AlfalfaGEDB | Msa0702200

M. sativa cultivar zhongmu-4 / Msa0702200

KEGG: K20667
GO: -
PFAM: PF00067.25

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0702200	XP_024628198.1	97.445	274	7	0	80	353	164	437	0.0	561

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0702200	sp\|K4CEE8\|C7A46_SOLLC	51.829	328	145	5	28	353	123	439	2.76e-117	351

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0702200	A0A396GRG8	97.445	274	7	0	80	353	164	437	0.0	561

TFs/TRs:

Gene ID	Type	Classification

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
Msa0004340	Msa0702200	0.830510	2.820244e-55	-8.615850e-47
Msa0005690	Msa0702200	0.839293	1.728403e-57	-8.615850e-47
Msa0006050	Msa0702200	0.829818	4.159997e-55	-8.615850e-47
Msa0006700	Msa0702200	0.811434	7.016217e-51	-8.615850e-47
Msa0008850	Msa0702200	0.812693	3.728467e-51	-8.615850e-47
Msa0014410	Msa0702200	0.804235	2.380637e-49	-8.615850e-47
Msa0020320	Msa0702200	0.828635	8.057746e-55	-8.615850e-47
Msa0020630	Msa0702200	0.807472	4.970969e-50	-8.615850e-47
Msa0021980	Msa0702200	0.840221	9.905563e-58	-8.615850e-47
Msa0026670	Msa0702200	0.826913	2.089665e-54	-8.615850e-47
Msa0026930	Msa0702200	0.816086	6.627447e-52	-8.615850e-47
Msa0032450	Msa0702200	0.815619	8.425851e-52	-8.615850e-47
Msa0036150	Msa0702200	0.831439	1.668057e-55	-8.615850e-47
Msa0038310	Msa0702200	0.810381	1.185603e-50	-8.615850e-47
Msa0040410	Msa0702200	0.812888	3.379008e-51	-8.615850e-47
Msa0040550	Msa0702200	-0.845179	4.772506e-59	-8.615850e-47
Msa0044320	Msa0702200	0.802546	5.329558e-49	-8.615850e-47
Msa0047230	Msa0702200	0.805729	1.159633e-49	-8.615850e-47
Msa0051100	Msa0702200	0.802239	6.164361e-49	-8.615850e-47
Msa0053480	Msa0702200	0.828054	1.112645e-54	-8.615850e-47
Msa0053960	Msa0702200	0.845196	4.723182e-59	-8.615850e-47
Msa0054760	Msa0702200	0.827973	1.163732e-54	-8.615850e-47
Msa0057740	Msa0702200	0.816252	6.087074e-52	-8.615850e-47
Msa0059880	Msa0702200	-0.834508	2.878844e-56	-8.615850e-47
Msa0064550	Msa0702200	0.855943	4.492651e-62	-8.615850e-47
Msa0072710	Msa0702200	0.820924	5.303202e-53	-8.615850e-47
Msa0072830	Msa0702200	0.843885	1.064002e-58	-8.615850e-47
Msa0072860	Msa0702200	0.848561	5.665306e-60	-8.615850e-47
Msa0074780	Msa0702200	0.819766	9.776153e-53	-8.615850e-47
Msa0080810	Msa0702200	0.824545	7.616396e-54	-8.615850e-47
Msa0083550	Msa0702200	0.807299	5.408406e-50	-8.615850e-47
Msa0084090	Msa0702200	0.801804	7.573928e-49	-8.615850e-47
Msa0087130	Msa0702200	0.818252	2.159271e-52	-8.615850e-47
Msa0094240	Msa0702200	0.835033	2.123080e-56	-8.615850e-47
Msa0096510	Msa0702200	0.841403	4.854319e-58	-8.615850e-47
Msa0103060	Msa0702200	0.818697	1.712255e-52	-8.615850e-47
Msa0104360	Msa0702200	0.853450	2.369947e-61	-8.615850e-47
Msa0104390	Msa0702200	0.819698	1.012921e-52	-8.615850e-47
Msa0108070	Msa0702200	0.810894	9.186218e-51	-8.615850e-47
Msa0109490	Msa0702200	0.847485	1.122507e-59	-8.615850e-47
Msa0114700	Msa0702200	0.805661	1.198719e-49	-8.615850e-47
Msa0116470	Msa0702200	0.836594	8.540241e-57	-8.615850e-47
Msa0116510	Msa0702200	0.855956	4.454954e-62	-8.615850e-47
Msa0117300	Msa0702200	0.837471	5.098768e-57	-8.615850e-47
Msa0120320	Msa0702200	0.814913	1.209368e-51	-8.615850e-47
Msa0604880	Msa0702200	0.820987	5.129091e-53	-8.615850e-47
Msa0605250	Msa0702200	0.811257	7.663645e-51	-8.615850e-47
Msa0607440	Msa0702200	0.818885	1.552053e-52	-8.615850e-47
Msa0607620	Msa0702200	0.824290	8.743784e-54	-8.615850e-47
Msa0608940	Msa0702200	0.852790	3.663873e-61	-8.615850e-47
Msa0610810	Msa0702200	0.811187	7.937606e-51	-8.615850e-47
Msa0613480	Msa0702200	0.810865	9.317857e-51	-8.615850e-47
Msa0615430	Msa0702200	0.836978	6.814024e-57	-8.615850e-47
Msa0615850	Msa0702200	0.801391	9.207229e-49	-8.615850e-47
Msa0618260	Msa0702200	0.848386	6.335424e-60	-8.615850e-47
Msa0618490	Msa0702200	0.816399	5.641260e-52	-8.615850e-47
Msa0618520	Msa0702200	0.807928	3.977599e-50	-8.615850e-47
Msa0619390	Msa0702200	0.803470	3.433288e-49	-8.615850e-47
Msa0622250	Msa0702200	0.829161	6.008685e-55	-8.615850e-47
Msa0624040	Msa0702200	0.800320	1.523419e-48	-8.615850e-47
Msa0625440	Msa0702200	0.839935	1.176784e-57	-8.615850e-47
Msa0627050	Msa0702200	0.839817	1.262821e-57	-8.615850e-47
Msa0633720	Msa0702200	0.830876	2.293902e-55	-8.615850e-47
Msa0634260	Msa0702200	0.806698	7.248594e-50	-8.615850e-47
Msa0635350	Msa0702200	0.810368	1.193751e-50	-8.615850e-47
Msa0635990	Msa0702200	0.808321	3.280715e-50	-8.615850e-47
Msa0638040	Msa0702200	0.829502	4.966700e-55	-8.615850e-47
Msa0639030	Msa0702200	0.819030	1.438751e-52	-8.615850e-47
Msa0643020	Msa0702200	-0.801506	8.720343e-49	-8.615850e-47
Msa0646340	Msa0702200	0.825364	4.881508e-54	-8.615850e-47
Msa0646390	Msa0702200	0.803295	3.731564e-49	-8.615850e-47
Msa0647860	Msa0702200	0.812971	3.240234e-51	-8.615850e-47
Msa0648200	Msa0702200	0.808562	2.913700e-50	-8.615850e-47
Msa0649310	Msa0702200	0.802335	5.891708e-49	-8.615850e-47
Msa0649530	Msa0702200	0.829842	4.104877e-55	-8.615850e-47
Msa0651310	Msa0702200	0.808569	2.903296e-50	-8.615850e-47
Msa0654880	Msa0702200	0.843119	1.704808e-58	-8.615850e-47
Msa0657820	Msa0702200	0.808953	2.404410e-50	-8.615850e-47
Msa0657860	Msa0702200	0.925925	9.457646e-91	-8.615850e-47
Msa0659520	Msa0702200	0.815679	8.170631e-52	-8.615850e-47
Msa0665040	Msa0702200	0.815279	1.002749e-51	-8.615850e-47
Msa0669990	Msa0702200	0.811290	7.540039e-51	-8.615850e-47
Msa0670360	Msa0702200	-0.805196	1.499944e-49	-8.615850e-47
Msa0672350	Msa0702200	0.813906	2.018609e-51	-8.615850e-47
Msa0672850	Msa0702200	0.805892	1.071955e-49	-8.615850e-47
Msa0675010	Msa0702200	0.828099	1.085325e-54	-8.615850e-47
Msa0675790	Msa0702200	0.816932	4.285830e-52	-8.615850e-47
Msa0678240	Msa0702200	0.806929	6.477577e-50	-8.615850e-47
Msa0679780	Msa0702200	0.846657	1.892817e-59	-8.615850e-47
Msa0685880	Msa0702200	0.800701	1.273850e-48	-8.615850e-47
Msa0686300	Msa0702200	0.822732	2.023454e-53	-8.615850e-47
Msa0687320	Msa0702200	0.801679	8.034919e-49	-8.615850e-47
Msa0688760	Msa0702200	0.805879	1.078804e-49	-8.615850e-47
Msa0690580	Msa0702200	0.805676	1.190062e-49	-8.615850e-47
Msa0691740	Msa0702200	0.832049	1.179737e-55	-8.615850e-47
Msa0693400	Msa0702200	0.847150	1.387566e-59	-8.615850e-47
Msa0697600	Msa0702200	0.828834	7.213789e-55	-8.615850e-47
Msa0698480	Msa0702200	0.839911	1.193886e-57	-8.615850e-47
Msa0698650	Msa0702200	0.848150	7.360431e-60	-8.615850e-47
Msa0698900	Msa0702200	0.809504	1.831508e-50	-8.615850e-47
Msa0701460	Msa0702200	0.811492	6.814185e-51	-8.615850e-47
Msa0701530	Msa0702200	0.810372	1.191052e-50	-8.615850e-47
Msa0702200	Msa0702310	0.962336	9.335584e-121	-8.615850e-47
Msa0702200	Msa0702620	0.964377	2.991693e-123	-8.615850e-47
Msa0702200	Msa0705050	0.839361	1.658856e-57	-8.615850e-47
Msa0702200	Msa0705810	0.833266	5.887801e-56	-8.615850e-47
Msa0702200	Msa0712670	0.811931	5.469747e-51	-8.615850e-47
Msa0702200	Msa0712910	0.816596	5.097578e-52	-8.615850e-47
Msa0702200	Msa0714200	0.810617	1.054360e-50	-8.615850e-47
Msa0702200	Msa0718920	0.819493	1.128626e-52	-8.615850e-47
Msa0702200	Msa0727300	0.829069	6.326690e-55	-8.615850e-47
Msa0702200	Msa0729590	0.808328	3.268587e-50	-8.615850e-47
Msa0702200	Msa0734760	0.831812	1.350062e-55	-8.615850e-47
Msa0702200	Msa0742090	0.800213	1.601650e-48	-8.615850e-47
Msa0702200	Msa0744690	0.822999	1.753616e-53	-8.615850e-47
Msa0702200	Msa0747900	0.811128	8.175461e-51	-8.615850e-47
Msa0702200	Msa0748330	0.822974	1.777340e-53	-8.615850e-47
Msa0702200	Msa0748980	0.846012	2.837726e-59	-8.615850e-47
Msa0702200	Msa0749150	0.855554	5.836398e-62	-8.615850e-47
Msa0702200	Msa0752580	0.808944	2.414028e-50	-8.615850e-47
Msa0702200	Msa0752830	0.833082	6.539510e-56	-8.615850e-47
Msa0702200	Msa0754500	0.804415	2.184296e-49	-8.615850e-47
Msa0702200	Msa0755500	0.810426	1.159271e-50	-8.615850e-47
Msa0702200	Msa0756410	0.800279	1.552689e-48	-8.615850e-47
Msa0702200	Msa0756440	0.846873	1.651538e-59	-8.615850e-47
Msa0702200	Msa0756480	0.808190	3.498765e-50	-8.615850e-47
Msa0702200	Msa0766030	0.808040	3.765224e-50	-8.615850e-47
Msa0702200	Msa0768490	0.808662	2.773655e-50	-8.615850e-47
Msa0702200	Msa0768670	-0.806573	7.702493e-50	-8.615850e-47
Msa0702200	Msa0773290	0.811257	7.664102e-51	-8.615850e-47
Msa0702200	Msa0774560	0.830015	3.724754e-55	-8.615850e-47
Msa0702200	Msa0775580	0.825231	5.247035e-54	-8.615850e-47
Msa0702200	Msa0778580	0.818569	1.830581e-52	-8.615850e-47
Msa0702200	Msa0781030	0.830790	2.408180e-55	-8.615850e-47
Msa0702200	Msa0786100	0.840227	9.871111e-58	-8.615850e-47
Msa0702200	Msa0791120	0.837844	4.089458e-57	-8.615850e-47
Msa0702200	Msa0792880	0.842380	2.679678e-58	-8.615850e-47
Msa0702200	Msa0793100	0.812515	4.078661e-51	-8.615850e-47
Msa0702200	Msa0803530	0.822318	2.526365e-53	-8.615850e-47
Msa0702200	Msa0804340	0.815688	8.133747e-52	-8.615850e-47
Msa0702200	Msa0813030	0.801180	1.016873e-48	-8.615850e-47
Msa0702200	Msa0813630	0.845959	2.933253e-59	-8.615850e-47
Msa0702200	Msa0814160	-0.819194	1.320153e-52	-8.615850e-47
Msa0702200	Msa0815950	0.821118	4.786306e-53	-8.615850e-47
Msa0702200	Msa0821030	0.816696	4.841547e-52	-8.615850e-47
Msa0702200	Msa0825520	0.826240	3.023177e-54	-8.615850e-47
Msa0702200	Msa0828570	0.827309	1.680347e-54	-8.615850e-47
Msa0702200	Msa0828900	0.846300	2.368239e-59	-8.615850e-47
Msa0702200	Msa0829430	0.819966	8.798335e-53	-8.615850e-47
Msa0702200	Msa0833910	0.819394	1.188262e-52	-8.615850e-47
Msa0702200	Msa0834160	0.837849	4.076364e-57	-8.615850e-47
Msa0702200	Msa0835510	0.809675	1.682548e-50	-8.615850e-47
Msa0702200	Msa0835550	0.860316	2.249049e-63	-8.615850e-47
Msa0702200	Msa0840630	0.800429	1.447171e-48	-8.615850e-47
Msa0702200	Msa0842270	0.818743	1.671385e-52	-8.615850e-47
Msa0702200	Msa0846070	0.825093	5.657578e-54	-8.615850e-47
Msa0702200	Msa0849290	0.812020	5.230164e-51	-8.615850e-47
Msa0702200	Msa0861480	0.825108	5.611031e-54	-8.615850e-47
Msa0702200	Msa0861560	0.827664	1.380667e-54	-8.615850e-47
Msa0702200	Msa0864730	0.826991	2.001872e-54	-8.615850e-47
Msa0702200	Msa0864750	0.828142	1.059305e-54	-8.615850e-47
Msa0702200	Msa0868040	0.846213	2.501570e-59	-8.615850e-47
Msa0702200	Msa0871470	0.818747	1.668286e-52	-8.615850e-47
Msa0702200	Msa0879650	0.810266	1.255787e-50	-8.615850e-47
Msa0702200	Msa0883660	0.803892	2.806733e-49	-8.615850e-47
Msa0702200	Msa0884300	0.804228	2.388776e-49	-8.615850e-47
Msa0702200	Msa0884840	0.833787	4.363835e-56	-8.615850e-47
Msa0702200	Msa0887000	0.825645	4.186225e-54	-8.615850e-47
Msa0702200	Msa0888820	0.817894	2.601848e-52	-8.615850e-47
Msa0702200	Msa0895860	0.820462	6.773206e-53	-8.615850e-47
Msa0702200	Msa0899700	0.811900	5.555045e-51	-8.615850e-47
Msa0702200	Msa0899730	0.814760	1.307684e-51	-8.615850e-47
Msa0702200	Msa0903730	0.806662	7.378440e-50	-8.615850e-47
Msa0702200	Msa0904630	0.820151	7.980791e-53	-8.615850e-47
Msa0702200	Msa0910830	-0.809023	2.321825e-50	-8.615850e-47
Msa0702200	Msa0911910	0.851784	7.080206e-61	-8.615850e-47
Msa0702200	Msa0912110	0.835842	1.325868e-56	-8.615850e-47
Msa0702200	Msa0922340	0.812059	5.128353e-51	-8.615850e-47
Msa0702200	Msa0927890	0.835175	1.955015e-56	-8.615850e-47
Msa0702200	Msa0936650	0.812035	5.190387e-51	-8.615850e-47
Msa0702200	Msa0938370	0.811589	6.490281e-51	-8.615850e-47
Msa0702200	Msa0950410	0.803271	3.774439e-49	-8.615850e-47
Msa0702200	Msa0950470	0.821283	4.383525e-53	-8.615850e-47
Msa0702200	Msa0950570	0.822349	2.484242e-53	-8.615850e-47
Msa0702200	Msa0961230	0.808211	3.461624e-50	-8.615850e-47
Msa0702200	Msa0964650	0.802668	5.030779e-49	-8.615850e-47
Msa0702200	Msa0964680	0.828791	7.385254e-55	-8.615850e-47
Msa0702200	Msa0967250	0.801232	9.920415e-49	-8.615850e-47
Msa0702200	Msa0967260	0.833068	6.592016e-56	-8.615850e-47
Msa0702200	Msa0967670	0.838183	3.345259e-57	-8.615850e-47
Msa0702200	Msa0968780	0.818166	2.258293e-52	-8.615850e-47
Msa0702200	Msa0968960	0.811250	7.689770e-51	-8.615850e-47
Msa0702200	Msa0973130	0.846336	2.315059e-59	-8.615850e-47
Msa0702200	Msa0973230	0.813698	2.244076e-51	-8.615850e-47
Msa0702200	Msa0973890	0.806025	1.005056e-49	-8.615850e-47
Msa0702200	Msa0984000	0.851271	9.896544e-61	-8.615850e-47
Msa0702200	Msa0985430	0.803900	2.795274e-49	-8.615850e-47
Msa0702200	Msa0986560	0.802189	6.313750e-49	-8.615850e-47
Msa0702200	Msa0986620	0.822180	2.719633e-53	-8.615850e-47
Msa0702200	Msa0993450	-0.802623	5.138903e-49	-8.615850e-47
Msa0702200	Msa0995660	0.828639	8.040120e-55	-8.615850e-47
Msa0702200	Msa0998940	0.812733	3.654718e-51	-8.615850e-47
Msa0702200	Msa0999590	0.823579	1.283791e-53	-8.615850e-47
Msa0702200	Msa1004720	0.829298	5.566975e-55	-8.615850e-47
Msa0702200	Msa1008960	0.808001	3.837554e-50	-8.615850e-47
Msa0702200	Msa1009170	0.812358	4.413304e-51	-8.615850e-47
Msa0702200	Msa1014350	0.834471	2.941166e-56	-8.615850e-47
Msa0702200	Msa1014700	0.806274	8.905858e-50	-8.615850e-47
Msa0702200	Msa1016110	0.803566	3.279203e-49	-8.615850e-47
Msa0702200	Msa1021620	-0.802529	5.372904e-49	-8.615850e-47
Msa0702200	Msa1024350	-0.821334	4.267810e-53	-8.615850e-47
Msa0702200	Msa1026610	0.818878	1.557784e-52	-8.615850e-47
Msa0702200	Msa1026880	0.804785	1.828641e-49	-8.615850e-47
Msa0702200	Msa1028210	0.811986	5.320840e-51	-8.615850e-47
Msa0702200	Msa1028720	0.805070	1.594442e-49	-8.615850e-47
Msa0702200	Msa1029430	0.803820	2.903844e-49	-8.615850e-47
Msa0702200	Msa1031530	0.819128	1.366732e-52	-8.615850e-47
Msa0702200	Msa1036020	-0.800330	1.515959e-48	-8.615850e-47
Msa0702200	Msa1036250	0.803559	3.289637e-49	-8.615850e-47
Msa0702200	Msa1036350	0.806588	7.647354e-50	-8.615850e-47
Msa0702200	Msa1040730	-0.833431	5.354134e-56	-8.615850e-47
Msa0702200	Msa1044790	0.830754	2.457605e-55	-8.615850e-47
Msa0702200	Msa1052030	0.816270	6.029510e-52	-8.615850e-47
Msa0702200	Msa1053690	0.838303	3.115001e-57	-8.615850e-47
Msa0702200	Msa1055360	0.834216	3.407382e-56	-8.615850e-47
Msa0702200	Msa1061130	0.822756	1.998401e-53	-8.615850e-47
Msa0702200	Msa1061670	-0.817968	2.504441e-52	-8.615850e-47
Msa0702200	Msa1064210	0.806545	7.808745e-50	-8.615850e-47
Msa0702200	Msa1067710	0.810261	1.258802e-50	-8.615850e-47
Msa0702200	Msa1067910	0.803113	4.070113e-49	-8.615850e-47
Msa0702200	Msa1071310	0.810791	9.669766e-51	-8.615850e-47
Msa0702200	Msa1072640	0.818404	1.995710e-52	-8.615850e-47
Msa0702200	Msa1073140	0.818668	1.738732e-52	-8.615850e-47
Msa0702200	Msa1076520	0.819118	1.373718e-52	-8.615850e-47
Msa0702200	Msa1076630	0.801544	8.564500e-49	-8.615850e-47
Msa0702200	Msa1081700	0.814763	1.305313e-51	-8.615850e-47
Msa0702200	Msa1082150	0.836704	8.007170e-57	-8.615850e-47
Msa0702200	Msa1083850	0.818918	1.525125e-52	-8.615850e-47
Msa0702200	Msa1085370	0.807341	5.299385e-50	-8.615850e-47
Msa0702200	Msa1089680	0.804832	1.787912e-49	-8.615850e-47
Msa0702200	Msa1091230	0.803961	2.715111e-49	-8.615850e-47
Msa0702200	Msa1093390	0.848519	5.822462e-60	-8.615850e-47
Msa0702200	Msa1096510	0.804434	2.163847e-49	-8.615850e-47
Msa0702200	Msa1101300	0.822531	2.254262e-53	-8.615850e-47
Msa0702200	Msa1106960	-0.809440	1.890348e-50	-8.615850e-47
Msa0702200	Msa1108780	0.816307	5.915608e-52	-8.615850e-47
Msa0702200	Msa1109500	0.806305	8.773658e-50	-8.615850e-47
Msa0702200	Msa1109890	-0.807333	5.319897e-50	-8.615850e-47
Msa0702200	Msa1113210	0.838201	3.310298e-57	-8.615850e-47
Msa0702200	Msa1117830	0.813737	2.199620e-51	-8.615850e-47
Msa0702200	Msa1120660	0.814852	1.247178e-51	-8.615850e-47
Msa0702200	Msa1122720	0.812699	3.717894e-51	-8.615850e-47
Msa0702200	Msa1124440	0.800240	1.581573e-48	-8.615850e-47
Msa0702200	Msa1125450	0.844135	9.119051e-59	-8.615850e-47
Msa0702200	Msa1130070	0.807296	5.417042e-50	-8.615850e-47
Msa0702200	Msa1130650	0.820074	8.313522e-53	-8.615850e-47
Msa0702200	Msa1130730	0.801379	9.256818e-49	-8.615850e-47
Msa0702200	Msa1133180	0.820851	5.512411e-53	-8.615850e-47
Msa0702200	Msa1134560	0.821916	3.129728e-53	-8.615850e-47
Msa0702200	Msa1138450	0.808306	3.304048e-50	-8.615850e-47
Msa0702200	Msa1138480	0.813590	2.370454e-51	-8.615850e-47
Msa0702200	Msa1143860	0.802048	6.748974e-49	-8.615850e-47
Msa0702200	Msa1144420	0.809166	2.163923e-50	-8.615850e-47
Msa0702200	Msa1144730	0.818027	2.428458e-52	-8.615850e-47
Msa0702200	Msa1145930	0.818979	1.477459e-52	-8.615850e-47
Msa0702200	Msa1149570	0.803950	2.729543e-49	-8.615850e-47
Msa0702200	Msa1161520	0.825694	4.076051e-54	-8.615850e-47
Msa0702200	Msa1164570	0.849774	2.605621e-60	-8.615850e-47
Msa0702200	Msa1173380	0.862646	4.374301e-64	-8.615850e-47
Msa0702200	Msa1177620	0.823412	1.404553e-53	-8.615850e-47
Msa0702200	Msa1181400	0.811982	5.331559e-51	-8.615850e-47
Msa0702200	Msa1181730	0.833537	5.038419e-56	-8.615850e-47
Msa0702200	Msa1182400	0.841115	5.777293e-58	-8.615850e-47
Msa0702200	Msa1182800	0.873258	1.690365e-67	-8.615850e-47
Msa0702200	Msa1182830	0.855366	6.620074e-62	-8.615850e-47
Msa0702200	Msa1192150	0.818644	1.760491e-52	-8.615850e-47
Msa0702200	Msa1193400	0.875572	2.772907e-68	-8.615850e-47
Msa0702200	Msa1193430	0.877277	7.151840e-69	-8.615850e-47
Msa0702200	Msa1199750	0.824506	7.780266e-54	-8.615850e-47
Msa0702200	Msa1203840	0.830310	3.155497e-55	-8.615850e-47
Msa0702200	Msa1203860	0.827724	1.335983e-54	-8.615850e-47
Msa0702200	Msa1204430	0.803995	2.671607e-49	-8.615850e-47
Msa0702200	Msa1207480	-0.814033	1.892805e-51	-8.615850e-47
Msa0702200	Msa1208250	0.810811	9.574568e-51	-8.615850e-47
Msa0702200	Msa1209790	0.829595	4.715651e-55	-8.615850e-47
Msa0702200	Msa1209800	0.828959	6.726427e-55	-8.615850e-47
Msa0702200	Msa1211260	0.802069	6.682693e-49	-8.615850e-47
Msa0702200	Msa1211280	0.800169	1.635073e-48	-8.615850e-47
Msa0702200	Msa1211300	0.812302	4.539831e-51	-8.615850e-47
Msa0702200	Msa1211370	0.810985	8.776340e-51	-8.615850e-47
Msa0702200	Msa1211390	0.852864	3.488589e-61	-8.615850e-47
Msa0702200	Msa1212740	0.821489	3.930262e-53	-8.615850e-47
Msa0702200	Msa1221540	0.805589	1.241206e-49	-8.615850e-47
Msa0702200	Msa1222030	-0.816810	4.564704e-52	-8.615850e-47
Msa0702200	Msa1225140	0.802042	6.767113e-49	-8.615850e-47
Msa0702200	Msa1226600	0.809067	2.272686e-50	-8.615850e-47
Msa0702200	Msa1226880	0.805739	1.154012e-49	-8.615850e-47
Msa0702200	Msa1228280	0.874116	8.680666e-68	-8.615850e-47
Msa0702200	Msa1228330	0.877823	4.612799e-69	-8.615850e-47
Msa0702200	Msa1230190	0.844807	6.014438e-59	-8.615850e-47
Msa0702200	Msa1233770	0.831479	1.631248e-55	-8.615850e-47
Msa0702200	Msa1236860	0.804660	1.941857e-49	-8.615850e-47
Msa0702200	Msa1237260	0.885234	9.695538e-72	-8.615850e-47
Msa0702200	Msa1242990	0.812686	3.741012e-51	-8.615850e-47
Msa0702200	Msa1243730	0.876578	1.248710e-68	-8.615850e-47
Msa0702200	Msa1249410	0.879975	8.028660e-70	-8.615850e-47
Msa0702200	Msa1258200	0.818944	1.504927e-52	-8.615850e-47
Msa0702200	Msa1264140	0.848972	4.359471e-60	-8.615850e-47
Msa0702200	Msa1266710	-0.802895	4.514438e-49	-8.615850e-47
Msa0702200	Msa1272130	0.803117	4.062759e-49	-8.615850e-47
Msa0702200	Msa1272770	0.839004	2.052758e-57	-8.615850e-47
Msa0702200	Msa1272950	0.814916	1.207427e-51	-8.615850e-47
Msa0702200	Msa1276080	0.823918	1.069319e-53	-8.615850e-47
Msa0702200	Msa1278420	0.852492	4.456005e-61	-8.615850e-47
Msa0702200	Msa1279240	0.804959	1.681823e-49	-8.615850e-47
Msa0702200	Msa1279310	0.806297	8.808764e-50	-8.615850e-47
Msa0702200	Msa1279320	0.828225	1.012042e-54	-8.615850e-47
Msa0702200	Msa1279860	0.802059	6.713001e-49	-8.615850e-47
Msa0702200	Msa1279870	0.816500	5.355128e-52	-8.615850e-47
Msa0702200	Msa1282210	0.809771	1.604520e-50	-8.615850e-47
Msa0702200	Msa1288970	0.808833	2.549963e-50	-8.615850e-47
Msa0702200	Msa1291140	0.808001	3.837297e-50	-8.615850e-47
Msa0702200	Msa1293580	0.807327	5.336627e-50	-8.615850e-47
Msa0702200	Msa1302780	0.804992	1.654835e-49	-8.615850e-47
Msa0702200	Msa1306200	0.834741	2.514745e-56	-8.615850e-47
Msa0702200	Msa1308460	0.854571	1.126185e-61	-8.615850e-47
Msa0702200	Msa1311150	0.807949	3.937655e-50	-8.615850e-47
Msa0702200	Msa1317710	0.849280	3.579162e-60	-8.615850e-47
Msa0702200	Msa1326400	0.831307	1.797914e-55	-8.615850e-47
Msa0702200	Msa1328600	0.831758	1.391800e-55	-8.615850e-47
Msa0702200	Msa1329740	-0.827188	1.795362e-54	-8.615850e-47
Msa0702200	Msa1330910	0.833531	5.055290e-56	-8.615850e-47
Msa0702200	Msa1334020	0.809743	1.627312e-50	-8.615850e-47
Msa0702200	Msa1336080	0.805705	1.173433e-49	-8.615850e-47
Msa0702200	Msa1338180	0.818363	2.038815e-52	-8.615850e-47
Msa0702200	Msa1338590	0.812611	3.885251e-51	-8.615850e-47
Msa0702200	Msa1341790	0.809496	1.838396e-50	-8.615850e-47
Msa0702200	Msa1348240	0.805457	1.322829e-49	-8.615850e-47
Msa0702200	Msa1349640	0.854882	9.151834e-62	-8.615850e-47
Msa0702200	Msa1349810	0.861007	1.388216e-63	-8.615850e-47
Msa0702200	Msa1351590	0.812146	4.908953e-51	-8.615850e-47
Msa0702200	Msa1353760	0.819212	1.307326e-52	-8.615850e-47
Msa0702200	Msa1356730	0.845270	4.509876e-59	-8.615850e-47
Msa0702200	Msa1357380	0.811038	8.550327e-51	-8.615850e-47
Msa0702200	Msa1358340	0.816072	6.676767e-52	-8.615850e-47
Msa0702200	Msa1359620	0.814332	1.625919e-51	-8.615850e-47
Msa0702200	Msa1361190	0.808167	3.538572e-50	-8.615850e-47
Msa0702200	Msa1361200	0.845781	3.277363e-59	-8.615850e-47
Msa0702200	Msa1366700	0.813663	2.284021e-51	-8.615850e-47
Msa0702200	Msa1368660	0.834096	3.652719e-56	-8.615850e-47
Msa0702200	Msa1369180	0.833021	6.772277e-56	-8.615850e-47
Msa0702200	Msa1370930	-0.805416	1.348944e-49	-8.615850e-47
Msa0702200	Msa1376010	0.800095	1.692801e-48	-8.615850e-47
Msa0702200	Msa1378840	0.817392	3.377222e-52	-8.615850e-47
Msa0702200	Msa1384620	0.828445	8.955356e-55	-8.615850e-47
Msa0702200	Msa1384980	0.844895	5.692496e-59	-8.615850e-47
Msa0702200	Msa1386020	0.842668	2.247085e-58	-8.615850e-47
Msa0702200	Msa1386250	0.846646	1.906187e-59	-8.615850e-47
Msa0702200	Msa1388070	0.825842	3.760025e-54	-8.615850e-47
Msa0702200	Msa1388270	0.813443	2.552479e-51	-8.615850e-47
Msa0702200	Msa1393550	0.801265	9.768627e-49	-8.615850e-47
Msa0702200	Msa1394900	0.809781	1.596813e-50	-8.615850e-47
Msa0702200	Msa1395640	0.809830	1.558253e-50	-8.615850e-47
Msa0702200	Msa1397540	0.809623	1.726921e-50	-8.615850e-47
Msa0702200	Msa1403700	0.814847	1.250527e-51	-8.615850e-47
Msa0702200	Msa1405470	0.804436	2.162739e-49	-8.615850e-47
Msa0702200	Msa1407210	-0.809558	1.782884e-50	-8.615850e-47
Msa0702200	Msa1407670	-0.813131	2.989414e-51	-8.615850e-47
Msa0702200	Msa1408190	0.814977	1.170130e-51	-8.615850e-47
Msa0702200	Msa1413880	0.808408	3.143039e-50	-8.615850e-47
Msa0702200	Msa1413900	0.815123	1.085928e-51	-8.615850e-47
Msa0702200	Msa1415270	0.809659	1.696529e-50	-8.615850e-47
Msa0702200	Msa1420020	-0.802649	5.074705e-49	-8.615850e-47
Msa0702200	Msa1426310	0.801063	1.074615e-48	-8.615850e-47
Msa0702200	Msa1431240	0.842194	2.999958e-58	-8.615850e-47
Msa0702200	Msa1432250	0.843028	1.802789e-58	-8.615850e-47
Msa0702200	Msa1432350	0.806123	9.584373e-50	-8.615850e-47
Msa0702200	Msa1434660	0.821986	3.016101e-53	-8.615850e-47
Msa0702200	Msa1436660	0.803584	3.250995e-49	-8.615850e-47
Msa0702200	Msa1438780	0.828067	1.104866e-54	-8.615850e-47
Msa0702200	Msa1439070	0.826849	2.164429e-54	-8.615850e-47
Msa0702200	Msa1443550	0.878372	2.962742e-69	-8.615850e-47
Msa0702200	Msa1446220	0.803176	3.949255e-49	-8.615850e-47
Msa0702200	Msa1447560	0.801942	7.094752e-49	-8.615850e-47
Msa0702200	Msa1448990	0.813027	3.150378e-51	-8.615850e-47
Msa0702200	Msa1449770	-0.817486	3.215877e-52	-8.615850e-47
Msa0702200	Msa1450420	0.826554	2.544974e-54	-8.615850e-47
Msa0702200	Msa1450630	0.813193	2.897346e-51	-8.615850e-47
Msa0702200	Msa1450780	0.821360	4.207327e-53	-8.615850e-47
Msa0702200	Msa1450850	0.839589	1.447536e-57	-8.615850e-47
Msa0702200	Msa1451690	0.805966	1.034371e-49	-8.615850e-47
Msa0702200	Msa1451780	0.841005	6.176181e-58	-8.615850e-47
Msa0702200	Msa1452200	0.816700	4.831761e-52	-8.615850e-47
Msa0702200	Msa1456620	0.808550	2.931618e-50	-8.615850e-47
Msa0702200	Msa1457180	0.811098	8.297319e-51	-8.615850e-47
Msa0702200	Msa1459540	0.822989	1.763618e-53	-8.615850e-47
Msa0702200	Msa1459610	-0.809864	1.532727e-50	-8.615850e-47
Msa0702200	Msa1459630	0.819608	1.062284e-52	-8.615850e-47
Msa0702200	Msa1460310	-0.822489	2.304522e-53	-8.615850e-47
Msa0702200	Msa1463500	0.842787	2.088963e-58	-8.615850e-47
Msa0130100	Msa0702200	0.805313	1.418007e-49	-8.615850e-47
Msa0131090	Msa0702200	0.836168	1.095969e-56	-8.615850e-47
Msa0132920	Msa0702200	0.819608	1.062275e-52	-8.615850e-47
Msa0136580	Msa0702200	0.838812	2.302066e-57	-8.615850e-47
Msa0143280	Msa0702200	0.855628	5.551921e-62	-8.615850e-47
Msa0145180	Msa0702200	0.810682	1.021070e-50	-8.615850e-47
Msa0147540	Msa0702200	0.816630	5.009605e-52	-8.615850e-47
Msa0148430	Msa0702200	0.809803	1.579465e-50	-8.615850e-47
Msa0150910	Msa0702200	-0.816764	4.675070e-52	-8.615850e-47
Msa0153440	Msa0702200	0.821670	3.569138e-53	-8.615850e-47
Msa0153640	Msa0702200	0.805182	1.510612e-49	-8.615850e-47
Msa0154240	Msa0702200	0.849242	3.667860e-60	-8.615850e-47
Msa0154270	Msa0702200	0.816961	4.220617e-52	-8.615850e-47
Msa0159750	Msa0702200	0.809315	2.010605e-50	-8.615850e-47
Msa0160470	Msa0702200	0.805571	1.252030e-49	-8.615850e-47
Msa0160650	Msa0702200	0.816411	5.606055e-52	-8.615850e-47
Msa0163530	Msa0702200	0.811287	7.550588e-51	-8.615850e-47
Msa0163960	Msa0702200	0.826748	2.287874e-54	-8.615850e-47
Msa0164630	Msa0702200	0.848685	5.236909e-60	-8.615850e-47
Msa0173370	Msa0702200	0.845312	4.393696e-59	-8.615850e-47
Msa0175530	Msa0702200	0.812593	3.921231e-51	-8.615850e-47
Msa0175920	Msa0702200	0.805585	1.243233e-49	-8.615850e-47
Msa0181410	Msa0702200	0.852072	5.866392e-61	-8.615850e-47
Msa0184330	Msa0702200	0.804966	1.676145e-49	-8.615850e-47
Msa0184850	Msa0702200	0.840985	6.250112e-58	-8.615850e-47
Msa0187980	Msa0702200	0.814337	1.621854e-51	-8.615850e-47
Msa0188500	Msa0702200	0.831330	1.774238e-55	-8.615850e-47
Msa0190670	Msa0702200	-0.801267	9.759552e-49	-8.615850e-47
Msa0195140	Msa0702200	0.811520	6.720206e-51	-8.615850e-47
Msa0196630	Msa0702200	0.820700	5.971850e-53	-8.615850e-47
Msa0197730	Msa0702200	0.822349	2.483621e-53	-8.615850e-47
Msa0198440	Msa0702200	0.831143	1.972665e-55	-8.615850e-47
Msa0199740	Msa0702200	0.807656	4.542950e-50	-8.615850e-47
Msa0200870	Msa0702200	0.803863	2.845911e-49	-8.615850e-47
Msa0206600	Msa0702200	0.801506	8.721260e-49	-8.615850e-47
Msa0216220	Msa0702200	0.810367	1.194114e-50	-8.615850e-47
Msa0218860	Msa0702200	0.812870	3.411052e-51	-8.615850e-47
Msa0222720	Msa0702200	0.807790	4.255795e-50	-8.615850e-47
Msa0224370	Msa0702200	0.808393	3.166618e-50	-8.615850e-47
Msa0224400	Msa0702200	0.821201	4.578927e-53	-8.615850e-47
Msa0225880	Msa0702200	0.825694	4.077033e-54	-8.615850e-47
Msa0232860	Msa0702200	0.821254	4.453097e-53	-8.615850e-47
Msa0365360	Msa0702200	0.811181	7.962238e-51	-8.615850e-47
Msa0367310	Msa0702200	0.811448	6.965803e-51	-8.615850e-47
Msa0367590	Msa0702200	0.811819	5.785934e-51	-8.615850e-47
Msa0372990	Msa0702200	0.802709	4.933177e-49	-8.615850e-47
Msa0375570	Msa0702200	0.807382	5.194445e-50	-8.615850e-47
Msa0376480	Msa0702200	0.841199	5.492527e-58	-8.615850e-47
Msa0377280	Msa0702200	0.831570	1.549293e-55	-8.615850e-47
Msa0378670	Msa0702200	0.824354	8.449355e-54	-8.615850e-47
Msa0378700	Msa0702200	0.818904	1.536352e-52	-8.615850e-47
Msa0389050	Msa0702200	0.832762	7.853764e-56	-8.615850e-47
Msa0389060	Msa0702200	0.846627	1.928552e-59	-8.615850e-47
Msa0392050	Msa0702200	0.817809	2.720099e-52	-8.615850e-47
Msa0393140	Msa0702200	0.816116	6.527731e-52	-8.615850e-47
Msa0401340	Msa0702200	0.829467	5.065787e-55	-8.615850e-47
Msa0402640	Msa0702200	0.810439	1.152000e-50	-8.615850e-47
Msa0404060	Msa0702200	0.818240	2.173559e-52	-8.615850e-47
Msa0404690	Msa0702200	0.855690	5.325316e-62	-8.615850e-47
Msa0408160	Msa0702200	0.814294	1.657379e-51	-8.615850e-47
Msa0411000	Msa0702200	0.802132	6.487309e-49	-8.615850e-47
Msa0413740	Msa0702200	0.824910	6.248049e-54	-8.615850e-47
Msa0415200	Msa0702200	0.816195	6.268358e-52	-8.615850e-47
Msa0419040	Msa0702200	0.815095	1.101718e-51	-8.615850e-47
Msa0423590	Msa0702200	0.811017	8.637879e-51	-8.615850e-47
Msa0423600	Msa0702200	0.838180	3.351719e-57	-8.615850e-47
Msa0424220	Msa0702200	0.800665	1.295302e-48	-8.615850e-47
Msa0425080	Msa0702200	0.813797	2.134358e-51	-8.615850e-47
Msa0428330	Msa0702200	0.821536	3.831544e-53	-8.615850e-47
Msa0430040	Msa0702200	0.810977	8.813434e-51	-8.615850e-47
Msa0431940	Msa0702200	0.840028	1.112456e-57	-8.615850e-47
Msa0438440	Msa0702200	0.801387	9.223730e-49	-8.615850e-47
Msa0448120	Msa0702200	0.845964	2.924102e-59	-8.615850e-47
Msa0453220	Msa0702200	0.805734	1.156728e-49	-8.615850e-47
Msa0453310	Msa0702200	0.810092	1.368736e-50	-8.615850e-47
Msa0454940	Msa0702200	0.808002	3.836293e-50	-8.615850e-47
Msa0457380	Msa0702200	0.820663	6.090310e-53	-8.615850e-47
Msa0458790	Msa0702200	0.828332	9.533611e-55	-8.615850e-47
Msa0459120	Msa0702200	0.822111	2.821389e-53	-8.615850e-47
Msa0459920	Msa0702200	0.800764	1.236586e-48	-8.615850e-47
Msa0460220	Msa0702200	0.818618	1.783889e-52	-8.615850e-47
Msa0462590	Msa0702200	0.806744	7.089777e-50	-8.615850e-47
Msa0469950	Msa0702200	0.815726	7.977002e-52	-8.615850e-47
Msa0470650	Msa0702200	0.822154	2.757233e-53	-8.615850e-47
Msa0481050	Msa0702200	0.836094	1.144633e-56	-8.615850e-47
Msa0239610	Msa0702200	0.801210	1.002522e-48	-8.615850e-47
Msa0243470	Msa0702200	0.807873	4.085721e-50	-8.615850e-47
Msa0245870	Msa0702200	0.823245	1.536593e-53	-8.615850e-47
Msa0251140	Msa0702200	0.837737	4.355329e-57	-8.615850e-47
Msa0260190	Msa0702200	0.832257	1.047941e-55	-8.615850e-47
Msa0260470	Msa0702200	0.823835	1.118483e-53	-8.615850e-47
Msa0264020	Msa0702200	0.808766	2.635198e-50	-8.615850e-47
Msa0264940	Msa0702200	-0.817134	3.860616e-52	-8.615850e-47
Msa0267120	Msa0702200	0.813589	2.371253e-51	-8.615850e-47
Msa0270460	Msa0702200	0.804522	2.075219e-49	-8.615850e-47
Msa0272420	Msa0702200	0.842679	2.232046e-58	-8.615850e-47
Msa0274250	Msa0702200	-0.803364	3.612057e-49	-8.615850e-47
Msa0278670	Msa0702200	0.828697	7.784716e-55	-8.615850e-47
Msa0282170	Msa0702200	0.800626	1.319440e-48	-8.615850e-47
Msa0295570	Msa0702200	0.837796	4.208079e-57	-8.615850e-47
Msa0298270	Msa0702200	-0.802741	4.859421e-49	-8.615850e-47
Msa0302990	Msa0702200	-0.823685	1.212305e-53	-8.615850e-47
Msa0303500	Msa0702200	0.802109	6.555377e-49	-8.615850e-47
Msa0304110	Msa0702200	0.829355	5.392546e-55	-8.615850e-47
Msa0305860	Msa0702200	0.836038	1.182452e-56	-8.615850e-47
Msa0308570	Msa0702200	0.807436	5.059233e-50	-8.615850e-47
Msa0311330	Msa0702200	0.806307	8.766266e-50	-8.615850e-47
Msa0312570	Msa0702200	0.845633	3.595965e-59	-8.615850e-47
Msa0312780	Msa0702200	0.812345	4.441568e-51	-8.615850e-47
Msa0314980	Msa0702200	0.827168	1.816113e-54	-8.615850e-47
Msa0317360	Msa0702200	0.811091	8.327006e-51	-8.615850e-47
Msa0318070	Msa0702200	0.819875	9.230778e-53	-8.615850e-47
Msa0327860	Msa0702200	0.803280	3.758866e-49	-8.615850e-47
Msa0327870	Msa0702200	0.810561	1.084460e-50	-8.615850e-47
Msa0330770	Msa0702200	0.810944	8.960316e-51	-8.615850e-47
Msa0336270	Msa0702200	0.841513	4.541209e-58	-8.615850e-47
Msa0340530	Msa0702200	0.807957	3.920896e-50	-8.615850e-47
Msa0341190	Msa0702200	0.833640	4.748691e-56	-8.615850e-47
Msa0341770	Msa0702200	0.814559	1.448246e-51	-8.615850e-47
Msa0343370	Msa0702200	0.826462	2.676983e-54	-8.615850e-47
Msa0344680	Msa0702200	0.816363	5.749059e-52	-8.615850e-47
Msa0354390	Msa0702200	0.817720	2.847865e-52	-8.615850e-47
Msa0358720	Msa0702200	0.822199	2.691831e-53	-8.615850e-47
Msa0484250	Msa0702200	0.816597	5.094251e-52	-8.615850e-47
Msa0500490	Msa0702200	0.856456	3.178273e-62	-8.615850e-47
Msa0501470	Msa0702200	0.812842	3.459363e-51	-8.615850e-47
Msa0504630	Msa0702200	0.805757	1.144177e-49	-8.615850e-47
Msa0505390	Msa0702200	0.827987	1.154611e-54	-8.615850e-47
Msa0505660	Msa0702200	0.813857	2.069858e-51	-8.615850e-47
Msa0515680	Msa0702200	0.810881	9.243420e-51	-8.615850e-47
Msa0516480	Msa0702200	0.827712	1.344427e-54	-8.615850e-47
Msa0518480	Msa0702200	0.809142	2.189963e-50	-8.615850e-47
Msa0520810	Msa0702200	0.827798	1.281909e-54	-8.615850e-47
Msa0521940	Msa0702200	-0.800411	1.459467e-48	-8.615850e-47
Msa0525800	Msa0702200	0.805364	1.383148e-49	-8.615850e-47
Msa0528170	Msa0702200	0.807158	5.794125e-50	-8.615850e-47
Msa0530250	Msa0702200	0.812946	3.282889e-51	-8.615850e-47
Msa0530340	Msa0702200	0.858209	9.640339e-63	-8.615850e-47
Msa0533140	Msa0702200	0.817010	4.116365e-52	-8.615850e-47
Msa0534380	Msa0702200	0.814346	1.614625e-51	-8.615850e-47
Msa0535020	Msa0702200	0.841515	4.535253e-58	-8.615850e-47
Msa0535050	Msa0702200	0.838600	2.611140e-57	-8.615850e-47
Msa0535570	Msa0702200	-0.802818	4.683780e-49	-8.615850e-47
Msa0544930	Msa0702200	0.803866	2.840999e-49	-8.615850e-47
Msa0545230	Msa0702200	0.867337	1.473885e-65	-8.615850e-47
Msa0549330	Msa0702200	0.805553	1.263023e-49	-8.615850e-47
Msa0549540	Msa0702200	0.815601	8.504716e-52	-8.615850e-47
Msa0555510	Msa0702200	0.830806	2.385950e-55	-8.615850e-47
Msa0556070	Msa0702200	0.845962	2.927143e-59	-8.615850e-47
Msa0560370	Msa0702200	0.820735	5.862111e-53	-8.615850e-47
Msa0561420	Msa0702200	0.841227	5.400724e-58	-8.615850e-47
Msa0563140	Msa0702200	0.800280	1.551784e-48	-8.615850e-47
Msa0565150	Msa0702200	0.808614	2.840043e-50	-8.615850e-47
Msa0565530	Msa0702200	0.801605	8.323347e-49	-8.615850e-47
Msa0565760	Msa0702200	0.964835	7.883897e-124	-8.615850e-47
Msa0565860	Msa0702200	0.948111	1.799468e-106	-8.615850e-47
Msa0566010	Msa0702200	0.964608	1.528491e-123	-8.615850e-47
Msa0568120	Msa0702200	0.808701	2.721224e-50	-8.615850e-47
Msa0568600	Msa0702200	0.829529	4.891429e-55	-8.615850e-47
Msa0568610	Msa0702200	0.807877	4.077873e-50	-8.615850e-47
Msa0569230	Msa0702200	0.814692	1.353653e-51	-8.615850e-47
Msa0569930	Msa0702200	0.842457	2.556318e-58	-8.615850e-47
Msa0570680	Msa0702200	0.803251	3.810910e-49	-8.615850e-47
Msa0577050	Msa0702200	0.829476	5.039271e-55	-8.615850e-47
Msa0579170	Msa0702200	0.811849	5.698973e-51	-8.615850e-47
Msa0579230	Msa0702200	0.810785	9.700295e-51	-8.615850e-47
Msa0587070	Msa0702200	0.817885	2.613891e-52	-8.615850e-47
Msa0589540	Msa0702200	0.816455	5.481341e-52	-8.615850e-47
Msa0589610	Msa0702200	0.820198	7.784186e-53	-8.615850e-47
Msa0591780	Msa0702200	0.809208	2.119996e-50	-8.615850e-47
Msa0598250	Msa0702200	0.817136	3.856034e-52	-8.615850e-47
Msa0599250	Msa0702200	0.800122	1.671486e-48	-8.615850e-47
Msa0600820	Msa0702200	0.881151	3.045896e-70	-8.615850e-47
Msa0601920	Msa0702200	-0.800282	1.550517e-48	-8.615850e-47

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0702200	MtrunA17_Chr8g0380471	97.445	274	7	0	80	353	164	437	0.0	561
Msa0702200	MtrunA17_Chr8g0388921	55.678	273	121	0	81	353	166	438	2.10e-112	335
Msa0702200	MtrunA17_Chr5g0443731	40.714	280	165	1	76	354	155	434	2.03e-73	235
Msa0702200	MtrunA17_Chr5g0443401	40.647	278	155	5	80	354	169	439	1.36e-66	218
Msa0702200	MtrunA17_Chr8g0380931	38.406	276	164	5	80	352	193	465	1.38e-65	216
Msa0702200	MtrunA17_Chr3g0107511	41.197	284	155	6	75	352	160	437	2.99e-64	211
Msa0702200	MtrunA17_Chr3g0107501	38.710	279	161	4	80	352	163	437	5.95e-64	211
Msa0702200	MtrunA17_Chr8g0369791	36.996	273	159	6	85	354	165	427	8.91e-47	165
Msa0702200	MtrunA17_Chr7g0226771	34.173	278	168	6	79	351	163	430	9.49e-45	160
Msa0702200	MtrunA17_Chr5g0408181	35.354	297	167	8	61	354	151	425	1.50e-44	159
Msa0702200	MtrunA17_Chr5g0403931	36.981	265	155	6	94	351	180	439	2.00e-44	159
Msa0702200	MtrunA17_Chr4g0044851	36.910	233	138	4	124	354	207	432	1.22e-40	149
Msa0702200	MtrunA17_Chr5g0400421	33.080	263	171	5	94	353	191	451	2.10e-38	143
Msa0702200	MtrunA17_Chr1g0153371	35.217	230	145	2	125	354	206	431	6.21e-38	141
Msa0702200	MtrunA17_Chr8g0381541	30.502	259	178	2	95	351	190	448	6.65e-37	139
Msa0702200	MtrunA17_Chr8g0381571	30.502	259	178	2	95	351	190	448	8.54e-37	138
Msa0702200	MtrunA17_Chr8g0372711	30.888	259	174	2	95	353	192	445	1.03e-36	138
Msa0702200	MtrunA17_Chr8g0339861	35.268	224	143	2	131	353	225	447	1.10e-36	138
Msa0702200	MtrunA17_Chr5g0397971	27.208	283	198	4	73	351	152	430	2.09e-36	137
Msa0702200	MtrunA17_Chr8g0372411	29.434	265	179	3	91	351	179	439	2.22e-36	137
Msa0702200	MtrunA17_Chr2g0293411	28.000	375	240	6	4	351	75	446	2.31e-36	137
Msa0702200	MtrunA17_Chr1g0164371	33.594	256	164	3	94	348	182	432	2.62e-36	137
Msa0702200	MtrunA17_Chr8g0373441	35.897	234	139	6	94	322	177	404	2.27e-35	133
Msa0702200	MtrunA17_Chr3g0141801	29.304	273	179	5	90	353	177	444	2.85e-35	134
Msa0702200	MtrunA17_Chr8g0341951	28.906	256	175	4	96	350	183	432	4.12e-35	134
Msa0702200	MtrunA17_Chr4g0044841	36.052	233	140	4	124	354	208	433	5.44e-35	133
Msa0702200	MtrunA17_Chr3g0089351	28.897	263	181	3	92	354	101	357	3.73e-32	124
Msa0702200	MtrunA17_Chr3g0078411	28.261	276	182	5	77	351	164	424	7.36e-32	124
Msa0702200	MtrunA17_Chr5g0400411	33.840	263	170	4	94	353	189	450	8.16e-32	125
Msa0702200	MtrunA17_Chr3g0113321	30.798	263	166	9	95	349	172	426	2.09e-31	124
Msa0702200	MtrunA17_Chr2g0293421	28.244	262	186	2	91	351	187	447	6.33e-31	122
Msa0702200	MtrunA17_Chr7g0219961	30.833	240	152	6	118	351	192	423	2.51e-30	120
Msa0702200	MtrunA17_Chr6g0455461	29.707	239	158	4	117	351	192	424	4.51e-30	119
Msa0702200	MtrunA17_Chr3g0089361	28.517	263	182	4	92	354	183	439	1.12e-29	119
Msa0702200	MtrunA17_Chr6g0478161	27.562	283	186	6	80	353	180	452	3.95e-26	108
Msa0702200	MtrunA17_Chr0c19g0493771	32.571	175	108	3	185	353	437	607	5.00e-23	100
Msa0702200	MtrunA17_Chr8g0354531	30.303	231	143	6	133	350	377	602	2.83e-21	95.1
Msa0702200	MtrunA17_Chr2g0313821	26.488	336	213	11	38	350	149	473	3.33e-19	88.6
Msa0702200	MtrunA17_Chr2g0307291	27.541	305	196	9	66	350	176	475	7.63e-19	87.8
Msa0702200	MtrunA17_Chr2g0313791	26.774	310	192	11	66	350	169	468	1.18e-18	87.0
Msa0702200	MtrunA17_Chr1g0179811	27.753	227	140	5	140	350	278	496	1.45e-18	87.0
Msa0702200	MtrunA17_Chr3g0089381	28.079	203	140	4	95	296	4	201	1.64e-18	83.2
Msa0702200	MtrunA17_Chr2g0307301	27.541	305	196	8	66	350	176	475	3.17e-18	85.9
Msa0702200	MtrunA17_Chr5g0404861	39.048	105	62	1	249	351	16	120	3.33e-18	80.9
Msa0702200	MtrunA17_Chr5g0401691	29.808	208	134	4	149	347	255	459	1.49e-17	84.0
Msa0702200	MtrunA17_Chr8g0334941	26.493	268	170	7	100	351	30	286	2.25e-17	82.0
Msa0702200	MtrunA17_Chr5g0437001	37.755	98	58	2	255	349	1	98	5.97e-17	77.4
Msa0702200	MtrunA17_Chr4g0056951	31.579	209	129	7	153	352	262	465	1.10e-16	81.3
Msa0702200	MtrunA17_Chr2g0313781	25.301	332	216	11	41	350	164	485	1.35e-16	80.9
Msa0702200	MtrunA17_Chr2g0313751	26.537	309	194	10	66	350	201	500	2.20e-16	80.5
Msa0702200	MtrunA17_Chr1g0203151	28.571	224	143	6	140	354	257	472	3.63e-16	79.7
Msa0702200	MtrunA17_Chr6g0457421	29.956	227	146	8	133	354	250	468	3.71e-16	79.7
Msa0702200	MtrunA17_Chr6g0463551	30.380	158	98	3	133	283	33	185	3.92e-16	76.3
Msa0702200	MtrunA17_Chr5g0429651	26.016	246	156	8	133	355	228	470	4.90e-16	79.3
Msa0702200	MtrunA17_Chr8g0334891	26.493	268	170	7	100	351	185	441	5.09e-16	79.0
Msa0702200	MtrunA17_Chr2g0313761	26.101	318	184	9	66	350	169	468	5.44e-16	79.0
Msa0702200	MtrunA17_Chr7g0260821	26.014	296	167	12	90	351	182	459	5.51e-16	79.0
Msa0702200	MtrunA17_Chr2g0288661	24.756	307	202	8	66	350	176	475	8.47e-16	78.6
Msa0702200	MtrunA17_Chr3g0128461	29.358	218	135	7	146	354	278	485	9.43e-16	78.2
Msa0702200	MtrunA17_Chr1g0203141	27.803	223	146	6	140	354	261	476	9.83e-16	78.2
Msa0702200	MtrunA17_Chr7g0215181	28.870	239	149	7	133	356	245	477	1.10e-15	78.2
Msa0702200	MtrunA17_Chr7g0260831	27.273	220	138	7	143	351	250	458	1.36e-15	77.8
Msa0702200	MtrunA17_Chr8g0354571	28.165	316	179	13	66	350	183	481	1.56e-15	77.8
Msa0702200	MtrunA17_Chr2g0313811	25.460	326	209	11	49	350	170	485	1.72e-15	77.4
Msa0702200	MtrunA17_Chr2g0313801	24.756	307	202	8	66	350	174	473	3.00e-15	76.6
Msa0702200	MtrunA17_Chr2g0313831	27.300	337	209	13	38	350	149	473	6.17e-15	75.9
Msa0702200	MtrunA17_Chr1g0160861	33.333	159	98	4	201	354	139	294	8.98e-15	74.3
Msa0702200	MtrunA17_Chr1g0160851	33.333	159	98	4	201	354	298	453	1.06e-14	75.1
Msa0702200	MtrunA17_Chr2g0286091	27.126	247	161	7	122	353	217	459	1.12e-14	75.1
Msa0702200	MtrunA17_Chr8g0339311	28.283	198	131	4	158	347	279	473	1.30e-14	75.1
Msa0702200	MtrunA17_Chr1g0174461	27.500	200	131	6	156	347	263	456	1.94e-14	74.3
Msa0702200	MtrunA17_Chr4g0053621	29.000	200	132	6	161	354	262	457	2.19e-14	74.3
Msa0702200	MtrunA17_Chr6g0463541	44.118	68	37	1	284	351	3	69	2.52e-14	68.6
Msa0702200	MtrunA17_Chr4g0000151	38.750	80	49	0	272	351	22	101	3.72e-14	69.3
Msa0702200	MtrunA17_Chr4g0038271	26.496	234	155	6	137	355	291	522	3.97e-14	73.6
Msa0702200	MtrunA17_Chr6g0458561	31.646	158	98	3	197	347	324	478	3.99e-14	73.6
Msa0702200	MtrunA17_Chr3g0104351	26.087	230	152	5	144	355	249	478	4.90e-14	73.2
Msa0702200	MtrunA17_Chr5g0403321	31.401	207	123	7	157	353	264	461	5.08e-14	73.2
Msa0702200	MtrunA17_Chr5g0401681	28.241	216	140	7	148	354	240	449	6.70e-14	72.8
Msa0702200	MtrunA17_Chr8g0354511	29.437	231	145	6	133	350	256	481	7.37e-14	72.8
Msa0702200	MtrunA17_Chr8g0346261	27.751	209	135	5	147	347	296	496	8.79e-14	72.4
Msa0702200	MtrunA17_Chr4g0035921	28.846	156	101	3	198	347	311	462	9.41e-14	72.4
Msa0702200	MtrunA17_Chr7g0248991	30.556	144	96	2	185	328	219	358	9.57e-14	71.6
Msa0702200	MtrunA17_Chr1g0184421	26.786	224	134	7	143	351	252	460	9.79e-14	72.0
Msa0702200	MtrunA17_Chr1g0204271	26.866	268	165	10	113	355	206	467	1.06e-13	72.0
Msa0702200	MtrunA17_Chr8g0339331	26.957	230	147	9	140	354	249	472	1.08e-13	72.0
Msa0702200	MtrunA17_Chr2g0296651	29.189	185	126	4	164	347	262	442	1.19e-13	72.0
Msa0702200	MtrunA17_Chr8g0381561	35.165	91	59	0	261	351	9	99	1.29e-13	67.0
Msa0702200	MtrunA17_Chr1g0174441	28.270	237	150	6	127	347	246	478	1.57e-13	71.6
Msa0702200	MtrunA17_Chr1g0164321	25.328	229	150	4	144	355	285	509	1.81e-13	71.6
Msa0702200	MtrunA17_Chr5g0446131	27.083	240	151	7	131	350	236	471	1.87e-13	71.2
Msa0702200	MtrunA17_Chr6g0479681	26.160	237	146	7	141	354	260	490	2.00e-13	71.2
Msa0702200	MtrunA17_Chr1g0174481	29.279	222	138	6	139	347	236	451	2.50e-13	70.9
Msa0702200	MtrunA17_Chr8g0362481	28.889	225	142	7	138	347	166	387	2.83e-13	70.5
Msa0702200	MtrunA17_Chr5g0403351	26.442	208	135	6	157	353	258	458	4.14e-13	70.1
Msa0702200	MtrunA17_Chr5g0431501	25.896	251	167	7	115	354	216	458	5.16e-13	70.1
Msa0702200	MtrunA17_Chr5g0431461	25.896	251	167	7	115	354	216	458	5.16e-13	70.1
Msa0702200	MtrunA17_Chr1g0184461	26.364	220	140	6	143	351	252	460	6.27e-13	69.7
Msa0702200	MtrunA17_Chr1g0174451	26.778	239	157	4	123	347	223	457	6.54e-13	69.7
Msa0702200	MtrunA17_Chr4g0039391	28.037	214	136	6	150	348	242	452	7.05e-13	69.7
Msa0702200	MtrunA17_Chr6g0451811	31.056	161	93	6	198	347	2	155	7.75e-13	67.0
Msa0702200	MtrunA17_Chr1g0198191	31.214	173	106	5	193	356	308	476	8.74e-13	69.3
Msa0702200	MtrunA17_Chr2g0314731	29.744	195	128	5	159	347	255	446	9.14e-13	69.3
Msa0702200	MtrunA17_Chr7g0235551	27.354	223	147	5	139	351	244	461	1.14e-12	68.9
Msa0702200	MtrunA17_Chr8g0381551	28.676	136	96	1	95	229	190	325	1.47e-12	67.8
Msa0702200	MtrunA17_Chr8g0362731	25.703	249	168	6	119	354	125	369	1.64e-12	68.2
Msa0702200	MtrunA17_Chr5g0396521	26.341	205	106	6	183	350	330	526	1.76e-12	68.6
Msa0702200	MtrunA17_Chr2g0314721	29.101	189	126	4	164	347	272	457	1.78e-12	68.2
Msa0702200	MtrunA17_Chr3g0101611	29.615	260	155	11	120	355	207	462	2.59e-12	67.8
Msa0702200	MtrunA17_Chr8g0351311	27.966	236	140	8	141	355	247	473	2.80e-12	67.8
Msa0702200	MtrunA17_Chr8g0351801	26.991	226	140	5	138	347	251	467	3.03e-12	67.8
Msa0702200	MtrunA17_Chr8g0372251	25.481	208	130	6	155	345	253	452	3.46e-12	67.4
Msa0702200	MtrunA17_Chr6g0451691	29.911	224	135	9	138	343	255	474	4.77e-12	67.0
Msa0702200	MtrunA17_Chr1g0162811	30.435	161	103	3	198	353	299	455	5.43e-12	67.0
Msa0702200	MtrunA17_Chr6g0463621	30.303	165	101	4	202	355	1	162	6.85e-12	63.9
Msa0702200	MtrunA17_Chr5g0446161	28.788	198	126	4	166	353	263	455	9.11e-12	66.2
Msa0702200	MtrunA17_Chr1g0205361	30.818	159	102	3	201	354	298	453	9.40e-12	66.2
Msa0702200	MtrunA17_Chr8g0351391	26.724	232	147	8	141	355	247	472	1.03e-11	65.9
Msa0702200	MtrunA17_Chr8g0364081	27.347	245	142	9	140	354	264	502	1.13e-11	65.9
Msa0702200	MtrunA17_Chr2g0280081	28.736	174	115	3	187	351	787	960	1.17e-11	66.2
Msa0702200	MtrunA17_Chr6g0451781	29.493	217	136	8	140	343	291	503	1.29e-11	65.9
Msa0702200	MtrunA17_Chr8g0356001	32.967	182	111	6	173	347	278	455	1.41e-11	65.5
Msa0702200	MtrunA17_Chr6g0463791	31.013	158	98	2	204	353	300	454	1.71e-11	65.5
Msa0702200	MtrunA17_Chr8g0351401	24.537	216	149	4	154	355	256	471	1.73e-11	65.5
Msa0702200	MtrunA17_Chr4g0063221	27.119	236	153	7	131	350	244	476	1.89e-11	65.1
Msa0702200	MtrunA17_Chr3g0116741	27.419	186	119	6	172	347	285	464	1.98e-11	65.1
Msa0702200	MtrunA17_Chr3g0101731	26.549	226	150	8	133	347	230	450	2.24e-11	65.1
Msa0702200	MtrunA17_Chr8g0351421	26.636	214	140	6	157	355	260	471	2.33e-11	65.1
Msa0702200	MtrunA17_Chr7g0255131	27.363	201	127	6	165	351	270	465	2.34e-11	64.7
Msa0702200	MtrunA17_Chr8g0362701	26.991	226	147	6	133	343	230	452	2.72e-11	64.7
Msa0702200	MtrunA17_Chr1g0174471	29.000	200	129	4	156	347	278	472	3.00e-11	64.7
Msa0702200	MtrunA17_Chr1g0197891	29.680	219	142	8	135	347	232	444	3.67e-11	64.3
Msa0702200	MtrunA17_Chr8g0348751	25.112	223	143	9	148	351	251	468	3.90e-11	64.3
Msa0702200	MtrunA17_Chr7g0218601	27.982	218	135	7	136	343	239	444	4.88e-11	63.9
Msa0702200	MtrunA17_Chr1g0197871	31.694	183	114	7	171	347	267	444	5.36e-11	63.5
Msa0702200	MtrunA17_Chr6g0451681	29.870	154	98	4	201	347	277	427	5.91e-11	63.5
Msa0702200	MtrunA17_Chr6g0449341	24.424	217	153	4	149	355	310	525	6.45e-11	63.5
Msa0702200	MtrunA17_Chr7g0258211	27.607	163	96	3	201	347	305	461	8.99e-11	63.2
Msa0702200	MtrunA17_Chr1g0174431	30.189	159	95	4	201	347	1	155	9.51e-11	60.8

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa0702200	AT5G36110.1	48.529	272	136	1	82	353	169	436	4.72e-89	276
Msa0702200	AT2G42850.1	35.357	280	172	4	76	353	172	444	1.60e-59	199
Msa0702200	AT5G36110.2	44.186	215	116	1	82	296	169	379	4.78e-56	187
Msa0702200	AT5G45340.2	37.367	281	166	4	71	351	151	421	3.75e-51	176
Msa0702200	AT5G45340.1	37.367	281	166	4	71	351	151	421	9.64e-51	176
Msa0702200	AT4G19230.1	34.375	288	179	3	64	351	144	421	2.78e-48	169
Msa0702200	AT4G19230.2	34.375	288	179	3	64	351	144	421	6.28e-48	169
Msa0702200	AT2G29090.3	34.211	266	167	4	91	354	90	349	3.98e-46	162
Msa0702200	AT2G29090.2	34.211	266	167	4	91	354	185	444	5.42e-45	161
Msa0702200	AT2G29090.1	34.211	266	167	4	91	354	185	444	5.42e-45	161
Msa0702200	AT3G19270.1	38.528	231	135	4	124	353	203	427	2.54e-42	153
Msa0702200	AT3G19270.2	38.528	231	135	4	124	353	203	427	7.02e-42	152
Msa0702200	AT5G36130.1	59.596	99	40	0	255	353	1	99	1.42e-41	142
Msa0702200	AT2G32440.2	31.518	257	176	0	95	351	190	446	3.21e-39	145
Msa0702200	AT2G32440.1	31.518	257	176	0	95	351	190	446	3.21e-39	145
Msa0702200	AT4G36380.1	31.203	266	176	4	91	351	210	473	3.24e-39	146
Msa0702200	AT3G50660.1	32.881	295	156	6	94	351	183	472	6.20e-39	145
Msa0702200	AT2G42850.2	33.184	223	141	3	76	296	172	388	3.94e-38	140
Msa0702200	AT1G19630.3	29.740	269	185	4	85	353	171	435	6.40e-38	141
Msa0702200	AT1G19630.1	29.740	269	185	4	85	353	171	435	9.46e-38	141
Msa0702200	AT1G12740.2	29.344	259	176	4	96	351	182	436	2.21e-37	140
Msa0702200	AT1G12740.1	29.344	259	176	4	96	351	176	430	2.87e-37	140
Msa0702200	AT1G05160.2	31.660	259	175	2	95	351	191	449	7.66e-36	136
Msa0702200	AT1G05160.1	31.660	259	175	2	95	351	191	449	7.66e-36	136
Msa0702200	AT3G13730.2	28.782	271	187	3	83	350	184	451	2.59e-35	134
Msa0702200	AT3G13730.1	28.782	271	187	3	83	350	184	451	4.60e-35	134
Msa0702200	AT1G12740.4	28.679	265	176	5	96	351	176	436	4.79e-35	134
Msa0702200	AT1G19630.2	28.926	242	169	3	85	326	171	409	1.41e-32	126
Msa0702200	AT5G05690.3	28.736	261	176	4	95	351	55	309	1.04e-31	122
Msa0702200	AT5G14400.3	29.818	275	166	5	80	351	126	376	1.93e-31	122
Msa0702200	AT5G14400.1	29.818	275	166	5	80	351	72	322	2.52e-31	122
Msa0702200	AT5G14400.2	29.818	275	166	5	80	351	126	376	4.09e-31	122
Msa0702200	AT5G05690.1	28.736	261	176	4	95	351	174	428	5.52e-31	122
Msa0702200	AT3G50660.2	32.941	255	139	6	94	322	183	431	2.46e-30	120
Msa0702200	AT5G36140.1	30.583	206	131	2	27	232	118	311	2.52e-30	118
Msa0702200	AT3G30180.1	28.458	253	171	4	103	351	179	425	1.19e-29	119
Msa0702200	AT1G73340.1	29.965	287	171	6	80	353	173	442	8.14e-28	114
Msa0702200	AT5G38970.2	27.273	242	167	4	112	351	110	344	6.98e-27	110
Msa0702200	AT5G38970.4	27.273	242	167	4	112	351	110	344	6.98e-27	110
Msa0702200	AT5G38970.1	27.273	242	167	4	112	351	191	425	2.16e-26	109
Msa0702200	AT1G78490.1	30.159	252	155	8	108	353	202	438	3.32e-25	106
Msa0702200	AT4G15300.3	26.800	250	169	6	108	351	180	421	1.32e-24	104
Msa0702200	AT4G15300.2	26.800	250	169	6	108	351	190	431	1.44e-24	104
Msa0702200	AT3G44970.1	33.184	223	136	6	135	351	221	436	2.73e-24	103
Msa0702200	AT3G30290.1	26.829	246	169	5	108	349	121	359	4.56e-24	102
Msa0702200	AT4G15300.1	26.070	257	176	6	108	351	188	443	3.24e-23	100
Msa0702200	AT1G55940.1	28.054	221	150	5	139	353	237	454	6.84e-23	99.8
Msa0702200	AT1G55940.2	28.054	221	150	5	139	353	237	454	8.68e-23	99.8
Msa0702200	AT1G65670.1	26.271	236	160	4	122	353	204	429	1.04e-22	99.4
Msa0702200	AT5G05690.2	26.840	231	164	2	95	325	174	399	1.17e-22	98.6
Msa0702200	AT4G15396.3	26.050	238	164	5	122	353	203	434	2.05e-22	98.2
Msa0702200	AT4G15393.2	29.185	233	147	7	129	353	210	432	2.11e-22	98.2
Msa0702200	AT4G15396.1	26.050	238	164	5	122	353	203	434	2.47e-22	98.2
Msa0702200	AT5G38970.3	26.066	211	148	3	112	321	191	394	1.09e-21	95.9
Msa0702200	AT4G36380.2	29.381	194	133	3	91	282	210	401	1.23e-21	95.9
Msa0702200	AT4G37320.1	35.450	189	115	4	163	348	257	441	5.20e-20	91.7
Msa0702200	AT1G31800.1	31.977	172	107	3	185	350	358	525	5.78e-20	91.7
Msa0702200	AT5G14400.4	29.665	209	138	4	80	285	126	328	8.23e-20	89.4
Msa0702200	AT1G12740.3	26.702	191	135	3	96	285	176	362	4.21e-19	87.8
Msa0702200	AT5G48000.2	29.730	185	122	4	173	351	254	436	1.00e-18	87.4
Msa0702200	AT5G48000.4	29.730	185	122	4	173	351	254	436	1.00e-18	87.4
Msa0702200	AT5G48000.7	29.730	185	122	4	173	351	254	436	1.00e-18	87.4
Msa0702200	AT5G48000.6	29.730	185	122	4	173	351	254	436	1.00e-18	87.4
Msa0702200	AT5G48000.5	29.730	185	122	4	173	351	254	436	1.00e-18	87.4
Msa0702200	AT5G48000.3	29.730	185	122	4	173	351	254	436	1.00e-18	87.4
Msa0702200	AT5G48000.1	28.415	183	127	3	173	351	295	477	1.14e-18	87.4
Msa0702200	AT1G78490.2	29.680	219	135	7	108	322	202	405	3.87e-18	85.5
Msa0702200	AT3G28740.1	31.959	194	125	4	163	353	265	454	1.09e-17	84.7
Msa0702200	AT2G34490.1	29.583	240	154	8	125	353	216	451	1.26e-17	84.3
Msa0702200	AT3G56630.1	30.457	197	121	6	166	351	264	455	3.60e-17	83.2
Msa0702200	AT4G37400.1	30.263	228	139	6	135	351	231	449	3.75e-17	82.8
Msa0702200	AT4G37330.1	31.915	188	121	4	163	347	254	437	7.26e-17	82.0
Msa0702200	AT3G14630.1	29.204	226	148	6	132	350	245	465	7.46e-17	82.0
Msa0702200	AT1G66540.2	32.461	191	119	5	163	348	84	269	8.61e-17	80.9
Msa0702200	AT5G52400.1	30.317	221	140	8	140	354	268	480	9.68e-17	81.6
Msa0702200	AT4G37370.1	31.915	188	121	4	163	347	256	439	1.06e-16	81.6
Msa0702200	AT3G14630.2	29.204	226	148	6	132	350	300	520	1.24e-16	81.6
Msa0702200	AT3G53130.1	25.641	234	148	6	137	353	275	499	1.27e-16	81.6
Msa0702200	AT1G66540.1	32.461	191	119	5	163	348	143	328	2.10e-16	80.1
Msa0702200	AT2G45510.1	27.907	215	142	4	154	355	255	469	4.21e-16	79.7
Msa0702200	AT1G11680.1	25.095	263	180	7	100	351	187	443	4.39e-16	79.7
Msa0702200	AT4G37410.1	29.032	217	142	5	135	347	233	441	6.52e-16	79.3
Msa0702200	AT3G14640.1	28.085	235	152	6	129	350	241	471	7.13e-16	79.0
Msa0702200	AT3G14640.2	28.085	235	152	6	129	350	263	493	9.05e-16	79.0
Msa0702200	AT1G34540.1	27.861	201	128	7	163	351	260	455	1.14e-15	78.6
Msa0702200	AT3G14660.2	28.631	241	154	7	120	350	91	323	1.20e-15	77.8
Msa0702200	AT4G15396.2	23.950	238	148	5	122	353	203	413	1.48e-15	78.2
Msa0702200	AT2G28860.1	26.337	243	154	7	125	353	216	447	1.75e-15	77.8
Msa0702200	AT4G37360.1	32.386	176	114	3	174	348	270	441	3.27e-15	77.0
Msa0702200	AT5G25130.1	33.557	149	89	5	201	343	294	438	6.63e-15	76.3
Msa0702200	AT4G15310.1	25.806	186	133	3	173	354	253	437	6.63e-15	76.3
Msa0702200	AT2G44890.1	26.512	215	145	4	154	355	255	469	8.11e-15	75.9
Msa0702200	AT3G14660.1	28.631	241	154	7	120	350	237	469	9.14e-15	75.9
Msa0702200	AT4G37310.1	30.808	198	120	6	163	347	259	452	1.07e-14	75.5
Msa0702200	AT5G58860.1	29.060	234	138	9	137	347	234	462	1.39e-14	75.1
Msa0702200	AT2G28850.1	27.381	252	152	8	119	353	210	447	1.58e-14	75.1
Msa0702200	AT4G37430.1	29.204	226	142	8	135	351	236	452	1.63e-14	75.1
Msa0702200	AT2G26710.1	27.039	233	146	7	134	350	248	472	2.20e-14	74.7
Msa0702200	AT2G46960.1	29.185	233	145	7	131	350	132	357	2.45e-14	73.9
Msa0702200	AT5G57220.1	30.435	184	123	3	171	353	262	441	2.69e-14	74.3
Msa0702200	AT4G15393.3	27.778	198	130	5	129	322	177	365	4.49e-14	73.2
Msa0702200	AT5G25140.1	31.325	166	102	5	198	355	291	452	4.57e-14	73.6
Msa0702200	AT1G50520.1	27.027	222	139	6	142	349	253	465	5.93e-14	73.2
Msa0702200	AT2G46960.2	29.185	233	145	7	131	350	248	473	7.35e-14	73.2
Msa0702200	AT4G15393.1	27.778	198	130	5	129	322	210	398	7.81e-14	72.4
Msa0702200	AT1G75130.1	26.293	232	153	6	126	347	234	457	9.43e-14	72.8
Msa0702200	AT4G37340.1	31.183	186	121	5	165	348	261	441	9.87e-14	72.4
Msa0702200	AT2G34500.1	25.532	235	166	5	125	353	215	446	1.12e-13	72.4
Msa0702200	AT3G14690.1	27.111	225	147	6	136	350	252	469	1.16e-13	72.4
Msa0702200	AT3G14610.1	25.217	230	155	6	134	350	244	469	1.21e-13	72.4
Msa0702200	AT4G15396.4	24.510	204	145	4	122	322	203	400	1.36e-13	72.0
Msa0702200	AT5G24910.1	31.461	178	98	8	194	356	332	500	1.65e-13	72.0
Msa0702200	AT3G14690.2	27.111	225	147	6	136	350	287	504	1.83e-13	72.0
Msa0702200	AT5G24900.2	30.769	169	105	5	194	355	210	373	1.86e-13	71.6
Msa0702200	AT4G15110.1	27.363	201	109	6	183	350	338	534	1.87e-13	72.0
Msa0702200	AT3G61040.1	29.717	212	133	5	149	347	237	445	1.94e-13	71.6
Msa0702200	AT4G13770.1	30.348	201	126	8	163	351	256	454	2.10e-13	71.6
Msa0702200	AT5G67310.1	28.936	235	155	7	117	349	229	453	3.10e-13	71.2
Msa0702200	AT5G24900.1	31.395	172	100	7	194	355	327	490	5.74e-13	70.5
Msa0702200	AT3G20140.1	31.579	152	96	3	201	347	308	456	6.97e-13	70.1
Msa0702200	AT3G32047.1	27.885	208	132	5	148	343	252	453	7.01e-13	70.1
Msa0702200	AT5G06905.1	25.523	239	155	6	135	354	233	467	9.82e-13	69.7
Msa0702200	AT1G64930.1	30.899	178	112	5	182	351	290	464	1.08e-12	69.3
Msa0702200	AT3G20935.1	29.268	205	123	6	154	347	93	286	1.33e-12	68.6
Msa0702200	AT3G20120.2	29.487	156	98	3	201	347	171	323	3.29e-12	67.4
Msa0702200	AT3G20120.3	29.487	156	98	3	201	347	171	323	3.29e-12	67.4
Msa0702200	AT3G20120.1	29.487	156	98	3	201	347	171	323	3.29e-12	67.4
Msa0702200	AT3G20120.4	29.487	156	98	3	201	347	307	459	3.56e-12	67.8
Msa0702200	AT2G29090.4	28.369	141	95	2	91	230	185	320	3.67e-12	67.0
Msa0702200	AT4G31950.1	30.270	185	108	7	172	347	285	457	3.78e-12	67.8
Msa0702200	AT5G36220.2	28.977	176	120	3	174	348	130	301	4.89e-12	67.0
Msa0702200	AT3G20940.1	27.530	247	148	7	133	354	228	468	6.54e-12	67.0
Msa0702200	AT5G36220.1	28.977	176	120	3	174	348	276	447	1.04e-11	66.2
Msa0702200	AT2G26170.2	28.514	249	147	9	119	354	167	397	1.85e-11	65.5
Msa0702200	AT2G24180.1	27.586	203	132	5	150	341	248	446	2.45e-11	65.1
Msa0702200	AT2G26170.1	28.514	249	147	9	119	354	250	480	2.54e-11	65.1
Msa0702200	AT5G35715.1	24.797	246	160	9	113	343	146	381	3.29e-11	64.7
Msa0702200	AT5G47990.1	25.197	254	159	9	121	347	211	460	3.62e-11	64.7
Msa0702200	AT1G33730.1	28.947	190	126	4	163	347	135	320	5.94e-11	63.5
Msa0702200	AT1G33730.2	28.947	190	126	4	163	347	135	320	5.94e-11	63.5
Msa0702200	AT3G14650.1	26.906	223	150	6	136	350	252	469	6.61e-11	63.9
Msa0702200	AT5G04330.1	26.400	250	157	9	114	347	215	453	7.30e-11	63.9
Msa0702200	AT4G31970.1	29.448	163	102	6	194	347	310	468	8.40e-11	63.5

Find 78 sgRNAs with CRISPR-Local

Find 262 sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
AGCATAGGTAAAATCCTTTA+TGG	0.275374	4_4:+73759624	None:intergenic
GAAAGGTTTGTTACATGAAT+AGG	0.281392	4_4:+73760353	None:intergenic
GAAGAAAAGGAAAGTGGATT+TGG	0.289451	4_4:-73760210	Msa0702200:CDS
CTTAGGCGCCGCAATGATAT+TGG	0.298508	4_4:-73764781	Msa0702200:CDS
CCAAATGGAACATATGAATA+AGG	0.317996	4_4:+73759272	None:intergenic
TAACAAGTAAATGTGATAAA+AGG	0.325476	4_4:+73760159	None:intergenic
GCCTTATGAAACCTTGTTCC+AGG	0.328634	4_4:+73760278	None:intergenic
CCTTATTCATATGTTCCATT+TGG	0.347733	4_4:-73759272	Msa0702200:CDS
TCTTGCCCCAAACACATTCT+AGG	0.349577	4_4:+73759242	None:intergenic
AGGAGGACCTAGAATGTGTT+TGG	0.349634	4_4:-73759249	Msa0702200:CDS
TGAAAGCTACAAATGAAATA+AGG	0.357447	4_4:-73760253	Msa0702200:CDS
GGCTTCGCAATCAACTTTCC+TGG	0.366680	4_4:-73760296	Msa0702200:CDS
AATGTGTATAGCTGTATTAT+AGG	0.370831	4_4:+73760413	None:intergenic
TCATTGGTTATGAAGTATCT+TGG	0.378005	4_4:-73760038	Msa0702200:CDS
AAAGGTTTGTTACATGAATA+GGG	0.384152	4_4:+73760354	None:intergenic
CGCTTTCAGAGATGCCATAA+AGG	0.396578	4_4:-73759638	Msa0702200:CDS
GAATTTCTAAAAGGGATCAT+TGG	0.400489	4_4:-73760317	Msa0702200:CDS
GGAGGACCTAGAATGTGTTT+GGG	0.409965	4_4:-73759248	Msa0702200:CDS
TCCTGGAACAAGGTTTCATA+AGG	0.411433	4_4:-73760279	Msa0702200:CDS
TCCAGAAAATGAAATACTCT+TGG	0.427830	4_4:-73759705	Msa0702200:CDS
TATTCATATGTTCCATTTGG+AGG	0.446643	4_4:-73759269	Msa0702200:CDS
ACTCCCCTGCCTCTTTCCCT+TGG	0.450901	4_4:+73759746	None:intergenic
TTCTAGATCAGTACTATCAT+TGG	0.451944	4_4:-73760054	Msa0702200:CDS
TTAAAATGATTATGAAGAAA+AGG	0.452233	4_4:-73760223	Msa0702200:CDS
CAATATCATTGCGGCGCCTA+AGG	0.456422	4_4:+73764782	None:intergenic
CATGCATTCTTGCTTACAGT+TGG	0.457046	4_4:+73764662	None:intergenic
TTTGATGCTTCAAGGTTTGA+AGG	0.459869	4_4:-73759308	Msa0702200:CDS
TCTCTGAAAGCGCCACCGAC+AGG	0.468430	4_4:+73759649	None:intergenic
TCAGGATTTGAAAACAGTGT+TGG	0.475875	4_4:+73759335	None:intergenic
CTGAGGCTGTCCCCGCCTGT+CGG	0.476524	4_4:-73759664	Msa0702200:CDS
TGAAATTAGCCAAGGGAAAG+AGG	0.480337	4_4:-73759755	Msa0702200:CDS
CAATCAACTTTCCTGGAACA+AGG	0.481445	4_4:-73760289	Msa0702200:CDS
ATGCATTCTTGCTTACAGTT+GGG	0.482633	4_4:+73764663	None:intergenic
TGAAAGCGCCACCGACAGGC+GGG	0.482966	4_4:+73759653	None:intergenic
CGCTCGGTTAGAGATACTCT+TGG	0.495394	4_4:-73759216	Msa0702200:CDS
ATTCTAGGTCCTCCTCCAAA+TGG	0.498202	4_4:+73759257	None:intergenic
ATTAGCCAAGGGAAAGAGGC+AGG	0.499684	4_4:-73759751	Msa0702200:CDS
CCTTGCAATTGTTTACATGC+TGG	0.502577	4_4:+73764582	None:intergenic
GGTGTTTATGACAGTTGCAT+TGG	0.503191	4_4:-73759382	Msa0702200:intron
ATTCTTCAAAATATGATGAA+AGG	0.503401	4_4:+73760336	None:intergenic
GGCAGGGGAGTTATTGCAAT+GGG	0.509314	4_4:-73759734	Msa0702200:CDS
AGGCTGTCCCCGCCTGTCGG+TGG	0.509526	4_4:-73759661	Msa0702200:CDS
AGTGGATTTGGATGAAAAGA+AGG	0.515529	4_4:-73760198	Msa0702200:CDS
GATTATGAAGAAAAGGAAAG+TGG	0.517025	4_4:-73760216	Msa0702200:CDS
GCTTCAAGGTTTGAAGGAGA+AGG	0.523358	4_4:-73759302	Msa0702200:CDS
TAGCCAAGGGAAAGAGGCAG+GGG	0.528348	4_4:-73759749	Msa0702200:CDS
GGAACATATGAATAAGGTGT+TGG	0.529659	4_4:+73759278	None:intergenic
TCATATGTTCCATTTGGAGG+AGG	0.534499	4_4:-73759266	Msa0702200:CDS
GTTTATGAACAAGTGTTGAA+AGG	0.536878	4_4:-73760002	Msa0702200:intron
AACACTTGTTCATAAACTTG+AGG	0.550446	4_4:+73760008	None:intergenic
ATGCTGGAGAGCATGCATCT+TGG	0.555307	4_4:+73764598	None:intergenic
CTGAAAGCGCCACCGACAGG+CGG	0.557611	4_4:+73759652	None:intergenic
CTTCAAGGTTTGAAGGAGAA+GGG	0.558408	4_4:-73759301	Msa0702200:CDS
GAAAGCGCCACCGACAGGCG+GGG	0.559653	4_4:+73759654	None:intergenic
CTTGTTACACCTGATACAAG+TGG	0.559763	4_4:-73760143	Msa0702200:CDS
ATTATAACATCCCTAGTGGA+TGG	0.567013	4_4:-73759600	Msa0702200:CDS
GAACAACTTGAAATTAGCCA+AGG	0.578712	4_4:-73759763	Msa0702200:CDS
GTTTGGGGCAAGAGTTCGCT+CGG	0.580677	4_4:-73759232	Msa0702200:CDS
TCTATACATGTCATTGATGG+TGG	0.580686	4_4:-73764751	Msa0702200:CDS
ATGTTGCTTCTGAAGTTCTG+AGG	0.584534	4_4:-73759681	Msa0702200:CDS
TAACATCCCTAGTGGATGGA+AGG	0.587209	4_4:-73759596	Msa0702200:intron
TGTAAACAATTGCAAGGCAA+AGG	0.595793	4_4:-73764576	Msa0702200:intron
GATACAAATTTAGATGCAGA+TGG	0.597216	4_4:-73764717	Msa0702200:CDS
AAACATACCTTCCATCCACT+AGG	0.600198	4_4:+73759589	None:intergenic
AGGGATGTTATAATCAGCAT+AGG	0.611512	4_4:+73759609	None:intergenic
GTACTGATCTAGAAGTGTCA+TGG	0.614010	4_4:+73760063	None:intergenic
AACATACCTTCCATCCACTA+GGG	0.616641	4_4:+73759590	None:intergenic
ACAATGACTAGCAAATCCTT+AGG	0.617164	4_4:-73764798	Msa0702200:CDS
TTACACCTGATACAAGTGGA+AGG	0.625910	4_4:-73760139	Msa0702200:CDS
CCAGCATGTAAACAATTGCA+AGG	0.627304	4_4:-73764582	Msa0702200:CDS
GAACACACATACAACACACA+TGG	0.635289	4_4:-73759360	Msa0702200:CDS
TTAGCCAAGGGAAAGAGGCA+GGG	0.642507	4_4:-73759750	Msa0702200:CDS
AACAACTTGAAATTAGCCAA+GGG	0.643857	4_4:-73759762	Msa0702200:CDS
AGGCAGGGGAGTTATTGCAA+TGG	0.650161	4_4:-73759735	Msa0702200:CDS
GCTGATTATAACATCCCTAG+TGG	0.655417	4_4:-73759604	Msa0702200:CDS
TGTGATAAAAGGTCTTGTGT+AGG	0.663837	4_4:+73760170	None:intergenic
AGGGGAGTTATTGCAATGGG+AGG	0.678989	4_4:-73759731	Msa0702200:CDS
GAGGACCTAGAATGTGTTTG+GGG	0.695156	4_4:-73759247	Msa0702200:CDS

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content
!!!	TTTATTTTTTTAAAAAAAAT+TGG	-	chr4_4:73760002-73760021	Msa0702200:intron	0.0%
!!!	TTATTTTTTTAAAAAAAATT+GGG	-	chr4_4:73760003-73760022	Msa0702200:CDS	0.0%
!!!	ATATTACTTAGTAATTATTT+TGG	-	chr4_4:73759505-73759524	Msa0702200:intron	10.0%
!!	AATTTGAATATAATTGATAT+CGG	+	chr4_4:73760724-73760743	None:intergenic	10.0%
!!	TTTAAATTAATAAATTTCTC+CGG	+	chr4_4:73761147-73761166	None:intergenic	10.0%
!!!	TTATTAATTTATGATTTTCT+TGG	-	chr4_4:73761431-73761450	Msa0702200:intron	10.0%
!!!	TATTAATTTATGATTTTCTT+GGG	-	chr4_4:73761432-73761451	Msa0702200:intron	10.0%
!!!	TAATAAGATAATAATTTTTC+GGG	+	chr4_4:73761480-73761499	None:intergenic	10.0%
!!!	TTTATTTACTAATTTTGATT+TGG	+	chr4_4:73761596-73761615	None:intergenic	10.0%
!!!	AGTTTTTTGTTTTTTTTTTT+TGG	+	chr4_4:73763032-73763051	None:intergenic	10.0%
!!!	TATAGATTAGTTAAAAAATA+TGG	+	chr4_4:73763141-73763160	None:intergenic	10.0%
!!	CAAAAAAAAAAAACTATAAG+AGG	-	chr4_4:73759893-73759912	Msa0702200:intron	15.0%
!!!	TGAAATCTAATTTTGAAAAA+TGG	+	chr4_4:73760280-73760299	None:intergenic	15.0%
!!	GAAATATGCAAATTAATTAT+TGG	-	chr4_4:73760328-73760347	Msa0702200:CDS	15.0%
!!	TTAATCAACAAAAAATTAAC+AGG	-	chr4_4:73760390-73760409	Msa0702200:CDS	15.0%
!!	AATTTACTTATAATTGACAA+AGG	-	chr4_4:73760842-73760861	Msa0702200:intron	15.0%
!!	ATATATAACATTGAAGAAAA+TGG	-	chr4_4:73761545-73761564	Msa0702200:intron	15.0%
!!	TATATAACATTGAAGAAAAT+GGG	-	chr4_4:73761546-73761565	Msa0702200:intron	15.0%
!!!	TAAAGTTTGACTTTATTTTA+GGG	+	chr4_4:73762873-73762892	None:intergenic	15.0%
!!!	ATAAAGTTTGACTTTATTTT+AGG	+	chr4_4:73762874-73762893	None:intergenic	15.0%
!!!	TATTTTGAAGAATTTCTAAA+AGG	-	chr4_4:73763674-73763693	Msa0702200:intron	15.0%
!!!	ATTTTGAAGAATTTCTAAAA+GGG	-	chr4_4:73763675-73763694	Msa0702200:intron	15.0%
!!	TTAAAATGATTATGAAGAAA+AGG	-	chr4_4:73763777-73763796	Msa0702200:intron	15.0%
!!	TTTGAACATTAATTTCAATA+TGG	-	chr4_4:73764035-73764054	Msa0702200:intron	15.0%
!!!	AAATTTGATTTTCAAGCATA+TGG	+	chr4_4:73759365-73759384	None:intergenic	20.0%
!!!	ATATATTGTCACTACATTTT+AGG	+	chr4_4:73759466-73759485	None:intergenic	20.0%
!!	AATATACATATGTTATCTAG+AGG	+	chr4_4:73759490-73759509	None:intergenic	20.0%
!!	GTTAACATTAAATTTCTATG+TGG	+	chr4_4:73759722-73759741	None:intergenic	20.0%
!!!	CAAGTTTCATGTTTTAAAAA+TGG	+	chr4_4:73759749-73759768	None:intergenic	20.0%
!!	TCTATTAGATATATAAGTCA+TGG	+	chr4_4:73759976-73759995	None:intergenic	20.0%
!!	TTTAAAAAAAATTGGGAAAG+AGG	-	chr4_4:73760010-73760029	Msa0702200:CDS	20.0%
!!	TTAAAAATGTATCAATTCAG+TGG	+	chr4_4:73760132-73760151	None:intergenic	20.0%
!!!	GGGTTTTATAAATAAAGTAT+TGG	+	chr4_4:73760186-73760205	None:intergenic	20.0%
!!	TTATTTATAAAACCCAAACA+AGG	-	chr4_4:73760191-73760210	Msa0702200:CDS	20.0%
!!	GCAATGAAAGATAAAAAAAA+AGG	-	chr4_4:73760690-73760709	Msa0702200:intron	20.0%
!!	CTTTATATTGACATTAATGA+AGG	+	chr4_4:73761094-73761113	None:intergenic	20.0%
!!	CTCTATAAATTAATAATGTC+AGG	-	chr4_4:73761120-73761139	Msa0702200:intron	20.0%
!!!	GCATTGTTGTTAAAAAAAAA+AGG	-	chr4_4:73761692-73761711	Msa0702200:intron	20.0%
!!!	TTGAATAATTAACTTGAACA+AGG	-	chr4_4:73761949-73761968	Msa0702200:intron	20.0%
!!!	CTTTGATTTGATAGTAAAAA+AGG	+	chr4_4:73762046-73762065	None:intergenic	20.0%
!!	TGTGTGAAATATATATAGTT+CGG	-	chr4_4:73762124-73762143	Msa0702200:intron	20.0%
!!!	TAGTTCGGATTTTTTTTTTT+TGG	-	chr4_4:73762139-73762158	Msa0702200:intron	20.0%
!!!	AGTTCGGATTTTTTTTTTTT+GGG	-	chr4_4:73762140-73762159	Msa0702200:intron	20.0%
!!	TTATTATTCATCATAGCTTA+TGG	-	chr4_4:73762332-73762351	Msa0702200:intron	20.0%
!!!	GCTAATTAACACTTTAAAAA+TGG	+	chr4_4:73762781-73762800	None:intergenic	20.0%
!!!	TTTTTTTTTTTTGGTAAGAC+TGG	+	chr4_4:73763023-73763042	None:intergenic	20.0%
!!!	AATGGACATATATTTTGAAA+CGG	+	chr4_4:73763082-73763101	None:intergenic	20.0%
!!	ATTCTTCAAAATATGATGAA+AGG	+	chr4_4:73763667-73763686	None:intergenic	20.0%
!!	TAACAAGTAAATGTGATAAA+AGG	+	chr4_4:73763844-73763863	None:intergenic	20.0%
!!	TATAAGAAAAAAAAGCAACA+TGG	+	chr4_4:73764159-73764178	None:intergenic	20.0%
!!!	CTTTTATGAAAAACTTGATT+AGG	-	chr4_4:73764179-73764198	Msa0702200:intron	20.0%
!	AAAAAGAACCAATATCATTG+CGG	+	chr4_4:73759230-73759249	None:intergenic	25.0%
!!	TTTTCTATACATGTCATTGA+TGG	-	chr4_4:73759246-73759265	Msa0702200:CDS	25.0%
!	ACTTCATTATAGAAATCATG+CGG	+	chr4_4:73759534-73759553	None:intergenic	25.0%
!	AAATGTGAATAAGATATGTG+TGG	-	chr4_4:73759639-73759658	Msa0702200:CDS	25.0%
!!	AAATATGATACCTTTTGTCT+CGG	-	chr4_4:73759682-73759701	Msa0702200:CDS	25.0%
!	ATTCATTAGTAAGAAATGAG+TGG	+	chr4_4:73759827-73759846	None:intergenic	25.0%
!	ACTAATGAATCTATCATTAG+AGG	-	chr4_4:73759837-73759856	Msa0702200:intron	25.0%
!	CTAATGAATCTATCATTAGA+GGG	-	chr4_4:73759838-73759857	Msa0702200:intron	25.0%
!	GAAAAATATATTGTCGTCTT+AGG	-	chr4_4:73760244-73760263	Msa0702200:CDS	25.0%
!	CTTACAATATCTCTTATTCT+AGG	+	chr4_4:73760429-73760448	None:intergenic	25.0%
!	AGAATAAGAGATATTGTAAG+AGG	-	chr4_4:73760429-73760448	Msa0702200:CDS	25.0%
!	AGGTTTCATAAAACTATGTA+CGG	+	chr4_4:73760460-73760479	None:intergenic	25.0%
!	TCAGATAAACGAAAAACTAT+CGG	-	chr4_4:73760488-73760507	Msa0702200:intron	25.0%
!	ACTTAACTAAGATTTCATGT+TGG	+	chr4_4:73760552-73760571	None:intergenic	25.0%
!	ATAGAAGTAATAATGACACT+TGG	+	chr4_4:73760623-73760642	None:intergenic	25.0%
!!	ACGTATACAAGATTTTTGTT+GGG	-	chr4_4:73760657-73760676	Msa0702200:intron	25.0%
!!	TGTATGAGTGATAGATATTT+TGG	+	chr4_4:73760982-73761001	None:intergenic	25.0%
!	TAAATTAATAATGTCAGGAC+CGG	-	chr4_4:73761125-73761144	Msa0702200:intron	25.0%
!	ATACAGTAAATGTAAACAAG+AGG	-	chr4_4:73761358-73761377	Msa0702200:intron	25.0%
!!!	TTTTTTTTCCTTGTTTTGTG+TGG	-	chr4_4:73761658-73761677	Msa0702200:intron	25.0%
!!!	AAAAAAAAAGGCATCACAAA+TGG	-	chr4_4:73761704-73761723	Msa0702200:intron	25.0%
!	TTAGAATGCTAACTTATAGT+GGG	+	chr4_4:73761793-73761812	None:intergenic	25.0%
!	ATTAGAATGCTAACTTATAG+TGG	+	chr4_4:73761794-73761813	None:intergenic	25.0%
!	ATTAACTGTGTTTAATGTTG+TGG	+	chr4_4:73761923-73761942	None:intergenic	25.0%
!	TGATTGTAGTTGAAAGTTTA+AGG	-	chr4_4:73762230-73762249	Msa0702200:intron	25.0%
!!!	AATAACTAGAGCTTTGTTTT+TGG	+	chr4_4:73762310-73762329	None:intergenic	25.0%
!	AAAACAAGAATGTTCAAGTA+TGG	-	chr4_4:73762442-73762461	Msa0702200:intron	25.0%
!	AAGTAATTTCTAAGTGTTTC+TGG	+	chr4_4:73762567-73762586	None:intergenic	25.0%
!	TAGAAATTACTTGCCTAATA+TGG	-	chr4_4:73762575-73762594	Msa0702200:intron	25.0%
!	AAAATAAGAACCAGTTGAAT+TGG	+	chr4_4:73762668-73762687	None:intergenic	25.0%
!	AAAAACATGCTAGAATCATA+TGG	+	chr4_4:73762710-73762729	None:intergenic	25.0%
!	TCATGACTTAAATGTCTAAA+CGG	-	chr4_4:73762742-73762761	Msa0702200:intron	25.0%
!	AACATCTTCACAAATATCTA+TGG	+	chr4_4:73762922-73762941	None:intergenic	25.0%
!	ACATCATGATGTAAATTGAT+TGG	-	chr4_4:73762965-73762984	Msa0702200:intron	25.0%
!!!	TTGTTGATTTACACTTTTGA+AGG	-	chr4_4:73763542-73763561	Msa0702200:intron	25.0%
!!!	TGTTGATTTACACTTTTGAA+GGG	-	chr4_4:73763543-73763562	Msa0702200:intron	25.0%
!	AATGTGTATAGCTGTATTAT+AGG	+	chr4_4:73763590-73763609	None:intergenic	25.0%
!!!	TTGTTGCTTATTTTTAAGCA+TGG	-	chr4_4:73763619-73763638	Msa0702200:intron	25.0%
!!!	AAAGGTTTGTTACATGAATA+GGG	+	chr4_4:73763649-73763668	None:intergenic	25.0%
!	TGAAAGCTACAAATGAAATA+AGG	-	chr4_4:73763747-73763766	Msa0702200:intron	25.0%
!!	ATACTATTACTTCTTTTTGC+TGG	-	chr4_4:73763914-73763933	Msa0702200:intron	25.0%
!!!	TATTCTAAAGCATGTATGTA+TGG	-	chr4_4:73764597-73764616	Msa0702200:CDS	25.0%
	GATACAAATTTAGATGCAGA+TGG	-	chr4_4:73759283-73759302	Msa0702200:CDS	30.0%
	TGTTTGTCAAGCACTTTATA+TGG	+	chr4_4:73759932-73759951	None:intergenic	30.0%
	ATAAAACCCAAACAAGGATT+AGG	-	chr4_4:73760197-73760216	Msa0702200:CDS	30.0%
	ATATATTGTCGTCTTAGGAT+CGG	-	chr4_4:73760249-73760268	Msa0702200:CDS	30.0%
!	GACGTATACAAGATTTTTGT+TGG	-	chr4_4:73760656-73760675	Msa0702200:intron	30.0%
!	CGTATACAAGATTTTTGTTG+GGG	-	chr4_4:73760658-73760677	Msa0702200:intron	30.0%
	TCACTCATACAAAAATGTGA+AGG	-	chr4_4:73760991-73761010	Msa0702200:intron	30.0%
	AAAATGTGAAGGACCTAAAA+CGG	-	chr4_4:73761002-73761021	Msa0702200:intron	30.0%
	ATACTTAAATATACACCACG+AGG	-	chr4_4:73761040-73761059	Msa0702200:intron	30.0%
	ACTATTGTGTTCATATGCAT+TGG	-	chr4_4:73761314-73761333	Msa0702200:intron	30.0%
	TTGGGACCGAAAATTATAAA+GGG	-	chr4_4:73761450-73761469	Msa0702200:intron	30.0%
!	GGAGATCCCTTTATAATTTT+CGG	+	chr4_4:73761459-73761478	None:intergenic	30.0%
	TTAGGTACAAATATGTGTTC+AGG	+	chr4_4:73762193-73762212	None:intergenic	30.0%
!!!	AATTGCAAGGAGGATTTTTT+AGG	+	chr4_4:73762256-73762275	None:intergenic	30.0%
	ACTGAACACATATAATTGCA+AGG	+	chr4_4:73762269-73762288	None:intergenic	30.0%
!!!	TAGAGCTTTGTTTTTGGAAT+TGG	+	chr4_4:73762304-73762323	None:intergenic	30.0%
	TTATTCATCATAGCTTATGG+AGG	-	chr4_4:73762335-73762354	Msa0702200:intron	30.0%
	TTCTTGTGATGAAATGCAAA+AGG	+	chr4_4:73762407-73762426	None:intergenic	30.0%
	AAGGTTGTCTCTTGTTAATA+TGG	-	chr4_4:73762491-73762510	Msa0702200:intron	30.0%
	TTGTCTCTTGTTAATATGGT+TGG	-	chr4_4:73762495-73762514	Msa0702200:intron	30.0%
	TGAGCAATTCTATCCATATT+AGG	+	chr4_4:73762591-73762610	None:intergenic	30.0%
	CAAACCAATGTGTGTTTATA+TGG	+	chr4_4:73762617-73762636	None:intergenic	30.0%
	TAATTAGCAGATAGTGAGAT+AGG	-	chr4_4:73762793-73762812	Msa0702200:intron	30.0%
	AGATAGGTACATGACATAAA+AGG	-	chr4_4:73762809-73762828	Msa0702200:intron	30.0%
!!	GAAAAACAATAGTTTCTAGC+TGG	+	chr4_4:73762843-73762862	None:intergenic	30.0%
!!!	GACATATATTTTGAAACGGA+GGG	+	chr4_4:73763078-73763097	None:intergenic	30.0%
	ATAGTGCACATTGCAAAAAA+TGG	+	chr4_4:73763100-73763119	None:intergenic	30.0%
	TAACAGTCAAAATTGTGCAT+TGG	-	chr4_4:73763262-73763281	Msa0702200:intron	30.0%
!!	CTTGGACATGTATTTTGAAA+CGG	-	chr4_4:73763303-73763322	Msa0702200:intron	30.0%
!!	GAAAGGTTTGTTACATGAAT+AGG	+	chr4_4:73763650-73763669	None:intergenic	30.0%
!	GAATTTCTAAAAGGGATCAT+TGG	-	chr4_4:73763683-73763702	Msa0702200:intron	30.0%
	GATTATGAAGAAAAGGAAAG+TGG	-	chr4_4:73763784-73763803	Msa0702200:intron	30.0%
	TTCTAGATCAGTACTATCAT+TGG	-	chr4_4:73763946-73763965	Msa0702200:intron	30.0%
!	TCATTGGTTATGAAGTATCT+TGG	-	chr4_4:73763962-73763981	Msa0702200:intron	30.0%
	AACACTTGTTCATAAACTTG+AGG	+	chr4_4:73763995-73764014	None:intergenic	30.0%
!!	GTTTATGAACAAGTGTTGAA+AGG	-	chr4_4:73763998-73764017	Msa0702200:intron	30.0%
	AACAACTTGAAATTAGCCAA+GGG	-	chr4_4:73764238-73764257	Msa0702200:intron	30.0%
	TCCAGAAAATGAAATACTCT+TGG	-	chr4_4:73764295-73764314	Msa0702200:intron	30.0%
!!!	TCCAAGAGTATTTCATTTTC+TGG	+	chr4_4:73764299-73764318	None:intergenic	30.0%
	AGCATAGGTAAAATCCTTTA+TGG	+	chr4_4:73764379-73764398	None:intergenic	30.0%
!!	CTTGAAGCATCAAATTTTTC+AGG	+	chr4_4:73764686-73764705	None:intergenic	30.0%
	CTGAAAAATTTGATGCTTCA+AGG	-	chr4_4:73764684-73764703	Msa0702200:CDS	30.0%
	CCAAATGGAACATATGAATA+AGG	+	chr4_4:73764731-73764750	None:intergenic	30.0%
	CCTTATTCATATGTTCCATT+TGG	-	chr4_4:73764728-73764747	Msa0702200:CDS	30.0%
	TATTCATATGTTCCATTTGG+AGG	-	chr4_4:73764731-73764750	Msa0702200:CDS	30.0%
	TCTATACATGTCATTGATGG+TGG	-	chr4_4:73759249-73759268	Msa0702200:CDS	35.0%
	ATGCATTCTTGCTTACAGTT+GGG	+	chr4_4:73759340-73759359	None:intergenic	35.0%
	TGTAAACAATTGCAAGGCAA+AGG	-	chr4_4:73759424-73759443	Msa0702200:intron	35.0%
	GTTTGATTATCCGAGACAAA+AGG	+	chr4_4:73759695-73759714	None:intergenic	35.0%
	CAAGTTAAGCCTCTTATAGT+TGG	+	chr4_4:73759872-73759891	None:intergenic	35.0%
!	TGCATTCCTAATCCTTGTTT+GGG	+	chr4_4:73760206-73760225	None:intergenic	35.0%
	ATGCATTCCTAATCCTTGTT+TGG	+	chr4_4:73760207-73760226	None:intergenic	35.0%
	TCTCTTATTCTAGGCTTCTT+GGG	+	chr4_4:73760420-73760439	None:intergenic	35.0%
	ATCTCTTATTCTAGGCTTCT+TGG	+	chr4_4:73760421-73760440	None:intergenic	35.0%
	TCGTTTATCTGAGTTTCACA+AGG	+	chr4_4:73760480-73760499	None:intergenic	35.0%
	TTTGAACTTGACAATGCAAC+AGG	+	chr4_4:73760527-73760546	None:intergenic	35.0%
	CTTGGGACCGAAAATTATAA+AGG	-	chr4_4:73761449-73761468	Msa0702200:intron	35.0%
	CAAAGACAGTCATGAAATGA+TGG	+	chr4_4:73761749-73761768	None:intergenic	35.0%
	TTGTGGTTTATGAAGCTAAG+TGG	+	chr4_4:73761906-73761925	None:intergenic	35.0%
	GAACACATATAATTGCAAGG+AGG	+	chr4_4:73762266-73762285	None:intergenic	35.0%
!!	GACAAAGCTCATAGTTTTAC+CGG	-	chr4_4:73762359-73762378	Msa0702200:intron	35.0%
	TTGTGATGAAATGCAAAAGG+AGG	+	chr4_4:73762404-73762423	None:intergenic	35.0%
	ACAAGAATGTTCAAGTATGG+TGG	-	chr4_4:73762445-73762464	Msa0702200:intron	35.0%
	ATGAAGCAAAAGCAACTAGA+AGG	-	chr4_4:73762520-73762539	Msa0702200:intron	35.0%
	AGCACCATATAAACACACAT+TGG	-	chr4_4:73762610-73762629	Msa0702200:intron	35.0%
!!	AACACACATTGGTTTGATTC+TGG	-	chr4_4:73762621-73762640	Msa0702200:intron	35.0%
	GTAAATTGATTGGATGTACG+TGG	-	chr4_4:73762975-73762994	Msa0702200:intron	35.0%
!!!	GGACATATATTTTGAAACGG+AGG	+	chr4_4:73763079-73763098	None:intergenic	35.0%
!!!	GACATGTATTTTGAAACGGA+GGG	-	chr4_4:73763307-73763326	Msa0702200:intron	35.0%
!!	GATTTACACTTTTGAAGGGA+AGG	-	chr4_4:73763547-73763566	Msa0702200:intron	35.0%
!	GAAGAAAAGGAAAGTGGATT+TGG	-	chr4_4:73763790-73763809	Msa0702200:intron	35.0%
!	AGTGGATTTGGATGAAAAGA+AGG	-	chr4_4:73763802-73763821	Msa0702200:intron	35.0%
!	TGTGATAAAAGGTCTTGTGT+AGG	+	chr4_4:73763833-73763852	None:intergenic	35.0%
	AAAAACCTTCCACTTGTATC+AGG	+	chr4_4:73763869-73763888	None:intergenic	35.0%
!	TGGAAGGTTTTTGAATGAAG+TGG	-	chr4_4:73763877-73763896	Msa0702200:intron	35.0%
	GAACAACTTGAAATTAGCCA+AGG	-	chr4_4:73764237-73764256	Msa0702200:intron	35.0%
	AGGGATGTTATAATCAGCAT+AGG	+	chr4_4:73764394-73764413	None:intergenic	35.0%
	ATTATAACATCCCTAGTGGA+TGG	-	chr4_4:73764400-73764419	Msa0702200:intron	35.0%
	TCAGGATTTGAAAACAGTGT+TGG	+	chr4_4:73764668-73764687	None:intergenic	35.0%
	TTTGATGCTTCAAGGTTTGA+AGG	-	chr4_4:73764692-73764711	Msa0702200:CDS	35.0%
	GGAACATATGAATAAGGTGT+TGG	+	chr4_4:73764725-73764744	None:intergenic	35.0%
	CATGCATTCTTGCTTACAGT+TGG	+	chr4_4:73759341-73759360	None:intergenic	40.0%
	CCTTGCAATTGTTTACATGC+TGG	+	chr4_4:73759421-73759440	None:intergenic	40.0%
	CCAGCATGTAAACAATTGCA+AGG	-	chr4_4:73759418-73759437	Msa0702200:intron	40.0%
	GCAGTACAACCAACTATAAG+AGG	-	chr4_4:73759860-73759879	Msa0702200:intron	40.0%
	TAGGAATGCATGCACTTCTA+CGG	-	chr4_4:73760216-73760235	Msa0702200:CDS	40.0%
	CTAATTTACGTTGAGTCCCA+AGG	+	chr4_4:73761292-73761311	None:intergenic	40.0%
	CAAGTAGCACTAAGGGAAAA+TGG	+	chr4_4:73761830-73761849	None:intergenic	40.0%
	ATGGAAGCAAGTAGCACTAA+GGG	+	chr4_4:73761837-73761856	None:intergenic	40.0%
	AATGGAAGCAAGTAGCACTA+AGG	+	chr4_4:73761838-73761857	None:intergenic	40.0%
!	TGCTACTTGCTTCCATTTGT+CGG	-	chr4_4:73761841-73761860	Msa0702200:intron	40.0%
!!	CTTCCATTTGTCGGTTCATT+TGG	-	chr4_4:73761850-73761869	Msa0702200:intron	40.0%
	GTACCTAACCACATATGTGA+AGG	-	chr4_4:73762205-73762224	Msa0702200:intron	40.0%
	ACTCCTTCACATATGTGGTT+AGG	+	chr4_4:73762211-73762230	None:intergenic	40.0%
	CAATCACTCCTTCACATATG+TGG	+	chr4_4:73762216-73762235	None:intergenic	40.0%
!!	CATAGTTTTACCGGCAGTTT+TGG	-	chr4_4:73762368-73762387	Msa0702200:intron	40.0%
	AACAACTTCTTCACTGAGCT+AGG	+	chr4_4:73762471-73762490	None:intergenic	40.0%
	GCTCAGTGAAGAAGTTGTTA+AGG	-	chr4_4:73762472-73762491	Msa0702200:intron	40.0%
!	GATTCTGGCTATACTTTAGC+CGG	-	chr4_4:73762636-73762655	Msa0702200:intron	40.0%
!	ATTCTGGCTATACTTTAGCC+GGG	-	chr4_4:73762637-73762656	Msa0702200:intron	40.0%
!!!	GGACATGTATTTTGAAACGG+AGG	-	chr4_4:73763306-73763325	Msa0702200:intron	40.0%
	CAATCAACTTTCCTGGAACA+AGG	-	chr4_4:73763711-73763730	Msa0702200:intron	40.0%
	TCCTGGAACAAGGTTTCATA+AGG	-	chr4_4:73763721-73763740	Msa0702200:intron	40.0%
	CTTGTTACACCTGATACAAG+TGG	-	chr4_4:73763857-73763876	Msa0702200:intron	40.0%
	TTACACCTGATACAAGTGGA+AGG	-	chr4_4:73763861-73763880	Msa0702200:intron	40.0%
!!	GTACTGATCTAGAAGTGTCA+TGG	+	chr4_4:73763940-73763959	None:intergenic	40.0%
	TGAAATTAGCCAAGGGAAAG+AGG	-	chr4_4:73764245-73764264	Msa0702200:intron	40.0%
!!	ATGTTGCTTCTGAAGTTCTG+AGG	-	chr4_4:73764319-73764338	Msa0702200:intron	40.0%
	GCTGATTATAACATCCCTAG+TGG	-	chr4_4:73764396-73764415	Msa0702200:intron	40.0%
	AACATACCTTCCATCCACTA+GGG	+	chr4_4:73764413-73764432	None:intergenic	40.0%
	AAACATACCTTCCATCCACT+AGG	+	chr4_4:73764414-73764433	None:intergenic	40.0%
	GGTGTTTATGACAGTTGCAT+TGG	-	chr4_4:73764618-73764637	Msa0702200:CDS	40.0%
	GAACACACATACAACACACA+TGG	-	chr4_4:73764640-73764659	Msa0702200:CDS	40.0%
	CTTCAAGGTTTGAAGGAGAA+GGG	-	chr4_4:73764699-73764718	Msa0702200:CDS	40.0%
	TCATATGTTCCATTTGGAGG+AGG	-	chr4_4:73764734-73764753	Msa0702200:CDS	40.0%
!	AAGCAACACGCAACCGTTTT+AGG	+	chr4_4:73761018-73761037	None:intergenic	45.0%
	AATGAAGGCTTCTGTTGCGA+CGG	+	chr4_4:73761079-73761098	None:intergenic	45.0%
	CGCTGCAACGTAATTCTAAG+AGG	+	chr4_4:73761267-73761286	None:intergenic	45.0%
	AATTACGTTGCAGCGAACCT+TGG	-	chr4_4:73761272-73761291	Msa0702200:intron	45.0%
	ATTACGTTGCAGCGAACCTT+GGG	-	chr4_4:73761273-73761292	Msa0702200:intron	45.0%
!!!	TTTCCTTGTTTTGTGTGGCG+AGG	-	chr4_4:73761663-73761682	Msa0702200:intron	45.0%
!!!	TTCCTTGTTTTGTGTGGCGA+GGG	-	chr4_4:73761664-73761683	Msa0702200:intron	45.0%
	TCGCCAAATGAACCGACAAA+TGG	+	chr4_4:73761856-73761875	None:intergenic	45.0%
	ACAAAGAGAGCCAAAACTGC+CGG	+	chr4_4:73762381-73762400	None:intergenic	45.0%
!	CCAGTTGAATTGGTTCAACC+CGG	+	chr4_4:73762658-73762677	None:intergenic	45.0%
	CATGTGTGAAGTGGTTGACT+TGG	-	chr4_4:73763285-73763304	Msa0702200:intron	45.0%
	GCCTTATGAAACCTTGTTCC+AGG	+	chr4_4:73763725-73763744	None:intergenic	45.0%
!!	AAAACAGTGCAGCTGACTTG+AGG	+	chr4_4:73764066-73764085	None:intergenic	45.0%
	TACTTGAGGTCGGAACACAA+GGG	-	chr4_4:73764102-73764121	Msa0702200:intron	45.0%
	CGCTTTCAGAGATGCCATAA+AGG	-	chr4_4:73764362-73764381	Msa0702200:intron	45.0%
!	TAACATCCCTAGTGGATGGA+AGG	-	chr4_4:73764404-73764423	Msa0702200:intron	45.0%
	GCTTCAAGGTTTGAAGGAGA+AGG	-	chr4_4:73764698-73764717	Msa0702200:CDS	45.0%
	ATTCTAGGTCCTCCTCCAAA+TGG	+	chr4_4:73764746-73764765	None:intergenic	45.0%
	AGGAGGACCTAGAATGTGTT+TGG	-	chr4_4:73764751-73764770	Msa0702200:CDS	45.0%
	GGAGGACCTAGAATGTGTTT+GGG	-	chr4_4:73764752-73764771	Msa0702200:CDS	45.0%
	GAGGACCTAGAATGTGTTTG+GGG	-	chr4_4:73764753-73764772	Msa0702200:CDS	45.0%
	TCTTGCCCCAAACACATTCT+AGG	+	chr4_4:73764761-73764780	None:intergenic	45.0%
!!!	ATAATAAGATAATAATTTTT+CGG	+	chr4_4:73761481-73761500	None:intergenic	5.0%
	CAATATCATTGCGGCGCCTA+AGG	+	chr4_4:73759221-73759240	None:intergenic	50.0%
!	CTTAGGCGCCGCAATGATAT+TGG	-	chr4_4:73759219-73759238	Msa0702200:CDS	50.0%
!	ATGCTGGAGAGCATGCATCT+TGG	+	chr4_4:73759405-73759424	None:intergenic	50.0%
	ATCCCTCGCCACACAAAACA+AGG	+	chr4_4:73761669-73761688	None:intergenic	50.0%
!	CCGGGTTGAACCAATTCAAC+TGG	-	chr4_4:73762655-73762674	Msa0702200:intron	50.0%
!	GTGCATTGGCATGTGTGAAG+TGG	-	chr4_4:73763276-73763295	Msa0702200:intron	50.0%
!!	CACTTTTGAAGGGAAGGAGC+AGG	-	chr4_4:73763553-73763572	Msa0702200:intron	50.0%
	GGCTTCGCAATCAACTTTCC+TGG	-	chr4_4:73763704-73763723	Msa0702200:intron	50.0%
	CACTGCAACGTACTTGAGGT+CGG	-	chr4_4:73764092-73764111	Msa0702200:intron	50.0%
	GTACTTGAGGTCGGAACACA+AGG	-	chr4_4:73764101-73764120	Msa0702200:intron	50.0%
	ATTAGCCAAGGGAAAGAGGC+AGG	-	chr4_4:73764249-73764268	Msa0702200:intron	50.0%
	TTAGCCAAGGGAAAGAGGCA+GGG	-	chr4_4:73764250-73764269	Msa0702200:intron	50.0%
	AGGCAGGGGAGTTATTGCAA+TGG	-	chr4_4:73764265-73764284	Msa0702200:intron	50.0%
	GGCAGGGGAGTTATTGCAAT+GGG	-	chr4_4:73764266-73764285	Msa0702200:intron	50.0%
	AGGGGAGTTATTGCAATGGG+AGG	-	chr4_4:73764269-73764288	Msa0702200:intron	50.0%
	CGCTCGGTTAGAGATACTCT+TGG	-	chr4_4:73764784-73764803	Msa0702200:CDS	50.0%
!!	CAGTGCAGCTGACTTGAGGT+CGG	+	chr4_4:73764062-73764081	None:intergenic	55.0%
	CGTGCACTGCAACGTACTTG+AGG	-	chr4_4:73764088-73764107	Msa0702200:intron	55.0%
	TAGCCAAGGGAAAGAGGCAG+GGG	-	chr4_4:73764251-73764270	Msa0702200:intron	55.0%
!	GTTTGGGGCAAGAGTTCGCT+CGG	-	chr4_4:73764768-73764787	Msa0702200:CDS	55.0%
	TACACCACGAGGCTTCGTCG+TGG	-	chr4_4:73761051-73761070	Msa0702200:intron	60.0%
	ACACCACGAGGCTTCGTCGT+GGG	-	chr4_4:73761052-73761071	Msa0702200:intron	60.0%
	ACTCCCCTGCCTCTTTCCCT+TGG	+	chr4_4:73764257-73764276	None:intergenic	60.0%
!!	TCTCTGAAAGCGCCACCGAC+AGG	+	chr4_4:73764354-73764373	None:intergenic	60.0%
	CACCACGAGGCTTCGTCGTG+GGG	-	chr4_4:73761053-73761072	Msa0702200:intron	65.0%
!!	TGAAAGCGCCACCGACAGGC+GGG	+	chr4_4:73764350-73764369	None:intergenic	65.0%
!!	CTGAAAGCGCCACCGACAGG+CGG	+	chr4_4:73764351-73764370	None:intergenic	65.0%
	CTGAGGCTGTCCCCGCCTGT+CGG	-	chr4_4:73764336-73764355	Msa0702200:intron	70.0%
!!	GAAAGCGCCACCGACAGGCG+GGG	+	chr4_4:73764349-73764368	None:intergenic	70.0%
	GGCCCCACGACGAAGCCTCG+TGG	+	chr4_4:73761058-73761077	None:intergenic	75.0%
	AGGCTGTCCCCGCCTGTCGG+TGG	-	chr4_4:73764339-73764358	Msa0702200:intron	75.0%

Chromosome	Type	Strat	End	Strand	Name
chr4_4	gene	73759205	73764817	73759205	ID=Msa0702200;Name=Msa0702200
chr4_4	mRNA	73759205	73764817	73759205	ID=Msa0702200-mRNA-1;Parent=Msa0702200;Name=Msa0702200-mRNA-1;_AED=0.23;_eAED=0.23;_QI=0\|0\|0\|1\|1\|1\|4\|0\|356
chr4_4	exon	73764577	73764817	73764577	ID=Msa0702200-mRNA-1:exon:22803;Parent=Msa0702200-mRNA-1
chr4_4	exon	73760003	73760458	73760003	ID=Msa0702200-mRNA-1:exon:22802;Parent=Msa0702200-mRNA-1
chr4_4	exon	73759597	73759784	73759597	ID=Msa0702200-mRNA-1:exon:22801;Parent=Msa0702200-mRNA-1
chr4_4	exon	73759205	73759390	73759205	ID=Msa0702200-mRNA-1:exon:22800;Parent=Msa0702200-mRNA-1
chr4_4	CDS	73764577	73764817	73764577	ID=Msa0702200-mRNA-1:cds;Parent=Msa0702200-mRNA-1
chr4_4	CDS	73760003	73760458	73760003	ID=Msa0702200-mRNA-1:cds;Parent=Msa0702200-mRNA-1
chr4_4	CDS	73759597	73759784	73759597	ID=Msa0702200-mRNA-1:cds;Parent=Msa0702200-mRNA-1
chr4_4	CDS	73759205	73759390	73759205	ID=Msa0702200-mRNA-1:cds;Parent=Msa0702200-mRNA-1

Gene Sequence

>Msa0702200

ATGACTAGCAAATCCTTAGGCGCCGCAATGATATTGGTTCTTTTTCTATACATGTCATTGATGGTGGTAGCAGTTGAAGATACAAATTTAGATGCAGATGGTGATGACATTAAAGATGACAAGATGTCGTTACCCAACTGTAAGCAAGAATGCATGTCCATATGCTTGAAAATCAAATTTGCAGAAGATTCACTTTGCCAAGATGCATGCTCTCCAGCATGTAAACAATTGCAAGGCAAAGGGAAGGAGCAGGTTGTTGTCTATCCTATAATACAGCTATACACATTTGAATTAGCTTGTTGCTTATTTTTAAGCATGGAAGACCCTATTCATGTAACAAACCTTTCATCATATTTTGAAGAATTTCTAAAAGGGATCATTGGCTTCGCAATCAACTTTCCTGGAACAAGGTTTCATAAGGCAATGAAAGCTACAAATGAAATAAGGAAAGAAATTAAAATGATTATGAAGAAAAGGAAAGTGGATTTGGATGAAAAGAAGGCATCACCTACACAAGACCTTTTATCACATTTACTTGTTACACCTGATACAAGTGGAAGGTTTTTGAATGAAGTGGAGATTATTGATAACATACTATTACTTCTTTTTGCTGGCCATGACACTTCTAGATCAGTACTATCATTGGTTATGAAGTATCTTGGAAATTTGCCTCAAGTTTATGAACAAGTGTTGAAAGAACAACTTGAAATTAGCCAAGGGAAAGAGGCAGGGGAGTTATTGCAATGGGAGGATATCCAGAAAATGAAATACTCTTGGAATGTTGCTTCTGAAGTTCTGAGGCTGTCCCCGCCTGTCGGTGGCGCTTTCAGAGATGCCATAAAGGATTTTACCTATGCTGATTATAACATCCCTAGTGGATGGAAGTTGCATTGGAACACACATACAACACACATGGATCCAACACTGTTTTCAAATCCTGAAAAATTTGATGCTTCAAGGTTTGAAGGAGAAGGGCCAACACCTTATTCATATGTTCCATTTGGAGGAGGACCTAGAATGTGTTTGGGGCAAGAGTTCGCTCGGTTAGAGATACTCTTGGTTTCAAGATAA

Protein sequence

>Msa0702200

MTSKSLGAAMILVLFLYMSLMVVAVEDTNLDADGDDIKDDKMSLPNCKQECMSICLKIKFAEDSLCQDACSPACKQLQGKGKEQVVVYPIIQLYTFELACCLFLSMEDPIHVTNLSSYFEEFLKGIIGFAINFPGTRFHKAMKATNEIRKEIKMIMKKRKVDLDEKKASPTQDLLSHLLVTPDTSGRFLNEVEIIDNILLLLFAGHDTSRSVLSLVMKYLGNLPQVYEQVLKEQLEISQGKEAGELLQWEDIQKMKYSWNVASEVLRLSPPVGGAFRDAIKDFTYADYNIPSGWKLHWNTHTTHMDPTLFSNPEKFDASRFEGEGPTPYSYVPFGGGPRMCLGQEFARLEILLVSR*