AlfalfaGEDB | Msa0932150

M. sativa cultivar zhongmu-4 / Msa0932150

KEGG: K03327
GO: GO:0000041 GO:0003674 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0006855 GO:0008150 GO:0015238 GO:0015691 GO:0015893 GO:0016020 GO:0022857 GO:0030001 GO:0042221 GO:0042493 GO:0044464 GO:0050896 GO:0051179 GO:0051234 GO:0051235 GO:0051238 GO:0055085 GO:0065007 GO:0065008 GO:0070838 GO:0071944 GO:0072511
PFAM: PF01554.21

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0932150	sp\|Q9C9M8\|DTX9_ARATH	49.446	451	224	2	7	457	1	447	1.77e-163	473

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0932150	A0A396HAE5	96.026	453	11	1	2	454	3	448	0.0	883

TFs/TRs:

Gene ID	Type	Classification

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
Msa0004340	Msa0932150	-0.806122	9.589252e-50	-8.615850e-47
Msa0004590	Msa0932150	0.823360	1.444784e-53	-8.615850e-47
Msa0006080	Msa0932150	0.832866	7.400437e-56	-8.615850e-47
Msa0009290	Msa0932150	0.801447	8.966272e-49	-8.615850e-47
Msa0009530	Msa0932150	-0.840907	6.553486e-58	-8.615850e-47
Msa0009560	Msa0932150	-0.817385	3.390276e-52	-8.615850e-47
Msa0010150	Msa0932150	0.812986	3.216040e-51	-8.615850e-47
Msa0011040	Msa0932150	0.810551	1.089485e-50	-8.615850e-47
Msa0011100	Msa0932150	-0.804572	2.025604e-49	-8.615850e-47
Msa0012770	Msa0932150	0.818718	1.693271e-52	-8.615850e-47
Msa0013040	Msa0932150	0.815302	9.912942e-52	-8.615850e-47
Msa0013270	Msa0932150	0.832633	8.454795e-56	-8.615850e-47
Msa0014590	Msa0932150	0.836223	1.061326e-56	-8.615850e-47
Msa0016380	Msa0932150	-0.803053	4.188461e-49	-8.615850e-47
Msa0017710	Msa0932150	0.839981	1.144209e-57	-8.615850e-47
Msa0024500	Msa0932150	-0.815301	9.913963e-52	-8.615850e-47
Msa0025570	Msa0932150	0.804602	1.996328e-49	-8.615850e-47
Msa0025700	Msa0932150	0.837503	5.001849e-57	-8.615850e-47
Msa0034100	Msa0932150	-0.848556	5.683565e-60	-8.615850e-47
Msa0036550	Msa0932150	0.812798	3.537014e-51	-8.615850e-47
Msa0036810	Msa0932150	0.833428	5.362543e-56	-8.615850e-47
Msa0037180	Msa0932150	0.835510	1.609260e-56	-8.615850e-47
Msa0040210	Msa0932150	0.801239	9.891567e-49	-8.615850e-47
Msa0040360	Msa0932150	0.802277	6.054186e-49	-8.615850e-47
Msa0045620	Msa0932150	0.818734	1.679470e-52	-8.615850e-47
Msa0045810	Msa0932150	0.837467	5.108986e-57	-8.615850e-47
Msa0046200	Msa0932150	0.822636	2.130562e-53	-8.615850e-47
Msa0046970	Msa0932150	0.822280	2.578250e-53	-8.615850e-47
Msa0050320	Msa0932150	-0.814343	1.616755e-51	-8.615850e-47
Msa0051910	Msa0932150	0.814141	1.792189e-51	-8.615850e-47
Msa0054790	Msa0932150	0.838599	2.613624e-57	-8.615850e-47
Msa0057860	Msa0932150	0.833687	4.620904e-56	-8.615850e-47
Msa0059880	Msa0932150	0.817366	3.423186e-52	-8.615850e-47
Msa0062010	Msa0932150	0.808686	2.741312e-50	-8.615850e-47
Msa0062190	Msa0932150	0.809588	1.756816e-50	-8.615850e-47
Msa0063540	Msa0932150	0.823380	1.429047e-53	-8.615850e-47
Msa0064990	Msa0932150	0.812132	4.945019e-51	-8.615850e-47
Msa0072390	Msa0932150	-0.869326	3.366229e-66	-8.615850e-47
Msa0073110	Msa0932150	0.800358	1.495991e-48	-8.615850e-47
Msa0073270	Msa0932150	0.825248	5.198214e-54	-8.615850e-47
Msa0077230	Msa0932150	0.809410	1.918116e-50	-8.615850e-47
Msa0081120	Msa0932150	-0.808207	3.468641e-50	-8.615850e-47
Msa0081290	Msa0932150	-0.811481	6.851952e-51	-8.615850e-47
Msa0081790	Msa0932150	-0.821705	3.502640e-53	-8.615850e-47
Msa0089470	Msa0932150	-0.808927	2.434226e-50	-8.615850e-47
Msa0091090	Msa0932150	-0.813848	2.079752e-51	-8.615850e-47
Msa0092220	Msa0932150	0.841735	3.968282e-58	-8.615850e-47
Msa0102920	Msa0932150	0.815495	8.978215e-52	-8.615850e-47
Msa0105590	Msa0932150	-0.807346	5.287435e-50	-8.615850e-47
Msa0106540	Msa0932150	0.822634	2.132410e-53	-8.615850e-47
Msa0108350	Msa0932150	0.819741	9.906857e-53	-8.615850e-47
Msa0114700	Msa0932150	-0.810892	9.196181e-51	-8.615850e-47
Msa0120320	Msa0932150	-0.800323	1.520900e-48	-8.615850e-47
Msa0120450	Msa0932150	0.809405	1.923539e-50	-8.615850e-47
Msa0606150	Msa0932150	0.811422	7.058750e-51	-8.615850e-47
Msa0606600	Msa0932150	0.807063	6.068008e-50	-8.615850e-47
Msa0608780	Msa0932150	-0.818989	1.469357e-52	-8.615850e-47
Msa0608820	Msa0932150	0.819535	1.103462e-52	-8.615850e-47
Msa0609460	Msa0932150	0.816836	4.504182e-52	-8.615850e-47
Msa0610190	Msa0932150	0.812025	5.218331e-51	-8.615850e-47
Msa0610700	Msa0932150	-0.810712	1.005703e-50	-8.615850e-47
Msa0612580	Msa0932150	0.802869	4.571599e-49	-8.615850e-47
Msa0616010	Msa0932150	0.810884	9.229557e-51	-8.615850e-47
Msa0618680	Msa0932150	0.823141	1.625001e-53	-8.615850e-47
Msa0618700	Msa0932150	0.823599	1.270128e-53	-8.615850e-47
Msa0621670	Msa0932150	-0.803854	2.857737e-49	-8.615850e-47
Msa0623310	Msa0932150	0.831103	2.018138e-55	-8.615850e-47
Msa0624050	Msa0932150	0.814057	1.869853e-51	-8.615850e-47
Msa0624930	Msa0932150	0.865237	6.833132e-65	-8.615850e-47
Msa0643190	Msa0932150	0.807360	5.250948e-50	-8.615850e-47
Msa0645060	Msa0932150	0.813859	2.068048e-51	-8.615850e-47
Msa0646010	Msa0932150	0.811714	6.097434e-51	-8.615850e-47
Msa0646430	Msa0932150	0.810115	1.353458e-50	-8.615850e-47
Msa0647300	Msa0932150	0.824654	7.180350e-54	-8.615850e-47
Msa0647320	Msa0932150	0.829089	6.254860e-55	-8.615850e-47
Msa0649250	Msa0932150	-0.827839	1.253617e-54	-8.615850e-47
Msa0650100	Msa0932150	0.807538	4.813903e-50	-8.615850e-47
Msa0655430	Msa0932150	0.814187	1.750691e-51	-8.615850e-47
Msa0658120	Msa0932150	0.838017	3.690495e-57	-8.615850e-47
Msa0659020	Msa0932150	-0.859428	4.165979e-63	-8.615850e-47
Msa0665830	Msa0932150	0.802031	6.803120e-49	-8.615850e-47
Msa0667600	Msa0932150	0.836712	7.969725e-57	-8.615850e-47
Msa0670360	Msa0932150	0.806384	8.444362e-50	-8.615850e-47
Msa0671400	Msa0932150	0.836474	9.163353e-57	-8.615850e-47
Msa0671640	Msa0932150	0.805838	1.100214e-49	-8.615850e-47
Msa0672950	Msa0932150	0.813393	2.618286e-51	-8.615850e-47
Msa0673940	Msa0932150	0.805963	1.035776e-49	-8.615850e-47
Msa0676200	Msa0932150	0.823551	1.303381e-53	-8.615850e-47
Msa0680460	Msa0932150	0.815419	9.336209e-52	-8.615850e-47
Msa0684560	Msa0932150	0.829960	3.842743e-55	-8.615850e-47
Msa0685390	Msa0932150	-0.800991	1.111409e-48	-8.615850e-47
Msa0686830	Msa0932150	0.822460	2.341507e-53	-8.615850e-47
Msa0687220	Msa0932150	0.811948	5.421399e-51	-8.615850e-47
Msa0689830	Msa0932150	0.820366	7.125648e-53	-8.615850e-47
Msa0689840	Msa0932150	0.817621	2.999349e-52	-8.615850e-47
Msa0690190	Msa0932150	0.806235	9.075247e-50	-8.615850e-47
Msa0691610	Msa0932150	0.814447	1.533785e-51	-8.615850e-47
Msa0692090	Msa0932150	0.800273	1.556922e-48	-8.615850e-47
Msa0698650	Msa0932150	-0.803428	3.502940e-49	-8.615850e-47
Msa0701660	Msa0932150	0.807982	3.873617e-50	-8.615850e-47
Msa0702020	Msa0932150	-0.807829	4.174838e-50	-8.615850e-47
Msa0702690	Msa0932150	-0.800871	1.176165e-48	-8.615850e-47
Msa0702970	Msa0932150	0.836334	9.946088e-57	-8.615850e-47
Msa0703430	Msa0932150	-0.800083	1.701778e-48	-8.615850e-47
Msa0705460	Msa0932150	0.841711	4.026541e-58	-8.615850e-47
Msa0705520	Msa0932150	0.845556	3.773209e-59	-8.615850e-47
Msa0705810	Msa0932150	-0.812281	4.587250e-51	-8.615850e-47
Msa0707880	Msa0932150	-0.838343	3.043228e-57	-8.615850e-47
Msa0711260	Msa0932150	0.854836	9.439522e-62	-8.615850e-47
Msa0715350	Msa0932150	0.823706	1.198989e-53	-8.615850e-47
Msa0716700	Msa0932150	0.819919	9.017547e-53	-8.615850e-47
Msa0721930	Msa0932150	0.815075	1.113247e-51	-8.615850e-47
Msa0732970	Msa0932150	0.853058	3.070693e-61	-8.615850e-47
Msa0733240	Msa0932150	-0.814305	1.648779e-51	-8.615850e-47
Msa0738680	Msa0932150	0.833711	4.558843e-56	-8.615850e-47
Msa0739720	Msa0932150	0.811379	7.211853e-51	-8.615850e-47
Msa0742090	Msa0932150	-0.815230	1.028457e-51	-8.615850e-47
Msa0745140	Msa0932150	0.810180	1.310518e-50	-8.615850e-47
Msa0750990	Msa0932150	0.803776	2.966743e-49	-8.615850e-47
Msa0751960	Msa0932150	0.839221	1.804456e-57	-8.615850e-47
Msa0753500	Msa0932150	0.840480	8.477247e-58	-8.615850e-47
Msa0754750	Msa0932150	0.823414	1.403105e-53	-8.615850e-47
Msa0756670	Msa0932150	-0.820989	5.123536e-53	-8.615850e-47
Msa0761830	Msa0932150	0.847559	1.071172e-59	-8.615850e-47
Msa0762930	Msa0932150	0.816878	4.405661e-52	-8.615850e-47
Msa0768670	Msa0932150	0.806381	8.457327e-50	-8.615850e-47
Msa0768720	Msa0932150	0.807530	4.833054e-50	-8.615850e-47
Msa0769910	Msa0932150	-0.812322	4.493088e-51	-8.615850e-47
Msa0772420	Msa0932150	0.808768	2.633328e-50	-8.615850e-47
Msa0773960	Msa0932150	0.861941	7.201823e-64	-8.615850e-47
Msa0774360	Msa0932150	-0.804868	1.757092e-49	-8.615850e-47
Msa0776640	Msa0932150	0.808161	3.548045e-50	-8.615850e-47
Msa0789220	Msa0932150	0.850776	1.364738e-60	-8.615850e-47
Msa0791300	Msa0932150	0.801779	7.663204e-49	-8.615850e-47
Msa0792410	Msa0932150	0.826178	3.128395e-54	-8.615850e-47
Msa0794030	Msa0932150	0.817986	2.480302e-52	-8.615850e-47
Msa0795210	Msa0932150	0.831080	2.043742e-55	-8.615850e-47
Msa0797980	Msa0932150	-0.816389	5.672776e-52	-8.615850e-47
Msa0802950	Msa0932150	-0.818378	2.022135e-52	-8.615850e-47
Msa0803530	Msa0932150	-0.825946	3.552603e-54	-8.615850e-47
Msa0804170	Msa0932150	0.860291	2.288575e-63	-8.615850e-47
Msa0806930	Msa0932150	0.848571	5.631111e-60	-8.615850e-47
Msa0810080	Msa0932150	0.813278	2.775327e-51	-8.615850e-47
Msa0814160	Msa0932150	0.805858	1.089641e-49	-8.615850e-47
Msa0819150	Msa0932150	0.834619	2.699536e-56	-8.615850e-47
Msa0822740	Msa0932150	0.814887	1.225545e-51	-8.615850e-47
Msa0823310	Msa0932150	-0.823293	1.497091e-53	-8.615850e-47
Msa0825920	Msa0932150	0.814551	1.454613e-51	-8.615850e-47
Msa0831890	Msa0932150	0.853043	3.100464e-61	-8.615850e-47
Msa0832750	Msa0932150	0.825822	3.800350e-54	-8.615850e-47
Msa0836060	Msa0932150	-0.817792	2.743298e-52	-8.615850e-47
Msa0838620	Msa0932150	-0.815594	8.532484e-52	-8.615850e-47
Msa0838670	Msa0932150	-0.807837	4.159385e-50	-8.615850e-47
Msa0842180	Msa0932150	0.822316	2.527941e-53	-8.615850e-47
Msa0121320	Msa0932150	0.824483	7.877883e-54	-8.615850e-47
Msa0125600	Msa0932150	0.810920	9.065256e-51	-8.615850e-47
Msa0125860	Msa0932150	0.828145	1.057903e-54	-8.615850e-47
Msa0128110	Msa0932150	-0.841520	4.520617e-58	-8.615850e-47
Msa0128340	Msa0932150	0.828310	9.650477e-55	-8.615850e-47
Msa0128740	Msa0932150	0.821847	3.246928e-53	-8.615850e-47
Msa0132080	Msa0932150	-0.817149	3.829808e-52	-8.615850e-47
Msa0136180	Msa0932150	-0.819326	1.231806e-52	-8.615850e-47
Msa0137010	Msa0932150	-0.807045	6.122716e-50	-8.615850e-47
Msa0137760	Msa0932150	0.810010	1.425542e-50	-8.615850e-47
Msa0143280	Msa0932150	-0.829542	4.855448e-55	-8.615850e-47
Msa0147680	Msa0932150	0.835484	1.633686e-56	-8.615850e-47
Msa0150910	Msa0932150	0.827516	1.498726e-54	-8.615850e-47
Msa0154720	Msa0932150	-0.812635	3.840041e-51	-8.615850e-47
Msa0160650	Msa0932150	-0.811373	7.232343e-51	-8.615850e-47
Msa0163960	Msa0932150	-0.863394	2.569569e-64	-8.615850e-47
Msa0166180	Msa0932150	0.824956	6.095081e-54	-8.615850e-47
Msa0174590	Msa0932150	0.800105	1.684254e-48	-8.615850e-47
Msa0176600	Msa0932150	0.800154	1.646053e-48	-8.615850e-47
Msa0177320	Msa0932150	0.817120	3.889079e-52	-8.615850e-47
Msa0178440	Msa0932150	-0.800495	1.403226e-48	-8.615850e-47
Msa0179450	Msa0932150	0.807500	4.903716e-50	-8.615850e-47
Msa0180100	Msa0932150	-0.837322	5.565091e-57	-8.615850e-47
Msa0180210	Msa0932150	0.828816	7.285289e-55	-8.615850e-47
Msa0183200	Msa0932150	-0.814547	1.457338e-51	-8.615850e-47
Msa0184510	Msa0932150	-0.831745	1.402487e-55	-8.615850e-47
Msa0187980	Msa0932150	-0.810760	9.818181e-51	-8.615850e-47
Msa0189150	Msa0932150	-0.804773	1.838974e-49	-8.615850e-47
Msa0190670	Msa0932150	0.854372	1.286227e-61	-8.615850e-47
Msa0190890	Msa0932150	0.848256	6.880998e-60	-8.615850e-47
Msa0193680	Msa0932150	0.822723	2.033763e-53	-8.615850e-47
Msa0195580	Msa0932150	0.800537	1.375698e-48	-8.615850e-47
Msa0196260	Msa0932150	0.840257	9.696126e-58	-8.615850e-47
Msa0197920	Msa0932150	0.809293	2.032409e-50	-8.615850e-47
Msa0206370	Msa0932150	0.813322	2.714763e-51	-8.615850e-47
Msa0207640	Msa0932150	0.813619	2.335284e-51	-8.615850e-47
Msa0211460	Msa0932150	0.824079	9.803628e-54	-8.615850e-47
Msa0216150	Msa0932150	-0.820931	5.283696e-53	-8.615850e-47
Msa0218060	Msa0932150	0.810424	1.160954e-50	-8.615850e-47
Msa0219840	Msa0932150	0.810502	1.116280e-50	-8.615850e-47
Msa0220090	Msa0932150	0.816044	6.772987e-52	-8.615850e-47
Msa0225070	Msa0932150	-0.853237	2.728267e-61	-8.615850e-47
Msa0233210	Msa0932150	0.832360	9.880882e-56	-8.615850e-47
Msa0235080	Msa0932150	0.820482	6.701167e-53	-8.615850e-47
Msa0236690	Msa0932150	-0.806262	8.960959e-50	-8.615850e-47
Msa0236940	Msa0932150	0.850287	1.872396e-60	-8.615850e-47
Msa0238110	Msa0932150	0.861901	7.407612e-64	-8.615850e-47
Msa0238140	Msa0932150	0.810260	1.259292e-50	-8.615850e-47
Msa0364910	Msa0932150	-0.830433	2.945690e-55	-8.615850e-47
Msa0367590	Msa0932150	-0.807776	4.285121e-50	-8.615850e-47
Msa0369760	Msa0932150	0.808251	3.395605e-50	-8.615850e-47
Msa0370620	Msa0932150	0.805807	1.117117e-49	-8.615850e-47
Msa0371350	Msa0932150	-0.805218	1.484138e-49	-8.615850e-47
Msa0373550	Msa0932150	0.800778	1.228349e-48	-8.615850e-47
Msa0374040	Msa0932150	0.800392	1.472539e-48	-8.615850e-47
Msa0374470	Msa0932150	0.815415	9.355168e-52	-8.615850e-47
Msa0374560	Msa0932150	0.808037	3.770611e-50	-8.615850e-47
Msa0374600	Msa0932150	0.815654	8.274861e-52	-8.615850e-47
Msa0375860	Msa0932150	0.821894	3.167490e-53	-8.615850e-47
Msa0378310	Msa0932150	-0.816613	5.052093e-52	-8.615850e-47
Msa0379480	Msa0932150	0.839345	1.674919e-57	-8.615850e-47
Msa0380680	Msa0932150	0.804718	1.888494e-49	-8.615850e-47
Msa0383770	Msa0932150	0.806589	7.642502e-50	-8.615850e-47
Msa0386880	Msa0932150	0.819302	1.247405e-52	-8.615850e-47
Msa0386910	Msa0932150	0.818066	2.379442e-52	-8.615850e-47
Msa0388210	Msa0932150	0.821484	3.939618e-53	-8.615850e-47
Msa0396860	Msa0932150	0.814389	1.579469e-51	-8.615850e-47
Msa0403740	Msa0932150	-0.823072	1.685901e-53	-8.615850e-47
Msa0404140	Msa0932150	0.827427	1.573585e-54	-8.615850e-47
Msa0412580	Msa0932150	-0.818475	1.922532e-52	-8.615850e-47
Msa0416040	Msa0932150	0.808677	2.753896e-50	-8.615850e-47
Msa0416340	Msa0932150	0.806813	6.856036e-50	-8.615850e-47
Msa0419420	Msa0932150	-0.819273	1.266180e-52	-8.615850e-47
Msa0421320	Msa0932150	0.820988	5.126889e-53	-8.615850e-47
Msa0424540	Msa0932150	0.828649	7.993979e-55	-8.615850e-47
Msa0427260	Msa0932150	-0.814439	1.539520e-51	-8.615850e-47
Msa0428330	Msa0932150	-0.818587	1.813208e-52	-8.615850e-47
Msa0436610	Msa0932150	-0.801652	8.139040e-49	-8.615850e-47
Msa0444210	Msa0932150	0.823642	1.241175e-53	-8.615850e-47
Msa0452770	Msa0932150	0.821068	4.913590e-53	-8.615850e-47
Msa0456450	Msa0932150	-0.827591	1.437975e-54	-8.615850e-47
Msa0457070	Msa0932150	-0.838686	2.482124e-57	-8.615850e-47
Msa0463970	Msa0932150	0.817310	3.524509e-52	-8.615850e-47
Msa0470420	Msa0932150	0.813060	3.099342e-51	-8.615850e-47
Msa0471130	Msa0932150	-0.801103	1.054290e-48	-8.615850e-47
Msa0471390	Msa0932150	0.815590	8.552404e-52	-8.615850e-47
Msa0472390	Msa0932150	0.825631	4.218898e-54	-8.615850e-47
Msa0475330	Msa0932150	0.827449	1.554558e-54	-8.615850e-47
Msa0477030	Msa0932150	0.805686	1.184213e-49	-8.615850e-47
Msa0240540	Msa0932150	0.812907	3.346613e-51	-8.615850e-47
Msa0240590	Msa0932150	-0.830508	2.823590e-55	-8.615850e-47
Msa0248410	Msa0932150	0.804013	2.648257e-49	-8.615850e-47
Msa0251120	Msa0932150	0.809194	2.134961e-50	-8.615850e-47
Msa0258010	Msa0932150	0.803715	3.053582e-49	-8.615850e-47
Msa0260980	Msa0932150	0.811251	7.686761e-51	-8.615850e-47
Msa0261400	Msa0932150	0.837855	4.061711e-57	-8.615850e-47
Msa0266140	Msa0932150	-0.843572	1.290436e-58	-8.615850e-47
Msa0267450	Msa0932150	-0.830375	3.042644e-55	-8.615850e-47
Msa0267510	Msa0932150	-0.829449	5.116065e-55	-8.615850e-47
Msa0267710	Msa0932150	0.831170	1.942308e-55	-8.615850e-47
Msa0269240	Msa0932150	0.806449	8.181818e-50	-8.615850e-47
Msa0270730	Msa0932150	-0.801812	7.547020e-49	-8.615850e-47
Msa0271660	Msa0932150	0.803460	3.449833e-49	-8.615850e-47
Msa0274250	Msa0932150	0.805560	1.258536e-49	-8.615850e-47
Msa0274570	Msa0932150	0.818679	1.728424e-52	-8.615850e-47
Msa0275560	Msa0932150	0.800135	1.661386e-48	-8.615850e-47
Msa0278480	Msa0932150	0.802893	4.519554e-49	-8.615850e-47
Msa0279000	Msa0932150	0.809641	1.711786e-50	-8.615850e-47
Msa0279090	Msa0932150	-0.823025	1.729075e-53	-8.615850e-47
Msa0279810	Msa0932150	0.834572	2.774427e-56	-8.615850e-47
Msa0290800	Msa0932150	0.832405	9.635006e-56	-8.615850e-47
Msa0295680	Msa0932150	0.819017	1.448284e-52	-8.615850e-47
Msa0298400	Msa0932150	0.803508	3.371976e-49	-8.615850e-47
Msa0299030	Msa0932150	0.833803	4.324587e-56	-8.615850e-47
Msa0300670	Msa0932150	-0.800422	1.452268e-48	-8.615850e-47
Msa0303920	Msa0932150	0.852052	5.945413e-61	-8.615850e-47
Msa0304060	Msa0932150	-0.850604	1.525531e-60	-8.615850e-47
Msa0307630	Msa0932150	0.830570	2.727009e-55	-8.615850e-47
Msa0311540	Msa0932150	0.822718	2.038931e-53	-8.615850e-47
Msa0316000	Msa0932150	0.808807	2.583208e-50	-8.615850e-47
Msa0316020	Msa0932150	0.840036	1.107381e-57	-8.615850e-47
Msa0318410	Msa0932150	0.812769	3.588883e-51	-8.615850e-47
Msa0319220	Msa0932150	0.832448	9.401081e-56	-8.615850e-47
Msa0328100	Msa0932150	0.808268	3.366127e-50	-8.615850e-47
Msa0328870	Msa0932150	0.841476	4.643433e-58	-8.615850e-47
Msa0333770	Msa0932150	0.800661	1.298174e-48	-8.615850e-47
Msa0335340	Msa0932150	0.814069	1.858288e-51	-8.615850e-47
Msa0336520	Msa0932150	0.800320	1.523165e-48	-8.615850e-47
Msa0347320	Msa0932150	0.801949	7.073178e-49	-8.615850e-47
Msa0348370	Msa0932150	0.836937	6.982511e-57	-8.615850e-47
Msa0349910	Msa0932150	0.834581	2.758491e-56	-8.615850e-47
Msa0349930	Msa0932150	0.857994	1.116777e-62	-8.615850e-47
Msa0354550	Msa0932150	0.803290	3.741330e-49	-8.615850e-47
Msa0358470	Msa0932150	0.826195	3.099778e-54	-8.615850e-47
Msa0364030	Msa0932150	-0.823225	1.552966e-53	-8.615850e-47
Msa0484210	Msa0932150	-0.807720	4.404030e-50	-8.615850e-47
Msa0484410	Msa0932150	0.837841	4.096797e-57	-8.615850e-47
Msa0491760	Msa0932150	0.807576	4.726038e-50	-8.615850e-47
Msa0491770	Msa0932150	0.818300	2.106874e-52	-8.615850e-47
Msa0509520	Msa0932150	0.810700	1.011881e-50	-8.615850e-47
Msa0523720	Msa0932150	0.821907	3.145644e-53	-8.615850e-47
Msa0529360	Msa0932150	0.865511	5.599921e-65	-8.615850e-47
Msa0535570	Msa0932150	0.802515	5.409949e-49	-8.615850e-47
Msa0538050	Msa0932150	-0.810783	9.706006e-51	-8.615850e-47
Msa0549960	Msa0932150	0.807440	5.049083e-50	-8.615850e-47
Msa0555280	Msa0932150	0.824358	8.427226e-54	-8.615850e-47
Msa0556720	Msa0932150	0.804638	1.962528e-49	-8.615850e-47
Msa0561420	Msa0932150	-0.801763	7.722432e-49	-8.615850e-47
Msa0562050	Msa0932150	0.811980	5.335495e-51	-8.615850e-47
Msa0565700	Msa0932150	0.844939	5.540442e-59	-8.615850e-47
Msa0566460	Msa0932150	0.851975	6.253156e-61	-8.615850e-47
Msa0567330	Msa0932150	0.822227	2.652264e-53	-8.615850e-47
Msa0567570	Msa0932150	0.811720	6.080483e-51	-8.615850e-47
Msa0568460	Msa0932150	-0.828512	8.629973e-55	-8.615850e-47
Msa0569100	Msa0932150	0.806864	6.688345e-50	-8.615850e-47
Msa0572730	Msa0932150	-0.800596	1.338257e-48	-8.615850e-47
Msa0575380	Msa0932150	0.814341	1.618866e-51	-8.615850e-47
Msa0576180	Msa0932150	0.811253	7.677736e-51	-8.615850e-47
Msa0576320	Msa0932150	0.830358	3.071972e-55	-8.615850e-47
Msa0576500	Msa0932150	-0.834338	3.175673e-56	-8.615850e-47
Msa0579170	Msa0932150	-0.824908	6.254095e-54	-8.615850e-47
Msa0579230	Msa0932150	-0.829207	5.858502e-55	-8.615850e-47
Msa0580210	Msa0932150	0.834407	3.051551e-56	-8.615850e-47
Msa0580730	Msa0932150	0.806253	8.998935e-50	-8.615850e-47
Msa0583390	Msa0932150	0.840612	7.827677e-58	-8.615850e-47
Msa0584370	Msa0932150	0.843832	1.099039e-58	-8.615850e-47
Msa0584970	Msa0932150	0.814838	1.256648e-51	-8.615850e-47
Msa0587180	Msa0932150	0.803337	3.658802e-49	-8.615850e-47
Msa0587870	Msa0932150	0.827895	1.215255e-54	-8.615850e-47
Msa0589460	Msa0932150	0.807594	4.682955e-50	-8.615850e-47
Msa0591490	Msa0932150	0.808436	3.100438e-50	-8.615850e-47
Msa0602050	Msa0932150	0.835191	1.937547e-56	-8.615850e-47
Msa0846900	Msa0932150	0.811679	6.206744e-51	-8.615850e-47
Msa0847140	Msa0932150	0.805239	1.469681e-49	-8.615850e-47
Msa0848670	Msa0932150	-0.812739	3.643021e-51	-8.615850e-47
Msa0852090	Msa0932150	-0.832627	8.486980e-56	-8.615850e-47
Msa0853150	Msa0932150	-0.807782	4.271495e-50	-8.615850e-47
Msa0859270	Msa0932150	0.823571	1.289316e-53	-8.615850e-47
Msa0861730	Msa0932150	0.815600	8.507884e-52	-8.615850e-47
Msa0861820	Msa0932150	0.800863	1.180575e-48	-8.615850e-47
Msa0862230	Msa0932150	-0.821889	3.176197e-53	-8.615850e-47
Msa0867080	Msa0932150	0.803146	4.007356e-49	-8.615850e-47
Msa0869660	Msa0932150	0.843683	1.205419e-58	-8.615850e-47
Msa0871420	Msa0932150	0.827430	1.571073e-54	-8.615850e-47
Msa0879650	Msa0932150	-0.814412	1.561040e-51	-8.615850e-47
Msa0880910	Msa0932150	0.818111	2.324322e-52	-8.615850e-47
Msa0882370	Msa0932150	0.821950	3.074049e-53	-8.615850e-47
Msa0887100	Msa0932150	-0.826596	2.487283e-54	-8.615850e-47
Msa0893840	Msa0932150	0.810551	1.089466e-50	-8.615850e-47
Msa0898830	Msa0932150	-0.804086	2.557000e-49	-8.615850e-47
Msa0900830	Msa0932150	0.818131	2.300024e-52	-8.615850e-47
Msa0902340	Msa0932150	0.807799	4.236830e-50	-8.615850e-47
Msa0907840	Msa0932150	0.810782	9.713282e-51	-8.615850e-47
Msa0913140	Msa0932150	-0.820605	6.278913e-53	-8.615850e-47
Msa0914710	Msa0932150	0.819033	1.436330e-52	-8.615850e-47
Msa0925630	Msa0932150	-0.810372	1.190805e-50	-8.615850e-47
Msa0930210	Msa0932150	0.809370	1.956801e-50	-8.615850e-47
Msa0931550	Msa0932150	-0.830140	3.473468e-55	-8.615850e-47
Msa0932140	Msa0932150	0.970705	5.023301e-132	-8.615850e-47
Msa0932150	Msa0936630	0.818636	1.767293e-52	-8.615850e-47
Msa0932150	Msa0940780	0.838308	3.106794e-57	-8.615850e-47
Msa0932150	Msa0946310	0.808302	3.310634e-50	-8.615850e-47
Msa0932150	Msa0947430	0.813601	2.357003e-51	-8.615850e-47
Msa0932150	Msa0950470	-0.816955	4.233813e-52	-8.615850e-47
Msa0932150	Msa0950570	-0.821304	4.336118e-53	-8.615850e-47
Msa0932150	Msa0965950	0.814155	1.779470e-51	-8.615850e-47
Msa0932150	Msa0967780	0.819441	1.159545e-52	-8.615850e-47
Msa0932150	Msa0967900	-0.857097	2.058091e-62	-8.615850e-47
Msa0932150	Msa0970270	0.918186	2.125261e-86	-8.615850e-47
Msa0932150	Msa0973770	0.808346	3.241005e-50	-8.615850e-47
Msa0932150	Msa0982560	0.832612	8.560304e-56	-8.615850e-47
Msa0932150	Msa0989480	0.814470	1.515595e-51	-8.615850e-47
Msa0932150	Msa0993450	0.811595	6.470507e-51	-8.615850e-47
Msa0932150	Msa0998660	-0.800396	1.470004e-48	-8.615850e-47
Msa0932150	Msa1002820	0.825923	3.597005e-54	-8.615850e-47
Msa0932150	Msa1006220	0.811914	5.516656e-51	-8.615850e-47
Msa0932150	Msa1014550	-0.815293	9.958698e-52	-8.615850e-47
Msa0932150	Msa1024350	0.801333	9.459842e-49	-8.615850e-47
Msa0932150	Msa1024420	0.800788	1.222774e-48	-8.615850e-47
Msa0932150	Msa1024570	0.858414	8.376311e-63	-8.615850e-47
Msa0932150	Msa1026490	0.811499	6.789846e-51	-8.615850e-47
Msa0932150	Msa1029780	0.804069	2.578056e-49	-8.615850e-47
Msa0932150	Msa1029820	0.810204	1.294998e-50	-8.615850e-47
Msa0932150	Msa1029860	0.800816	1.206654e-48	-8.615850e-47
Msa0932150	Msa1030320	0.830097	3.556919e-55	-8.615850e-47
Msa0932150	Msa1031530	-0.837601	4.721781e-57	-8.615850e-47
Msa0932150	Msa1036020	0.803890	2.808967e-49	-8.615850e-47
Msa0932150	Msa1037350	0.800152	1.648284e-48	-8.615850e-47
Msa0932150	Msa1041060	0.803702	3.072489e-49	-8.615850e-47
Msa0932150	Msa1041170	0.812496	4.117382e-51	-8.615850e-47
Msa0932150	Msa1043020	-0.800150	1.649835e-48	-8.615850e-47
Msa0932150	Msa1047300	0.801857	7.388635e-49	-8.615850e-47
Msa0932150	Msa1047340	0.802546	5.328697e-49	-8.615850e-47
Msa0932150	Msa1052030	-0.809099	2.236673e-50	-8.615850e-47
Msa0932150	Msa1053340	0.830078	3.596368e-55	-8.615850e-47
Msa0932150	Msa1055450	0.805723	1.163262e-49	-8.615850e-47
Msa0932150	Msa1055520	-0.806201	9.229925e-50	-8.615850e-47
Msa0932150	Msa1061760	0.806712	7.199119e-50	-8.615850e-47
Msa0932150	Msa1064940	0.813369	2.651086e-51	-8.615850e-47
Msa0932150	Msa1066150	0.821946	3.080264e-53	-8.615850e-47
Msa0932150	Msa1068730	0.815124	1.085365e-51	-8.615850e-47
Msa0932150	Msa1068780	0.800284	1.548982e-48	-8.615850e-47
Msa0932150	Msa1068940	0.809692	1.668601e-50	-8.615850e-47
Msa0932150	Msa1069350	0.820138	8.034654e-53	-8.615850e-47
Msa0932150	Msa1070630	-0.859078	5.304891e-63	-8.615850e-47
Msa0932150	Msa1074560	0.826978	2.015671e-54	-8.615850e-47
Msa0932150	Msa1076280	0.807535	4.820287e-50	-8.615850e-47
Msa0932150	Msa1076830	0.839363	1.657127e-57	-8.615850e-47
Msa0932150	Msa1078300	0.812829	3.480943e-51	-8.615850e-47
Msa0932150	Msa1078590	-0.832201	1.082218e-55	-8.615850e-47
Msa0932150	Msa1078600	-0.802619	5.147790e-49	-8.615850e-47
Msa0932150	Msa1078760	-0.831492	1.619132e-55	-8.615850e-47
Msa0932150	Msa1078770	-0.802631	5.119468e-49	-8.615850e-47
Msa0932150	Msa1079820	0.807314	5.369363e-50	-8.615850e-47
Msa0932150	Msa1085560	0.801937	7.113692e-49	-8.615850e-47
Msa0932150	Msa1088400	-0.807287	5.440112e-50	-8.615850e-47
Msa0932150	Msa1088740	-0.837680	4.507022e-57	-8.615850e-47
Msa0932150	Msa1090150	0.802536	5.355587e-49	-8.615850e-47
Msa0932150	Msa1093190	-0.840414	8.821693e-58	-8.615850e-47
Msa0932150	Msa1095410	0.820340	7.224706e-53	-8.615850e-47
Msa0932150	Msa1096520	-0.802995	4.304412e-49	-8.615850e-47
Msa0932150	Msa1096570	-0.814529	1.470916e-51	-8.615850e-47
Msa0932150	Msa1101300	-0.822549	2.231852e-53	-8.615850e-47
Msa0932150	Msa1103450	0.800946	1.135098e-48	-8.615850e-47
Msa0932150	Msa1107330	0.840073	1.083202e-57	-8.615850e-47
Msa0932150	Msa1108560	0.809056	2.284713e-50	-8.615850e-47
Msa0932150	Msa1111650	0.827705	1.349912e-54	-8.615850e-47
Msa0932150	Msa1116850	-0.801490	8.783977e-49	-8.615850e-47
Msa0932150	Msa1123010	0.803093	4.109383e-49	-8.615850e-47
Msa0932150	Msa1124210	0.835991	1.215364e-56	-8.615850e-47
Msa0932150	Msa1124220	0.805218	1.484342e-49	-8.615850e-47
Msa0932150	Msa1125450	-0.828226	1.011589e-54	-8.615850e-47
Msa0932150	Msa1127200	0.823483	1.352296e-53	-8.615850e-47
Msa0932150	Msa1132330	0.830020	3.714249e-55	-8.615850e-47
Msa0932150	Msa1133440	-0.805870	1.083535e-49	-8.615850e-47
Msa0932150	Msa1140480	-0.803915	2.775794e-49	-8.615850e-47
Msa0932150	Msa1142590	0.834046	3.757529e-56	-8.615850e-47
Msa0932150	Msa1142600	0.810685	1.019185e-50	-8.615850e-47
Msa0932150	Msa1143490	0.851552	8.237261e-61	-8.615850e-47
Msa0932150	Msa1143860	-0.801143	1.034923e-48	-8.615850e-47
Msa0932150	Msa1145930	-0.805641	1.210260e-49	-8.615850e-47
Msa0932150	Msa1146980	0.825494	4.546414e-54	-8.615850e-47
Msa0932150	Msa1147010	0.819928	8.974524e-53	-8.615850e-47
Msa0932150	Msa1148210	0.806999	6.260647e-50	-8.615850e-47
Msa0932150	Msa1150860	0.822183	2.714320e-53	-8.615850e-47
Msa0932150	Msa1156240	0.801236	9.903579e-49	-8.615850e-47
Msa0932150	Msa1156740	0.805347	1.395136e-49	-8.615850e-47
Msa0932150	Msa1157210	0.834396	3.070239e-56	-8.615850e-47
Msa0932150	Msa1158450	-0.854789	9.741734e-62	-8.615850e-47
Msa0932150	Msa1164570	-0.832234	1.062168e-55	-8.615850e-47
Msa0932150	Msa1165460	0.839630	1.412358e-57	-8.615850e-47
Msa0932150	Msa1165880	0.801941	7.098976e-49	-8.615850e-47
Msa0932150	Msa1169590	-0.823008	1.745230e-53	-8.615850e-47
Msa0932150	Msa1170320	0.816054	6.738615e-52	-8.615850e-47
Msa0932150	Msa1179340	0.815893	7.320252e-52	-8.615850e-47
Msa0932150	Msa1181090	0.809553	1.787791e-50	-8.615850e-47
Msa0932150	Msa1186260	0.823056	1.700741e-53	-8.615850e-47
Msa0932150	Msa1186340	0.843796	1.123740e-58	-8.615850e-47
Msa0932150	Msa1187900	0.804265	2.347131e-49	-8.615850e-47
Msa0932150	Msa1188080	0.807945	3.944257e-50	-8.615850e-47
Msa0932150	Msa1190350	-0.848423	6.187168e-60	-8.615850e-47
Msa0932150	Msa1190610	0.811062	8.445502e-51	-8.615850e-47
Msa0932150	Msa1191530	-0.805118	1.557276e-49	-8.615850e-47
Msa0932150	Msa1197720	0.801453	8.938544e-49	-8.615850e-47
Msa0932150	Msa1205270	-0.858900	5.996714e-63	-8.615850e-47
Msa0932150	Msa1206220	0.824553	7.584655e-54	-8.615850e-47
Msa0932150	Msa1209990	-0.801535	8.601053e-49	-8.615850e-47
Msa0932150	Msa1211130	0.826745	2.292367e-54	-8.615850e-47
Msa0932150	Msa1214960	0.805541	1.270384e-49	-8.615850e-47
Msa0932150	Msa1217890	0.825316	5.010677e-54	-8.615850e-47
Msa0932150	Msa1223540	0.803204	3.896779e-49	-8.615850e-47
Msa0932150	Msa1223620	0.807061	6.074147e-50	-8.615850e-47
Msa0932150	Msa1223960	0.829901	3.972235e-55	-8.615850e-47
Msa0932150	Msa1223990	0.807980	3.876844e-50	-8.615850e-47
Msa0932150	Msa1225140	-0.803320	3.687948e-49	-8.615850e-47
Msa0932150	Msa1225890	0.839390	1.631006e-57	-8.615850e-47
Msa0932150	Msa1226210	0.822545	2.237070e-53	-8.615850e-47
Msa0932150	Msa1228460	-0.800281	1.551077e-48	-8.615850e-47
Msa0932150	Msa1228600	-0.819335	1.226107e-52	-8.615850e-47
Msa0932150	Msa1230560	0.847894	8.664791e-60	-8.615850e-47
Msa0932150	Msa1236860	-0.865729	4.781798e-65	-8.615850e-47
Msa0932150	Msa1240060	0.821316	4.307363e-53	-8.615850e-47
Msa0932150	Msa1244900	0.814094	1.834772e-51	-8.615850e-47
Msa0932150	Msa1245530	0.805274	1.444542e-49	-8.615850e-47
Msa0932150	Msa1255030	-0.806019	1.007823e-49	-8.615850e-47
Msa0932150	Msa1255710	0.805021	1.632492e-49	-8.615850e-47
Msa0932150	Msa1257200	0.801005	1.104084e-48	-8.615850e-47
Msa0932150	Msa1259560	0.808121	3.618946e-50	-8.615850e-47
Msa0932150	Msa1262650	0.802197	6.289377e-49	-8.615850e-47
Msa0932150	Msa1263110	0.833716	4.546084e-56	-8.615850e-47
Msa0932150	Msa1263120	0.815273	1.006165e-51	-8.615850e-47
Msa0932150	Msa1263520	0.806815	6.848507e-50	-8.615850e-47
Msa0932150	Msa1266120	-0.828132	1.065785e-54	-8.615850e-47
Msa0932150	Msa1267990	0.825799	3.849472e-54	-8.615850e-47
Msa0932150	Msa1273320	0.819558	1.090544e-52	-8.615850e-47
Msa0932150	Msa1281370	0.832335	1.002750e-55	-8.615850e-47
Msa0932150	Msa1281780	0.810730	9.966390e-51	-8.615850e-47
Msa0932150	Msa1283980	0.800615	1.326542e-48	-8.615850e-47
Msa0932150	Msa1286860	-0.841599	4.308911e-58	-8.615850e-47
Msa0932150	Msa1295210	-0.827206	1.778414e-54	-8.615850e-47
Msa0932150	Msa1297220	-0.861684	8.627183e-64	-8.615850e-47
Msa0932150	Msa1298480	-0.800416	1.456147e-48	-8.615850e-47
Msa0932150	Msa1311370	0.836291	1.019969e-56	-8.615850e-47
Msa0932150	Msa1313720	0.813558	2.409207e-51	-8.615850e-47
Msa0932150	Msa1317240	-0.857229	1.881847e-62	-8.615850e-47
Msa0932150	Msa1317740	0.800087	1.699091e-48	-8.615850e-47
Msa0932150	Msa1320530	0.832236	1.060641e-55	-8.615850e-47
Msa0932150	Msa1321970	0.823402	1.412074e-53	-8.615850e-47
Msa0932150	Msa1322500	0.817829	2.692303e-52	-8.615850e-47
Msa0932150	Msa1322980	0.811784	5.887073e-51	-8.615850e-47
Msa0932150	Msa1323080	0.813309	2.732618e-51	-8.615850e-47
Msa0932150	Msa1323260	-0.865437	5.908122e-65	-8.615850e-47
Msa0932150	Msa1332690	-0.801853	7.402014e-49	-8.615850e-47
Msa0932150	Msa1335100	0.821477	3.955315e-53	-8.615850e-47
Msa0932150	Msa1342360	-0.827332	1.659045e-54	-8.615850e-47
Msa0932150	Msa1342760	0.835944	1.249102e-56	-8.615850e-47
Msa0932150	Msa1343450	-0.868907	4.603537e-66	-8.615850e-47
Msa0932150	Msa1345390	0.801245	9.863121e-49	-8.615850e-47
Msa0932150	Msa1350580	-0.807533	4.826316e-50	-8.615850e-47
Msa0932150	Msa1352600	-0.800578	1.349808e-48	-8.615850e-47
Msa0932150	Msa1352630	-0.818215	2.202054e-52	-8.615850e-47
Msa0932150	Msa1357860	0.805492	1.300423e-49	-8.615850e-47
Msa0932150	Msa1359590	0.805014	1.637352e-49	-8.615850e-47
Msa0932150	Msa1361980	0.830260	3.246911e-55	-8.615850e-47
Msa0932150	Msa1361990	0.811626	6.373756e-51	-8.615850e-47
Msa0932150	Msa1368420	0.811257	7.664889e-51	-8.615850e-47
Msa0932150	Msa1369180	-0.809690	1.670344e-50	-8.615850e-47
Msa0932150	Msa1371800	0.823402	1.411963e-53	-8.615850e-47
Msa0932150	Msa1373560	0.823557	1.299187e-53	-8.615850e-47
Msa0932150	Msa1376010	-0.803228	3.853612e-49	-8.615850e-47
Msa0932150	Msa1376070	0.840852	6.773154e-58	-8.615850e-47
Msa0932150	Msa1376310	0.825931	3.582134e-54	-8.615850e-47
Msa0932150	Msa1377520	0.810120	1.349604e-50	-8.615850e-47
Msa0932150	Msa1378400	0.807078	6.024056e-50	-8.615850e-47
Msa0932150	Msa1380740	0.829951	3.862415e-55	-8.615850e-47
Msa0932150	Msa1383220	0.808932	2.428556e-50	-8.615850e-47
Msa0932150	Msa1383500	0.822656	2.107377e-53	-8.615850e-47
Msa0932150	Msa1384410	-0.826520	2.593594e-54	-8.615850e-47
Msa0932150	Msa1386250	-0.817705	2.871262e-52	-8.615850e-47
Msa0932150	Msa1387480	0.803896	2.800831e-49	-8.615850e-47
Msa0932150	Msa1387530	0.827068	1.918824e-54	-8.615850e-47
Msa0932150	Msa1395050	0.832461	9.327688e-56	-8.615850e-47
Msa0932150	Msa1395720	0.811624	6.377871e-51	-8.615850e-47
Msa0932150	Msa1400290	-0.836860	7.307141e-57	-8.615850e-47
Msa0932150	Msa1402300	0.804382	2.218862e-49	-8.615850e-47
Msa0932150	Msa1403660	0.805459	1.321521e-49	-8.615850e-47
Msa0932150	Msa1405830	0.821783	3.360214e-53	-8.615850e-47
Msa0932150	Msa1407670	0.821059	4.937156e-53	-8.615850e-47
Msa0932150	Msa1407810	0.816186	6.296702e-52	-8.615850e-47
Msa0932150	Msa1412740	-0.808612	2.843397e-50	-8.615850e-47
Msa0932150	Msa1413020	0.861802	7.940502e-64	-8.615850e-47
Msa0932150	Msa1414780	-0.806101	9.688340e-50	-8.615850e-47
Msa0932150	Msa1418840	-0.801281	9.697672e-49	-8.615850e-47
Msa0932150	Msa1421120	0.807340	5.301361e-50	-8.615850e-47
Msa0932150	Msa1421130	0.811083	8.359480e-51	-8.615850e-47
Msa0932150	Msa1421540	0.810980	8.801197e-51	-8.615850e-47
Msa0932150	Msa1429810	0.833319	5.711054e-56	-8.615850e-47
Msa0932150	Msa1434700	0.806309	8.758860e-50	-8.615850e-47
Msa0932150	Msa1436660	-0.801931	7.131702e-49	-8.615850e-47
Msa0932150	Msa1437780	0.814694	1.352066e-51	-8.615850e-47
Msa0932150	Msa1441450	0.809528	1.809933e-50	-8.615850e-47
Msa0932150	Msa1449770	0.827758	1.310613e-54	-8.615850e-47
Msa0932150	Msa1450630	-0.833092	6.503619e-56	-8.615850e-47
Msa0932150	Msa1450780	-0.811454	6.943787e-51	-8.615850e-47
Msa0932150	Msa1455360	0.845149	4.863610e-59	-8.615850e-47
Msa0932150	Msa1456620	-0.817564	3.088984e-52	-8.615850e-47
Msa0932150	Msa1457850	0.804892	1.736619e-49	-8.615850e-47
Msa0932150	Msa1459610	0.821893	3.169281e-53	-8.615850e-47
Msa0932150	Msa1460530	-0.833175	6.202553e-56	-8.615850e-47
Msa0932150	Msa1460970	0.815543	8.761961e-52	-8.615850e-47
Msa0932150	Msa1461660	0.819096	1.389828e-52	-8.615850e-47
Msa0932150	Msa1462610	0.825244	5.209959e-54	-8.615850e-47
Msa0932150	Msa1462780	0.849683	2.762329e-60	-8.615850e-47

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0932150	MtrunA17_Chr6g0449061	96.026	453	11	1	2	454	3	448	0.0	883
Msa0932150	MtrunA17_Chr7g0251321	71.866	359	82	1	96	454	1	340	0.0	536
Msa0932150	MtrunA17_Chr7g0251331	52.796	447	207	2	15	458	2	447	1.40e-169	486
Msa0932150	MtrunA17_Chr1g0208821	49.672	457	224	3	1	452	1	456	1.78e-158	457
Msa0932150	MtrunA17_Chr1g0208881	51.570	446	211	2	16	457	5	449	6.14e-156	451
Msa0932150	MtrunA17_Chr1g0208891	51.253	439	213	1	19	457	7	444	2.36e-153	444
Msa0932150	MtrunA17_Chr6g0483361	49.883	429	212	2	21	447	10	437	5.07e-144	420
Msa0932150	MtrunA17_Chr6g0483381	49.431	439	218	3	13	449	5	441	1.51e-142	417
Msa0932150	MtrunA17_Chr6g0477961	49.635	411	204	2	39	447	30	439	9.86e-133	392
Msa0932150	MtrunA17_Chr1g0208791	45.721	444	233	3	13	451	17	457	8.36e-128	380
Msa0932150	MtrunA17_Chr8g0392601	43.448	435	245	1	27	461	3	436	7.01e-123	366
Msa0932150	MtrunA17_Chr6g0483351	50.549	364	178	1	96	457	1	364	1.47e-122	364
Msa0932150	MtrunA17_Chr6g0483341	44.084	431	241	0	31	461	36	466	5.34e-121	362
Msa0932150	MtrunA17_Chr6g0483331	42.482	419	241	0	31	449	7	425	6.52e-110	333
Msa0932150	MtrunA17_Chr2g0322671	36.211	475	282	5	1	457	1	472	1.97e-102	315
Msa0932150	MtrunA17_Chr4g0024501	35.258	485	285	4	1	457	1	484	9.33e-101	311
Msa0932150	MtrunA17_Chr2g0317131	38.530	449	267	3	13	453	12	459	1.44e-98	304
Msa0932150	MtrunA17_Chr6g0483161	39.130	368	205	1	94	461	1	349	4.27e-96	294
Msa0932150	MtrunA17_Chr2g0317151	38.255	447	273	2	7	453	6	449	8.94e-96	297
Msa0932150	MtrunA17_Chr2g0288281	39.452	365	221	0	96	460	1	365	2.94e-88	274
Msa0932150	MtrunA17_Chr2g0317161	37.560	418	258	3	35	451	30	445	5.01e-86	272
Msa0932150	MtrunA17_Chr2g0317171	35.682	440	275	3	19	451	13	451	5.96e-84	266
Msa0932150	MtrunA17_Chr8g0368001	34.716	458	292	5	3	457	16	469	8.80e-82	261
Msa0932150	MtrunA17_Chr2g0317221	38.162	359	222	0	93	451	7	365	3.49e-79	252
Msa0932150	MtrunA17_Chr5g0412771	35.116	430	277	2	32	461	52	479	7.60e-78	251
Msa0932150	MtrunA17_Chr5g0412541	33.554	453	286	5	8	451	3	449	2.72e-76	246
Msa0932150	MtrunA17_Chr1g0203791	33.769	459	284	7	2	449	27	476	3.87e-75	245
Msa0932150	MtrunA17_Chr5g0397991	32.409	469	299	8	2	461	32	491	1.59e-74	243
Msa0932150	MtrunA17_Chr5g0428251	31.579	437	292	4	19	451	36	469	3.54e-72	238
Msa0932150	MtrunA17_Chr6g0473701	32.308	455	297	6	3	452	95	543	2.74e-71	237
Msa0932150	MtrunA17_Chr6g0467321	31.947	457	293	4	18	460	21	473	8.00e-71	233
Msa0932150	MtrunA17_Chr7g0254521	32.609	460	301	4	4	461	2	454	2.77e-70	231
Msa0932150	MtrunA17_Chr3g0140931	30.786	458	304	6	11	461	26	477	1.80e-69	230
Msa0932150	MtrunA17_Chr5g0442331	31.510	457	293	3	14	451	5	460	1.16e-66	222
Msa0932150	MtrunA17_Chr3g0132531	33.933	445	289	3	7	451	20	459	3.36e-66	221
Msa0932150	MtrunA17_Chr7g0254511	31.567	453	300	5	8	457	3	448	2.35e-65	218
Msa0932150	MtrunA17_Chr7g0254531	35.519	366	235	1	96	461	1	365	1.44e-64	213
Msa0932150	MtrunA17_Chr8g0389801	31.132	424	285	4	32	453	19	437	1.81e-63	212
Msa0932150	MtrunA17_Chr1g0154441	34.358	358	230	2	96	451	1	355	2.87e-63	210
Msa0932150	MtrunA17_Chr4g0013031	31.132	424	281	5	36	453	66	484	2.48e-61	208
Msa0932150	MtrunA17_Chr5g0412571	35.635	362	224	3	94	451	38	394	1.05e-59	201
Msa0932150	MtrunA17_Chr1g0202761	31.019	432	295	2	26	457	33	461	5.60e-59	201
Msa0932150	MtrunA17_Chr6g0468531	30.973	452	300	6	13	457	3	449	8.82e-56	192
Msa0932150	MtrunA17_Chr2g0295631	30.090	442	292	3	28	453	12	452	1.80e-55	192
Msa0932150	MtrunA17_Chr6g0468521	29.011	455	304	7	13	457	3	448	1.29e-54	189
Msa0932150	MtrunA17_Chr6g0460541	32.698	367	239	3	94	457	3	364	5.11e-51	178
Msa0932150	MtrunA17_Chr6g0468511	29.412	442	301	5	13	448	3	439	9.09e-48	171
Msa0932150	MtrunA17_Chr7g0248051	30.892	437	299	2	20	456	54	487	2.27e-47	171
Msa0932150	MtrunA17_Chr6g0483241	43.889	180	101	0	94	273	1	180	5.60e-47	160
Msa0932150	MtrunA17_Chr6g0483264	44.578	166	92	0	277	442	2	167	9.99e-45	155
Msa0932150	MtrunA17_Chr7g0254501	34.686	271	175	1	181	451	2	270	1.44e-44	158
Msa0932150	MtrunA17_Chr3g0132541	28.372	430	247	6	31	456	32	404	1.81e-40	150
Msa0932150	MtrunA17_Chr5g0440661	29.363	361	182	9	96	451	1	293	2.69e-36	136
Msa0932150	MtrunA17_Chr8g0364761	30.000	270	187	2	37	305	54	322	1.58e-33	129
Msa0932150	MtrunA17_Chr6g0487091	28.521	284	178	6	181	453	97	366	3.84e-29	118
Msa0932150	MtrunA17_Chr6g0483221	41.727	139	81	0	323	461	6	144	1.08e-28	111
Msa0932150	MtrunA17_Chr8g0364751	42.424	132	76	0	320	451	16	147	9.27e-27	106
Msa0932150	MtrunA17_Chr6g0483261	44.167	120	67	0	323	442	6	125	1.70e-25	102
Msa0932150	MtrunA17_Chr5g0398571	28.625	269	181	3	192	454	1	264	1.02e-24	103
Msa0932150	MtrunA17_Chr6g0460521	34.595	185	121	0	273	457	1	185	2.06e-21	92.8
Msa0932150	MtrunA17_Chr6g0460531	27.106	273	177	7	7	273	3	259	5.85e-18	83.6
Msa0932150	MtrunA17_Chr5g0442311	25.824	182	127	2	96	273	1	178	1.04e-15	75.1
Msa0932150	MtrunA17_Chr6g0483281	49.296	71	36	0	207	277	5	75	1.27e-14	69.3
Msa0932150	MtrunA17_Chr6g0483291	45.946	74	36	1	26	99	4	73	7.39e-11	58.2

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0932150	AT1G66760.1	49.446	451	224	2	7	457	1	447	8.95e-165	473
Msa0932150	AT1G66760.2	49.446	451	224	2	7	457	1	447	1.80e-164	473
Msa0932150	AT1G64820.1	50.885	452	221	1	10	461	2	452	7.70e-161	464
Msa0932150	AT1G71140.1	51.972	431	206	1	27	457	16	445	3.40e-157	454
Msa0932150	AT1G66780.1	51.487	437	208	2	24	457	19	454	2.79e-153	444
Msa0932150	AT2G04100.1	50.476	420	207	1	33	452	26	444	5.60e-147	428
Msa0932150	AT2G04100.2	50.476	420	207	1	33	452	26	444	7.63e-147	427
Msa0932150	AT2G04090.1	50.000	420	209	1	33	452	26	444	6.81e-146	425
Msa0932150	AT1G15170.1	47.484	457	236	2	1	457	1	453	1.24e-145	425
Msa0932150	AT1G15150.1	47.775	427	222	1	31	457	25	450	3.93e-145	424
Msa0932150	AT1G15160.1	45.733	457	241	3	1	457	1	450	4.74e-144	421
Msa0932150	AT5G52450.1	48.444	450	218	3	1	449	1	437	6.15e-144	421
Msa0932150	AT2G04040.1	47.765	425	221	1	32	456	22	445	1.31e-143	419
Msa0932150	AT2G04080.1	45.147	443	242	1	14	456	4	445	6.22e-143	418
Msa0932150	AT2G04080.2	45.147	443	242	1	14	456	4	445	8.99e-143	417
Msa0932150	AT2G04050.1	47.489	438	223	2	20	457	16	446	1.50e-142	417
Msa0932150	AT2G04070.1	47.506	421	220	1	37	457	27	446	3.67e-141	413
Msa0932150	AT1G66760.4	48.363	397	201	2	7	403	1	393	1.12e-138	404
Msa0932150	AT2G34360.1	49.061	426	207	5	26	449	15	432	4.10e-136	400
Msa0932150	AT1G15180.1	45.695	453	241	3	1	452	1	449	4.66e-134	395
Msa0932150	AT1G73700.1	49.438	445	217	3	7	451	1	437	1.06e-133	394
Msa0932150	AT1G66760.3	50.157	319	159	0	139	457	1	319	2.55e-118	350
Msa0932150	AT2G34360.2	43.765	425	189	3	26	449	15	390	7.24e-115	345
Msa0932150	AT1G15150.2	48.338	331	171	0	127	457	4	334	9.47e-115	342
Msa0932150	AT1G15170.2	48.943	331	169	0	127	457	4	334	9.22e-114	339
Msa0932150	AT3G23550.1	38.411	453	266	4	18	461	6	454	6.97e-98	302
Msa0932150	AT3G23560.1	37.556	450	267	5	12	451	7	452	5.05e-94	292
Msa0932150	AT3G21690.1	36.384	448	273	2	9	456	35	470	2.07e-92	289
Msa0932150	AT1G61890.1	35.129	427	264	4	37	457	47	466	1.10e-86	274
Msa0932150	AT1G61890.2	35.129	427	264	4	37	457	47	466	2.37e-86	273
Msa0932150	AT1G15180.2	46.931	277	147	0	127	403	4	280	4.81e-86	270
Msa0932150	AT5G38030.1	36.385	426	269	2	32	457	40	463	1.11e-83	266
Msa0932150	AT1G11670.1	33.412	425	274	3	37	457	50	469	2.82e-82	263
Msa0932150	AT3G26590.1	33.766	462	292	3	8	457	4	463	6.53e-82	262
Msa0932150	AT1G61890.3	35.437	412	253	4	37	442	47	451	1.37e-81	260
Msa0932150	AT1G12950.1	36.150	426	270	2	32	457	62	485	2.58e-80	258
Msa0932150	AT4G21903.1	37.879	396	234	5	67	457	83	471	4.56e-79	254
Msa0932150	AT4G21910.2	35.915	426	261	5	37	457	57	475	7.20e-79	254
Msa0932150	AT4G21910.4	35.915	426	261	5	37	457	57	475	7.20e-79	254
Msa0932150	AT4G21903.2	37.879	396	234	5	67	457	83	471	7.76e-79	254
Msa0932150	AT4G21910.3	35.059	425	266	4	37	457	55	473	1.65e-78	253
Msa0932150	AT4G21910.1	35.059	425	266	4	37	457	55	473	1.65e-78	253
Msa0932150	AT4G21903.3	37.978	366	219	2	96	457	1	362	1.70e-77	247
Msa0932150	AT3G59030.1	34.670	424	274	3	35	457	49	470	2.17e-77	250
Msa0932150	AT3G23560.2	36.318	402	242	5	12	403	7	404	4.83e-76	244
Msa0932150	AT1G23300.1	34.943	435	276	5	24	456	32	461	1.98e-73	240
Msa0932150	AT1G47530.1	34.066	455	294	4	7	457	1	453	4.23e-73	238
Msa0932150	AT5G65380.1	34.444	450	284	5	6	451	7	449	2.56e-72	236
Msa0932150	AT5G10420.1	33.183	443	292	3	9	451	12	450	5.15e-72	236
Msa0932150	AT3G26590.2	37.293	362	226	1	96	457	1	361	6.81e-72	233
Msa0932150	AT4G29140.1	33.554	453	288	5	3	453	30	471	1.42e-71	236
Msa0932150	AT4G23030.1	33.623	461	293	5	11	461	1	458	1.45e-70	232
Msa0932150	AT1G33110.1	33.784	444	290	3	10	451	7	448	3.98e-70	231
Msa0932150	AT5G52050.1	32.265	468	290	9	1	453	1	456	4.07e-70	231
Msa0932150	AT5G44050.1	32.009	453	305	3	9	461	13	462	1.01e-69	230
Msa0932150	AT1G33100.1	34.389	442	287	3	10	451	7	445	5.90e-69	228
Msa0932150	AT1G33090.1	34.521	449	280	6	10	451	7	448	7.17e-67	222
Msa0932150	AT2G38510.1	29.535	430	298	3	36	461	5	433	6.63e-66	219
Msa0932150	AT1G71870.1	31.278	454	289	6	18	452	6	455	1.54e-65	219
Msa0932150	AT1G33080.2	33.333	444	292	3	10	451	7	448	4.76e-64	215
Msa0932150	AT1G33080.1	33.333	444	292	3	10	451	7	448	5.79e-64	214
Msa0932150	AT1G47530.2	35.635	362	232	1	96	457	1	361	2.08e-63	210
Msa0932150	AT1G58340.1	30.549	419	286	3	35	451	56	471	1.61e-62	212
Msa0932150	AT4G00350.1	34.266	429	269	7	37	460	88	508	2.85e-62	211
Msa0932150	AT5G19700.1	31.442	423	279	5	36	453	35	451	6.49e-61	207
Msa0932150	AT3G59030.2	32.703	370	246	3	35	403	49	416	4.23e-58	197
Msa0932150	AT4G22790.1	30.905	453	296	5	3	451	6	445	8.76e-57	196
Msa0932150	AT5G49130.1	29.792	433	289	4	35	453	24	455	4.35e-56	194
Msa0932150	AT4G25640.1	31.494	435	295	2	18	452	15	446	1.60e-55	192
Msa0932150	AT4G25640.2	31.494	435	295	2	18	452	15	446	5.26e-55	191
Msa0932150	AT5G17700.2	29.821	446	303	4	10	451	7	446	5.09e-53	186
Msa0932150	AT5G17700.1	29.821	446	303	4	10	451	7	446	5.09e-53	186
Msa0932150	AT1G33110.2	31.830	399	264	5	10	404	7	401	2.48e-52	181
Msa0932150	AT4G25640.3	31.579	418	283	2	18	435	15	429	7.10e-52	182
Msa0932150	AT3G03620.2	29.291	437	302	5	19	451	16	449	2.08e-49	176
Msa0932150	AT3G03620.1	29.291	437	302	5	19	451	16	449	2.08e-49	176
Msa0932150	AT5G17700.3	27.387	398	279	4	10	403	7	398	1.10e-36	139
Msa0932150	AT2G04066.1	49.000	100	51	0	357	456	41	140	4.85e-27	107

Find 108 sgRNAs with CRISPR-Local

Find 209 sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
CATTCCTATTTGTTGGATTC+TGG	0.144927	6_3:+149841	Msa0932150:CDS
ACTAACATCTAGACATATTT+TGG	0.171532	6_3:+151661	Msa0932150:three_prime_UTR
ATTCCTATTGGTTTGTTATT+AGG	0.201827	6_3:+151227	Msa0932150:CDS
TAGCTATTGGAATTTCTTAT+TGG	0.229128	6_3:+149900	Msa0932150:CDS
TTCCTTCTGGACTCATGTTT+TGG	0.233890	6_3:+150038	Msa0932150:CDS
TGCAAATATGCTATTCCTTC+TGG	0.235933	6_3:+150025	Msa0932150:CDS
GTTAGAGTGGTTGTGATTAT+TGG	0.240480	6_3:+150540	Msa0932150:CDS
ACTCGTGTTTCAAATGAATT+AGG	0.240783	6_3:+150486	Msa0932150:CDS
TACCTCATTCCCGCTCTATT+TGG	0.243762	6_3:+149725	Msa0932150:CDS
GTTAGTGCTGATAGTCTAAT+TGG	0.244051	6_3:+150690	Msa0932150:CDS
TGTGAATTACATTGCGGATA+TGG	0.251319	6_3:+150647	Msa0932150:CDS
AGTCTAATTGGAGCTCTTTC+AGG	0.262673	6_3:+150702	Msa0932150:CDS
ACAGCTCCCTTAGCTGTCTT+TGG	0.262861	6_3:-150519	None:intergenic
AATATCCACACAAGAGATAT+TGG	0.269827	6_3:-149632	None:intergenic
GGTATACTTGTTTCATTCTC+TGG	0.275398	6_3:+148416	Msa0932150:CDS
ATTGGAGCTGCTTTAGCTAT+TGG	0.308771	6_3:+149887	Msa0932150:CDS
CTTATTGGTTGAATGTGATA+TGG	0.309579	6_3:+149915	Msa0932150:CDS
GAGGTTTCAAGTTGAGGATT+AGG	0.328796	6_3:-150187	None:intergenic
GGTTGAATGTGATATGGCTT+TGG	0.339522	6_3:+149921	Msa0932150:CDS
TATATTGTGGGAATTCCTAT+TGG	0.359116	6_3:+151215	Msa0932150:CDS
AAAACCAGAATCCAACAAAT+AGG	0.359230	6_3:-149845	None:intergenic
TCAAGTGGTTTCTCTTATGA+TGG	0.367964	6_3:+148382	Msa0932150:CDS
GTTGAAGAAGGTGAGTTTCA+TGG	0.370676	6_3:+148319	Msa0932150:CDS
GTTGAATGTGATATGGCTTT+GGG	0.371323	6_3:+149922	Msa0932150:CDS
ACCTTTGGTGCAGAGGAGTA+TGG	0.372023	6_3:+149554	Msa0932150:CDS
TTGTGGATGGGAACTCTATC+AGG	0.380221	6_3:+151278	Msa0932150:CDS
TTCTTCATTCCATATGCAAT+TGG	0.387110	6_3:+150343	Msa0932150:CDS
AAACCTCGGTTCTTTCTGTC+TGG	0.401635	6_3:+150203	Msa0932150:CDS
ATGAGTAGAAAACACAATCT+TGG	0.406242	6_3:-149978	None:intergenic
CTTATGATGGTGGGACATCT+TGG	0.426032	6_3:+148395	Msa0932150:CDS
CGAGCTACATGAGACATTCC+AGG	0.426985	6_3:-149689	None:intergenic
AGGAGGTGGATTTCAAGAAA+TGG	0.431562	6_3:+151166	Msa0932150:CDS
GAAAGATCATTCCCTGAGTC+TGG	0.432954	6_3:-149781	None:intergenic
AAACCTAATAACAAACCAAT+AGG	0.436422	6_3:-151230	None:intergenic
GCATTGCAGTTGGGAATGGC+TGG	0.439253	6_3:+149506	Msa0932150:intron
AGCATGCTCTCAAAATTTGT+AGG	0.446532	6_3:-151734	None:intergenic
TTGTAACTGCATTAACTGAT+TGG	0.453816	6_3:+151329	Msa0932150:exon
ACAAAGAAATTAATCATGAT+AGG	0.455982	6_3:+151554	Msa0932150:three_prime_UTR
GGAGGTGGATTTCAAGAAAT+GGG	0.458931	6_3:+151167	Msa0932150:CDS
CCTTGGAGCTTACTATATTG+TGG	0.467917	6_3:+151202	Msa0932150:CDS
GTTTGCATTGCAGTTGGGAA+TGG	0.469251	6_3:+149502	Msa0932150:intron
ATATCCACACAAGAGATATT+GGG	0.469336	6_3:-149631	None:intergenic
GCAGAAGCTCCAATTGCATA+TGG	0.475350	6_3:-150352	None:intergenic
TTGCTTATACAGCTGTTGTA+TGG	0.475962	6_3:+151609	Msa0932150:three_prime_UTR
CTTGGAGCTTACTATATTGT+GGG	0.480379	6_3:+151203	Msa0932150:CDS
ACACTATGTGGACAAACCTT+TGG	0.487914	6_3:+149539	Msa0932150:CDS
TCCATACTCCTCTGCACCAA+AGG	0.494105	6_3:-149555	None:intergenic
GAGTTTCATGGCAGCTCCAA+TGG	0.497826	6_3:+148331	Msa0932150:CDS
GCAGGGGTTGCTAGAGGAGG+TGG	0.498862	6_3:+151152	Msa0932150:intron
GATTCGCTATTTCCAGACTC+AGG	0.500456	6_3:+149769	Msa0932150:CDS
AGTGGTTTCTCTTATGATGG+TGG	0.502914	6_3:+148385	Msa0932150:CDS
GCAGAGGAGTATGGAAAACT+TGG	0.503242	6_3:+149563	Msa0932150:CDS
CATCTAAAATTAAATGCGAA+GGG	0.503899	6_3:+151254	Msa0932150:CDS
ATTAACTGATTGGCAGAAAG+AGG	0.504417	6_3:+151339	Msa0932150:three_prime_UTR
AATTAAATGCGAAGGGATTG+TGG	0.504525	6_3:+151261	Msa0932150:CDS
GTTTCAAATGAATTAGGAGC+AGG	0.508966	6_3:+150492	Msa0932150:CDS
AGAACCGAGGTTTCAAGTTG+AGG	0.511415	6_3:-150193	None:intergenic
TTCACAATATCTTCTTCAAG+TGG	0.512019	6_3:+148367	Msa0932150:CDS
GTTTCCCAATATCTCTTGTG+TGG	0.512963	6_3:+149627	Msa0932150:CDS
AAATGCGAAGGGATTGTGGA+TGG	0.515962	6_3:+151265	Msa0932150:CDS
AAACTCTAGAGAGATGAGTA+AGG	0.519910	6_3:+148214	Msa0932150:CDS
TCATCACTCTTTCTTAGCAA+TGG	0.528379	6_3:-148248	None:intergenic
CTAAAATATTTCTAAAGCAA+AGG	0.529386	6_3:-150596	None:intergenic
TCATCTAAAATTAAATGCGA+AGG	0.529668	6_3:+151253	Msa0932150:CDS
ATTCATTCAAGAGTTGAAGA+AGG	0.535676	6_3:+148307	Msa0932150:CDS
GAAACTGTTACAGCTACCAT+TGG	0.542723	6_3:-148347	None:intergenic
AACTAACAACACATTGGTGG+TGG	0.546469	6_3:+151523	Msa0932150:three_prime_UTR
GGAAATCCAAAGACAGCTAA+GGG	0.549690	6_3:+150513	Msa0932150:CDS
AGGAAATCCAAAGACAGCTA+AGG	0.552623	6_3:+150512	Msa0932150:CDS
GTGGTTTCTCTTATGATGGT+GGG	0.552777	6_3:+148386	Msa0932150:CDS
CATTGCAGGCAACAAAAGCA+AGG	0.553104	6_3:+151474	Msa0932150:intron
CAACTCTTCCATCACTTCCA+TGG	0.554813	6_3:-148271	None:intergenic
ATAGCATATTTGCAGAACTC+TGG	0.558784	6_3:-150016	None:intergenic
TCAGGGAATGATCTTTCCCA+TGG	0.560267	6_3:+149787	Msa0932150:CDS
TAGAGAGATGAGTAAGGAGG+TGG	0.565909	6_3:+148220	Msa0932150:CDS
AGCCAAATAGAGCGGGAATG+AGG	0.570337	6_3:-149727	None:intergenic
TGGACAAACCTTTGGTGCAG+AGG	0.570653	6_3:+149547	Msa0932150:CDS
TACCAAAACATGAGTCCAGA+AGG	0.573401	6_3:-150040	None:intergenic
ATTCGCTATTTCCAGACTCA+GGG	0.576880	6_3:+149770	Msa0932150:CDS
CATATTTGCAGAACTCTGGT+AGG	0.578691	6_3:-150012	None:intergenic
AGCTAAGGGAGCTGTTAGAG+TGG	0.582031	6_3:+150527	Msa0932150:CDS
TTGAGGATTAGGTAAAAGCC+CGG	0.583309	6_3:-150176	None:intergenic
TTCAGCAAAAGACATGGCAA+TGG	0.584361	6_3:-148444	None:intergenic
AGTGCATAGCCAAATAGAGC+GGG	0.584898	6_3:-149734	None:intergenic
AGTGATGACCATGGAAGTGA+TGG	0.586777	6_3:+148263	Msa0932150:CDS
CTAACAGAAACACAAAGAAG+AGG	0.588544	6_3:-150672	None:intergenic
AAGTTGGGATTAGGACACAT+TGG	0.599322	6_3:+149869	Msa0932150:CDS
TAATCCTCAACTTGAAACCT+CGG	0.601964	6_3:+150189	Msa0932150:CDS
ATGCAATTGGAGCTTCTGCA+AGG	0.601986	6_3:+150356	Msa0932150:CDS
AGGCAACAAAAGCAAGGGAG+AGG	0.607625	6_3:+151480	Msa0932150:intron
AATTAAAATAAGAATCTCAA+AGG	0.607660	6_3:-150152	None:intergenic
GAGCTACATGAGACATTCCA+GGG	0.620444	6_3:-149688	None:intergenic
AATGCGAAGGGATTGTGGAT+GGG	0.620482	6_3:+151266	Msa0932150:CDS
CCACAATATAGTAAGCTCCA+AGG	0.626718	6_3:-151202	None:intergenic
TGAACTGCAGGGGTTGCTAG+AGG	0.635927	6_3:+151146	Msa0932150:intron
ACTGCAGGGGTTGCTAGAGG+AGG	0.647610	6_3:+151149	Msa0932150:intron
GAGGTGGATTTCAAGAAATG+GGG	0.650274	6_3:+151168	Msa0932150:CDS
CTCTAGAGAGATGAGTAAGG+AGG	0.653478	6_3:+148217	Msa0932150:CDS
AGTAACTTCAGCAAAAGACA+TGG	0.654565	6_3:-148450	None:intergenic
ATTGCAGGCAACAAAAGCAA+GGG	0.658902	6_3:+151475	Msa0932150:intron
TGTGATTATTGGAATTGCTG+AGG	0.666119	6_3:+150551	Msa0932150:CDS
AGGTGGATTTCAAGAAATGG+GGG	0.668457	6_3:+151169	Msa0932150:CDS
ACAAGTTGTGAATTACATTG+CGG	0.676878	6_3:+150641	Msa0932150:CDS
CTAAGAAAGAGTGATGACCA+TGG	0.683327	6_3:+148254	Msa0932150:CDS
TGGAATGAAGAAGTGCAATG+AGG	0.693110	6_3:-150332	None:intergenic
GGAGCATTAGAAACACTATG+TGG	0.708532	6_3:+149527	Msa0932150:CDS
AAGTGCATAGCCAAATAGAG+CGG	0.722956	6_3:-149735	None:intergenic
TCACCAGACAGAAAGAACCG+AGG	0.782249	6_3:-150206	None:intergenic

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content
!!	AAAAAAATGAATATACAAAA+GGG	-	chr6_3:149273-149292	None:intergenic	10.0%
!!	TAGATTAAATTCATTAAATA+AGG	-	chr6_3:149363-149382	None:intergenic	10.0%
!!	CAAAAAAATGAATATACAAA+AGG	-	chr6_3:149274-149293	None:intergenic	15.0%
!!!	TTTGTATATTCATTTTTTTG+AGG	+	chr6_3:149274-149293	Msa0932150:intron	15.0%
!!!	TTGTATATTCATTTTTTTGA+GGG	+	chr6_3:149275-149294	Msa0932150:intron	15.0%
!!	AATTAAAATAAGAATCTCAA+AGG	-	chr6_3:150155-150174	None:intergenic	15.0%
!!!	CTAGATTTTAATGTATATTT+TGG	+	chr6_3:151041-151060	Msa0932150:intron	15.0%
!!	AAAATCAGAAGAAGAAAAAT+AGG	-	chr6_3:148613-148632	None:intergenic	20.0%
!!!	AAAGTACTAATCAAACATTT+AGG	-	chr6_3:148657-148676	None:intergenic	20.0%
!!	TGTACAAATACAGAAAATTT+AGG	-	chr6_3:149184-149203	None:intergenic	20.0%
!!	GCTTCATAGTATAAATATAA+TGG	+	chr6_3:149457-149476	Msa0932150:intron	20.0%
!!	TATCACATGATATTATTGTT+AGG	-	chr6_3:150406-150425	None:intergenic	20.0%
!!!	CTAAAATATTTCTAAAGCAA+AGG	-	chr6_3:150599-150618	None:intergenic	20.0%
!!!	CTTTGCTTTAGAAATATTTT+AGG	+	chr6_3:150597-150616	Msa0932150:CDS	20.0%
!!	AAATTTCATTTACTTTCTGA+GGG	+	chr6_3:150932-150951	Msa0932150:intron	20.0%
!!!	TTTTAGAATGAAGATATTTG+TGG	-	chr6_3:151090-151109	None:intergenic	20.0%
!!	AATAAAAACTAACAACACAT+TGG	+	chr6_3:151517-151536	Msa0932150:three_prime_UTR	20.0%
!!	ACAAAGAAATTAATCATGAT+AGG	+	chr6_3:151554-151573	Msa0932150:three_prime_UTR	20.0%
!!!	TTTCCTTTTCTTGTTTTTCT+TGG	+	chr6_3:148522-148541	Msa0932150:intron	25.0%
!	AATCCAAGAAAAACAAGAAA+AGG	-	chr6_3:148528-148547	None:intergenic	25.0%
!!	TTCTTCTTCTGATTTTTGTT+TGG	+	chr6_3:148617-148636	Msa0932150:intron	25.0%
!!!	TTCTGATTTTTGTTTGGATT+AGG	+	chr6_3:148623-148642	Msa0932150:intron	25.0%
!	ACTTTGTAACAGTAATAAAC+AGG	+	chr6_3:148672-148691	Msa0932150:intron	25.0%
!	CTTCACTCATTATATTCAAT+AGG	-	chr6_3:148792-148811	None:intergenic	25.0%
!!	ATCATTCTCAATTTTCTTGT+GGG	+	chr6_3:148822-148841	Msa0932150:intron	25.0%
!!	TAGTCCTCATATTTTCATTT+TGG	-	chr6_3:148951-148970	None:intergenic	25.0%
!	ATGAAAATATGAGGACTAAT+TGG	+	chr6_3:148953-148972	Msa0932150:intron	25.0%
!	TGAAAATATGAGGACTAATT+GGG	+	chr6_3:148954-148973	Msa0932150:intron	25.0%
!	AATTCTCCTAGAAAATTATG+AGG	+	chr6_3:149002-149021	Msa0932150:intron	25.0%
!	ATTCTCCTAGAAAATTATGA+GGG	+	chr6_3:149003-149022	Msa0932150:intron	25.0%
!	TTATGAGGGTTGTATATAAA+TGG	+	chr6_3:149017-149036	Msa0932150:intron	25.0%
!	AATATACAAAAGGGACATTA+AGG	-	chr6_3:149264-149283	None:intergenic	25.0%
!	AAGGTATAAATATTTAGACG+AGG	-	chr6_3:149344-149363	None:intergenic	25.0%
!	TAGCTATTGGAATTTCTTAT+TGG	+	chr6_3:149900-149919	Msa0932150:CDS	25.0%
!!!	CAATATTGTGTAGTTTTGAA+TGG	+	chr6_3:150125-150144	Msa0932150:intron	25.0%
!!!	GAGATTCTTATTTTAATTGC+CGG	+	chr6_3:150157-150176	Msa0932150:CDS	25.0%
!!!	AGATTCTTATTTTAATTGCC+GGG	+	chr6_3:150158-150177	Msa0932150:CDS	25.0%
!	ATTTATAATGCATTGTCCTA+AGG	+	chr6_3:150244-150263	Msa0932150:intron	25.0%
!	TTTATAATGCATTGTCCTAA+GGG	+	chr6_3:150245-150264	Msa0932150:intron	25.0%
!	TATTGTTAGGATTATGTGTA+TGG	-	chr6_3:150393-150412	None:intergenic	25.0%
!	TGCTCTAATATATAGTCATT+AGG	+	chr6_3:150843-150862	Msa0932150:intron	25.0%
!	AGTTGTGTGAATATAACAAT+AGG	+	chr6_3:150897-150916	Msa0932150:intron	25.0%
!	GTTGTGTGAATATAACAATA+GGG	+	chr6_3:150898-150917	Msa0932150:intron	25.0%
!	CAAATTTCATTTACTTTCTG+AGG	+	chr6_3:150931-150950	Msa0932150:intron	25.0%
!!!	ATTCCTATTGGTTTGTTATT+AGG	+	chr6_3:151227-151246	Msa0932150:CDS	25.0%
!	AAACCTAATAACAAACCAAT+AGG	-	chr6_3:151233-151252	None:intergenic	25.0%
!!	TCATCTAAAATTAAATGCGA+AGG	+	chr6_3:151253-151272	Msa0932150:CDS	25.0%
!!	CATCTAAAATTAAATGCGAA+GGG	+	chr6_3:151254-151273	Msa0932150:CDS	25.0%
!!	AAAGAAAAAAGTGCACAATT+TGG	-	chr6_3:151398-151417	None:intergenic	25.0%
!	TTGTTGCAAAAAAACAAATG+TGG	-	chr6_3:151425-151444	None:intergenic	25.0%
!!!	TTGTTTTTTTGCAACAATTG+AGG	+	chr6_3:151428-151447	Msa0932150:intron	25.0%
!!!	TGTTGTTAGTTTTTATTGAC+TGG	-	chr6_3:151514-151533	None:intergenic	25.0%
!!	ACTAACATCTAGACATATTT+TGG	+	chr6_3:151661-151680	Msa0932150:three_prime_UTR	25.0%
	ATTCATTCAAGAGTTGAAGA+AGG	+	chr6_3:148307-148326	Msa0932150:CDS	30.0%
	TTCACAATATCTTCTTCAAG+TGG	+	chr6_3:148367-148386	Msa0932150:CDS	30.0%
!	GATCATTCTCAATTTTCTTG+TGG	+	chr6_3:148821-148840	Msa0932150:intron	30.0%
	TCCATAAATCGTTGTATTAG+AGG	+	chr6_3:148912-148931	Msa0932150:intron	30.0%
	CCATAAATCGTTGTATTAGA+GGG	+	chr6_3:148913-148932	Msa0932150:intron	30.0%
	GTCTCCAAAATGAAAATATG+AGG	+	chr6_3:148944-148963	Msa0932150:intron	30.0%
!	TACAACCCTCATAATTTTCT+AGG	-	chr6_3:149011-149030	None:intergenic	30.0%
	GGATTTGTATACCATTCATT+TGG	+	chr6_3:149153-149172	Msa0932150:intron	30.0%
!	TTTAGGATTCTCCAAATGAA+TGG	-	chr6_3:149167-149186	None:intergenic	30.0%
	ATATCCACACAAGAGATATT+GGG	-	chr6_3:149634-149653	None:intergenic	30.0%
	AATATCCACACAAGAGATAT+TGG	-	chr6_3:149635-149654	None:intergenic	30.0%
!	TTTTGCACATTCCTATTTGT+TGG	+	chr6_3:149834-149853	Msa0932150:CDS	30.0%
	AAAACCAGAATCCAACAAAT+AGG	-	chr6_3:149848-149867	None:intergenic	30.0%
!!!	TTGGATTCTGGTTTTTAAGT+TGG	+	chr6_3:149853-149872	Msa0932150:CDS	30.0%
!!!	TGGATTCTGGTTTTTAAGTT+GGG	+	chr6_3:149854-149873	Msa0932150:CDS	30.0%
!	CTTATTGGTTGAATGTGATA+TGG	+	chr6_3:149915-149934	Msa0932150:CDS	30.0%
!!!	ATCTTGGTTTTTTGACATGA+TGG	-	chr6_3:149965-149984	None:intergenic	30.0%
	ATGAGTAGAAAACACAATCT+TGG	-	chr6_3:149981-150000	None:intergenic	30.0%
!!!	TATTGTGTAGTTTTGAATGG+TGG	+	chr6_3:150128-150147	Msa0932150:intron	30.0%
	TTCTTCATTCCATATGCAAT+TGG	+	chr6_3:150343-150362	Msa0932150:CDS	30.0%
	ACTCGTGTTTCAAATGAATT+AGG	+	chr6_3:150486-150505	Msa0932150:CDS	30.0%
	ACAAGTTGTGAATTACATTG+CGG	+	chr6_3:150641-150660	Msa0932150:CDS	30.0%
!	AGTACACATTCACGTTTTTA+GGG	+	chr6_3:150985-151004	Msa0932150:intron	30.0%
	ATATAATGAATGTGAACTGC+AGG	+	chr6_3:151134-151153	Msa0932150:intron	30.0%
	TATAATGAATGTGAACTGCA+GGG	+	chr6_3:151135-151154	Msa0932150:intron	30.0%
	TATATTGTGGGAATTCCTAT+TGG	+	chr6_3:151215-151234	Msa0932150:CDS	30.0%
	TTGTAACTGCATTAACTGAT+TGG	+	chr6_3:151329-151348	Msa0932150:exon	30.0%
	AAAAACTAACAACACATTGG+TGG	+	chr6_3:151520-151539	Msa0932150:three_prime_UTR	30.0%
!	TGTACATGTGATTTTTGTAC+TGG	+	chr6_3:151685-151704	Msa0932150:three_prime_UTR	30.0%
!	AAACTCTAGAGAGATGAGTA+AGG	+	chr6_3:148214-148233	Msa0932150:CDS	35.0%
	TCATCACTCTTTCTTAGCAA+TGG	-	chr6_3:148251-148270	None:intergenic	35.0%
	TCAAGTGGTTTCTCTTATGA+TGG	+	chr6_3:148382-148401	Msa0932150:CDS	35.0%
	GGTATACTTGTTTCATTCTC+TGG	+	chr6_3:148416-148435	Msa0932150:CDS	35.0%
	AGTAACTTCAGCAAAAGACA+TGG	-	chr6_3:148453-148472	None:intergenic	35.0%
!	ATGTCTTTTGCTGAAGTTAC+TGG	+	chr6_3:148452-148471	Msa0932150:CDS	35.0%
	AGAGAGAAGAAGAACATACA+AGG	-	chr6_3:148487-148506	None:intergenic	35.0%
	TAAACAGGATCTCATGTGAA+AGG	+	chr6_3:148687-148706	Msa0932150:intron	35.0%
	TGTCACTCTTTGATCTTGTT+AGG	-	chr6_3:148726-148745	None:intergenic	35.0%
	CCCTCTAATACAACGATTTA+TGG	-	chr6_3:148916-148935	None:intergenic	35.0%
	GTGAAGACTATAGAGTAGTT+GGG	+	chr6_3:149039-149058	Msa0932150:intron	35.0%
	TGTACATCTCAACGATCTAA+CGG	+	chr6_3:149198-149217	Msa0932150:intron	35.0%
!	ATCTAACGGCTCAAGTTTTA+GGG	+	chr6_3:149212-149231	Msa0932150:intron	35.0%
!	ACATTAAGGTGTTTGAATGG+TGG	-	chr6_3:149250-149269	None:intergenic	35.0%
	GACATTATGACTGTGAAATG+TGG	-	chr6_3:149302-149321	None:intergenic	35.0%
	TTTAGTATCAATGTCGTGTC+TGG	+	chr6_3:149418-149437	Msa0932150:intron	35.0%
!	TTTCTTGTTTGCATTGCAGT+TGG	+	chr6_3:149496-149515	Msa0932150:intron	35.0%
!	TTCTTGTTTGCATTGCAGTT+GGG	+	chr6_3:149497-149516	Msa0932150:intron	35.0%
	GATACTGAGCTAAAAACCAT+GGG	-	chr6_3:149806-149825	None:intergenic	35.0%
	AGATACTGAGCTAAAAACCA+TGG	-	chr6_3:149807-149826	None:intergenic	35.0%
!	CATTCCTATTTGTTGGATTC+TGG	+	chr6_3:149841-149860	Msa0932150:CDS	35.0%
!!!	CTGGTTTTTAAGTTGGGATT+AGG	+	chr6_3:149860-149879	Msa0932150:CDS	35.0%
	GTTGAATGTGATATGGCTTT+GGG	+	chr6_3:149922-149941	Msa0932150:CDS	35.0%
	ATAGCATATTTGCAGAACTC+TGG	-	chr6_3:150019-150038	None:intergenic	35.0%
	TGCAAATATGCTATTCCTTC+TGG	+	chr6_3:150025-150044	Msa0932150:CDS	35.0%
	TAATCCTCAACTTGAAACCT+CGG	+	chr6_3:150189-150208	Msa0932150:CDS	35.0%
	AACACAAACATCATGACATG+GGG	-	chr6_3:150455-150474	None:intergenic	35.0%
	CAACACAAACATCATGACAT+GGG	-	chr6_3:150456-150475	None:intergenic	35.0%
	ACAACACAAACATCATGACA+TGG	-	chr6_3:150457-150476	None:intergenic	35.0%
	GTTTCAAATGAATTAGGAGC+AGG	+	chr6_3:150492-150511	Msa0932150:CDS	35.0%
	GTTAGAGTGGTTGTGATTAT+TGG	+	chr6_3:150540-150559	Msa0932150:CDS	35.0%
	TGTGATTATTGGAATTGCTG+AGG	+	chr6_3:150551-150570	Msa0932150:CDS	35.0%
	TGTGAATTACATTGCGGATA+TGG	+	chr6_3:150647-150666	Msa0932150:CDS	35.0%
	CTAACAGAAACACAAAGAAG+AGG	-	chr6_3:150675-150694	None:intergenic	35.0%
!!	GTTAGTGCTGATAGTCTAAT+TGG	+	chr6_3:150690-150709	Msa0932150:CDS	35.0%
!	CAGTACACATTCACGTTTTT+AGG	+	chr6_3:150984-151003	Msa0932150:intron	35.0%
	ATAATGAATGTGAACTGCAG+GGG	+	chr6_3:151136-151155	Msa0932150:intron	35.0%
	CTTGGAGCTTACTATATTGT+GGG	+	chr6_3:151203-151222	Msa0932150:CDS	35.0%
	AATTAAATGCGAAGGGATTG+TGG	+	chr6_3:151261-151280	Msa0932150:CDS	35.0%
	ATTAACTGATTGGCAGAAAG+AGG	+	chr6_3:151339-151358	Msa0932150:three_prime_UTR	35.0%
	TTGCTTATACAGCTGTTGTA+TGG	+	chr6_3:151609-151628	Msa0932150:three_prime_UTR	35.0%
	AGCATGCTCTCAAAATTTGT+AGG	-	chr6_3:151737-151756	None:intergenic	35.0%
!!	CAAATTTTGAGAGCATGCTT+TGG	+	chr6_3:151738-151757	Msa0932150:three_prime_UTR	35.0%
	CTAAGAAAGAGTGATGACCA+TGG	+	chr6_3:148254-148273	Msa0932150:CDS	40.0%
	GTTGAAGAAGGTGAGTTTCA+TGG	+	chr6_3:148319-148338	Msa0932150:CDS	40.0%
	GAAACTGTTACAGCTACCAT+TGG	-	chr6_3:148350-148369	None:intergenic	40.0%
	AGTGGTTTCTCTTATGATGG+TGG	+	chr6_3:148385-148404	Msa0932150:CDS	40.0%
	GTGGTTTCTCTTATGATGGT+GGG	+	chr6_3:148386-148405	Msa0932150:CDS	40.0%
	TTCAGCAAAAGACATGGCAA+TGG	-	chr6_3:148447-148466	None:intergenic	40.0%
	GCTTAGAGATGCAAACTAGT+TGG	-	chr6_3:148562-148581	None:intergenic	40.0%
	GGTGAAGACTATAGAGTAGT+TGG	+	chr6_3:149038-149057	Msa0932150:intron	40.0%
	GACTATAGAGTAGTTGGGTA+TGG	+	chr6_3:149044-149063	Msa0932150:intron	40.0%
	ATAGAGTAGTTGGGTATGGT+TGG	+	chr6_3:149048-149067	Msa0932150:intron	40.0%
	CTTATTTCAACTCTGCGTGT+AGG	-	chr6_3:149134-149153	None:intergenic	40.0%
	CTACACGCAGAGTTGAAATA+AGG	+	chr6_3:149132-149151	Msa0932150:intron	40.0%
!	GATCTAACGGCTCAAGTTTT+AGG	+	chr6_3:149211-149230	Msa0932150:intron	40.0%
!	GGGACATTAAGGTGTTTGAA+TGG	-	chr6_3:149253-149272	None:intergenic	40.0%
!	GGAGCATTAGAAACACTATG+TGG	+	chr6_3:149527-149546	Msa0932150:CDS	40.0%
	ACACTATGTGGACAAACCTT+TGG	+	chr6_3:149539-149558	Msa0932150:CDS	40.0%
	GTTTCCCAATATCTCTTGTG+TGG	+	chr6_3:149627-149646	Msa0932150:CDS	40.0%
!!!	CTGTTTTTTAGTCAAGACCC+TGG	+	chr6_3:149671-149690	Msa0932150:CDS	40.0%
	AAGTGCATAGCCAAATAGAG+CGG	-	chr6_3:149738-149757	None:intergenic	40.0%
!	ATTCGCTATTTCCAGACTCA+GGG	+	chr6_3:149770-149789	Msa0932150:CDS	40.0%
	AAGTTGGGATTAGGACACAT+TGG	+	chr6_3:149869-149888	Msa0932150:CDS	40.0%
!	ATTGGAGCTGCTTTAGCTAT+TGG	+	chr6_3:149887-149906	Msa0932150:CDS	40.0%
	GGTTGAATGTGATATGGCTT+TGG	+	chr6_3:149921-149940	Msa0932150:CDS	40.0%
	CATATTTGCAGAACTCTGGT+AGG	-	chr6_3:150015-150034	None:intergenic	40.0%
!	TTCCTTCTGGACTCATGTTT+TGG	+	chr6_3:150038-150057	Msa0932150:CDS	40.0%
	TACCAAAACATGAGTCCAGA+AGG	-	chr6_3:150043-150062	None:intergenic	40.0%
	TTGAGGATTAGGTAAAAGCC+CGG	-	chr6_3:150179-150198	None:intergenic	40.0%
!!	GAGGTTTCAAGTTGAGGATT+AGG	-	chr6_3:150190-150209	None:intergenic	40.0%
	ACATTGCATAGTTCACCCTT+AGG	-	chr6_3:150263-150282	None:intergenic	40.0%
!	TGGAATGAAGAAGTGCAATG+AGG	-	chr6_3:150335-150354	None:intergenic	40.0%
	ACACAAACATCATGACATGG+GGG	-	chr6_3:150454-150473	None:intergenic	40.0%
	AGGAAATCCAAAGACAGCTA+AGG	+	chr6_3:150512-150531	Msa0932150:CDS	40.0%
	GGAAATCCAAAGACAGCTAA+GGG	+	chr6_3:150513-150532	Msa0932150:CDS	40.0%
	AGTCTAATTGGAGCTCTTTC+AGG	+	chr6_3:150702-150721	Msa0932150:CDS	40.0%
	GTCGATGAATCGAGATTAGA+CGG	-	chr6_3:151068-151087	None:intergenic	40.0%
!	AGGAGGTGGATTTCAAGAAA+TGG	+	chr6_3:151166-151185	Msa0932150:CDS	40.0%
!	GGAGGTGGATTTCAAGAAAT+GGG	+	chr6_3:151167-151186	Msa0932150:CDS	40.0%
!	GAGGTGGATTTCAAGAAATG+GGG	+	chr6_3:151168-151187	Msa0932150:CDS	40.0%
!	AGGTGGATTTCAAGAAATGG+GGG	+	chr6_3:151169-151188	Msa0932150:CDS	40.0%
	CCACAATATAGTAAGCTCCA+AGG	-	chr6_3:151205-151224	None:intergenic	40.0%
	CCTTGGAGCTTACTATATTG+TGG	+	chr6_3:151202-151221	Msa0932150:CDS	40.0%
	CATGTGATTGATTGCATTGC+AGG	+	chr6_3:151460-151479	Msa0932150:intron	40.0%
	ATTGCAGGCAACAAAAGCAA+GGG	+	chr6_3:151475-151494	Msa0932150:intron	40.0%
	AACTAACAACACATTGGTGG+TGG	+	chr6_3:151523-151542	Msa0932150:three_prime_UTR	40.0%
!	CTCTAGAGAGATGAGTAAGG+AGG	+	chr6_3:148217-148236	Msa0932150:CDS	45.0%
	TAGAGAGATGAGTAAGGAGG+TGG	+	chr6_3:148220-148239	Msa0932150:CDS	45.0%
	AGTGATGACCATGGAAGTGA+TGG	+	chr6_3:148263-148282	Msa0932150:CDS	45.0%
	CAACTCTTCCATCACTTCCA+TGG	-	chr6_3:148274-148293	None:intergenic	45.0%
!!	CTTATGATGGTGGGACATCT+TGG	+	chr6_3:148395-148414	Msa0932150:CDS	45.0%
	GTAGGATCTTGTCACACAAC+AGG	-	chr6_3:149116-149135	None:intergenic	45.0%
	GTTTGCATTGCAGTTGGGAA+TGG	+	chr6_3:149502-149521	Msa0932150:intron	45.0%
!	GCAGAGGAGTATGGAAAACT+TGG	+	chr6_3:149563-149582	Msa0932150:CDS	45.0%
	GAGCTACATGAGACATTCCA+GGG	-	chr6_3:149691-149710	None:intergenic	45.0%
	TACCTCATTCCCGCTCTATT+TGG	+	chr6_3:149725-149744	Msa0932150:CDS	45.0%
	AGTGCATAGCCAAATAGAGC+GGG	-	chr6_3:149737-149756	None:intergenic	45.0%
!	GATTCGCTATTTCCAGACTC+AGG	+	chr6_3:149769-149788	Msa0932150:CDS	45.0%
	GAAAGATCATTCCCTGAGTC+TGG	-	chr6_3:149784-149803	None:intergenic	45.0%
	TCAGGGAATGATCTTTCCCA+TGG	+	chr6_3:149787-149806	Msa0932150:CDS	45.0%
!!	AGAACCGAGGTTTCAAGTTG+AGG	-	chr6_3:150196-150215	None:intergenic	45.0%
	AAACCTCGGTTCTTTCTGTC+TGG	+	chr6_3:150203-150222	Msa0932150:CDS	45.0%
	GCAGAAGCTCCAATTGCATA+TGG	-	chr6_3:150355-150374	None:intergenic	45.0%
	ATGCAATTGGAGCTTCTGCA+AGG	+	chr6_3:150356-150375	Msa0932150:CDS	45.0%
	ATTGGAGCTTCTGCAAGGTT+TGG	+	chr6_3:150361-150380	Msa0932150:intron	45.0%
!	AGCTTCTGCAAGGTTTGGTT+TGG	+	chr6_3:150366-150385	Msa0932150:intron	45.0%
	TTAGGGATGTCAGTGACTGT+TGG	+	chr6_3:151002-151021	Msa0932150:intron	45.0%
	AAATGCGAAGGGATTGTGGA+TGG	+	chr6_3:151265-151284	Msa0932150:CDS	45.0%
	AATGCGAAGGGATTGTGGAT+GGG	+	chr6_3:151266-151285	Msa0932150:CDS	45.0%
	TTGTGGATGGGAACTCTATC+AGG	+	chr6_3:151278-151297	Msa0932150:CDS	45.0%
	CATTGCAGGCAACAAAAGCA+AGG	+	chr6_3:151474-151493	Msa0932150:intron	45.0%
	GAGTTTCATGGCAGCTCCAA+TGG	+	chr6_3:148331-148350	Msa0932150:CDS	50.0%
!	TGGACAAACCTTTGGTGCAG+AGG	+	chr6_3:149547-149566	Msa0932150:CDS	50.0%
!	ACCTTTGGTGCAGAGGAGTA+TGG	+	chr6_3:149554-149573	Msa0932150:CDS	50.0%
	TCCATACTCCTCTGCACCAA+AGG	-	chr6_3:149558-149577	None:intergenic	50.0%
	CGAGCTACATGAGACATTCC+AGG	-	chr6_3:149692-149711	None:intergenic	50.0%
	AGCCAAATAGAGCGGGAATG+AGG	-	chr6_3:149730-149749	None:intergenic	50.0%
	TCACCAGACAGAAAGAACCG+AGG	-	chr6_3:150209-150228	None:intergenic	50.0%
	ACAGCTCCCTTAGCTGTCTT+TGG	-	chr6_3:150522-150541	None:intergenic	50.0%
	AGCTAAGGGAGCTGTTAGAG+TGG	+	chr6_3:150527-150546	Msa0932150:CDS	50.0%
	ATGGGGGCTTATGTGAACCT+TGG	+	chr6_3:151185-151204	Msa0932150:CDS	50.0%
	AGGCAACAAAAGCAAGGGAG+AGG	+	chr6_3:151480-151499	Msa0932150:intron	50.0%
	GCATTGCAGTTGGGAATGGC+TGG	+	chr6_3:149506-149525	Msa0932150:intron	55.0%
	TGAACTGCAGGGGTTGCTAG+AGG	+	chr6_3:151146-151165	Msa0932150:intron	55.0%
	ACTGCAGGGGTTGCTAGAGG+AGG	+	chr6_3:151149-151168	Msa0932150:intron	60.0%
	GCAGGGGTTGCTAGAGGAGG+TGG	+	chr6_3:151152-151171	Msa0932150:intron	65.0%

Chromosome	Type	Strat	End	Strand	Name
chr6_3	gene	148192	151795	148192	ID=Msa0932150;Name=Msa0932150
chr6_3	mRNA	148192	151795	148192	ID=Msa0932150-mRNA-1;Parent=Msa0932150;Name=Msa0932150-mRNA-1;_AED=0.13;_eAED=0.13;_QI=17\|1\|1\|1\|0.83\|0.85\|7\|340\|461
chr6_3	exon	148192	148487	148192	ID=Msa0932150-mRNA-1:exon:55;Parent=Msa0932150-mRNA-1
chr6_3	exon	149515	150059	149515	ID=Msa0932150-mRNA-1:exon:56;Parent=Msa0932150-mRNA-1
chr6_3	exon	150138	150224	150138	ID=Msa0932150-mRNA-1:exon:57;Parent=Msa0932150-mRNA-1
chr6_3	exon	150321	150377	150321	ID=Msa0932150-mRNA-1:exon:58;Parent=Msa0932150-mRNA-1
chr6_3	exon	150485	150723	150485	ID=Msa0932150-mRNA-1:exon:59;Parent=Msa0932150-mRNA-1
chr6_3	exon	151156	151360	151156	ID=Msa0932150-mRNA-1:exon:60;Parent=Msa0932150-mRNA-1
chr6_3	exon	151482	151795	151482	ID=Msa0932150-mRNA-1:exon:61;Parent=Msa0932150-mRNA-1
chr6_3	five_prime_UTR	148192	148208	148192	ID=Msa0932150-mRNA-1:five_prime_utr;Parent=Msa0932150-mRNA-1
chr6_3	CDS	148209	148487	148209	ID=Msa0932150-mRNA-1:cds;Parent=Msa0932150-mRNA-1
chr6_3	CDS	149515	150059	149515	ID=Msa0932150-mRNA-1:cds;Parent=Msa0932150-mRNA-1
chr6_3	CDS	150138	150224	150138	ID=Msa0932150-mRNA-1:cds;Parent=Msa0932150-mRNA-1
chr6_3	CDS	150321	150377	150321	ID=Msa0932150-mRNA-1:cds;Parent=Msa0932150-mRNA-1
chr6_3	CDS	150485	150723	150485	ID=Msa0932150-mRNA-1:cds;Parent=Msa0932150-mRNA-1
chr6_3	CDS	151156	151334	151156	ID=Msa0932150-mRNA-1:cds;Parent=Msa0932150-mRNA-1
chr6_3	three_prime_UTR	151335	151360	151335	ID=Msa0932150-mRNA-1:three_prime_utr;Parent=Msa0932150-mRNA-1
chr6_3	three_prime_UTR	151482	151795	151482	ID=Msa0932150-mRNA-1:three_prime_utr;Parent=Msa0932150-mRNA-1

Gene Sequence

>Msa0932150

ATGAAAAACTCTAGAGAGATGAGTAAGGAGGTGGCAACACCATTGCTAAGAAAGAGTGATGACCATGGAAGTGATGGAAGAGTTGAGATTGAGAATACATTCATTCAAGAGTTGAAGAAGGTGAGTTTCATGGCAGCTCCAATGGTAGCTGTAACAGTTTCACAATATCTTCTTCAAGTGGTTTCTCTTATGATGGTGGGACATCTTGGTATACTTGTTTCATTCTCTGGTGTTTCCATTGCCATGTCTTTTGCTGAAGTTACTGGCTTTAGTGTCCTTTTGGGAATGGCTGGAGCATTAGAAACACTATGTGGACAAACCTTTGGTGCAGAGGAGTATGGAAAACTTGGAAACTACACTTGCTGTGCAATATTAACTCTAACTGTAGTTTGTTTCCCAATATCTCTTGTGTGGATATTCACAGATAAAATACTACTGTTTTTTAGTCAAGACCCTGGAATGTCTCATGTAGCTCGCGAGTACTGCATATACCTCATTCCCGCTCTATTTGGCTATGCACTTCTTCAAGCGTTGATTCGCTATTTCCAGACTCAGGGAATGATCTTTCCCATGGTTTTTAGCTCAGTATCTGCTCTATTTTTGCACATTCCTATTTGTTGGATTCTGGTTTTTAAGTTGGGATTAGGACACATTGGAGCTGCTTTAGCTATTGGAATTTCTTATTGGTTGAATGTGATATGGCTTTGGGTTTATATTAAGTACTCTCCATCATGTCAAAAAACCAAGATTGTGTTTTCTACTCATGCTTTACATAACCTACCAGAGTTCTGCAAATATGCTATTCCTTCTGGACTCATGTTTTGTTTTGAATGGTGGTCCTTTGAGATTCTTATTTTAATTGCCGGGCTTTTACCTAATCCTCAACTTGAAACCTCGGTTCTTTCTGTCTGCTTGAACACTACCTCATTGCACTTCTTCATTCCATATGCAATTGGAGCTTCTGCAAGTACTCGTGTTTCAAATGAATTAGGAGCAGGAAATCCAAAGACAGCTAAGGGAGCTGTTAGAGTGGTTGTGATTATTGGAATTGCTGAGGCAATTATTGTCAGCACTTTCTTCCTTTGCTTTAGAAATATTTTAGGATATGCTTATAGCAATGATGAACAAGTTGTGAATTACATTGCGGATATGGTTCCTCTTCTTTGTGTTTCTGTTAGTGCTGATAGTCTAATTGGAGCTCTTTCAGGGGTTGCTAGAGGAGGTGGATTTCAAGAAATGGGGGCTTATGTGAACCTTGGAGCTTACTATATTGTGGGAATTCCTATTGGTTTGTTATTAGGTTTTCATCTAAAATTAAATGCGAAGGGATTGTGGATGGGAACTCTATCAGGATCTGTTTTAATGTCATTATACTATCTATTGTAA

Protein sequence

>Msa0932150

MKNSREMSKEVATPLLRKSDDHGSDGRVEIENTFIQELKKVSFMAAPMVAVTVSQYLLQVVSLMMVGHLGILVSFSGVSIAMSFAEVTGFSVLLGMAGALETLCGQTFGAEEYGKLGNYTCCAILTLTVVCFPISLVWIFTDKILLFFSQDPGMSHVAREYCIYLIPALFGYALLQALIRYFQTQGMIFPMVFSSVSALFLHIPICWILVFKLGLGHIGAALAIGISYWLNVIWLWVYIKYSPSCQKTKIVFSTHALHNLPEFCKYAIPSGLMFCFEWWSFEILILIAGLLPNPQLETSVLSVCLNTTSLHFFIPYAIGASASTRVSNELGAGNPKTAKGAVRVVVIIGIAEAIIVSTFFLCFRNILGYAYSNDEQVVNYIADMVPLLCVSVSADSLIGALSGVARGGGFQEMGAYVNLGAYYIVGIPIGLLLGFHLKLNAKGLWMGTLSGSVLMSLYYLL*