAAGCGTGTGTT+TGG | - | contig611end:13928-13947 | MsG0080049019.01.T01:intron | 35.0% | |
ACGTTCATTCTCTCTTCAAA+GGG | - | contig611end:10220-10239 | MsG0080049019.01.T01:CDS | 35.0% | |
AGGAAAACAAATACGTCAGT+AGG | + | contig611end:14460-14479 | MsG0080049019.01.T01:intergenic | 35.0% | |
AGTTTGAGAGGAAGTTTCAA+TGG | + | contig611end:10194-10213 | MsG0080049019.01.T01:intergenic | 35.0% | |
ATAGCTTTCTCTAACCATCT+TGG | + | contig611end:14987-15006 | MsG0080049019.01.T01:intergenic | 35.0% | |
ATGCATTGAACTTGTGACTT+GGG | - | contig611end:13326-13345 | MsG0080049019.01.T01:intron | 35.0% | |
ATTAGTATATGGTAAGCAGG+TGG | + | contig611end:12940-12959 | MsG0080049019.01.T01:intergenic | 35.0% | |
CGTACATCATAGTACATGTT+TGG | - | contig611end:14295-14314 | MsG0080049019.01.T01:intron | 35.0% | |
CTAAACAGTTTGATCCTTCA+TGG | + | contig611end:12859-12878 | MsG0080049019.01.T01:intergenic | 35.0% | |
CTTCACTAAAATTGCCAAGA+TGG | - | contig611end:14970-14989 | MsG0080049019.01.T01:exon | 35.0% | |
GATGTTCAAAATGTGTGAGT+TGG | - | contig611end:13025-13044 | MsG0080049019.01.T01:intron | 35.0% | |
GGGTATAAGATTGAGGTAAA+AGG | + | contig611end:14107-14126 | MsG0080049019.01.T01:intergenic | 35.0% | |
TAAGCTATGAAGCATGGATA+CGG | + | contig611end:14824-14843 | MsG0080049019.01.T01:intergenic | 35.0% | |
TATGCATTGAACTTGTGACT+TGG | - | contig611end:13325-13344 | MsG0080049019.01.T01:intron | 35.0% | |
TCGAATGTAATCACGTGTAT+TGG | - | contig611end:11552-11571 | MsG0080049019.01.T01:CDS | 35.0% | |
TCTAAATTGCAACAAAACGC+GGG | - | contig611end:12114-12133 | MsG0080049019.01.T01:intron | 35.0% | |
TGAAATCAAGACAAAGCCAA+CGG | + | contig611end:14208-14227 | MsG0080049019.01.T01:intergenic | 35.0% | |
TGAAGGAATTGAATTGACAC+CGG | + | contig611end:14561-14580 | MsG0080049019.01.T01:intergenic | 35.0% | |
TGGTTAGCGCTATCAAAAAT+TGG | - | contig611end:11754-11773 | MsG0080049019.01.T01:intron | 35.0% | |
TGGTTAGGAAAGTAGAGTAA+TGG | - | contig611end:12352-12371 | MsG0080049019.01.T01:intron | 35.0% | |
TTAAGGATTTGTCACCAGAA+GGG | - | contig611end:10285-10304 | MsG0080049019.01.T01:CDS | 35.0% | |
TTCACAATAACAAACCTCGA+TGG | + | contig611end:11341-11360 | MsG0080049019.01.T01:intergenic | 35.0% | |
! | AAGAGAAGCGTGAATGTTTA+TGG | + | contig611end:14519-14538 | MsG0080049019.01.T01:intergenic | 35.0% |
! | AAGGGAAAACATACTAGCTT+TGG | - | contig611end:14239-14258 | MsG0080049019.01.T01:intron | 35.0% |
! | ACACCTTCAATCAAAAGTGT+CGG | - | contig611end:11594-11613 | MsG0080049019.01.T01:intron | 35.0% |
! | AGATAGGTTAGAGCTTTTAC+TGG | + | contig611end:12730-12749 | MsG0080049019.01.T01:intergenic | 35.0% |
! | AGATCTTTGTTTGTGTGGTT+TGG | - | contig611end:11291-11310 | MsG0080049019.01.T01:intron | 35.0% |
! | AGTAAAAGCTCTAACCTATC+TGG | - | contig611end:12729-12748 | MsG0080049019.01.T01:intron | 35.0% |
! | GAAAAGCATATGGCATTACA+AGG | - | contig611end:13217-13236 | MsG0080049019.01.T01:intron | 35.0% |
!! | ATTTGGGTCTTGTTTGGATA+AGG | - | contig611end:10606-10625 | MsG0080049019.01.T01:intron | 35.0% |
!! | ATTTGGGTCTTGTTTGGTTA+AGG | - | contig611end:10891-10910 | MsG0080049019.01.T01:intron | 35.0% |
!! | CAAAAGTGTCAATGCAACAA+TGG | - | contig611end:11253-11272 | MsG0080049019.01.T01:intron | 35.0% |
!! | CATTATTCTAGTTCCTTACC+CGG | + | contig611end:11708-11727 | MsG0080049019.01.T01:intergenic | 35.0% |
!! | GCATTGACACTTTTGAATGA+AGG | + | contig611end:11248-11267 | MsG0080049019.01.T01:intergenic | 35.0% |
!! | GCATTTTTGTTTGTGTGGTT+TGG | - | contig611end:10963-10982 | MsG0080049019.01.T01:CDS | 35.0% |
!! | GTCAAAATTTGGGTCTTGTT+TGG | - | contig611end:10600-10619 | MsG0080049019.01.T01:intron | 35.0% |
!! | TTGTTTCAGGTTGTGTTGAA+TGG | - | contig611end:14882-14901 | MsG0080049019.01.T01:exon | 35.0% |
!!! | TGAATCAGATTTTGAGACAC+TGG | - | contig611end:11665-11684 | MsG0080049019.01.T01:intron | 35.0% |
!!! | TGAGACACTGGTTTTTATGT+AGG | - | contig611end:11677-11696 | MsG0080049019.01.T01:intron | 35.0% |
!!! | TGGTGTTGATAAGTTTTCAG+TGG | + | contig611end:10077-10096 | MsG0080049019.01.T01:intergenic | 35.0% |
ACTGTCTGATCTCACATGAA+TGG | - | contig611end:12078-12097 | MsG0080049019.01.T01:intron | 40.0% | |
AGTGATATCGTCGATGAGAT+GGG | - | contig611end:12549-12568 | MsG0080049019.01.T01:intron | 40.0% | |
CAAATACGTCAGTAGGTTTG+TGG | + | contig611end:14453-14472 | MsG0080049019.01.T01:intergenic | 40.0% | |
CACGTTCATTCTCTCTTCAA+AGG | - | contig611end:10219-10238 | MsG0080049019.01.T01:CDS | 40.0% | |
CAGCTTAAGCATGGTATAGT+TGG | - | contig611end:13630-13649 | MsG0080049019.01.T01:intron | 40.0% | |
CTCATCGACGATATCACTAT+TGG | + | contig611end:12547-12566 | MsG0080049019.01.T01:intergenic | 40.0% | |
GAAATGGAGGAGAAGATGAA+GGG | + | contig611end:10104-10123 | MsG0080049019.01.T01:intergenic | 40.0% | |
GAAGAGAGAGAAAGTAAGAG+TGG | + | contig611end:10157-10176 | MsG0080049019.01.T01:intergenic | 40.0% | |
GACAGTAATTGTCGATGAAG+AGG | - | contig611end:13369-13388 | MsG0080049019.01.T01:intron | 40.0% | |
GGTATAGTTGGTTACACGAT+GGG | - | contig611end:13642-13661 | MsG0080049019.01.T01:intron | 40.0% | |
GTATCAGAAGACACTTCAGT+TGG | - | contig611end:10313-10332 | MsG0080049019.01.T01:intron | 40.0% | |
GTCCAATGTCTAACACAGAT+AGG | + | contig611end:11222-11241 | MsG0080049019.01.T01:intergenic | 40.0% | |
GTCCTATCTGTGTTAGACAT+TGG | - | contig611end:11217-11236 | MsG0080049019.01.T01:intron | 40.0% | |
GTTAAGGATTTGTCACCAGA+AGG | - | contig611end:10284-10303 | MsG0080049019.01.T01:CDS | 40.0% | |
GTTTGGATCGATTGTGAGTT+TGG | + | contig611end:14419-14438 | MsG0080049019.01.T01:intergenic | 40.0% | |
TAAAAGCAAGCTCACCAGAT+AGG | + | contig611end:12746-12765 | MsG0080049019.01.T01:intergenic | 40.0% | |
TAAGAGTGGAGAGAGAAAGT+GGG | + | contig611end:10143-10162 | MsG0080049019.01.T01:intergenic | 40.0% | |
TAAGGATTTGTCACCAGAAG+GGG | - | contig611end:10286-10305 | MsG0080049019.01.T01:CDS | 40.0% | |
TAGTGATATCGTCGATGAGA+TGG | - | contig611end:12548-12567 | MsG0080049019.01.T01:intron | 40.0% | |
TATGTAGGTTTATCCGGGTA+AGG | - | contig611end:11692-11711 | MsG0080049019.01.T01:intron | 40.0% | |
TCCATGCGCAAAACATGAAA+AGG | + | contig611end:14480-14499 | MsG0080049019.01.T01:intergenic | 40.0% | |
TCTTTCATGCAGCTTAAGCA+TGG | - | contig611end:13621-13640 | MsG0080049019.01.T01:intron | 40.0% | |
TGATGCTGGAAGGAAAACTA+TGG | - | contig611end:12576-12595 | MsG0080049019.01.T01:intron | 40.0% | |
TGGTATAGTTGGTTACACGA+TGG | - | contig611end:13641-13660 | MsG0080049019.01.T01:intron | 40.0% | |
TTCTCATATTAGCCGTGTCT+CGG | - | contig611end:14676-14695 | MsG0080049019.01.T01:intron | 40.0% | |
TTGAGAGGAAGTTTCAATGG+TGG | + | contig611end:10191-10210 | MsG0080049019.01.T01:intergenic | 40.0% | |
! | AGTTTCAATGGTGGTGATGA+TGG | + | contig611end:10182-10201 | MsG0080049019.01.T01:intergenic | 40.0% |
! | CTTTGAAGAGAGAATGAACG+TGG | + | contig611end:10221-10240 | MsG0080049019.01.T01:intergenic | 40.0% |
! | GAGCAATTTTCTTGCCAAAG+AGG | - | contig611end:10996-11015 | MsG0080049019.01.T01:CDS | 40.0% |
! | GCACCTTCAATCAAAAGTGT+TGG | - | contig611end:10768-10787 | MsG0080049019.01.T01:intron | 40.0% |
! | GTTTTACAGGTACGATCGAT+CGG | - | contig611end:14180-14199 | MsG0080049019.01.T01:intron | 40.0% |
! | TAAGCGTGTGTTTGGAACTT+CGG | - | contig611end:13936-13955 | MsG0080049019.01.T01:intron | 40.0% |
! | TCCTTTTCATGTTTTGCGCA+TGG | - | contig611end:14476-14495 | MsG0080049019.01.T01:intron | 40.0% |
!! | AAGTGGGTTTGGTTTGGAAA+TGG | + | contig611end:10120-10139 | MsG0080049019.01.T01:intergenic | 40.0% |
!! | AGACCGACACTTTTGATTGA+AGG | + | contig611end:11600-11619 | MsG0080049019.01.T01:intergenic | 40.0% |
!! | CAAAAGTGTTGGTGCTTCAA+GGG | - | contig611end:10779-10798 | MsG0080049019.01.T01:intron | 40.0% |
!! | CACATGAATGGTGTTGATCA+TGG | - | contig611end:12090-12109 | MsG0080049019.01.T01:intron | 40.0% |
!! | CTTCATTGATTTCGTGAGCT+AGG | - | contig611end:12767-12786 | MsG0080049019.01.T01:intron | 40.0% |
!! | GAGTAATGCTCTTGCTATTG+AGG | - | contig611end:10382-10401 | MsG0080049019.01.T01:intron | 40.0% |
!! | GCACCAACACTTTTGATTGA+AGG | + | contig611end:10774-10793 | MsG0080049019.01.T01:intergenic | 40.0% |
!! | GTGCAATTCTCTTGCTATTG+AGG | - | contig611end:10564-10583 | MsG0080049019.01.T01:intron | 40.0% |
!! | TCAAAAGTGTTGGTGCTTCA+AGG | - | contig611end:10778-10797 | MsG0080049019.01.T01:intron | 40.0% |
!! | TTATCAGGTTGGAAACCAGT+TGG | - | contig611end:14041-14060 | MsG0080049019.01.T01:intron | 40.0% |
!! | TTCAATCAAAAGTGTCGGTC+TGG | - | contig611end:11599-11618 | MsG0080049019.01.T01:intron | 40.0% |
!! | TTTCAGGTTGTGTTGAATGG+TGG | - | contig611end:14885-14904 | MsG0080049019.01.T01:exon | 40.0% |
!!! | CTGAGGGTCTTCTTTTTTTG+GGG | - | contig611end:12276-12295 | MsG0080049019.01.T01:intron | 40.0% |
!!! | GCTGAGGGTCTTCTTTTTTT+GGG | - | contig611end:12275-12294 | MsG0080049019.01.T01:intron | 40.0% |
!!! | TGCTGAGGGTCTTCTTTTTT+TGG | - | contig611end:12274-12293 | MsG0080049019.01.T01:intron | 40.0% |
AAGCAATTCTCTTGCCATCG+AGG | - | contig611end:11324-11343 | MsG0080049019.01.T01:intron | 45.0% | |
AATTGAATTGACACCGGCAG+CGG | + | contig611end:14555-14574 | MsG0080049019.01.T01:intergenic | 45.0% | |
ACAATGTGACACCATGATCG+TGG | - | contig611end:14342-14361 | MsG0080049019.01.T01:intron | 45.0% | |
AGGAGAAGATGAAGGGAGAA+TGG | + | contig611end:10097-10116 | MsG0080049019.01.T01:intergenic | 45.0% | |
ATGGATACGGATACAGACAC+CGG | + | contig611end:14811-14830 | MsG0080049019.01.T01:intergenic | 45.0% | |
ATTTGTTTGTGGGCGAGGTT+TGG | - | contig611end:12332-12351 | MsG0080049019.01.T01:intron | 45.0% | |
CACAGACACGAACATGACAT+TGG | - | contig611end:11479-11498 | MsG0080049019.01.T01:intron | 45.0% | |
CGAATATTTGTTTGTGGGCG+AGG | - | contig611end:12327-12346 | MsG0080049019.01.T01:intron | 45.0% | |
GACTGATGCAGCTGCAATTA+CGG | - | contig611end:12144-12163 | MsG0080049019.01.T01:intron | 45.0% | |
GAGCAATTCACTTGCCATTG+AGG | - | contig611end:10849-10868 | MsG0080049019.01.T01:intron | 45.0% | |
GATTTCGTGAGCTAGGCAAT+AGG | - | contig611end:12774-12793 | MsG0080049019.01.T01:intron | 45.0% | |
GGAAATGGAGGAGAAGATGA+AGG | + | contig611end:10105-10124 | MsG0080049019.01.T01:intergenic | 45.0% | |
GTAAGAGTGGAGAGAGAAAG+TGG | + | contig611end:10144-10163 | MsG0080049019.01.T01:intergenic | 45.0% | |
GTGAGTTTGGCGAAATCACT+TGG | + | contig611end:14406-14425 | MsG0080049019.01.T01:intergenic | 45.0% | |
GTGATATCGTCGATGAGATG+GGG | - | contig611end:12550-12569 | MsG0080049019.01.T01:intron | 45.0% | |
GTTACACGATGGGTACTTTG+TGG | - | contig611end:13652-13671 | MsG0080049019.01.T01:intron | 45.0% | |
TCAAGGGCTCCGACAAAAAT+TGG | - | contig611end:10795-10814 | MsG0080049019.01.T01:intron | 45.0% | |
TGGCACTAACACGTTGAAAC+AGG | - | contig611end:11499-11518 | MsG0080049019.01.T01:intron | 45.0% | |
TGTCATGTTCGTGTCTGTGT+CGG | + | contig611end:11478-11497 | MsG0080049019.01.T01:intergenic | 45.0% | |
TTCTGATACACTTCCCCTTC+TGG | + | contig611end:10302-10321 | MsG0080049019.01.T01:intergenic | 45.0% | |
TTGCGCACAAGAAAACTGAC+AGG | + | contig611end:14069-14088 | MsG0080049019.01.T01:intergenic | 45.0% | |
! | ACTGTACAGATTGCTTGCTG+AGG | - | contig611end:12259-12278 | MsG0080049019.01.T01:intron | 45.0% |
! | CCATGTTTGCTGCTCTTACT+GGG | - | contig611end:10345-10364 | MsG0080049019.01.T01:intron | 45.0% |
! | CTGTACAGATTGCTTGCTGA+GGG | - | contig611end:12260-12279 | MsG0080049019.01.T01:intron | 45.0% |
! | GAACGTGGTTTGAGTTTGAG+AGG | + | contig611end:10206-10225 | MsG0080049019.01.T01:intergenic | 45.0% |
! | GGTTAGAGCTTTTACTGGAC+CGG | + | contig611end:12725-12744 | MsG0080049019.01.T01:intergenic | 45.0% |
! | TCCATGTTTGCTGCTCTTAC+TGG | - | contig611end:10344-10363 | MsG0080049019.01.T01:intron | 45.0% |
! | TGTTTGGAACTTCGGTTCTG+TGG | - | contig611end:13944-13963 | MsG0080049019.01.T01:intron | 45.0% |
!! | ATGAGATGGGGTATTGATGC+TGG | - | contig611end:12562-12581 | MsG0080049019.01.T01:intron | 45.0% |
!! | CACGTGTATTGGTGTTGTGT+TGG | - | contig611end:11563-11582 | MsG0080049019.01.T01:CDS | 45.0% |
!! | TATATGTGTCGGTGTCGTGT+CGG | + | contig611end:14727-14746 | MsG0080049019.01.T01:intergenic | 45.0% |
!! | TGGGTTTGGTTTGGAAATGG+AGG | + | contig611end:10117-10136 | MsG0080049019.01.T01:intergenic | 45.0% |
!! | TTCAATGGTGGTGATGATGG+CGG | + | contig611end:10179-10198 | MsG0080049019.01.T01:intergenic | 45.0% |
ACACGATGGGTACTTTGTGG+AGG | - | contig611end:13655-13674 | MsG0080049019.01.T01:intron | 50.0% | |
CCCAGTAAGAGCAGCAAACA+TGG | + | contig611end:10348-10367 | MsG0080049019.01.T01:intergenic | 50.0% | |
GAAAACTGACAGGCTCCAAC+TGG | + | contig611end:14059-14078 | MsG0080049019.01.T01:intergenic | 50.0% | |
GGAGAGAGAAAGTGGGAAGT+GGG | + | contig611end:10136-10155 | MsG0080049019.01.T01:intergenic | 50.0% | |
TGCAACCACAATTGCAGCTG+CGG | - | contig611end:12194-12213 | MsG0080049019.01.T01:intron | 50.0% | |
TGGAGAGAGAAAGTGGGAAG+TGG | + | contig611end:10137-10156 | MsG0080049019.01.T01:intergenic | 50.0% | |
! | AGTGGGAAGTGGGTTTGGTT+TGG | + | contig611end:10126-10145 | MsG0080049019.01.T01:intergenic | 50.0% |
! | CAAGGTCGTGTTTGGTTCGT+TGG | + | contig611end:10035-10054 | MsG0080049019.01.T01:intergenic | 50.0% |
! | GAGAAAGTGGGAAGTGGGTT+TGG | + | contig611end:10131-10150 | MsG0080049019.01.T01:intergenic | 50.0% |
! | GTTTGCTGCTCTTACTGGGT+TGG | - | contig611end:10349-10368 | MsG0080049019.01.T01:intron | 50.0% |
! | TATTAGCCGTGTCTCGGTGT+CGG | - | contig611end:14682-14701 | MsG0080049019.01.T01:intron | 50.0% |
! | TGTGGCTTTTGCCACGATCA+TGG | + | contig611end:14356-14375 | MsG0080049019.01.T01:intergenic | 50.0% |
! | TTTGTGGGCGAGGTTTGGTT+AGG | - | contig611end:12337-12356 | MsG0080049019.01.T01:intron | 50.0% |
!! | GATGGGGTATTGATGCTGGA+AGG | - | contig611end:12566-12585 | MsG0080049019.01.T01:intron | 50.0% |
TCGTGGCAAAAGCCACACCT+TGG | - | contig611end:14359-14378 | MsG0080049019.01.T01:intron | 55.0% | |
! | ACATTTGTGCTGACCGCTGC+CGG | - | contig611end:14539-14558 | MsG0080049019.01.T01:intron | 55.0% |
GCGATCCGCAGCTGCAATTG+TGG | + | contig611end:12202-12221 | MsG0080049019.01.T01:intergenic | 60.0% | |
TCGTGTCCGACACCGAGACA+CGG | + | contig611end:14691-14710 | MsG0080049019.01.T01:intergenic | 60.0% | |
!! | GTACGATCGATCGGTGCCGT+TGG | - | contig611end:14189-14208 | MsG0080049019.01.T01:intron | 60.0% |
!! | TGTCGGTGTCGTGTCGGTGT+CGG | + | contig611end:14721-14740 | MsG0080049019.01.T01:intergenic | 60.0% |
CGGCGTGTCTGTGTCGTGTC+CGG | - | contig611end:14789-14808 | MsG0080049019.01.T01:intron | 65.0% | |
!! | GTCTCGGTGTCGGACACGAC+AGG | - | contig611end:14692-14711 | MsG0080049019.01.T01:intron | 65.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
contig611end | gene | 10001 | 15221 | 10001 | ID=MsG0080049019.01; |
contig611end | mRNA | 10001 | 15221 | 10001 | ID=MsG0080049019.01.T01;Parent=MsG0080049019.01 |
contig611end | exon | 10001 | 10331 | 10001 | ID=MsG0080049019.01.T01.exon;Parent=MsG0080049019.01.T01 |
contig611end | CDS | 10212 | 10331 | 10212 | ID=MsG0080049019.01.T01.cds;Parent=MsG0080049019.01.T01 |
contig611end | CDS | 10609 | 10710 | 10609 | ID=MsG0080049019.01.T01.cds;Parent=MsG0080049019.01.T01 |
contig611end | exon | 10609 | 10710 | 10609 | ID=MsG0080049019.01.T01.exon;Parent=MsG0080049019.01.T01 |
contig611end | CDS | 10962 | 11033 | 10962 | ID=MsG0080049019.01.T01.cds;Parent=MsG0080049019.01.T01 |
contig611end | exon | 10962 | 11033 | 10962 | ID=MsG0080049019.01.T01.exon;Parent=MsG0080049019.01.T01 |
contig611end | CDS | 11132 | 11174 | 11132 | ID=MsG0080049019.01.T01.cds;Parent=MsG0080049019.01.T01 |
contig611end | exon | 11132 | 11174 | 11132 | ID=MsG0080049019.01.T01.exon;Parent=MsG0080049019.01.T01 |
contig611end | CDS | 11546 | 11589 | 11546 | ID=MsG0080049019.01.T01.cds;Parent=MsG0080049019.01.T01 |
contig611end | exon | 11546 | 11589 | 11546 | ID=MsG0080049019.01.T01.exon;Parent=MsG0080049019.01.T01 |
contig611end | CDS | 12472 | 12531 | 12472 | ID=MsG0080049019.01.T01.cds;Parent=MsG0080049019.01.T01 |
contig611end | exon | 12472 | 12531 | 12472 | ID=MsG0080049019.01.T01.exon;Parent=MsG0080049019.01.T01 |
contig611end | CDS | 12625 | 12705 | 12625 | ID=MsG0080049019.01.T01.cds;Parent=MsG0080049019.01.T01 |
contig611end | exon | 12625 | 12705 | 12625 | ID=MsG0080049019.01.T01.exon;Parent=MsG0080049019.01.T01 |
contig611end | CDS | 14819 | 15154 | 14819 | ID=MsG0080049019.01.T01.cds;Parent=MsG0080049019.01.T01 |
contig611end | exon | 14819 | 15221 | 14819 | ID=MsG0080049019.01.T01.exon;Parent=MsG0080049019.01.T01 |
Gene Sequence |
Protein sequence |