AlfalfaGEDB | Msa1254170

M. sativa cultivar zhongmu-4 / Msa1254170

KEGG: -
GO: GO:0003674 GO:0003824 GO:0007275 GO:0007568 GO:0008150 GO:0008152 GO:0010150 GO:0016491 GO:0016679 GO:0016682 GO:0032501 GO:0032502 GO:0048366 GO:0048367 GO:0048731 GO:0048827 GO:0048856 GO:0055114 GO:0090693 GO:0099402
PFAM: PF14226.9

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1254170	XP_024628133.1	86.735	392	21	2	1	392	1	361	0.0	694

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1254170	sp\|Q39224\|SRG1_ARATH	34.783	345	184	3	51	392	52	358	5.44e-65	214

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score

TFs/TRs:

Gene ID	Type	Classification

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
Msa0003470	Msa1254170	0.852175	5.483177e-61	-8.615850e-47
Msa0007450	Msa1254170	0.829152	6.040965e-55	-8.615850e-47
Msa0009210	Msa1254170	0.820496	6.651510e-53	-8.615850e-47
Msa0009890	Msa1254170	0.819919	9.018659e-53	-8.615850e-47
Msa0012460	Msa1254170	0.843244	1.578150e-58	-8.615850e-47
Msa0013810	Msa1254170	0.802225	6.206226e-49	-8.615850e-47
Msa0017120	Msa1254170	0.845817	3.206066e-59	-8.615850e-47
Msa0025830	Msa1254170	0.801177	1.018401e-48	-8.615850e-47
Msa0032350	Msa1254170	0.800638	1.311925e-48	-8.615850e-47
Msa0034320	Msa1254170	0.824230	9.031860e-54	-8.615850e-47
Msa0035090	Msa1254170	0.809531	1.806863e-50	-8.615850e-47
Msa0041540	Msa1254170	0.818124	2.309247e-52	-8.615850e-47
Msa0043680	Msa1254170	0.814012	1.913379e-51	-8.615850e-47
Msa0047470	Msa1254170	0.804420	2.178693e-49	-8.615850e-47
Msa0049990	Msa1254170	0.823567	1.292122e-53	-8.615850e-47
Msa0056040	Msa1254170	0.841090	5.865713e-58	-8.615850e-47
Msa0059590	Msa1254170	0.815011	1.150368e-51	-8.615850e-47
Msa0061320	Msa1254170	0.826216	3.063287e-54	-8.615850e-47
Msa0062750	Msa1254170	0.824883	6.339277e-54	-8.615850e-47
Msa0065390	Msa1254170	0.849141	3.912582e-60	-8.615850e-47
Msa0073350	Msa1254170	0.810673	1.025502e-50	-8.615850e-47
Msa0077910	Msa1254170	0.837380	5.380241e-57	-8.615850e-47
Msa0078520	Msa1254170	0.806772	6.992913e-50	-8.615850e-47
Msa0079530	Msa1254170	0.804493	2.103530e-49	-8.615850e-47
Msa0081300	Msa1254170	0.815798	7.687739e-52	-8.615850e-47
Msa0083570	Msa1254170	0.826977	2.017268e-54	-8.615850e-47
Msa0084680	Msa1254170	0.809347	1.978731e-50	-8.615850e-47
Msa0089210	Msa1254170	0.813377	2.639814e-51	-8.615850e-47
Msa0091480	Msa1254170	0.812785	3.560400e-51	-8.615850e-47
Msa0092660	Msa1254170	0.818172	2.251519e-52	-8.615850e-47
Msa0092730	Msa1254170	0.817403	3.358121e-52	-8.615850e-47
Msa0094060	Msa1254170	0.820722	5.901371e-53	-8.615850e-47
Msa0094420	Msa1254170	0.802892	4.520700e-49	-8.615850e-47
Msa0103780	Msa1254170	0.837655	4.571884e-57	-8.615850e-47
Msa0104190	Msa1254170	0.801038	1.087146e-48	-8.615850e-47
Msa0104420	Msa1254170	0.849618	2.880207e-60	-8.615850e-47
Msa0107460	Msa1254170	0.840013	1.122463e-57	-8.615850e-47
Msa0110710	Msa1254170	0.846792	1.738981e-59	-8.615850e-47
Msa0112290	Msa1254170	0.804984	1.661573e-49	-8.615850e-47
Msa0112340	Msa1254170	0.802430	5.630802e-49	-8.615850e-47
Msa0115010	Msa1254170	0.835456	1.660402e-56	-8.615850e-47
Msa0605230	Msa1254170	0.808129	3.604277e-50	-8.615850e-47
Msa0606140	Msa1254170	0.800695	1.277444e-48	-8.615850e-47
Msa0607280	Msa1254170	0.809119	2.214649e-50	-8.615850e-47
Msa0607300	Msa1254170	0.832785	7.754471e-56	-8.615850e-47
Msa0607480	Msa1254170	0.824722	6.918953e-54	-8.615850e-47
Msa0609990	Msa1254170	0.811881	5.607682e-51	-8.615850e-47
Msa0614230	Msa1254170	0.839435	1.587581e-57	-8.615850e-47
Msa0619060	Msa1254170	0.851901	6.561159e-61	-8.615850e-47
Msa0619170	Msa1254170	0.815631	8.373578e-52	-8.615850e-47
Msa0619330	Msa1254170	0.816952	4.241857e-52	-8.615850e-47
Msa0620090	Msa1254170	0.855307	6.888405e-62	-8.615850e-47
Msa0621770	Msa1254170	0.807786	4.264687e-50	-8.615850e-47
Msa0622390	Msa1254170	0.824698	7.009714e-54	-8.615850e-47
Msa0623760	Msa1254170	0.821384	4.155355e-53	-8.615850e-47
Msa0624220	Msa1254170	0.851561	8.189572e-61	-8.615850e-47
Msa0624240	Msa1254170	0.851216	1.025541e-60	-8.615850e-47
Msa0628060	Msa1254170	0.811031	8.578126e-51	-8.615850e-47
Msa0635130	Msa1254170	0.824250	8.935918e-54	-8.615850e-47
Msa0638040	Msa1254170	0.808521	2.972627e-50	-8.615850e-47
Msa0638710	Msa1254170	0.805220	1.483144e-49	-8.615850e-47
Msa0639420	Msa1254170	0.816589	5.116653e-52	-8.615850e-47
Msa0640880	Msa1254170	0.863171	3.011114e-64	-8.615850e-47
Msa0642650	Msa1254170	0.808804	2.586769e-50	-8.615850e-47
Msa0643800	Msa1254170	0.807885	4.061881e-50	-8.615850e-47
Msa0646710	Msa1254170	0.803166	3.969034e-49	-8.615850e-47
Msa0647110	Msa1254170	0.813005	3.185592e-51	-8.615850e-47
Msa0647460	Msa1254170	0.828500	8.683730e-55	-8.615850e-47
Msa0647710	Msa1254170	0.809722	1.644068e-50	-8.615850e-47
Msa0647750	Msa1254170	0.827074	1.912221e-54	-8.615850e-47
Msa0653710	Msa1254170	0.819151	1.350039e-52	-8.615850e-47
Msa0654060	Msa1254170	0.800803	1.214287e-48	-8.615850e-47
Msa0659040	Msa1254170	0.823763	1.162807e-53	-8.615850e-47
Msa0659070	Msa1254170	0.810453	1.143997e-50	-8.615850e-47
Msa0659130	Msa1254170	0.834857	2.351487e-56	-8.615850e-47
Msa0659960	Msa1254170	0.821755	3.411070e-53	-8.615850e-47
Msa0660820	Msa1254170	0.824704	6.986632e-54	-8.615850e-47
Msa0662270	Msa1254170	0.841546	4.451781e-58	-8.615850e-47
Msa0667220	Msa1254170	0.809533	1.805751e-50	-8.615850e-47
Msa0667970	Msa1254170	0.821399	4.122497e-53	-8.615850e-47
Msa0672350	Msa1254170	0.805675	1.190448e-49	-8.615850e-47
Msa0677110	Msa1254170	0.806297	8.808789e-50	-8.615850e-47
Msa0681890	Msa1254170	0.844868	5.789751e-59	-8.615850e-47
Msa0683650	Msa1254170	0.817585	3.055384e-52	-8.615850e-47
Msa0685520	Msa1254170	0.849043	4.164626e-60	-8.615850e-47
Msa0685540	Msa1254170	0.802222	6.214621e-49	-8.615850e-47
Msa0690350	Msa1254170	0.830568	2.729130e-55	-8.615850e-47
Msa0690500	Msa1254170	0.800078	1.705764e-48	-8.615850e-47
Msa0690530	Msa1254170	0.804881	1.745864e-49	-8.615850e-47
Msa0690720	Msa1254170	0.828518	8.598766e-55	-8.615850e-47
Msa0691100	Msa1254170	0.804437	2.161619e-49	-8.615850e-47
Msa0692910	Msa1254170	0.825668	4.134958e-54	-8.615850e-47
Msa0700910	Msa1254170	0.841653	4.171549e-58	-8.615850e-47
Msa0702070	Msa1254170	0.811841	5.721948e-51	-8.615850e-47
Msa0702120	Msa1254170	0.815675	8.184931e-52	-8.615850e-47
Msa0703720	Msa1254170	0.844627	6.722937e-59	-8.615850e-47
Msa0703760	Msa1254170	0.839979	1.145514e-57	-8.615850e-47
Msa0704570	Msa1254170	0.820873	5.450413e-53	-8.615850e-47
Msa0704990	Msa1254170	0.824096	9.710975e-54	-8.615850e-47
Msa0705030	Msa1254170	0.827183	1.801196e-54	-8.615850e-47
Msa0705250	Msa1254170	0.805972	1.031303e-49	-8.615850e-47
Msa0705610	Msa1254170	0.834407	3.050757e-56	-8.615850e-47
Msa0706530	Msa1254170	0.833366	5.559533e-56	-8.615850e-47
Msa0707780	Msa1254170	0.813877	2.048897e-51	-8.615850e-47
Msa0709480	Msa1254170	0.837987	3.756725e-57	-8.615850e-47
Msa0717510	Msa1254170	0.800953	1.131374e-48	-8.615850e-47
Msa0719340	Msa1254170	0.834594	2.738860e-56	-8.615850e-47
Msa0720380	Msa1254170	0.822032	2.942102e-53	-8.615850e-47
Msa0730180	Msa1254170	0.807439	5.052456e-50	-8.615850e-47
Msa0732100	Msa1254170	0.821377	4.169867e-53	-8.615850e-47
Msa0733110	Msa1254170	0.822057	2.904222e-53	-8.615850e-47
Msa0734430	Msa1254170	0.806485	8.040883e-50	-8.615850e-47
Msa0738970	Msa1254170	0.823966	1.042126e-53	-8.615850e-47
Msa0739570	Msa1254170	0.809063	2.276407e-50	-8.615850e-47
Msa0744450	Msa1254170	0.805264	1.451588e-49	-8.615850e-47
Msa0748890	Msa1254170	0.823504	1.336760e-53	-8.615850e-47
Msa0760950	Msa1254170	0.816494	5.372786e-52	-8.615850e-47
Msa0763910	Msa1254170	0.801305	9.585127e-49	-8.615850e-47
Msa0770430	Msa1254170	0.804828	1.791428e-49	-8.615850e-47
Msa0772150	Msa1254170	0.836096	1.143386e-56	-8.615850e-47
Msa0772210	Msa1254170	0.805214	1.487324e-49	-8.615850e-47
Msa0774680	Msa1254170	0.800692	1.278935e-48	-8.615850e-47
Msa0780140	Msa1254170	0.804575	2.022912e-49	-8.615850e-47
Msa0786090	Msa1254170	0.803066	4.163226e-49	-8.615850e-47
Msa0790180	Msa1254170	0.802105	6.569656e-49	-8.615850e-47
Msa0790830	Msa1254170	0.829242	5.744178e-55	-8.615850e-47
Msa0793060	Msa1254170	0.811789	5.873254e-51	-8.615850e-47
Msa0796450	Msa1254170	0.806363	8.531023e-50	-8.615850e-47
Msa0800130	Msa1254170	0.801708	7.927266e-49	-8.615850e-47
Msa0802500	Msa1254170	0.828317	9.615166e-55	-8.615850e-47
Msa0803130	Msa1254170	0.822406	2.409913e-53	-8.615850e-47
Msa0804110	Msa1254170	0.836098	1.141526e-56	-8.615850e-47
Msa0804930	Msa1254170	0.816034	6.809283e-52	-8.615850e-47
Msa0810370	Msa1254170	0.808944	2.414734e-50	-8.615850e-47
Msa0811510	Msa1254170	0.808579	2.889427e-50	-8.615850e-47
Msa0814760	Msa1254170	0.828157	1.050630e-54	-8.615850e-47
Msa0819370	Msa1254170	0.801606	8.316540e-49	-8.615850e-47
Msa0823300	Msa1254170	0.810012	1.424048e-50	-8.615850e-47
Msa0830410	Msa1254170	0.808833	2.550600e-50	-8.615850e-47
Msa0838220	Msa1254170	0.811207	7.859023e-51	-8.615850e-47
Msa0841490	Msa1254170	0.820480	6.708612e-53	-8.615850e-47
Msa0841980	Msa1254170	0.809770	1.605857e-50	-8.615850e-47
Msa0122210	Msa1254170	0.808026	3.791264e-50	-8.615850e-47
Msa0125230	Msa1254170	0.806850	6.733760e-50	-8.615850e-47
Msa0125800	Msa1254170	0.844510	7.231965e-59	-8.615850e-47
Msa0130120	Msa1254170	0.813843	2.084753e-51	-8.615850e-47
Msa0135980	Msa1254170	0.830367	3.056265e-55	-8.615850e-47
Msa0137600	Msa1254170	0.814678	1.363452e-51	-8.615850e-47
Msa0139740	Msa1254170	0.807846	4.140092e-50	-8.615850e-47
Msa0141550	Msa1254170	0.801874	7.329567e-49	-8.615850e-47
Msa0141670	Msa1254170	0.831645	1.484288e-55	-8.615850e-47
Msa0142000	Msa1254170	0.807119	5.906233e-50	-8.615850e-47
Msa0144340	Msa1254170	0.839898	1.202742e-57	-8.615850e-47
Msa0146470	Msa1254170	0.850568	1.560922e-60	-8.615850e-47
Msa0149070	Msa1254170	0.807348	5.280804e-50	-8.615850e-47
Msa0150210	Msa1254170	0.829692	4.466006e-55	-8.615850e-47
Msa0152380	Msa1254170	0.830632	2.632102e-55	-8.615850e-47
Msa0153640	Msa1254170	0.823228	1.550525e-53	-8.615850e-47
Msa0157020	Msa1254170	0.853496	2.299626e-61	-8.615850e-47
Msa0157350	Msa1254170	0.825873	3.696237e-54	-8.615850e-47
Msa0162030	Msa1254170	0.800177	1.628382e-48	-8.615850e-47
Msa0164540	Msa1254170	0.821111	4.801956e-53	-8.615850e-47
Msa0168900	Msa1254170	0.848176	7.242170e-60	-8.615850e-47
Msa0170440	Msa1254170	0.838402	2.937394e-57	-8.615850e-47
Msa0173610	Msa1254170	0.821210	4.557184e-53	-8.615850e-47
Msa0173850	Msa1254170	0.801661	8.104395e-49	-8.615850e-47
Msa0175280	Msa1254170	0.809796	1.584735e-50	-8.615850e-47
Msa0175900	Msa1254170	0.822071	2.881362e-53	-8.615850e-47
Msa0181010	Msa1254170	0.826825	2.192641e-54	-8.615850e-47
Msa0181020	Msa1254170	0.811098	8.295643e-51	-8.615850e-47
Msa0185390	Msa1254170	0.844529	7.143469e-59	-8.615850e-47
Msa0185550	Msa1254170	0.805592	1.239358e-49	-8.615850e-47
Msa0190000	Msa1254170	0.810553	1.088699e-50	-8.615850e-47
Msa0192020	Msa1254170	0.807042	6.130408e-50	-8.615850e-47
Msa0202150	Msa1254170	0.803751	3.001840e-49	-8.615850e-47
Msa0202630	Msa1254170	0.804495	2.101627e-49	-8.615850e-47
Msa0203180	Msa1254170	0.806371	8.499426e-50	-8.615850e-47
Msa0206080	Msa1254170	0.838969	2.096872e-57	-8.615850e-47
Msa0206120	Msa1254170	0.810692	1.015586e-50	-8.615850e-47
Msa0206940	Msa1254170	0.805107	1.565556e-49	-8.615850e-47
Msa0206970	Msa1254170	0.816140	6.446949e-52	-8.615850e-47
Msa0213080	Msa1254170	0.807544	4.799707e-50	-8.615850e-47
Msa0215980	Msa1254170	0.830340	3.103231e-55	-8.615850e-47
Msa0216790	Msa1254170	0.813022	3.158664e-51	-8.615850e-47
Msa0217470	Msa1254170	0.802215	6.235072e-49	-8.615850e-47
Msa0219660	Msa1254170	0.816062	6.709943e-52	-8.615850e-47
Msa0220110	Msa1254170	0.823121	1.642887e-53	-8.615850e-47
Msa0220760	Msa1254170	0.801216	9.997650e-49	-8.615850e-47
Msa0222070	Msa1254170	0.829261	5.682183e-55	-8.615850e-47
Msa0222120	Msa1254170	0.828755	7.538038e-55	-8.615850e-47
Msa0222510	Msa1254170	0.811255	7.670703e-51	-8.615850e-47
Msa0223390	Msa1254170	0.815029	1.139450e-51	-8.615850e-47
Msa0227290	Msa1254170	0.814808	1.276093e-51	-8.615850e-47
Msa0236330	Msa1254170	0.813189	2.902584e-51	-8.615850e-47
Msa1226360	Msa1254170	0.805768	1.138234e-49	-8.615850e-47
Msa1226600	Msa1254170	0.815536	8.793803e-52	-8.615850e-47
Msa1228950	Msa1254170	0.821378	4.168792e-53	-8.615850e-47
Msa1229050	Msa1254170	0.808176	3.522839e-50	-8.615850e-47
Msa1232010	Msa1254170	0.833021	6.772820e-56	-8.615850e-47
Msa1232860	Msa1254170	0.816496	5.366094e-52	-8.615850e-47
Msa1238410	Msa1254170	0.801735	7.825462e-49	-8.615850e-47
Msa1238480	Msa1254170	0.805180	1.512116e-49	-8.615850e-47
Msa1238700	Msa1254170	0.807910	4.013471e-50	-8.615850e-47
Msa1254170	Msa1254190	0.805804	1.118276e-49	-8.615850e-47
Msa1254170	Msa1254200	0.861241	1.178019e-63	-8.615850e-47
Msa1254170	Msa1254210	0.823508	1.333906e-53	-8.615850e-47
Msa1254170	Msa1268370	0.800610	1.329225e-48	-8.615850e-47
Msa1254170	Msa1271490	0.809821	1.565275e-50	-8.615850e-47
Msa1254170	Msa1271510	0.814573	1.438099e-51	-8.615850e-47
Msa1254170	Msa1271600	0.834137	3.565665e-56	-8.615850e-47
Msa1254170	Msa1275290	0.806244	9.037008e-50	-8.615850e-47
Msa1254170	Msa1279700	0.811827	5.762671e-51	-8.615850e-47
Msa1254170	Msa1286910	0.806545	7.809378e-50	-8.615850e-47
Msa1254170	Msa1291400	0.811005	8.691322e-51	-8.615850e-47
Msa1254170	Msa1293530	0.851119	1.092216e-60	-8.615850e-47
Msa1254170	Msa1300880	0.828204	1.024016e-54	-8.615850e-47
Msa1254170	Msa1302150	0.801171	1.021346e-48	-8.615850e-47
Msa1254170	Msa1302160	0.806364	8.526126e-50	-8.615850e-47
Msa1254170	Msa1302170	0.875892	2.153618e-68	-8.615850e-47
Msa1254170	Msa1307370	0.809632	1.719410e-50	-8.615850e-47
Msa1254170	Msa1309100	0.849429	3.252614e-60	-8.615850e-47
Msa1254170	Msa1309360	0.803211	3.883615e-49	-8.615850e-47
Msa1254170	Msa1309910	0.818771	1.647068e-52	-8.615850e-47
Msa1254170	Msa1312730	0.814270	1.677836e-51	-8.615850e-47
Msa1254170	Msa1315980	0.802245	6.149014e-49	-8.615850e-47
Msa1254170	Msa1325980	0.828047	1.116934e-54	-8.615850e-47
Msa1254170	Msa1326000	0.805911	1.061974e-49	-8.615850e-47
Msa1254170	Msa1327040	0.806991	6.285313e-50	-8.615850e-47
Msa1254170	Msa1331900	0.829294	5.579731e-55	-8.615850e-47
Msa1254170	Msa1334650	0.837802	4.191723e-57	-8.615850e-47
Msa1254170	Msa1336320	0.833137	6.337299e-56	-8.615850e-47
Msa1254170	Msa1339250	0.822458	2.343297e-53	-8.615850e-47
Msa1254170	Msa1344430	0.842628	2.302617e-58	-8.615850e-47
Msa1254170	Msa1349360	0.826509	2.609380e-54	-8.615850e-47
Msa1254170	Msa1352290	0.802264	6.093282e-49	-8.615850e-47
Msa1254170	Msa1354040	0.822963	1.788341e-53	-8.615850e-47
Msa1254170	Msa1355860	0.802364	5.810862e-49	-8.615850e-47
Msa1254170	Msa1356200	0.809399	1.929073e-50	-8.615850e-47
Msa1254170	Msa1365210	0.822050	2.915136e-53	-8.615850e-47
Msa1254170	Msa1366620	0.805257	1.457035e-49	-8.615850e-47
Msa1254170	Msa1367810	0.850992	1.186145e-60	-8.615850e-47
Msa1254170	Msa1368730	0.826815	2.204751e-54	-8.615850e-47
Msa1254170	Msa1372560	0.853314	2.593829e-61	-8.615850e-47
Msa1254170	Msa1374810	0.824964	6.067514e-54	-8.615850e-47
Msa1254170	Msa1375400	0.801777	7.670704e-49	-8.615850e-47
Msa1254170	Msa1375630	0.806802	6.890691e-50	-8.615850e-47
Msa1254170	Msa1376530	0.816226	6.166974e-52	-8.615850e-47
Msa1254170	Msa1376640	0.804376	2.225328e-49	-8.615850e-47
Msa1254170	Msa1379070	0.801842	7.438979e-49	-8.615850e-47
Msa1254170	Msa1379090	0.800403	1.464764e-48	-8.615850e-47
Msa1254170	Msa1379980	0.841486	4.615144e-58	-8.615850e-47
Msa1254170	Msa1381130	0.841978	3.422713e-58	-8.615850e-47
Msa1254170	Msa1385940	0.801796	7.603785e-49	-8.615850e-47
Msa1254170	Msa1388850	0.838119	3.474845e-57	-8.615850e-47
Msa1254170	Msa1391430	0.806836	6.777780e-50	-8.615850e-47
Msa1254170	Msa1392680	0.803141	4.015355e-49	-8.615850e-47
Msa1254170	Msa1393200	0.820430	6.888548e-53	-8.615850e-47
Msa1254170	Msa1397110	0.804507	2.089567e-49	-8.615850e-47
Msa1254170	Msa1398740	0.832868	7.395463e-56	-8.615850e-47
Msa1254170	Msa1398840	0.822385	2.436895e-53	-8.615850e-47
Msa1254170	Msa1404370	0.807467	4.983837e-50	-8.615850e-47
Msa1254170	Msa1404790	0.806150	9.457555e-50	-8.615850e-47
Msa1254170	Msa1405770	0.841355	4.995847e-58	-8.615850e-47
Msa1254170	Msa1406230	0.834290	3.265579e-56	-8.615850e-47
Msa1254170	Msa1406550	0.832640	8.421228e-56	-8.615850e-47
Msa1254170	Msa1406880	0.822155	2.755574e-53	-8.615850e-47
Msa1254170	Msa1407710	0.803072	4.150708e-49	-8.615850e-47
Msa1254170	Msa1410170	0.826710	2.336871e-54	-8.615850e-47
Msa1254170	Msa1412520	0.825511	4.505527e-54	-8.615850e-47
Msa1254170	Msa1415250	0.835068	2.080675e-56	-8.615850e-47
Msa1254170	Msa1416460	0.829131	6.111456e-55	-8.615850e-47
Msa1254170	Msa1421810	0.806135	9.528761e-50	-8.615850e-47
Msa1254170	Msa1422490	0.839505	1.522043e-57	-8.615850e-47
Msa1254170	Msa1422500	0.806913	6.529832e-50	-8.615850e-47
Msa1254170	Msa1423190	0.836274	1.029841e-56	-8.615850e-47
Msa1254170	Msa1424240	0.802998	4.299858e-49	-8.615850e-47
Msa1254170	Msa1432470	0.848029	7.948201e-60	-8.615850e-47
Msa1254170	Msa1435050	0.810222	1.283321e-50	-8.615850e-47
Msa1254170	Msa1435470	0.813801	2.129233e-51	-8.615850e-47
Msa1254170	Msa1435910	0.803449	3.467436e-49	-8.615850e-47
Msa1254170	Msa1435980	0.803530	3.336395e-49	-8.615850e-47
Msa1254170	Msa1437150	0.823861	1.102606e-53	-8.615850e-47
Msa1254170	Msa1437320	0.803955	2.723014e-49	-8.615850e-47
Msa1254170	Msa1437690	0.802198	6.284866e-49	-8.615850e-47
Msa1254170	Msa1439800	0.821487	3.932885e-53	-8.615850e-47
Msa1254170	Msa1440180	0.806656	7.398830e-50	-8.615850e-47
Msa1254170	Msa1449600	0.813333	2.698622e-51	-8.615850e-47
Msa1254170	Msa1449680	0.825311	5.023151e-54	-8.615850e-47
Msa1254170	Msa1449740	0.804662	1.939534e-49	-8.615850e-47
Msa1254170	Msa1451840	0.819590	1.072412e-52	-8.615850e-47
Msa1254170	Msa1458330	0.844624	6.735465e-59	-8.615850e-47
Msa1254170	Msa1458920	0.821590	3.724649e-53	-8.615850e-47
Msa1254170	Msa1464800	0.808239	3.414896e-50	-8.615850e-47
Msa0367370	Msa1254170	0.808999	2.350488e-50	-8.615850e-47
Msa0368430	Msa1254170	0.843889	1.061106e-58	-8.615850e-47
Msa0369780	Msa1254170	0.814416	1.558212e-51	-8.615850e-47
Msa0371610	Msa1254170	0.810314	1.226118e-50	-8.615850e-47
Msa0375430	Msa1254170	0.852952	3.293094e-61	-8.615850e-47
Msa0377460	Msa1254170	0.823660	1.228748e-53	-8.615850e-47
Msa0378000	Msa1254170	0.804031	2.626147e-49	-8.615850e-47
Msa0379110	Msa1254170	0.831567	1.551206e-55	-8.615850e-47
Msa0379390	Msa1254170	0.808528	2.963678e-50	-8.615850e-47
Msa0379450	Msa1254170	0.813167	2.935556e-51	-8.615850e-47
Msa0379900	Msa1254170	0.814072	1.856276e-51	-8.615850e-47
Msa0380060	Msa1254170	0.840315	9.365226e-58	-8.615850e-47
Msa0380420	Msa1254170	0.810103	1.361578e-50	-8.615850e-47
Msa0380430	Msa1254170	0.802270	6.075702e-49	-8.615850e-47
Msa0380520	Msa1254170	0.822794	1.957692e-53	-8.615850e-47
Msa0382290	Msa1254170	0.819058	1.417151e-52	-8.615850e-47
Msa0382500	Msa1254170	0.822810	1.940511e-53	-8.615850e-47
Msa0393540	Msa1254170	0.820951	5.229111e-53	-8.615850e-47
Msa0399180	Msa1254170	0.835423	1.692506e-56	-8.615850e-47
Msa0401370	Msa1254170	0.823388	1.422603e-53	-8.615850e-47
Msa0404870	Msa1254170	0.814497	1.495208e-51	-8.615850e-47
Msa0413740	Msa1254170	0.805419	1.347089e-49	-8.615850e-47
Msa0415050	Msa1254170	0.821915	3.132570e-53	-8.615850e-47
Msa0415460	Msa1254170	0.852491	4.459006e-61	-8.615850e-47
Msa0415930	Msa1254170	0.853584	2.170082e-61	-8.615850e-47
Msa0417150	Msa1254170	0.809012	2.335210e-50	-8.615850e-47
Msa0417630	Msa1254170	0.843867	1.076069e-58	-8.615850e-47
Msa0420070	Msa1254170	0.821348	4.234999e-53	-8.615850e-47
Msa0420080	Msa1254170	0.817454	3.269700e-52	-8.615850e-47
Msa0421800	Msa1254170	0.849429	3.252214e-60	-8.615850e-47
Msa0423110	Msa1254170	0.823976	1.036528e-53	-8.615850e-47
Msa0426480	Msa1254170	0.810215	1.287808e-50	-8.615850e-47
Msa0426860	Msa1254170	0.805656	1.201283e-49	-8.615850e-47
Msa0426890	Msa1254170	0.800490	1.406673e-48	-8.615850e-47
Msa0427050	Msa1254170	0.815611	8.460379e-52	-8.615850e-47
Msa0429270	Msa1254170	0.806432	8.248263e-50	-8.615850e-47
Msa0430020	Msa1254170	0.843985	1.000639e-58	-8.615850e-47
Msa0432680	Msa1254170	0.834253	3.334702e-56	-8.615850e-47
Msa0436450	Msa1254170	0.831698	1.440055e-55	-8.615850e-47
Msa0444340	Msa1254170	0.829461	5.082780e-55	-8.615850e-47
Msa0458110	Msa1254170	0.804577	2.020617e-49	-8.615850e-47
Msa0458790	Msa1254170	0.814746	1.317095e-51	-8.615850e-47
Msa0462120	Msa1254170	0.805232	1.474299e-49	-8.615850e-47
Msa0463140	Msa1254170	0.806763	7.022792e-50	-8.615850e-47
Msa0463540	Msa1254170	0.820020	8.553074e-53	-8.615850e-47
Msa0463580	Msa1254170	0.807486	4.937797e-50	-8.615850e-47
Msa0463990	Msa1254170	0.800632	1.315816e-48	-8.615850e-47
Msa0465860	Msa1254170	0.808549	2.933153e-50	-8.615850e-47
Msa0466070	Msa1254170	0.805577	1.248226e-49	-8.615850e-47
Msa0466340	Msa1254170	0.803446	3.473204e-49	-8.615850e-47
Msa0466830	Msa1254170	0.823166	1.603294e-53	-8.615850e-47
Msa0467800	Msa1254170	0.846583	1.982705e-59	-8.615850e-47
Msa0467880	Msa1254170	0.855431	6.339434e-62	-8.615850e-47
Msa0467980	Msa1254170	0.819292	1.253876e-52	-8.615850e-47
Msa0471890	Msa1254170	0.807715	4.413712e-50	-8.615850e-47
Msa0472270	Msa1254170	0.803245	3.822293e-49	-8.615850e-47
Msa0473320	Msa1254170	0.813380	2.635670e-51	-8.615850e-47
Msa0473450	Msa1254170	0.811287	7.550831e-51	-8.615850e-47
Msa0475130	Msa1254170	0.809437	1.893346e-50	-8.615850e-47
Msa0476150	Msa1254170	0.803643	3.160359e-49	-8.615850e-47
Msa0476180	Msa1254170	0.812103	5.017826e-51	-8.615850e-47
Msa0480150	Msa1254170	0.850322	1.829926e-60	-8.615850e-47
Msa0482580	Msa1254170	0.846460	2.142159e-59	-8.615850e-47
Msa0985430	Msa1254170	0.818067	2.378360e-52	-8.615850e-47
Msa0990520	Msa1254170	0.815459	9.145208e-52	-8.615850e-47
Msa0992570	Msa1254170	0.840734	7.274585e-58	-8.615850e-47
Msa0992590	Msa1254170	0.828235	1.006429e-54	-8.615850e-47
Msa1001780	Msa1254170	0.817608	3.018912e-52	-8.615850e-47
Msa1002040	Msa1254170	0.818357	2.045156e-52	-8.615850e-47
Msa1002980	Msa1254170	0.823412	1.404681e-53	-8.615850e-47
Msa1013510	Msa1254170	0.804946	1.692112e-49	-8.615850e-47
Msa1022310	Msa1254170	0.824144	9.463516e-54	-8.615850e-47
Msa1024140	Msa1254170	0.801150	1.031406e-48	-8.615850e-47
Msa1024580	Msa1254170	0.811317	7.437495e-51	-8.615850e-47
Msa1027790	Msa1254170	0.838614	2.589407e-57	-8.615850e-47
Msa1028460	Msa1254170	0.800092	1.694723e-48	-8.615850e-47
Msa1029320	Msa1254170	0.826997	1.995586e-54	-8.615850e-47
Msa1030280	Msa1254170	0.808106	3.645604e-50	-8.615850e-47
Msa1032140	Msa1254170	0.814925	1.201879e-51	-8.615850e-47
Msa1033120	Msa1254170	0.806288	8.847685e-50	-8.615850e-47
Msa1035090	Msa1254170	0.814422	1.553349e-51	-8.615850e-47
Msa1044040	Msa1254170	0.840678	7.526364e-58	-8.615850e-47
Msa1045440	Msa1254170	0.836614	8.439875e-57	-8.615850e-47
Msa1061180	Msa1254170	0.831721	1.421293e-55	-8.615850e-47
Msa1061310	Msa1254170	0.827383	1.612779e-54	-8.615850e-47
Msa1067430	Msa1254170	0.838559	2.676782e-57	-8.615850e-47
Msa1070900	Msa1254170	0.823364	1.441573e-53	-8.615850e-47
Msa1072080	Msa1254170	0.805727	1.161104e-49	-8.615850e-47
Msa1074630	Msa1254170	0.830646	2.611778e-55	-8.615850e-47
Msa1081850	Msa1254170	0.802948	4.403800e-49	-8.615850e-47
Msa1084150	Msa1254170	0.804597	2.001374e-49	-8.615850e-47
Msa1084490	Msa1254170	0.818800	1.622266e-52	-8.615850e-47
Msa1085700	Msa1254170	0.813357	2.666112e-51	-8.615850e-47
Msa1090230	Msa1254170	0.816532	5.269554e-52	-8.615850e-47
Msa1106560	Msa1254170	0.831013	2.122872e-55	-8.615850e-47
Msa1106580	Msa1254170	0.806690	7.277988e-50	-8.615850e-47
Msa1106760	Msa1254170	0.804680	1.923103e-49	-8.615850e-47
Msa0242290	Msa1254170	0.803453	3.461363e-49	-8.615850e-47
Msa0246300	Msa1254170	0.810875	9.271191e-51	-8.615850e-47
Msa0247310	Msa1254170	0.831246	1.861485e-55	-8.615850e-47
Msa0249270	Msa1254170	0.817163	3.803387e-52	-8.615850e-47
Msa0250520	Msa1254170	0.830210	3.338033e-55	-8.615850e-47
Msa0251110	Msa1254170	0.815672	8.197614e-52	-8.615850e-47
Msa0253410	Msa1254170	0.812441	4.232535e-51	-8.615850e-47
Msa0257130	Msa1254170	0.809058	2.282426e-50	-8.615850e-47
Msa0259330	Msa1254170	0.805050	1.609903e-49	-8.615850e-47
Msa0261440	Msa1254170	0.875062	4.143139e-68	-8.615850e-47
Msa0263430	Msa1254170	0.841202	5.481690e-58	-8.615850e-47
Msa0263620	Msa1254170	0.826996	1.996416e-54	-8.615850e-47
Msa0265780	Msa1254170	0.820734	5.864282e-53	-8.615850e-47
Msa0269830	Msa1254170	0.834981	2.188922e-56	-8.615850e-47
Msa0274780	Msa1254170	0.803962	2.713497e-49	-8.615850e-47
Msa0278720	Msa1254170	0.813518	2.457571e-51	-8.615850e-47
Msa0280120	Msa1254170	0.806529	7.871292e-50	-8.615850e-47
Msa0280140	Msa1254170	0.828012	1.138610e-54	-8.615850e-47
Msa0284260	Msa1254170	0.820947	5.239937e-53	-8.615850e-47
Msa0284870	Msa1254170	0.815311	9.863674e-52	-8.615850e-47
Msa0291040	Msa1254170	0.806094	9.717772e-50	-8.615850e-47
Msa0295240	Msa1254170	0.837976	3.782517e-57	-8.615850e-47
Msa0296000	Msa1254170	0.817104	3.920836e-52	-8.615850e-47
Msa0296610	Msa1254170	0.823143	1.623579e-53	-8.615850e-47
Msa0301020	Msa1254170	0.837364	5.430313e-57	-8.615850e-47
Msa0301460	Msa1254170	0.830788	2.410327e-55	-8.615850e-47
Msa0301800	Msa1254170	0.833899	4.090889e-56	-8.615850e-47
Msa0302660	Msa1254170	0.807915	4.002468e-50	-8.615850e-47
Msa0303780	Msa1254170	0.815152	1.070290e-51	-8.615850e-47
Msa0304870	Msa1254170	0.802134	6.480068e-49	-8.615850e-47
Msa0307460	Msa1254170	0.803508	3.370705e-49	-8.615850e-47
Msa0308430	Msa1254170	0.812761	3.603234e-51	-8.615850e-47
Msa0313800	Msa1254170	0.807841	4.149556e-50	-8.615850e-47
Msa0315480	Msa1254170	0.801691	7.989350e-49	-8.615850e-47
Msa0316330	Msa1254170	0.820105	8.176100e-53	-8.615850e-47
Msa0322970	Msa1254170	0.806132	9.543086e-50	-8.615850e-47
Msa0334780	Msa1254170	0.803665	3.128153e-49	-8.615850e-47
Msa0334980	Msa1254170	0.823687	1.211503e-53	-8.615850e-47
Msa0338570	Msa1254170	0.812706	3.704480e-51	-8.615850e-47
Msa0338900	Msa1254170	0.808533	2.956211e-50	-8.615850e-47
Msa0341260	Msa1254170	0.801715	7.899418e-49	-8.615850e-47
Msa0342620	Msa1254170	0.834777	2.463699e-56	-8.615850e-47
Msa0349000	Msa1254170	0.812689	3.735723e-51	-8.615850e-47
Msa0349450	Msa1254170	0.827699	1.354259e-54	-8.615850e-47
Msa0358230	Msa1254170	0.827420	1.580100e-54	-8.615850e-47
Msa0358710	Msa1254170	0.817913	2.576486e-52	-8.615850e-47
Msa0362840	Msa1254170	0.822786	1.965600e-53	-8.615850e-47
Msa1112610	Msa1254170	0.841589	4.335945e-58	-8.615850e-47
Msa1122510	Msa1254170	0.805602	1.233109e-49	-8.615850e-47
Msa1123340	Msa1254170	0.801930	7.137422e-49	-8.615850e-47
Msa1125780	Msa1254170	0.819325	1.232494e-52	-8.615850e-47
Msa1125950	Msa1254170	0.822503	2.288222e-53	-8.615850e-47
Msa1126310	Msa1254170	0.801959	7.039880e-49	-8.615850e-47
Msa1128350	Msa1254170	0.803609	3.212986e-49	-8.615850e-47
Msa1132820	Msa1254170	0.826022	3.406669e-54	-8.615850e-47
Msa1137800	Msa1254170	0.806981	6.317099e-50	-8.615850e-47
Msa1138600	Msa1254170	0.812633	3.842774e-51	-8.615850e-47
Msa1140940	Msa1254170	0.800769	1.233841e-48	-8.615850e-47
Msa1145370	Msa1254170	0.817474	3.237364e-52	-8.615850e-47
Msa1149760	Msa1254170	0.830209	3.340180e-55	-8.615850e-47
Msa1149960	Msa1254170	0.820037	8.474548e-53	-8.615850e-47
Msa1157160	Msa1254170	0.836902	7.125287e-57	-8.615850e-47
Msa1161160	Msa1254170	0.806189	9.282773e-50	-8.615850e-47
Msa1166180	Msa1254170	0.831199	1.911169e-55	-8.615850e-47
Msa1166280	Msa1254170	0.825215	5.292284e-54	-8.615850e-47
Msa1166970	Msa1254170	0.802682	4.995348e-49	-8.615850e-47
Msa1171340	Msa1254170	0.826206	3.079982e-54	-8.615850e-47
Msa1173410	Msa1254170	0.819794	9.632543e-53	-8.615850e-47
Msa1175750	Msa1254170	0.814293	1.658376e-51	-8.615850e-47
Msa1178970	Msa1254170	0.812936	3.298906e-51	-8.615850e-47
Msa1180410	Msa1254170	0.820247	7.585898e-53	-8.615850e-47
Msa1183390	Msa1254170	0.802602	5.188977e-49	-8.615850e-47
Msa1183610	Msa1254170	0.826174	3.135803e-54	-8.615850e-47
Msa1183760	Msa1254170	0.836139	1.114992e-56	-8.615850e-47
Msa1184580	Msa1254170	0.815697	8.095741e-52	-8.615850e-47
Msa1186210	Msa1254170	0.802680	5.000596e-49	-8.615850e-47
Msa1190910	Msa1254170	0.830518	2.806993e-55	-8.615850e-47
Msa1198420	Msa1254170	0.803461	3.447490e-49	-8.615850e-47
Msa1200920	Msa1254170	0.830984	2.157869e-55	-8.615850e-47
Msa1200930	Msa1254170	0.849608	2.899409e-60	-8.615850e-47
Msa1208750	Msa1254170	0.829986	3.786694e-55	-8.615850e-47
Msa1213540	Msa1254170	0.813173	2.926217e-51	-8.615850e-47
Msa1214900	Msa1254170	0.846218	2.493361e-59	-8.615850e-47
Msa1215210	Msa1254170	0.841909	3.568960e-58	-8.615850e-47
Msa1215530	Msa1254170	0.826210	3.073605e-54	-8.615850e-47
Msa1218720	Msa1254170	0.816434	5.542345e-52	-8.615850e-47
Msa1219250	Msa1254170	0.835094	2.049265e-56	-8.615850e-47
Msa1220740	Msa1254170	0.836725	7.906673e-57	-8.615850e-47
Msa1221260	Msa1254170	0.823668	1.223485e-53	-8.615850e-47
Msa1222390	Msa1254170	0.822882	1.867128e-53	-8.615850e-47
Msa0482960	Msa1254170	0.800727	1.258640e-48	-8.615850e-47
Msa0485280	Msa1254170	0.818732	1.681066e-52	-8.615850e-47
Msa0486200	Msa1254170	0.805893	1.071265e-49	-8.615850e-47
Msa0487560	Msa1254170	0.802108	6.558982e-49	-8.615850e-47
Msa0487620	Msa1254170	0.805483	1.306467e-49	-8.615850e-47
Msa0488830	Msa1254170	0.804215	2.404143e-49	-8.615850e-47
Msa0489620	Msa1254170	0.809103	2.232580e-50	-8.615850e-47
Msa0503120	Msa1254170	0.800959	1.128558e-48	-8.615850e-47
Msa0504740	Msa1254170	0.823037	1.718197e-53	-8.615850e-47
Msa0505390	Msa1254170	0.802353	5.841360e-49	-8.615850e-47
Msa0509540	Msa1254170	0.816186	6.296401e-52	-8.615850e-47
Msa0510230	Msa1254170	0.823019	1.734944e-53	-8.615850e-47
Msa0512130	Msa1254170	0.811238	7.738609e-51	-8.615850e-47
Msa0514260	Msa1254170	0.849120	3.964522e-60	-8.615850e-47
Msa0517400	Msa1254170	0.821982	3.022350e-53	-8.615850e-47
Msa0519200	Msa1254170	0.854244	1.400840e-61	-8.615850e-47
Msa0520730	Msa1254170	0.800121	1.672206e-48	-8.615850e-47
Msa0524020	Msa1254170	0.823411	1.405209e-53	-8.615850e-47
Msa0526130	Msa1254170	0.840673	7.545151e-58	-8.615850e-47
Msa0528870	Msa1254170	0.803856	2.854909e-49	-8.615850e-47
Msa0532840	Msa1254170	0.815209	1.039560e-51	-8.615850e-47
Msa0533010	Msa1254170	0.810183	1.308404e-50	-8.615850e-47
Msa0538570	Msa1254170	0.814402	1.568958e-51	-8.615850e-47
Msa0539320	Msa1254170	0.827939	1.185484e-54	-8.615850e-47
Msa0542040	Msa1254170	0.830111	3.530274e-55	-8.615850e-47
Msa0546740	Msa1254170	0.835711	1.431584e-56	-8.615850e-47
Msa0547050	Msa1254170	0.827157	1.826301e-54	-8.615850e-47
Msa0550720	Msa1254170	0.814722	1.333168e-51	-8.615850e-47
Msa0552670	Msa1254170	0.819769	9.760954e-53	-8.615850e-47
Msa0555940	Msa1254170	0.800303	1.535070e-48	-8.615850e-47
Msa0555980	Msa1254170	0.812476	4.159481e-51	-8.615850e-47
Msa0558890	Msa1254170	0.808793	2.601294e-50	-8.615850e-47
Msa0560200	Msa1254170	0.839286	1.734944e-57	-8.615850e-47
Msa0567290	Msa1254170	0.820545	6.481495e-53	-8.615850e-47
Msa0576150	Msa1254170	0.805050	1.609213e-49	-8.615850e-47
Msa0576420	Msa1254170	0.832810	7.644986e-56	-8.615850e-47
Msa0579610	Msa1254170	0.815728	7.966368e-52	-8.615850e-47
Msa0581340	Msa1254170	0.819948	8.880191e-53	-8.615850e-47
Msa0587900	Msa1254170	0.815385	9.499178e-52	-8.615850e-47
Msa0589290	Msa1254170	0.815379	9.526673e-52	-8.615850e-47
Msa0594390	Msa1254170	0.810851	9.383483e-51	-8.615850e-47
Msa0595780	Msa1254170	0.817705	2.870460e-52	-8.615850e-47
Msa0596430	Msa1254170	0.805094	1.575441e-49	-8.615850e-47
Msa0598250	Msa1254170	0.807604	4.660423e-50	-8.615850e-47
Msa0600390	Msa1254170	0.857435	1.635006e-62	-8.615850e-47
Msa0601780	Msa1254170	0.824867	6.397215e-54	-8.615850e-47
Msa0602670	Msa1254170	0.800432	1.445491e-48	-8.615850e-47
Msa0844100	Msa1254170	0.813929	1.995973e-51	-8.615850e-47
Msa0851740	Msa1254170	0.815157	1.067382e-51	-8.615850e-47
Msa0851870	Msa1254170	0.818946	1.503492e-52	-8.615850e-47
Msa0855490	Msa1254170	0.812394	4.334507e-51	-8.615850e-47
Msa0859390	Msa1254170	0.825304	5.043868e-54	-8.615850e-47
Msa0862240	Msa1254170	0.822491	2.302973e-53	-8.615850e-47
Msa0863250	Msa1254170	0.800013	1.758720e-48	-8.615850e-47
Msa0881050	Msa1254170	0.824271	8.836788e-54	-8.615850e-47
Msa0884730	Msa1254170	0.803985	2.684625e-49	-8.615850e-47
Msa0893390	Msa1254170	0.821597	3.709428e-53	-8.615850e-47
Msa0899140	Msa1254170	0.823497	1.341564e-53	-8.615850e-47
Msa0900320	Msa1254170	0.833122	6.392423e-56	-8.615850e-47
Msa0906720	Msa1254170	0.804481	2.116274e-49	-8.615850e-47
Msa0910650	Msa1254170	0.837383	5.369054e-57	-8.615850e-47
Msa0925160	Msa1254170	0.817719	2.850677e-52	-8.615850e-47
Msa0930160	Msa1254170	0.834301	3.243678e-56	-8.615850e-47
Msa0930330	Msa1254170	0.818936	1.511175e-52	-8.615850e-47
Msa0931480	Msa1254170	0.815510	8.910560e-52	-8.615850e-47
Msa0931730	Msa1254170	0.805727	1.160888e-49	-8.615850e-47
Msa0934830	Msa1254170	0.806314	8.734732e-50	-8.615850e-47
Msa0935730	Msa1254170	0.803149	4.001258e-49	-8.615850e-47
Msa0938970	Msa1254170	0.806117	9.610538e-50	-8.615850e-47
Msa0946650	Msa1254170	0.819791	9.647224e-53	-8.615850e-47
Msa0955260	Msa1254170	0.829680	4.494941e-55	-8.615850e-47
Msa0958020	Msa1254170	0.809521	1.815852e-50	-8.615850e-47
Msa0959970	Msa1254170	0.800909	1.155112e-48	-8.615850e-47
Msa0970090	Msa1254170	0.807396	5.158522e-50	-8.615850e-47
Msa0971860	Msa1254170	0.811685	6.186151e-51	-8.615850e-47
Msa0972730	Msa1254170	0.827726	1.334377e-54	-8.615850e-47
Msa0978000	Msa1254170	0.820118	8.119553e-53	-8.615850e-47

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1254170	MtrunA17_Chr8g0370711	86.224	392	16	1	1	392	1	354	0.0	692
Msa1254170	MtrunA17_Chr8g0370721	81.378	392	35	1	1	392	1	354	0.0	657
Msa1254170	MtrunA17_Chr3g0145171	68.367	392	86	1	1	392	1	354	0.0	552
Msa1254170	MtrunA17_Chr3g0145181	63.077	390	99	6	7	392	5	353	7.09e-169	476
Msa1254170	MtrunA17_Chr3g0145201	62.857	350	86	5	47	392	679	988	2.83e-145	437
Msa1254170	MtrunA17_Chr4g0064781	44.474	380	165	4	13	392	15	348	1.04e-110	328
Msa1254170	MtrunA17_Chr5g0423251	34.817	382	201	6	14	392	12	348	8.89e-69	221
Msa1254170	MtrunA17_Chr3g0087031	35.876	354	185	5	14	367	23	334	3.42e-67	217
Msa1254170	MtrunA17_Chr5g0421041	34.121	381	203	5	14	392	12	346	5.20e-67	216
Msa1254170	MtrunA17_Chr5g0423191	36.337	344	176	4	51	392	46	348	7.58e-66	213
Msa1254170	MtrunA17_Chr2g0314401	33.161	386	204	6	14	392	16	354	1.32e-65	213
Msa1254170	MtrunA17_Chr2g0296371	34.635	384	201	8	15	392	17	356	1.40e-65	213
Msa1254170	MtrunA17_Chr7g0239111	33.071	381	210	6	14	392	19	356	1.34e-64	210
Msa1254170	MtrunA17_Chr8g0375671	32.995	394	216	6	3	392	8	357	1.21e-63	207
Msa1254170	MtrunA17_Chr2g0314391	33.854	384	204	6	14	392	35	373	1.65e-63	207
Msa1254170	MtrunA17_Chr5g0420981	33.430	344	187	4	51	392	52	355	1.94e-62	204
Msa1254170	MtrunA17_Chr7g0239121	31.152	382	217	7	14	392	15	353	2.51e-62	204
Msa1254170	MtrunA17_Chr7g0239101	32.653	343	188	5	52	392	55	356	7.53e-62	203
Msa1254170	MtrunA17_Chr7g0242551	33.956	321	170	3	50	366	52	334	2.63e-61	201
Msa1254170	MtrunA17_Chr8g0375681	35.806	310	158	3	85	392	15	285	6.34e-61	198
Msa1254170	MtrunA17_Chr5g0421011	33.430	344	186	4	51	392	46	348	7.65e-61	200
Msa1254170	MtrunA17_Chr5g0421101	32.199	382	211	6	14	392	12	348	9.63e-61	200
Msa1254170	MtrunA17_Chr5g0423201	33.913	345	184	5	51	392	46	349	1.02e-60	200
Msa1254170	MtrunA17_Chr8g0375601	31.937	382	216	5	15	392	11	352	1.15e-60	200
Msa1254170	MtrunA17_Chr7g0239821	31.977	344	191	4	51	392	63	365	1.68e-60	199
Msa1254170	MtrunA17_Chr2g0314381	31.510	384	214	6	14	392	41	380	9.62e-60	198
Msa1254170	MtrunA17_Chr8g0375571	32.292	384	212	6	14	392	10	350	1.16e-59	197
Msa1254170	MtrunA17_Chr7g0232161	40.789	228	132	2	50	277	58	282	1.42e-59	196
Msa1254170	MtrunA17_Chr4g0006371	32.622	328	179	3	46	369	56	345	5.10e-59	196
Msa1254170	MtrunA17_Chr5g0420941	32.727	385	209	6	12	392	8	346	6.83e-59	195
Msa1254170	MtrunA17_Chr8g0365241	31.977	344	192	4	51	392	56	359	9.79e-59	195
Msa1254170	MtrunA17_Chr5g0423221	32.948	346	184	4	52	392	71	373	2.35e-58	194
Msa1254170	MtrunA17_Chr8g0375701	34.006	347	177	6	52	392	55	355	1.06e-57	192
Msa1254170	MtrunA17_Chr3g0113641	31.831	355	199	4	15	366	15	329	1.85e-57	191
Msa1254170	MtrunA17_Chr5g0420951	32.849	344	189	4	51	392	52	355	4.63e-57	190
Msa1254170	MtrunA17_Chr5g0420901	30.928	388	218	6	9	392	6	347	2.03e-56	189
Msa1254170	MtrunA17_Chr1g0162191	32.288	319	177	2	51	369	46	325	4.06e-56	188
Msa1254170	MtrunA17_Chr7g0239071	33.871	310	164	3	85	392	31	301	1.61e-55	185
Msa1254170	MtrunA17_Chr5g0421091	31.688	385	214	5	12	392	8	347	2.14e-55	186
Msa1254170	MtrunA17_Chr5g0437181	30.618	356	202	5	15	366	14	328	1.93e-54	183
Msa1254170	MtrunA17_Chr4g0064771	35.593	295	100	2	90	384	1	205	2.60e-53	176
Msa1254170	MtrunA17_Chr5g0424201	32.099	324	174	6	50	370	42	322	1.16e-52	178
Msa1254170	MtrunA17_Chr5g0420721	35.664	286	143	3	109	392	4	250	9.85e-52	173
Msa1254170	MtrunA17_Chr5g0398291	29.459	370	205	8	12	368	5	331	2.27e-51	175
Msa1254170	MtrunA17_Chr3g0114861	31.737	334	170	8	52	379	40	321	9.08e-51	173
Msa1254170	MtrunA17_Chr3g0128001	33.333	333	172	6	51	382	37	320	3.26e-50	172
Msa1254170	MtrunA17_Chr2g0314371	35.052	291	154	5	14	277	16	298	9.62e-50	171
Msa1254170	MtrunA17_Chr3g0109041	32.861	353	179	10	52	390	42	350	7.45e-48	166
Msa1254170	MtrunA17_Chr5g0423211	30.058	346	195	6	52	392	47	350	4.58e-47	164
Msa1254170	MtrunA17_Chr1g0179801	30.874	366	196	9	13	366	25	345	5.22e-46	162
Msa1254170	MtrunA17_Chr5g0424211	30.599	317	172	6	52	363	42	315	1.50e-45	159
Msa1254170	MtrunA17_Chr2g0332191	32.822	326	162	9	52	369	52	328	4.90e-44	156
Msa1254170	MtrunA17_Chr8g0345831	28.955	335	184	8	52	382	42	326	1.50e-41	149
Msa1254170	MtrunA17_Chr7g0265221	30.448	335	176	8	46	366	61	352	2.18e-41	150
Msa1254170	MtrunA17_Chr3g0102041	27.964	329	192	8	51	376	38	324	9.31e-41	147
Msa1254170	MtrunA17_Chr5g0412671	30.398	352	178	10	52	387	38	338	9.94e-41	147
Msa1254170	MtrunA17_Chr3g0114871	34.322	236	141	7	48	277	38	265	2.06e-40	144
Msa1254170	MtrunA17_Chr6g0455481	28.612	353	195	9	40	385	30	332	1.12e-39	144
Msa1254170	MtrunA17_Chr7g0239091	28.779	344	192	6	51	392	159	451	1.40e-39	146
Msa1254170	MtrunA17_Chr8g0371931	28.060	335	192	8	51	382	38	326	2.05e-39	144
Msa1254170	MtrunA17_Chr2g0289341	28.280	343	191	9	51	386	3	297	3.28e-39	142
Msa1254170	MtrunA17_Chr5g0412651	29.132	357	176	10	52	387	38	338	5.75e-39	142
Msa1254170	MtrunA17_Chr5g0405411	26.158	367	219	8	19	382	9	326	2.17e-38	141
Msa1254170	MtrunA17_Chr3g0121141	27.907	344	196	9	53	391	5	301	6.97e-38	139
Msa1254170	MtrunA17_Chr1g0162361	32.229	332	164	10	52	368	27	312	1.02e-37	139
Msa1254170	MtrunA17_Chr7g0250511	28.616	318	183	6	52	367	49	324	1.93e-37	138
Msa1254170	MtrunA17_Chr4g0045471	30.499	341	172	12	52	370	26	323	2.35e-37	138
Msa1254170	MtrunA17_Chr4g0050031	28.080	349	199	8	52	392	62	366	3.05e-37	138
Msa1254170	MtrunA17_Chr4g0045441	31.454	337	169	12	52	368	26	320	3.98e-37	137
Msa1254170	MtrunA17_Chr5g0412681	28.613	346	179	9	52	385	33	322	5.88e-37	137
Msa1254170	MtrunA17_Chr8g0371921	27.164	335	195	8	51	382	38	326	9.97e-37	137
Msa1254170	MtrunA17_Chr3g0125201	27.653	311	175	4	52	358	3	267	1.97e-36	134
Msa1254170	MtrunA17_Chr4g0045451	30.636	346	177	12	52	377	26	328	3.35e-36	135
Msa1254170	MtrunA17_Chr8g0351101	29.915	351	196	8	50	390	52	362	3.79e-36	135
Msa1254170	MtrunA17_Chr4g0045411	29.730	333	177	11	52	369	30	320	9.09e-36	134
Msa1254170	MtrunA17_Chr3g0126741	27.778	324	184	8	52	370	59	337	2.42e-35	133
Msa1254170	MtrunA17_Chr5g0426891	27.794	349	198	9	27	369	17	317	1.25e-34	130
Msa1254170	MtrunA17_Chr6g0474391	28.852	357	195	10	49	390	61	373	1.51e-34	131
Msa1254170	MtrunA17_Chr1g0162321	29.446	343	172	11	51	368	68	365	2.67e-34	131
Msa1254170	MtrunA17_Chr1g0187831	27.247	356	199	9	48	391	66	373	3.13e-34	130
Msa1254170	MtrunA17_Chr2g0311921	28.923	325	179	10	52	369	54	333	3.18e-34	130
Msa1254170	MtrunA17_Chr2g0311761	28.571	322	180	8	52	367	68	345	7.59e-34	129
Msa1254170	MtrunA17_Chr1g0162351	29.446	343	172	11	51	368	68	365	1.31e-33	129
Msa1254170	MtrunA17_Chr1g0184101	28.035	346	202	7	27	370	15	315	2.75e-33	127
Msa1254170	MtrunA17_Chr1g0184161	26.480	321	191	6	52	370	38	315	3.24e-33	127
Msa1254170	MtrunA17_Chr1g0184121	27.987	318	185	6	52	367	37	312	6.20e-33	126
Msa1254170	MtrunA17_Chr2g0311701	29.305	331	181	7	46	367	63	349	1.18e-32	126
Msa1254170	MtrunA17_Chr8g0354261	28.492	358	200	10	46	392	62	374	2.96e-32	125
Msa1254170	MtrunA17_Chr1g0184151	26.480	321	191	6	52	370	38	315	3.44e-32	124
Msa1254170	MtrunA17_Chr2g0311681	28.829	333	180	8	46	367	57	343	7.35e-32	124
Msa1254170	MtrunA17_Chr5g0439011	26.861	309	176	7	53	358	6	267	8.39e-32	122
Msa1254170	MtrunA17_Chr7g0220011	26.807	332	190	7	52	377	39	323	8.81e-32	122
Msa1254170	MtrunA17_Chr8g0336781	28.977	352	193	13	52	392	95	400	9.34e-32	124
Msa1254170	MtrunA17_Chr1g0204181	28.242	347	196	9	49	385	56	359	2.71e-31	122
Msa1254170	MtrunA17_Chr8g0336851	26.857	350	202	9	52	392	60	364	3.01e-31	122
Msa1254170	MtrunA17_Chr1g0184111	26.844	339	202	7	52	388	37	331	3.66e-31	121
Msa1254170	MtrunA17_Chr8g0354241	28.212	358	201	10	46	392	62	374	4.74e-31	122
Msa1254170	MtrunA17_Chr1g0184241	28.035	346	193	10	27	367	46	340	5.04e-31	121
Msa1254170	MtrunA17_Chr7g0235951	27.654	358	201	12	47	392	62	373	7.02e-31	121
Msa1254170	MtrunA17_Chr1g0167951	26.629	353	205	10	48	392	49	355	1.03e-30	120
Msa1254170	MtrunA17_Chr1g0187821	26.149	348	197	11	46	383	61	358	1.06e-30	120
Msa1254170	MtrunA17_Chr8g0336861	27.193	342	192	12	52	384	60	353	2.10e-30	119
Msa1254170	MtrunA17_Chr8g0336761	27.066	351	200	10	52	392	60	364	2.61e-30	119
Msa1254170	MtrunA17_Chr6g0472861	25.948	343	197	11	46	380	64	357	2.79e-30	119
Msa1254170	MtrunA17_Chr4g0011311	32.618	233	149	5	48	278	63	289	2.92e-30	118
Msa1254170	MtrunA17_Chr2g0311631	27.401	354	197	10	52	392	55	361	3.29e-30	119
Msa1254170	MtrunA17_Chr8g0336631	26.989	352	200	10	52	392	60	365	3.77e-30	119
Msa1254170	MtrunA17_Chr6g0488511	26.036	338	190	7	52	384	3	285	5.84e-30	117
Msa1254170	MtrunA17_Chr5g0420881	34.807	181	78	2	214	392	2	144	6.38e-30	112
Msa1254170	MtrunA17_Chr3g0093741	28.571	357	200	11	43	392	46	354	8.00e-30	118
Msa1254170	MtrunA17_Chr7g0265351	28.333	360	196	12	43	392	30	337	8.14e-30	117
Msa1254170	MtrunA17_Chr3g0093761	28.426	394	213	12	11	392	17	353	8.79e-30	117
Msa1254170	MtrunA17_Chr2g0311831	27.950	322	181	8	52	367	68	344	9.37e-30	118
Msa1254170	MtrunA17_Chr2g0311741	28.280	343	194	10	46	383	21	316	1.03e-29	117
Msa1254170	MtrunA17_Chr1g0187811	27.143	350	193	12	46	383	182	481	1.11e-29	119
Msa1254170	MtrunA17_Chr3g0130391	28.358	335	185	9	41	362	55	347	1.30e-29	118
Msa1254170	MtrunA17_Chr4g0045431	30.128	312	161	10	72	368	51	320	2.04e-29	117
Msa1254170	MtrunA17_Chr8g0336751	27.273	352	197	9	52	392	94	397	2.55e-29	117
Msa1254170	MtrunA17_Chr3g0093751	29.006	362	192	12	43	392	46	354	2.76e-29	116
Msa1254170	MtrunA17_Chr4g0045461	30.769	338	173	12	52	370	26	321	3.09e-29	116
Msa1254170	MtrunA17_Chr8g0348081	27.557	352	197	13	52	392	60	364	3.52e-29	116
Msa1254170	MtrunA17_Chr8g0364471	27.385	325	182	8	52	367	67	346	3.85e-29	116
Msa1254170	MtrunA17_Chr2g0311691	28.135	327	178	8	52	367	63	343	3.98e-29	116
Msa1254170	MtrunA17_Chr7g0225881	26.284	331	189	9	45	367	60	343	7.56e-29	115
Msa1254170	MtrunA17_Chr2g0319491	27.300	337	178	12	52	382	33	308	8.83e-29	114
Msa1254170	MtrunA17_Chr2g0311711	28.704	324	177	9	52	367	67	344	1.03e-28	115
Msa1254170	MtrunA17_Chr4g0066121	28.086	324	180	9	52	367	60	338	2.31e-28	114
Msa1254170	MtrunA17_Chr1g0167961	27.103	321	185	7	52	367	69	345	3.84e-28	113
Msa1254170	MtrunA17_Chr1g0191201	27.190	331	188	7	40	359	41	329	7.04e-28	113
Msa1254170	MtrunA17_Chr2g0311861	28.000	350	177	12	52	392	64	347	1.18e-27	112
Msa1254170	MtrunA17_Chr8g0358941	27.273	330	176	11	52	367	27	306	1.21e-27	111
Msa1254170	MtrunA17_Chr7g0235981	25.680	331	190	7	74	392	41	327	2.04e-27	110
Msa1254170	MtrunA17_Chr2g0285931	25.000	328	185	9	52	367	28	306	3.26e-27	110
Msa1254170	MtrunA17_Chr4g0055591	26.957	345	194	10	47	383	55	349	3.45e-27	110
Msa1254170	MtrunA17_Chr8g0384461	24.543	383	217	11	19	385	19	345	4.57e-27	110
Msa1254170	MtrunA17_Chr7g0236011	28.818	347	192	10	46	383	61	361	6.67e-27	110
Msa1254170	MtrunA17_Chr1g0161041	27.928	333	188	9	44	370	85	371	9.87e-27	110
Msa1254170	MtrunA17_Chr7g0266651	26.389	360	202	12	46	392	53	362	1.15e-26	109
Msa1254170	MtrunA17_Chr1g0161081	27.439	328	190	8	44	367	62	345	5.29e-26	107
Msa1254170	MtrunA17_Chr3g0125421	25.656	343	198	8	27	359	17	312	5.78e-26	107
Msa1254170	MtrunA17_Chr8g0362741	31.489	235	138	7	46	278	61	274	8.25e-26	105
Msa1254170	MtrunA17_Chr1g0167911	25.155	322	189	9	52	367	54	329	1.17e-25	106
Msa1254170	MtrunA17_Chr4g0053251	26.543	324	178	8	52	355	8	291	1.99e-25	105
Msa1254170	MtrunA17_Chr8g0384481	26.912	353	203	12	46	389	53	359	2.01e-25	106
Msa1254170	MtrunA17_Chr1g0161111	28.354	328	187	8	44	367	121	404	2.18e-25	107
Msa1254170	MtrunA17_Chr8g0375661	34.615	156	97	2	14	167	17	169	1.90e-24	98.6
Msa1254170	MtrunA17_Chr2g0313111	27.273	319	172	11	52	361	28	295	2.42e-24	102
Msa1254170	MtrunA17_Chr1g0148771	28.205	312	163	10	52	359	63	317	2.43e-24	102
Msa1254170	MtrunA17_Chr7g0220001	24.658	292	169	5	81	366	66	312	2.52e-24	102
Msa1254170	MtrunA17_Chr8g0335411	26.816	358	206	10	46	392	61	373	2.66e-24	102
Msa1254170	MtrunA17_Chr8g0375641	32.065	184	115	4	3	184	8	183	3.66e-24	98.2
Msa1254170	MtrunA17_Chr4g0075471	31.410	156	69	1	205	360	21	138	6.94e-23	94.4
Msa1254170	MtrunA17_Chr3g0092531	25.714	315	180	9	52	360	6	272	4.96e-22	95.5
Msa1254170	MtrunA17_Chr6g0486831	27.434	339	180	15	54	369	20	315	1.16e-21	95.1
Msa1254170	MtrunA17_Chr5g0394071	31.455	213	95	6	170	382	5	166	1.19e-21	91.7
Msa1254170	MtrunA17_Chr7g0247991	25.141	354	203	9	46	387	61	364	1.38e-21	95.1
Msa1254170	MtrunA17_Chr4g0004061	26.761	355	208	11	44	392	1	309	1.64e-21	94.0
Msa1254170	MtrunA17_Chr3g0126761	28.111	217	115	4	167	382	44	220	2.82e-21	91.7
Msa1254170	MtrunA17_Chr4g0004071	27.119	236	128	6	158	392	116	308	2.98e-21	93.2
Msa1254170	MtrunA17_Chr7g0233661	33.690	187	74	5	196	382	4	140	3.70e-20	86.7
Msa1254170	MtrunA17_Chr4g0068891	26.220	328	179	11	52	368	20	295	8.01e-20	89.4
Msa1254170	MtrunA17_Chr4g0066991	25.872	344	184	10	47	383	62	341	2.13e-19	88.6
Msa1254170	MtrunA17_Chr1g0170631	29.353	201	93	5	199	392	34	192	3.30e-19	85.1
Msa1254170	MtrunA17_Chr8g0364171	36.607	112	69	2	167	278	18	127	3.78e-19	83.2
Msa1254170	MtrunA17_Chr3g0105281	25.466	322	176	9	52	366	34	298	7.43e-19	86.7
Msa1254170	MtrunA17_Chr1g0167931	24.062	320	157	7	52	367	54	291	1.81e-18	85.5
Msa1254170	MtrunA17_Chr8g0389941	24.405	336	192	12	54	369	33	326	2.74e-18	85.5
Msa1254170	MtrunA17_Chr8g0375581	42.529	87	47	1	187	273	2	85	4.12e-18	78.6
Msa1254170	MtrunA17_Chr1g0158021	30.568	229	140	8	48	269	45	261	5.39e-18	83.2
Msa1254170	MtrunA17_Chr4g0009541	25.688	327	193	12	52	370	7	291	9.26e-17	80.5
Msa1254170	MtrunA17_Chr3g0138351	26.301	346	195	15	48	380	3	301	9.83e-17	80.5
Msa1254170	MtrunA17_Chr8g0375591	35.878	131	80	2	6	134	2	130	1.03e-16	76.3
Msa1254170	MtrunA17_Chr4g0055911	25.948	343	182	14	48	370	5	295	1.07e-16	80.5
Msa1254170	MtrunA17_Chr4g0055871	25.959	339	176	14	51	370	8	290	2.79e-16	79.0
Msa1254170	MtrunA17_Chr8g0336831	30.000	190	122	7	52	236	60	243	1.45e-15	75.9
Msa1254170	MtrunA17_Chr5g0420891	30.435	161	103	3	9	167	6	159	3.62e-15	72.8
Msa1254170	MtrunA17_Chr1g0158011	25.818	275	147	9	98	366	10	233	4.56e-15	74.7
Msa1254170	MtrunA17_Chr2g0319521	31.579	114	76	2	165	278	14	125	8.31e-15	71.2
Msa1254170	MtrunA17_Chr8g0336801	27.717	184	89	4	214	392	12	156	1.82e-14	70.5
Msa1254170	MtrunA17_Chr4g0037611	30.818	159	69	5	188	345	12	130	2.21e-13	68.2
Msa1254170	MtrunA17_Chr1g0167921	31.008	129	79	5	149	276	37	156	5.95e-13	66.6
Msa1254170	MtrunA17_Chr2g0311611	44.286	70	33	1	214	277	2	71	9.45e-13	63.2

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1254170	AT1G49390.1	45.238	378	167	3	13	389	7	345	1.19e-115	341
Msa1254170	AT5G20400.1	44.974	378	168	3	13	389	7	345	6.77e-115	339
Msa1254170	AT5G54000.2	44.675	385	166	5	13	392	7	349	1.68e-113	335
Msa1254170	AT5G20550.1	44.855	379	168	4	13	389	7	346	2.92e-113	335
Msa1254170	AT1G49390.2	48.355	304	119	1	86	389	1	266	1.85e-104	309
Msa1254170	AT5G54000.1	46.906	307	125	1	86	392	1	269	4.95e-103	306
Msa1254170	AT3G21420.1	36.883	385	197	7	15	392	17	362	8.32e-71	226
Msa1254170	AT1G17020.1	34.783	345	184	3	51	392	52	358	5.53e-66	214
Msa1254170	AT1G17010.1	34.026	385	206	5	14	392	16	358	1.45e-65	213
Msa1254170	AT1G78550.1	34.043	376	200	6	21	392	25	356	3.73e-64	209
Msa1254170	AT4G25300.1	36.533	323	159	3	51	369	51	331	1.09e-63	208
Msa1254170	AT2G38240.1	33.537	328	173	4	46	370	42	327	1.36e-63	207
Msa1254170	AT4G25310.1	37.072	321	153	4	51	367	51	326	4.09e-60	198
Msa1254170	AT5G05600.1	33.140	344	187	5	51	389	61	366	9.04e-59	196
Msa1254170	AT1G78550.2	34.700	317	163	5	79	392	3	278	8.18e-56	185
Msa1254170	AT3G11180.2	32.571	350	190	6	45	391	88	394	1.07e-54	186
Msa1254170	AT3G11180.1	32.849	344	185	6	45	385	88	388	2.27e-54	185
Msa1254170	AT3G55970.1	32.188	320	174	5	52	366	52	333	1.12e-51	177
Msa1254170	AT4G22880.1	30.154	325	181	6	51	368	46	331	1.97e-51	176
Msa1254170	AT4G22880.2	30.154	325	181	6	51	368	46	331	1.97e-51	176
Msa1254170	AT4G22880.3	30.154	325	181	6	51	368	46	331	1.97e-51	176
Msa1254170	AT5G08640.2	30.029	343	188	9	52	388	40	336	4.19e-50	172
Msa1254170	AT5G08640.1	30.029	343	188	9	52	388	40	336	4.19e-50	172
Msa1254170	AT5G05600.2	36.522	230	143	2	51	277	61	290	1.12e-47	164
Msa1254170	AT3G60290.1	31.856	361	192	10	40	391	38	353	4.11e-47	164
Msa1254170	AT2G36690.2	32.044	362	193	10	13	366	19	335	2.45e-46	163
Msa1254170	AT2G36690.1	32.044	362	193	10	13	366	19	335	2.45e-46	163
Msa1254170	AT2G44800.1	33.333	321	170	6	48	366	48	326	2.47e-46	162
Msa1254170	AT4G10500.1	30.539	334	181	9	52	382	44	329	1.24e-44	158
Msa1254170	AT4G16330.2	32.370	346	177	10	52	390	67	362	4.32e-44	157
Msa1254170	AT3G55970.2	33.884	242	153	5	52	288	52	291	1.27e-42	151
Msa1254170	AT1G55290.1	29.974	387	208	12	11	388	25	357	4.50e-42	151
Msa1254170	AT5G24530.1	30.137	365	189	10	36	382	7	323	1.39e-41	149
Msa1254170	AT4G10490.1	28.818	347	196	10	52	391	42	344	1.61e-41	149
Msa1254170	AT5G07480.1	29.050	358	190	11	52	392	44	354	3.66e-41	149
Msa1254170	AT3G13610.1	30.312	353	193	8	46	392	56	361	6.38e-41	148
Msa1254170	AT4G25310.2	31.933	357	167	8	14	367	15	298	1.29e-40	146
Msa1254170	AT3G19010.1	32.036	334	170	10	52	370	28	319	2.62e-40	146
Msa1254170	AT3G19010.4	32.036	334	170	10	52	370	28	319	2.62e-40	146
Msa1254170	AT1G62380.1	27.405	343	199	7	47	386	2	297	3.55e-39	142
Msa1254170	AT5G07200.1	30.704	355	192	8	52	392	58	372	3.41e-38	141
Msa1254170	AT5G63600.2	26.959	319	182	8	48	363	29	299	5.62e-38	139
Msa1254170	AT1G12010.1	27.697	343	198	8	47	386	2	297	6.92e-38	139
Msa1254170	AT3G19000.1	31.373	357	178	12	27	367	16	321	1.16e-37	139
Msa1254170	AT4G16330.1	32.667	300	151	9	98	390	1	256	2.38e-37	136
Msa1254170	AT5G63600.1	26.646	319	182	7	48	363	29	298	4.27e-37	137
Msa1254170	AT1G60980.1	30.247	324	172	7	50	360	55	337	1.94e-36	137
Msa1254170	AT1G05010.1	29.582	311	168	7	53	359	5	268	2.37e-36	135
Msa1254170	AT5G63580.2	33.188	229	143	6	52	277	19	240	1.47e-35	130
Msa1254170	AT5G63580.1	33.480	227	141	6	52	275	19	238	1.99e-35	130
Msa1254170	AT1G15550.1	28.783	337	186	7	39	369	44	332	2.61e-35	133
Msa1254170	AT5G63590.1	26.567	335	188	8	48	370	10	298	2.70e-35	132
Msa1254170	AT3G19010.3	30.240	334	146	10	52	370	28	289	5.02e-35	131
Msa1254170	AT4G25420.1	29.395	347	191	8	49	385	58	360	7.94e-35	132
Msa1254170	AT1G44090.1	30.031	323	176	7	45	358	56	337	1.02e-34	132
Msa1254170	AT5G59540.1	28.011	357	202	10	46	392	55	366	2.06e-34	131
Msa1254170	AT3G19000.2	33.955	268	148	10	27	278	16	270	2.09e-34	129
Msa1254170	AT3G51240.1	25.150	334	201	7	52	382	38	325	2.40e-34	130
Msa1254170	AT5G63595.1	26.645	304	155	8	44	345	19	256	6.20e-34	127
Msa1254170	AT5G43935.1	26.646	319	161	10	52	363	19	271	1.11e-33	127
Msa1254170	AT3G19010.2	34.855	241	138	8	52	277	28	264	5.42e-33	125
Msa1254170	AT1G80340.1	29.513	349	183	11	27	366	28	322	4.09e-32	124
Msa1254170	AT2G30830.1	27.479	353	204	10	48	392	50	358	1.09e-31	123
Msa1254170	AT3G12900.1	26.957	345	190	11	55	388	59	352	1.13e-31	123
Msa1254170	AT1G80330.1	26.420	352	198	12	52	392	49	350	1.49e-31	123
Msa1254170	AT5G43440.1	27.557	352	202	10	49	392	59	365	1.77e-31	123
Msa1254170	AT1G06620.1	28.659	328	185	8	45	367	55	338	2.22e-31	122
Msa1254170	AT5G43450.1	28.483	323	180	8	52	369	61	337	2.30e-31	122
Msa1254170	AT1G77330.1	26.774	310	173	6	52	354	3	265	2.73e-31	121
Msa1254170	AT5G51810.1	28.530	347	192	8	53	385	54	358	3.05e-31	122
Msa1254170	AT1G78440.1	26.829	328	176	12	52	366	18	294	5.85e-31	120
Msa1254170	AT5G59530.1	28.182	330	185	8	46	367	52	337	1.20e-30	120
Msa1254170	AT5G43450.2	32.456	228	146	5	52	278	61	281	2.81e-30	118
Msa1254170	AT1G06620.2	32.479	234	150	5	45	276	55	282	3.41e-30	117
Msa1254170	AT4G25420.2	32.636	239	149	5	49	278	58	293	5.65e-30	117
Msa1254170	AT1G04380.1	28.090	356	194	10	48	392	41	345	7.43e-30	118
Msa1254170	AT5G43440.2	31.466	232	151	5	49	278	59	284	8.39e-30	117
Msa1254170	AT1G06650.2	28.409	352	195	12	52	392	64	369	1.33e-29	118
Msa1254170	AT4G25300.2	33.654	208	92	3	166	369	72	237	3.00e-29	114
Msa1254170	AT5G59540.2	30.085	236	155	6	46	277	55	284	3.25e-29	115
Msa1254170	AT1G06640.1	28.255	361	184	14	52	392	64	369	8.49e-29	115
Msa1254170	AT1G06645.1	27.920	351	195	12	52	392	77	379	1.39e-28	115
Msa1254170	AT5G07480.2	29.278	263	130	7	143	392	26	245	1.95e-28	112
Msa1254170	AT1G04380.2	32.627	236	142	6	48	278	41	264	2.67e-28	112
Msa1254170	AT1G03410.2	26.888	331	189	10	45	367	50	335	4.14e-28	114
Msa1254170	AT1G03410.1	26.888	331	189	10	45	367	87	372	5.56e-28	114
Msa1254170	AT4G21200.1	26.471	374	205	12	28	390	10	324	5.62e-28	113
Msa1254170	AT3G51240.2	26.056	284	162	6	101	382	4	241	6.48e-28	111
Msa1254170	AT1G04350.1	28.286	350	186	13	46	383	52	348	1.46e-27	112
Msa1254170	AT5G12270.1	26.836	354	196	8	52	392	56	359	2.58e-27	111
Msa1254170	AT3G61400.1	27.761	335	187	8	45	367	53	344	9.00e-27	110
Msa1254170	AT2G19590.1	26.627	338	191	10	43	376	2	286	3.73e-26	107
Msa1254170	AT1G06640.2	30.417	240	138	8	52	278	64	287	2.20e-25	105
Msa1254170	AT1G06650.1	28.936	235	156	6	52	282	64	291	4.35e-25	104
Msa1254170	AT1G06640.3	30.638	235	134	8	52	273	64	282	4.45e-25	103
Msa1254170	AT5G51810.2	30.081	246	156	6	53	284	54	297	5.33e-25	103
Msa1254170	AT1G30040.1	25.545	321	185	9	55	367	31	305	7.45e-25	104
Msa1254170	AT3G61400.2	29.876	241	156	5	45	277	53	288	1.89e-24	102
Msa1254170	AT3G46500.5	26.966	356	196	15	52	391	17	324	2.92e-24	102
Msa1254170	AT2G30840.1	26.506	332	193	9	43	367	48	335	1.36e-23	101
Msa1254170	AT4G21690.1	26.048	334	188	9	45	367	40	325	1.63e-23	100
Msa1254170	AT2G30840.2	28.333	240	162	5	43	278	48	281	1.23e-22	97.4
Msa1254170	AT3G49630.1	25.617	324	182	7	52	355	9	293	3.62e-22	96.7
Msa1254170	AT2G30840.3	28.151	238	161	5	43	276	48	279	4.03e-22	97.1
Msa1254170	AT3G49630.3	25.723	311	181	6	56	355	18	289	7.41e-22	95.9
Msa1254170	AT1G03400.2	26.822	343	197	12	57	373	42	356	1.12e-21	95.9
Msa1254170	AT3G46500.7	28.065	310	160	14	52	345	17	279	5.09e-21	92.8
Msa1254170	AT2G25450.1	24.090	357	217	10	45	392	48	359	8.01e-21	93.2
Msa1254170	AT1G52820.1	25.414	362	213	12	37	391	1	312	2.11e-20	91.3
Msa1254170	AT1G35190.1	27.635	351	183	16	55	382	15	317	2.86e-20	91.3
Msa1254170	AT2G19590.2	25.839	298	165	9	83	376	26	271	3.11e-20	90.5
Msa1254170	AT1G30040.2	26.840	231	153	8	55	277	31	253	4.03e-20	89.7
Msa1254170	AT1G03400.1	25.672	335	183	10	57	373	42	328	1.05e-19	90.1
Msa1254170	AT2G34555.1	25.077	323	184	11	52	366	27	299	4.95e-19	87.8
Msa1254170	AT3G46490.1	27.174	368	175	17	52	381	9	321	3.80e-17	82.0
Msa1254170	AT3G46490.2	28.012	332	147	16	52	344	9	287	1.19e-15	77.4
Msa1254170	AT1G14130.1	23.602	322	190	8	52	369	9	278	2.95e-14	73.6
Msa1254170	AT5G58660.2	24.409	254	159	8	49	278	31	275	2.03e-13	70.5

Find 111 sgRNAs with CRISPR-Local

Find 278 sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
TCATTCTTGTGGCTTCTTTC+TGG	0.080795	8_2:+52202185	Msa1254170:CDS
TAAGCTTTAATTTAAGAATT+TGG	0.157768	8_2:+52205650	Msa1254170:three_prime_UTR
TGAATCTCTTTCTCTGAATC+TGG	0.180143	8_2:-52205431	None:intergenic
ACCTGAAATCAATGGGGTTT+TGG	0.196014	8_2:-52202561	None:intergenic
TCATTATAGATATAATTATT+TGG	0.207972	8_2:-52202033	None:intergenic
GGTGGGTGCTCGCAGCAATT+TGG	0.216062	8_2:-52203881	None:intergenic
GTGGGTGCTCGCAGCAATTT+GGG	0.228023	8_2:-52203880	None:intergenic
CCCAAAACCCCATTGATTTC+AGG	0.235480	8_2:+52202560	Msa1254170:CDS
CTTTCATCTCACAGACTTCC+TGG	0.279980	8_2:-52205589	None:intergenic
CAAAACAATATTGAAGGATA+TGG	0.284911	8_2:+52202439	Msa1254170:CDS
TACAAAACTTCTTTAGTCTA+TGG	0.287867	8_2:+52205905	Msa1254170:three_prime_UTR
CACGCTAACTCTAATTAAAT+AGG	0.310510	8_2:+52205937	Msa1254170:three_prime_UTR
CAGAAAATCAAATGCTTGAT+TGG	0.314111	8_2:+52202479	Msa1254170:CDS
TCCTATGGCTGATCATGCTC+TGG	0.314307	8_2:+52203110	Msa1254170:CDS
TTGATTGCACCTCTAAATAT+AGG	0.319809	8_2:-52205999	None:intergenic
CTCTCTCTCCACATTCCTTT+AGG	0.320419	8_2:-52203050	None:intergenic
ACGTATTATTCTATCTGATT+AGG	0.325774	8_2:+52205696	Msa1254170:three_prime_UTR
AGTACTACCAACAAGGAAAA+AGG	0.333621	8_2:+52205531	Msa1254170:CDS
TTTACTGGTCTGTATAATAC+TGG	0.341137	8_2:-52205485	None:intergenic
CTTGTAACGCTTTACAATTA+CGG	0.350143	8_2:-52203811	None:intergenic
AACAATATACCGAATGTATC+TGG	0.350766	8_2:+52202965	Msa1254170:CDS
ATCAAAGGAATTTCAAACTT+TGG	0.350874	8_2:+52202536	Msa1254170:CDS
ACAAGAGCATCATGGATTAT+TGG	0.359537	8_2:-52203234	None:intergenic
AATCTAATCAAAATGCTTCC+AGG	0.381648	8_2:+52205571	Msa1254170:exon
AGGACATGGAGGGTAGTAAT+TGG	0.385875	8_2:-52203091	None:intergenic
ATCTATAATGAAGGTGGTGT+TGG	0.409589	8_2:+52202045	Msa1254170:CDS
ATAGCTTGAGTCATATTAGA+TGG	0.409856	8_2:+52205852	Msa1254170:three_prime_UTR
AATTTATACCTGAAATCAAT+GGG	0.410650	8_2:-52202568	None:intergenic
TTTACCACTACTCTGTGTAT+TGG	0.412856	8_2:-52205368	None:intergenic
ATGAATCAGAATGTGGCTTC+AGG	0.416306	8_2:-52203134	None:intergenic
ACTGGTTATCTTTGAGAACT+TGG	0.422799	8_2:-52203200	None:intergenic
TGGTGACATCCTATATTTAG+AGG	0.426974	8_2:+52205990	Msa1254170:three_prime_UTR
CATTCAAACGTGCAACATAC+TGG	0.433551	8_2:+52201857	Msa1254170:five_prime_UTR
TTGAAATTCCTTTGATCTTG+AGG	0.440037	8_2:-52202529	None:intergenic
GCGTTACAAGTTGGCAATGA+TGG	0.440803	8_2:+52203824	Msa1254170:CDS
GAATTTATACCTGAAATCAA+TGG	0.446659	8_2:-52202569	None:intergenic
CAAGCTGCACTTCATTCTTG+TGG	0.451802	8_2:+52202174	Msa1254170:CDS
TGAGATAGTTGGTAGTAAAT+CGG	0.451831	8_2:+52201975	Msa1254170:CDS
AGCTCATGTTGTGAAGTAGA+TGG	0.457466	8_2:-52202141	None:intergenic
GGAAGAGGATTGTTTCCTAA+AGG	0.458189	8_2:+52203035	Msa1254170:CDS
CCTTGATGGTTACAGATATC+GGG	0.458712	8_2:+52203786	Msa1254170:intron
ATGATAAAGGAGGCCAAGTA+GGG	0.468508	8_2:-52206044	None:intergenic
GATTAATGTTGGTGATCAAA+TGG	0.470053	8_2:+52203257	Msa1254170:CDS
TGCTCATCTATGTGGTCCAT+TGG	0.470338	8_2:-52201830	None:intergenic
TCGTTCACTAGTTTGTCAAC+CGG	0.473542	8_2:-52205455	None:intergenic
GAATCTCTTTCTCTGAATCT+GGG	0.476860	8_2:-52205430	None:intergenic
TTATTGGAACTTTAAACCAC+TGG	0.480568	8_2:-52203218	None:intergenic
AGCATGTCACCTACCCTACT+TGG	0.484401	8_2:+52206031	Msa1254170:three_prime_UTR
AATAATTATATCTATAATGA+AGG	0.493436	8_2:+52202036	Msa1254170:CDS
AGTAGTGGTAAATGCAGAAA+GGG	0.496294	8_2:+52205379	Msa1254170:CDS
AGGGAACAAAACAATATTGA+AGG	0.499241	8_2:+52202433	Msa1254170:CDS
AAATATAGGATGTCACCATA+TGG	0.501737	8_2:-52205985	None:intergenic
TCGGCAGAGGTTGAGATAGT+TGG	0.502686	8_2:+52201964	Msa1254170:CDS
ATATACAGATAATGAGCAAT+GGG	0.504522	8_2:+52205333	Msa1254170:intron
GGTTATCTTTGAGAACTTGG+AGG	0.510231	8_2:-52203197	None:intergenic
ATATAACTGCCAGATACATT+CGG	0.510757	8_2:-52202974	None:intergenic
CATGGCGAAGACACTGAACT+TGG	0.514251	8_2:+52203014	Msa1254170:CDS
TTCAGAGAAAGAGATTCAAC+CGG	0.515663	8_2:+52205436	Msa1254170:CDS
TTACTACCCTCCATGTCCTA+TGG	0.516124	8_2:+52203095	Msa1254170:CDS
AGTAGATGGAGAAGTGAGGT+TGG	0.516853	8_2:-52202127	None:intergenic
GATGATAAAGGAGGCCAAGT+AGG	0.520122	8_2:-52206045	None:intergenic
CGAGCACCCACCCATGGAGA+GGG	0.525848	8_2:+52203892	Msa1254170:CDS
TAGTAAATCGGTTCAAGAGT+TGG	0.532912	8_2:+52201987	Msa1254170:CDS
GCTCGTTTCTTGACAAAGTG+AGG	0.541459	8_2:+52202356	Msa1254170:CDS
AAGAATTTGGTGCTTGCAAG+AGG	0.542795	8_2:+52205663	Msa1254170:three_prime_UTR
CACAAGAATGAAGTGCAGCT+TGG	0.546880	8_2:-52202173	None:intergenic
ACATAACCCCTCTCCATGGG+TGG	0.556536	8_2:-52203899	None:intergenic
CCTATGGCTGATCATGCTCT+GGG	0.557427	8_2:+52203111	Msa1254170:CDS
TGGTAAATGCAGAAAGGGAA+AGG	0.560475	8_2:+52205384	Msa1254170:CDS
GCATGATCAGCCATAGGACA+TGG	0.560749	8_2:-52203105	None:intergenic
GATGCTCTTGTGATTAATGT+TGG	0.560795	8_2:+52203246	Msa1254170:CDS
AATTGTAAAGCGTTACAAGT+TGG	0.563275	8_2:+52203815	Msa1254170:CDS
AGGTTGGCAATGTCAATGAT+TGG	0.563323	8_2:-52202111	None:intergenic
AATTATATCTATAATGAAGG+TGG	0.563549	8_2:+52202039	Msa1254170:CDS
CATTAATCACAAGAGCATCA+TGG	0.564097	8_2:-52203242	None:intergenic
GAGTAGTGGTAAATGCAGAA+AGG	0.567843	8_2:+52205378	Msa1254170:CDS
GAAGACACTGAACTTGGAAG+AGG	0.567942	8_2:+52203020	Msa1254170:CDS
CAAGTTCAGTGTCTTCGCCA+TGG	0.571848	8_2:-52203013	None:intergenic
GATATATGTTAAATATCCAA+TGG	0.575035	8_2:+52201814	Msa1254170:five_prime_UTR
TTGCTGCGAGCACCCACCCA+TGG	0.575561	8_2:+52203886	Msa1254170:CDS
CTCGTTTCTTGACAAAGTGA+GGG	0.576302	8_2:+52202357	Msa1254170:CDS
GACACATAACCCCTCTCCAT+GGG	0.582435	8_2:-52203902	None:intergenic
TTATAGATATAATTATTTGG+TGG	0.585099	8_2:-52202030	None:intergenic
GAAACGAGCTTGTCATCCCA+TGG	0.585363	8_2:-52202342	None:intergenic
GGACACATAACCCCTCTCCA+TGG	0.587393	8_2:-52203903	None:intergenic
GCGAGCACCCACCCATGGAG+AGG	0.589350	8_2:+52203891	Msa1254170:CDS
ACATGAAAATCTGATTCTGA+AGG	0.589628	8_2:-52202087	None:intergenic
GATTGTTTCCTAAAGGAATG+TGG	0.591700	8_2:+52203042	Msa1254170:CDS
AATATACAGATAATGAGCAA+TGG	0.593689	8_2:+52205332	Msa1254170:intron
AGGTACATCCTCAAGATCAA+AGG	0.594954	8_2:+52202521	Msa1254170:CDS
ACAAACTAGTGAACGAGTCA+AGG	0.596933	8_2:+52205462	Msa1254170:CDS
CTAAAGGAATGTGGAGAGAG+AGG	0.597062	8_2:+52203051	Msa1254170:CDS
GCTGTTCAGGTGATAAACCA+TGG	0.598562	8_2:+52202325	Msa1254170:intron
CTGTTCAGGTGATAAACCAT+GGG	0.603760	8_2:+52202326	Msa1254170:intron
TGGGTGCTCGCAGCAATTTG+GGG	0.624881	8_2:-52203879	None:intergenic
AATGCAGATGCTCATCTATG+TGG	0.627232	8_2:-52201838	None:intergenic
CATAACCCCTCTCCATGGGT+GGG	0.632835	8_2:-52203898	None:intergenic
TAAAGGAGGCCAAGTAGGGT+AGG	0.633239	8_2:-52206040	None:intergenic
ATAGATGATGAATCAGAATG+TGG	0.639173	8_2:-52203141	None:intergenic
CCCAGAGCATGATCAGCCAT+AGG	0.646801	8_2:-52203111	None:intergenic
GAGTCCAATACACAGAGTAG+TGG	0.648084	8_2:+52205364	Msa1254170:CDS
GTGAAGTAGATGGAGAAGTG+AGG	0.653571	8_2:-52202131	None:intergenic
TTACAAGTTGGCAATGATGG+AGG	0.654108	8_2:+52203827	Msa1254170:CDS
AAGTTCTCAAAGATAACCAG+TGG	0.660926	8_2:+52203202	Msa1254170:CDS
ATTTATACCTGAAATCAATG+GGG	0.672971	8_2:-52202567	None:intergenic
GAGCACCCACCCATGGAGAG+GGG	0.673204	8_2:+52203893	Msa1254170:CDS
TGATCAGCCATAGGACATGG+AGG	0.676264	8_2:-52203102	None:intergenic
GATCAGCCATAGGACATGGA+GGG	0.682438	8_2:-52203101	None:intergenic
TAATGTTGGTGATCAAATGG+AGG	0.693090	8_2:+52203260	Msa1254170:CDS
TTTCTCGAGTACTACCAACA+AGG	0.720997	8_2:+52205524	Msa1254170:CDS
TCTCTTTCTCTGAATCTGGG+CGG	0.729749	8_2:-52205427	None:intergenic

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content
!!	TCATTATAGATATAATTATT+TGG	-	chr8_2:52202036-52202055	None:intergenic	10.0%
!!	AATAATTATATCTATAATGA+AGG	+	chr8_2:52202036-52202055	Msa1254170:CDS	10.0%
!!!	TTTAGATTTAAATGTATTTT+CGG	+	chr8_2:52202706-52202725	Msa1254170:intron	10.0%
!!	AATTTACACATTAAAATAAT+TGG	-	chr8_2:52204538-52204557	None:intergenic	10.0%
!!	ATATTATACATATATATAAG+TGG	+	chr8_2:52205143-52205162	Msa1254170:intron	10.0%
!!	TTATAGATATAATTATTTGG+TGG	-	chr8_2:52202033-52202052	None:intergenic	15.0%
!!	ACATAACTAAAATAAAAGTA+TGG	-	chr8_2:52202265-52202284	None:intergenic	15.0%
!!!	CCATTTAAAATAATATTAAG+TGG	-	chr8_2:52202598-52202617	None:intergenic	15.0%
!!!	CCACTTAATATTATTTTAAA+TGG	+	chr8_2:52202595-52202614	Msa1254170:intron	15.0%
!!!	AAAATAAATTCAAATGGATT+TGG	-	chr8_2:52202831-52202850	None:intergenic	15.0%
!!!	AAATCCATTTGAATTTATTT+TGG	+	chr8_2:52202830-52202849	Msa1254170:intron	15.0%
!!!	AGTTATATGAAGTAATTTTA+AGG	+	chr8_2:52202989-52203008	Msa1254170:CDS	15.0%
!!!	GTTATATGAAGTAATTTTAA+GGG	+	chr8_2:52202990-52203009	Msa1254170:CDS	15.0%
!!!	AAATTGATTATTTGAAATTG+AGG	+	chr8_2:52203523-52203542	Msa1254170:intron	15.0%
!!!	AATTGATTATTTGAAATTGA+GGG	+	chr8_2:52203524-52203543	Msa1254170:intron	15.0%
!!!	AAGTTTTATGTTTTATGTTA+GGG	+	chr8_2:52204040-52204059	Msa1254170:intron	15.0%
!!	TATATATACTATGAAATTGT+GGG	-	chr8_2:52204388-52204407	None:intergenic	15.0%
!!	ATATATATACTATGAAATTG+TGG	-	chr8_2:52204389-52204408	None:intergenic	15.0%
!!!	ACTATTAATTTTTTGTTCTA+TGG	+	chr8_2:52204586-52204605	Msa1254170:intron	15.0%
!!!	TTTTTATTTACACAAAATGT+TGG	+	chr8_2:52204691-52204710	Msa1254170:intron	15.0%
!!	TACATAAGAAATTAAAAGTA+TGG	+	chr8_2:52204863-52204882	Msa1254170:intron	15.0%
!!	TACATAAGAAATTAAAAGTA+TGG	+	chr8_2:52204863-52204882	Msa1254170:intron	15.0%
!!!	TATTTTTACTTATGTTTTCA+AGG	+	chr8_2:52205298-52205317	Msa1254170:intron	15.0%
!!!	TAAGCTTTAATTTAAGAATT+TGG	+	chr8_2:52205650-52205669	Msa1254170:three_prime_UTR	15.0%
!!	GATATATGTTAAATATCCAA+TGG	+	chr8_2:52201814-52201833	Msa1254170:five_prime_UTR	20.0%
!!	CACAATAACAATAACAAAAA+TGG	+	chr8_2:52201936-52201955	Msa1254170:exon	20.0%
!!	AATTATATCTATAATGAAGG+TGG	+	chr8_2:52202039-52202058	Msa1254170:CDS	20.0%
!!	AATTTATACCTGAAATCAAT+GGG	-	chr8_2:52202571-52202590	None:intergenic	20.0%
!!!	AGTAGCAAATACTTTTTTTT+TGG	+	chr8_2:52202623-52202642	Msa1254170:intron	20.0%
!!	TAAAGTATAAAAATATCCCA+TGG	-	chr8_2:52202675-52202694	None:intergenic	20.0%
!!	AACACCAAAATAAATTCAAA+TGG	-	chr8_2:52202837-52202856	None:intergenic	20.0%
!!!	ATTTGAATTTATTTTGGTGT+TGG	+	chr8_2:52202836-52202855	Msa1254170:intron	20.0%
!!!	TAATTTTTTAATCAACAACG+TGG	-	chr8_2:52203497-52203516	None:intergenic	20.0%
!!!	GAAGTTTTATGTTTTATGTT+AGG	+	chr8_2:52204039-52204058	Msa1254170:intron	20.0%
!!	CTATGGAAGATAATTTAAAT+CGG	+	chr8_2:52204603-52204622	Msa1254170:intron	20.0%
!!!	TAATTTAAATCGGTGTTTTA+AGG	+	chr8_2:52204613-52204632	Msa1254170:intron	20.0%
!!	TTATTAAAGAAAACGTCAAT+GGG	-	chr8_2:52204827-52204846	None:intergenic	20.0%
!!	TTTATTAAAGAAAACGTCAA+TGG	-	chr8_2:52204828-52204847	None:intergenic	20.0%
!!	TTATTAAAGAAAACGTCAAT+GGG	-	chr8_2:52204827-52204846	None:intergenic	20.0%
!!	TTTATTAAAGAAAACGTCAA+TGG	-	chr8_2:52204828-52204847	None:intergenic	20.0%
!!	TTATACATATATATAAGTGG+CGG	+	chr8_2:52205146-52205165	Msa1254170:intron	20.0%
!!	ATAAAATTAACAAGTGTCTT+TGG	+	chr8_2:52205210-52205229	Msa1254170:intron	20.0%
!!	AAAGAAAAATTTGAACCATA+TGG	+	chr8_2:52205970-52205989	Msa1254170:three_prime_UTR	20.0%
!!	AATAACAAAAATGGAAGTGT+CGG	+	chr8_2:52201945-52201964	Msa1254170:exon	25.0%
!	TATAAATAAATGTTTGCAGC+TGG	-	chr8_2:52202242-52202261	None:intergenic	25.0%
!!	AAAACAGTTGCGAATAATTT+TGG	-	chr8_2:52202303-52202322	None:intergenic	25.0%
!!!	TATTTTTGCTTTTCTTCCTT+TGG	-	chr8_2:52202409-52202428	None:intergenic	25.0%
!	AAGAAAAGCAAAAATATGCA+AGG	+	chr8_2:52202413-52202432	Msa1254170:CDS	25.0%
!	AGAAAAGCAAAAATATGCAA+GGG	+	chr8_2:52202414-52202433	Msa1254170:CDS	25.0%
!	CAAAACAATATTGAAGGATA+TGG	+	chr8_2:52202439-52202458	Msa1254170:CDS	25.0%
!	ATCAAAGGAATTTCAAACTT+TGG	+	chr8_2:52202536-52202555	Msa1254170:CDS	25.0%
!	ATTTATACCTGAAATCAATG+GGG	-	chr8_2:52202570-52202589	None:intergenic	25.0%
!	GAATTTATACCTGAAATCAA+TGG	-	chr8_2:52202572-52202591	None:intergenic	25.0%
!	TAATACTTTAATAGCTCCAT+GGG	+	chr8_2:52202656-52202675	Msa1254170:intron	25.0%
!	ATATATACCTTACAGTTACA+AGG	-	chr8_2:52202748-52202767	None:intergenic	25.0%
!!!	AATTTATTTTGGTGTTGGTT+TGG	+	chr8_2:52202841-52202860	Msa1254170:intron	25.0%
!!!	ATTTATTTTGGTGTTGGTTT+GGG	+	chr8_2:52202842-52202861	Msa1254170:intron	25.0%
!	ATGTAAATGAAGAATCATGT+CGG	+	chr8_2:52202914-52202933	Msa1254170:intron	25.0%
!!!	TTTTTTGCTGCAAGATAAAA+AGG	+	chr8_2:52203167-52203186	Msa1254170:CDS	25.0%
!	GTCAAACAAAGTTTATAAGT+TGG	+	chr8_2:52203317-52203336	Msa1254170:intron	25.0%
!	TCAAATAACATTGATGTATC+TGG	-	chr8_2:52203356-52203375	None:intergenic	25.0%
!!	TATGTTTTATGTTAGGGAAA+AGG	+	chr8_2:52204046-52204065	Msa1254170:intron	25.0%
!!!	CAGAGCTAGAAATAATTTTT+TGG	+	chr8_2:52204507-52204526	Msa1254170:intron	25.0%
!!!	GCTAGAAATAATTTTTTGGA+TGG	+	chr8_2:52204511-52204530	Msa1254170:intron	25.0%
!	TATTAAAGAAAACGTCAATG+GGG	-	chr8_2:52204826-52204845	None:intergenic	25.0%
!!	AAATTAAAAGTATGGCTAAC+TGG	+	chr8_2:52204871-52204890	Msa1254170:intron	25.0%
!	TATTAAAGAAAACGTCAATG+GGG	-	chr8_2:52204826-52204845	None:intergenic	25.0%
!!	AAATTAAAAGTATGGCTAAC+TGG	+	chr8_2:52204871-52204890	Msa1254170:intron	25.0%
!	AATATACAGATAATGAGCAA+TGG	+	chr8_2:52205332-52205351	Msa1254170:intron	25.0%
!	ATATACAGATAATGAGCAAT+GGG	+	chr8_2:52205333-52205352	Msa1254170:intron	25.0%
!!!	TAGATTTTGAAAGCATCAAT+TGG	-	chr8_2:52205557-52205576	None:intergenic	25.0%
!	ACGTATTATTCTATCTGATT+AGG	+	chr8_2:52205696-52205715	Msa1254170:three_prime_UTR	25.0%
!!	TTTTTCTATGCTTGATATAC+AGG	+	chr8_2:52205722-52205741	Msa1254170:three_prime_UTR	25.0%
!!	AAAATAGCTTTTGTGATGAT+CGG	+	chr8_2:52205796-52205815	Msa1254170:intron	25.0%
!!	TGATACAAACTCACATTTTA+GGG	-	chr8_2:52205879-52205898	None:intergenic	25.0%
!!	TTGATACAAACTCACATTTT+AGG	-	chr8_2:52205880-52205899	None:intergenic	25.0%
!	TACAAAACTTCTTTAGTCTA+TGG	+	chr8_2:52205905-52205924	Msa1254170:three_prime_UTR	25.0%
!!	TGAGATAGTTGGTAGTAAAT+CGG	+	chr8_2:52201975-52201994	Msa1254170:CDS	30.0%
	ACATGAAAATCTGATTCTGA+AGG	-	chr8_2:52202090-52202109	None:intergenic	30.0%
!!!	AATAATTTTGGAGCTTAAGG+AGG	-	chr8_2:52202291-52202310	None:intergenic	30.0%
!!!	GCAATTTTTTGAACTTCCAA+AGG	+	chr8_2:52202390-52202409	Msa1254170:CDS	30.0%
	AGGGAACAAAACAATATTGA+AGG	+	chr8_2:52202433-52202452	Msa1254170:CDS	30.0%
	CAGAAAATCAAATGCTTGAT+TGG	+	chr8_2:52202479-52202498	Msa1254170:CDS	30.0%
!!	GTGTGACAGAATATTTTTGA+AGG	+	chr8_2:52202501-52202520	Msa1254170:CDS	30.0%
	TTGAAATTCCTTTGATCTTG+AGG	-	chr8_2:52202532-52202551	None:intergenic	30.0%
	CTAATACTTTAATAGCTCCA+TGG	+	chr8_2:52202655-52202674	Msa1254170:intron	30.0%
	AACAATATACCGAATGTATC+TGG	+	chr8_2:52202965-52202984	Msa1254170:CDS	30.0%
	ATATAACTGCCAGATACATT+CGG	-	chr8_2:52202977-52202996	None:intergenic	30.0%
	ATAGATGATGAATCAGAATG+TGG	-	chr8_2:52203144-52203163	None:intergenic	30.0%
	TTATTGGAACTTTAAACCAC+TGG	-	chr8_2:52203221-52203240	None:intergenic	30.0%
!!	GATTAATGTTGGTGATCAAA+TGG	+	chr8_2:52203257-52203276	Msa1254170:CDS	30.0%
!!	TCAGTATTTTGAGCTAGAAA+GGG	+	chr8_2:52203664-52203683	Msa1254170:intron	30.0%
	TGTTCAAGTCTCCTTATATA+GGG	+	chr8_2:52203725-52203744	Msa1254170:intron	30.0%
	CTTGTAACGCTTTACAATTA+CGG	-	chr8_2:52203814-52203833	None:intergenic	30.0%
!	AATTGTAAAGCGTTACAAGT+TGG	+	chr8_2:52203815-52203834	Msa1254170:CDS	30.0%
	CCTAATAAGAAGGCTTAATT+CGG	-	chr8_2:52203933-52203952	None:intergenic	30.0%
	AACTAAGAACTCATCAAAGT+CGG	-	chr8_2:52204101-52204120	None:intergenic	30.0%
	TCATTATTCATTCCACTTTC+AGG	-	chr8_2:52204339-52204358	None:intergenic	30.0%
	GTATATATATTACGAGTGAG+TGG	+	chr8_2:52204399-52204418	Msa1254170:intron	30.0%
	TAATTAGAATGTAGTTGCCT+TGG	+	chr8_2:52204759-52204778	Msa1254170:intron	30.0%
	TAATTAGAATGTAGTTGCCT+TGG	+	chr8_2:52204759-52204778	Msa1254170:intron	30.0%
!	ATTTGAAACGTGAAACGTAA+AGG	+	chr8_2:52205055-52205074	Msa1254170:intron	30.0%
!	TTTTTATGAAACAAGAGCAG+TGG	-	chr8_2:52205186-52205205	None:intergenic	30.0%
!	TTTACTGGTCTGTATAATAC+TGG	-	chr8_2:52205488-52205507	None:intergenic	30.0%
!	ATCTTAGCACAATCTTTTAC+TGG	-	chr8_2:52205503-52205522	None:intergenic	30.0%
	AATCTAATCAAAATGCTTCC+AGG	+	chr8_2:52205571-52205590	Msa1254170:exon	30.0%
!	TTTTTGTGATAACCGGATTA+GGG	+	chr8_2:52205750-52205769	Msa1254170:intron	30.0%
	ATAGCTTGAGTCATATTAGA+TGG	+	chr8_2:52205852-52205871	Msa1254170:three_prime_UTR	30.0%
	CACGCTAACTCTAATTAAAT+AGG	+	chr8_2:52205937-52205956	Msa1254170:three_prime_UTR	30.0%
	AAATATAGGATGTCACCATA+TGG	-	chr8_2:52205988-52206007	None:intergenic	30.0%
	TTGATTGCACCTCTAAATAT+AGG	-	chr8_2:52206002-52206021	None:intergenic	30.0%
!	TAGTAAATCGGTTCAAGAGT+TGG	+	chr8_2:52201987-52202006	Msa1254170:CDS	35.0%
	ATCTATAATGAAGGTGGTGT+TGG	+	chr8_2:52202045-52202064	Msa1254170:CDS	35.0%
!!!	GCGAATAATTTTGGAGCTTA+AGG	-	chr8_2:52202294-52202313	None:intergenic	35.0%
	CACATCGAGACGTTATAAAA+TGG	+	chr8_2:52202775-52202794	Msa1254170:intron	35.0%
	TCGAGACGTTATAAAATGGT+TGG	+	chr8_2:52202779-52202798	Msa1254170:intron	35.0%
	TAAATGAAGAATCATGTCGG+CGG	+	chr8_2:52202917-52202936	Msa1254170:intron	35.0%
!!	TGAAGTAATTTTAAGGGCCA+TGG	+	chr8_2:52202996-52203015	Msa1254170:CDS	35.0%
	GATTGTTTCCTAAAGGAATG+TGG	+	chr8_2:52203042-52203061	Msa1254170:CDS	35.0%
	CTGCAAGATAAAAAGGTAGA+AGG	+	chr8_2:52203174-52203193	Msa1254170:CDS	35.0%
!	ACTGGTTATCTTTGAGAACT+TGG	-	chr8_2:52203203-52203222	None:intergenic	35.0%
	AAGTTCTCAAAGATAACCAG+TGG	+	chr8_2:52203202-52203221	Msa1254170:CDS	35.0%
!!	ACAAGAGCATCATGGATTAT+TGG	-	chr8_2:52203237-52203256	None:intergenic	35.0%
!!	CATTAATCACAAGAGCATCA+TGG	-	chr8_2:52203245-52203264	None:intergenic	35.0%
	GATGCTCTTGTGATTAATGT+TGG	+	chr8_2:52203246-52203265	Msa1254170:CDS	35.0%
!!	TAATGTTGGTGATCAAATGG+AGG	+	chr8_2:52203260-52203279	Msa1254170:CDS	35.0%
	ACAACGTGGTTGACATAATA+TGG	-	chr8_2:52203483-52203502	None:intergenic	35.0%
!!	GTCAGTATTTTGAGCTAGAA+AGG	+	chr8_2:52203663-52203682	Msa1254170:intron	35.0%
!!	CAGTATTTTGAGCTAGAAAG+GGG	+	chr8_2:52203665-52203684	Msa1254170:intron	35.0%
!!	AGTATTTTGAGCTAGAAAGG+GGG	+	chr8_2:52203666-52203685	Msa1254170:intron	35.0%
	TAGAAATCAATCGTACCTTG+AGG	+	chr8_2:52203698-52203717	Msa1254170:intron	35.0%
	CTGTTCAAGTCTCCTTATAT+AGG	+	chr8_2:52203724-52203743	Msa1254170:intron	35.0%
	AGCTACATACGTCAAAATAC+CGG	-	chr8_2:52203763-52203782	None:intergenic	35.0%
!	TCCTTGATGGTTACAGATAT+CGG	+	chr8_2:52203785-52203804	Msa1254170:intron	35.0%
	CCGAATTAAGCCTTCTTATT+AGG	+	chr8_2:52203930-52203949	Msa1254170:intron	35.0%
!	GATTTCGAGCATATGCTTTT+GGG	+	chr8_2:52203958-52203977	Msa1254170:intron	35.0%
	ACTAAGAACTCATCAAAGTC+GGG	-	chr8_2:52204100-52204119	None:intergenic	35.0%
	CAAGAAACCTTGAGCATTTA+AGG	+	chr8_2:52204164-52204183	Msa1254170:intron	35.0%
!!	GTAGTTTGCTAAGATCATTG+AGG	+	chr8_2:52204259-52204278	Msa1254170:intron	35.0%
	ATCATTGAGGATATGTTGCT+CGG	+	chr8_2:52204272-52204291	Msa1254170:intron	35.0%
	ATTTACCACTTTCATGCTAG+CGG	-	chr8_2:52204308-52204327	None:intergenic	35.0%
	AAATTAGTCAAGCCTGAAAG+TGG	+	chr8_2:52204324-52204343	Msa1254170:intron	35.0%
	AATGATCTGAGCAATCTCTT+CGG	+	chr8_2:52204354-52204373	Msa1254170:intron	35.0%
	CAAGAGTGAGGAAAATATCA+AGG	-	chr8_2:52204479-52204498	None:intergenic	35.0%
!	TGTGTTAAAGCGCTTAAGTT+CGG	-	chr8_2:52205091-52205110	None:intergenic	35.0%
!	TATATAAGTGGCGGAATAAG+TGG	+	chr8_2:52205155-52205174	Msa1254170:intron	35.0%
	TTTACCACTACTCTGTGTAT+TGG	-	chr8_2:52205371-52205390	None:intergenic	35.0%
	AGTAGTGGTAAATGCAGAAA+GGG	+	chr8_2:52205379-52205398	Msa1254170:CDS	35.0%
	GAATCTCTTTCTCTGAATCT+GGG	-	chr8_2:52205433-52205452	None:intergenic	35.0%
	TGAATCTCTTTCTCTGAATC+TGG	-	chr8_2:52205434-52205453	None:intergenic	35.0%
	TTCAGAGAAAGAGATTCAAC+CGG	+	chr8_2:52205436-52205455	Msa1254170:CDS	35.0%
	AGTACTACCAACAAGGAAAA+AGG	+	chr8_2:52205531-52205550	Msa1254170:CDS	35.0%
!	GGACAAGTTTTTGTGATAAC+CGG	+	chr8_2:52205743-52205762	Msa1254170:three_prime_UTR	35.0%
!	GTTTTTGTGATAACCGGATT+AGG	+	chr8_2:52205749-52205768	Msa1254170:intron	35.0%
!	CTTTTGTGATGATCGGATTA+GGG	+	chr8_2:52205803-52205822	Msa1254170:intron	35.0%
	TGGTGACATCCTATATTTAG+AGG	+	chr8_2:52205990-52206009	Msa1254170:three_prime_UTR	35.0%
	AATGCAGATGCTCATCTATG+TGG	-	chr8_2:52201841-52201860	None:intergenic	40.0%
	CATTCAAACGTGCAACATAC+TGG	+	chr8_2:52201857-52201876	Msa1254170:five_prime_UTR	40.0%
	AGGTTGGCAATGTCAATGAT+TGG	-	chr8_2:52202114-52202133	None:intergenic	40.0%
	AGCTCATGTTGTGAAGTAGA+TGG	-	chr8_2:52202144-52202163	None:intergenic	40.0%
	TCATTCTTGTGGCTTCTTTC+TGG	+	chr8_2:52202185-52202204	Msa1254170:CDS	40.0%
	ATGGTTTATCACCTGAACAG+CGG	-	chr8_2:52202326-52202345	None:intergenic	40.0%
	CTGTTCAGGTGATAAACCAT+GGG	+	chr8_2:52202326-52202345	Msa1254170:intron	40.0%
	CTCGTTTCTTGACAAAGTGA+GGG	+	chr8_2:52202357-52202376	Msa1254170:CDS	40.0%
	AGGTACATCCTCAAGATCAA+AGG	+	chr8_2:52202521-52202540	Msa1254170:CDS	40.0%
!	CTGAAATCAATGGGGTTTTG+GGG	-	chr8_2:52202562-52202581	None:intergenic	40.0%
!	CCTGAAATCAATGGGGTTTT+GGG	-	chr8_2:52202563-52202582	None:intergenic	40.0%
!	ACCTGAAATCAATGGGGTTT+TGG	-	chr8_2:52202564-52202583	None:intergenic	40.0%
!!	AGCTTAGCCTTGTAACTGTA+AGG	+	chr8_2:52202738-52202757	Msa1254170:intron	40.0%
	GGAAGAGGATTGTTTCCTAA+AGG	+	chr8_2:52203035-52203054	Msa1254170:CDS	40.0%
	ATGAATCAGAATGTGGCTTC+AGG	-	chr8_2:52203137-52203156	None:intergenic	40.0%
!	GGTTATCTTTGAGAACTTGG+AGG	-	chr8_2:52203200-52203219	None:intergenic	40.0%
	TCAAGTCTCCTTATATAGGG+AGG	+	chr8_2:52203728-52203747	Msa1254170:intron	40.0%
	CGTATGTAGCTATTCCTTGA+TGG	+	chr8_2:52203772-52203791	Msa1254170:intron	40.0%
!	CCTTGATGGTTACAGATATC+GGG	+	chr8_2:52203786-52203805	Msa1254170:intron	40.0%
!	TTACAAGTTGGCAATGATGG+AGG	+	chr8_2:52203827-52203846	Msa1254170:CDS	40.0%
	AAGAAGGCTTAATTCGGCAT+TGG	-	chr8_2:52203927-52203946	None:intergenic	40.0%
	TAAGCCTTCTTATTAGGCCT+CGG	+	chr8_2:52203936-52203955	Msa1254170:intron	40.0%
	AAATCCGAGGCCTAATAAGA+AGG	-	chr8_2:52203943-52203962	None:intergenic	40.0%
!	GGATTTCGAGCATATGCTTT+TGG	+	chr8_2:52203957-52203976	Msa1254170:intron	40.0%
	TGATGAGTTCTTAGTTCGCA+AGG	+	chr8_2:52204105-52204124	Msa1254170:intron	40.0%
	TTTACCACTTTCATGCTAGC+GGG	-	chr8_2:52204307-52204326	None:intergenic	40.0%
!	TTTTCCTCACTCTTGCTTAG+TGG	+	chr8_2:52204484-52204503	Msa1254170:intron	40.0%
	TTAGAATGTAGTTGCCTTGG+TGG	+	chr8_2:52204762-52204781	Msa1254170:intron	40.0%
	TTAGAATGTAGTTGCCTTGG+TGG	+	chr8_2:52204762-52204781	Msa1254170:intron	40.0%
	TTATGAAACAAGAGCAGTGG+CGG	-	chr8_2:52205183-52205202	None:intergenic	40.0%
	GAGTAGTGGTAAATGCAGAA+AGG	+	chr8_2:52205378-52205397	Msa1254170:CDS	40.0%
	TGGTAAATGCAGAAAGGGAA+AGG	+	chr8_2:52205384-52205403	Msa1254170:CDS	40.0%
!	TCGTTCACTAGTTTGTCAAC+CGG	-	chr8_2:52205458-52205477	None:intergenic	40.0%
	ACAAACTAGTGAACGAGTCA+AGG	+	chr8_2:52205462-52205481	Msa1254170:CDS	40.0%
	TTTCTCGAGTACTACCAACA+AGG	+	chr8_2:52205524-52205543	Msa1254170:CDS	40.0%
!!!	CAATTGGCCTTTTTCCTTGT+TGG	-	chr8_2:52205541-52205560	None:intergenic	40.0%
!!	AAGAATTTGGTGCTTGCAAG+AGG	+	chr8_2:52205663-52205682	Msa1254170:three_prime_UTR	40.0%
!	GCTTTTGTGATGATCGGATT+AGG	+	chr8_2:52205802-52205821	Msa1254170:intron	40.0%
	TGCTCATCTATGTGGTCCAT+TGG	-	chr8_2:52201833-52201852	None:intergenic	45.0%
!!	AAAAATGGAAGTGTCGGCAG+AGG	+	chr8_2:52201951-52201970	Msa1254170:exon	45.0%
	AGTAGATGGAGAAGTGAGGT+TGG	-	chr8_2:52202130-52202149	None:intergenic	45.0%
	GTGAAGTAGATGGAGAAGTG+AGG	-	chr8_2:52202134-52202153	None:intergenic	45.0%
	CACAAGAATGAAGTGCAGCT+TGG	-	chr8_2:52202176-52202195	None:intergenic	45.0%
	CAAGCTGCACTTCATTCTTG+TGG	+	chr8_2:52202174-52202193	Msa1254170:CDS	45.0%
	GCTGTTCAGGTGATAAACCA+TGG	+	chr8_2:52202325-52202344	Msa1254170:intron	45.0%
	GCTCGTTTCTTGACAAAGTG+AGG	+	chr8_2:52202356-52202375	Msa1254170:CDS	45.0%
!!	CCCAAAACCCCATTGATTTC+AGG	+	chr8_2:52202560-52202579	Msa1254170:CDS	45.0%
	GAAGACACTGAACTTGGAAG+AGG	+	chr8_2:52203020-52203039	Msa1254170:CDS	45.0%
	CTCTCTCTCCACATTCCTTT+AGG	-	chr8_2:52203053-52203072	None:intergenic	45.0%
	CTAAAGGAATGTGGAGAGAG+AGG	+	chr8_2:52203051-52203070	Msa1254170:CDS	45.0%
	AGGACATGGAGGGTAGTAAT+TGG	-	chr8_2:52203094-52203113	None:intergenic	45.0%
	TTACTACCCTCCATGTCCTA+TGG	+	chr8_2:52203095-52203114	Msa1254170:CDS	45.0%
!!	GTTGGTGATCAAATGGAGGT+AGG	+	chr8_2:52203264-52203283	Msa1254170:intron	45.0%
	GCATGTTGTTCTTGAGTGCT+TGG	+	chr8_2:52203598-52203617	Msa1254170:intron	45.0%
	TTGAGTGCTTGGAACAAGCA+GGG	+	chr8_2:52203609-52203628	Msa1254170:intron	45.0%
	AGACTTGAACAGTCTCCTCA+AGG	-	chr8_2:52203716-52203735	None:intergenic	45.0%
	AACCTGCACCTCCCTATATA+AGG	-	chr8_2:52203739-52203758	None:intergenic	45.0%
	CCCGATATCTGTAACCATCA+AGG	-	chr8_2:52203789-52203808	None:intergenic	45.0%
!	GCGTTACAAGTTGGCAATGA+TGG	+	chr8_2:52203824-52203843	Msa1254170:CDS	45.0%
	AAGCATATGCTCGAAATCCG+AGG	-	chr8_2:52203956-52203975	None:intergenic	45.0%
	TAGTCCAAGAATGACGACCT+GGG	-	chr8_2:52204002-52204021	None:intergenic	45.0%
	TTAGTCCAAGAATGACGACC+TGG	-	chr8_2:52204003-52204022	None:intergenic	45.0%
	TAGGGAAAAGGTCATGCTTG+CGG	+	chr8_2:52204058-52204077	Msa1254170:intron	45.0%
	CACGCATCCTTAAATGCTCA+AGG	-	chr8_2:52204174-52204193	None:intergenic	45.0%
	ATATCCCGCTAGCATGAAAG+TGG	+	chr8_2:52204300-52204319	Msa1254170:intron	45.0%
	ATCTGAGCAATCTCTTCGGA+AGG	+	chr8_2:52204358-52204377	Msa1254170:intron	45.0%
	CCACAAGAAACTCCTATCCT+CGG	-	chr8_2:52204425-52204444	None:intergenic	45.0%
	CGAGGATAGGAGTTTCTTGT+GGG	+	chr8_2:52204423-52204442	Msa1254170:intron	45.0%
	GAGTCCAATACACAGAGTAG+TGG	+	chr8_2:52205364-52205383	Msa1254170:CDS	45.0%
	TCTCTTTCTCTGAATCTGGG+CGG	-	chr8_2:52205430-52205449	None:intergenic	45.0%
	CTTTCATCTCACAGACTTCC+TGG	-	chr8_2:52205592-52205611	None:intergenic	45.0%
	GTGAAAGCGAAACCCTAATC+CGG	-	chr8_2:52205765-52205784	None:intergenic	45.0%
	TCGGCAGAGGTTGAGATAGT+TGG	+	chr8_2:52201964-52201983	Msa1254170:CDS	50.0%
!	GCAACTGTTTTCCGCTGTTC+AGG	+	chr8_2:52202312-52202331	Msa1254170:intron	50.0%
	GAAACGAGCTTGTCATCCCA+TGG	-	chr8_2:52202345-52202364	None:intergenic	50.0%
	CAAGTTCAGTGTCTTCGCCA+TGG	-	chr8_2:52203016-52203035	None:intergenic	50.0%
	CATGGCGAAGACACTGAACT+TGG	+	chr8_2:52203014-52203033	Msa1254170:CDS	50.0%
	GATCAGCCATAGGACATGGA+GGG	-	chr8_2:52203104-52203123	None:intergenic	50.0%
	TGATCAGCCATAGGACATGG+AGG	-	chr8_2:52203105-52203124	None:intergenic	50.0%
	GCATGATCAGCCATAGGACA+TGG	-	chr8_2:52203108-52203127	None:intergenic	50.0%
	TCCTATGGCTGATCATGCTC+TGG	+	chr8_2:52203110-52203129	Msa1254170:CDS	50.0%
	CCTATGGCTGATCATGCTCT+GGG	+	chr8_2:52203111-52203130	Msa1254170:CDS	50.0%
	CTTGAGTGCTTGGAACAAGC+AGG	+	chr8_2:52203608-52203627	Msa1254170:intron	50.0%
	TGAGTGCTTGGAACAAGCAG+GGG	+	chr8_2:52203610-52203629	Msa1254170:intron	50.0%
	TGAGCTAGAAAGGGGGCTTA+AGG	+	chr8_2:52203673-52203692	Msa1254170:intron	50.0%
	GAGCTAGAAAGGGGGCTTAA+GGG	+	chr8_2:52203674-52203693	Msa1254170:intron	50.0%
!	CTCCTTATATAGGGAGGTGC+AGG	+	chr8_2:52203734-52203753	Msa1254170:intron	50.0%
	GACACATAACCCCTCTCCAT+GGG	-	chr8_2:52203905-52203924	None:intergenic	50.0%
	AGTCCAAGAATGACGACCTG+GGG	-	chr8_2:52204001-52204020	None:intergenic	50.0%
	AGGGAAAAGGTCATGCTTGC+GGG	+	chr8_2:52204059-52204078	Msa1254170:intron	50.0%
	TGAGGATATGTTGCTCGGAG+AGG	+	chr8_2:52204277-52204296	Msa1254170:intron	50.0%
	ATATTACGAGTGAGTGGCCG+AGG	+	chr8_2:52204405-52204424	Msa1254170:intron	50.0%
	CCGAGGATAGGAGTTTCTTG+TGG	+	chr8_2:52204422-52204441	Msa1254170:intron	50.0%
	GAAGCTCAGACATTCCGACT+AGG	-	chr8_2:52204455-52204474	None:intergenic	50.0%
	TCTGCCACTAAGCAAGAGTG+AGG	-	chr8_2:52204491-52204510	None:intergenic	50.0%
	CAACTAGCATACGACCACCA+AGG	-	chr8_2:52204779-52204798	None:intergenic	50.0%
	AGTTGTGTCCAAGCTTGCGT+CGG	+	chr8_2:52204794-52204813	Msa1254170:intron	50.0%
	CAACTAGCATACGACCACCA+AGG	-	chr8_2:52204779-52204798	None:intergenic	50.0%
	AGTTGTGTCCAAGCTTGCGT+CGG	+	chr8_2:52204794-52204813	Msa1254170:intron	50.0%
	AGCATGTCACCTACCCTACT+TGG	+	chr8_2:52206031-52206050	Msa1254170:three_prime_UTR	50.0%
	GTCGGCGGATATGTCAATGC+AGG	+	chr8_2:52202932-52202951	Msa1254170:intron	55.0%
	CCCAGAGCATGATCAGCCAT+AGG	-	chr8_2:52203114-52203133	None:intergenic	55.0%
!	TATAGGGAGGTGCAGGTTGC+CGG	+	chr8_2:52203741-52203760	Msa1254170:intron	55.0%
	TGGGTGCTCGCAGCAATTTG+GGG	-	chr8_2:52203882-52203901	None:intergenic	55.0%
	GTGGGTGCTCGCAGCAATTT+GGG	-	chr8_2:52203883-52203902	None:intergenic	55.0%
	CATAACCCCTCTCCATGGGT+GGG	-	chr8_2:52203901-52203920	None:intergenic	55.0%
	ACATAACCCCTCTCCATGGG+TGG	-	chr8_2:52203902-52203921	None:intergenic	55.0%
	GGACACATAACCCCTCTCCA+TGG	-	chr8_2:52203906-52203925	None:intergenic	55.0%
	AGTCAAGAACAGTTGCCCCC+AGG	+	chr8_2:52203982-52204001	Msa1254170:intron	55.0%
	GTCCAAGAATGACGACCTGG+GGG	-	chr8_2:52204000-52204019	None:intergenic	55.0%
	CTTGTGGGCTTCGACCTAGT+CGG	+	chr8_2:52204438-52204457	Msa1254170:intron	55.0%
	GTTGTGTCCAAGCTTGCGTC+GGG	+	chr8_2:52204795-52204814	Msa1254170:intron	55.0%
	GTTGTGTCCAAGCTTGCGTC+GGG	+	chr8_2:52204795-52204814	Msa1254170:intron	55.0%
	GGTGGGTGCTCGCAGCAATT+TGG	-	chr8_2:52203884-52203903	None:intergenic	60.0%
	TGCCCCCAGGTCGTCATTCT+TGG	+	chr8_2:52203995-52204014	Msa1254170:intron	60.0%
	ACGAGTGAGTGGCCGAGGAT+AGG	+	chr8_2:52204410-52204429	Msa1254170:intron	60.0%
	GGTTAGACCCGACGCAAGCT+TGG	-	chr8_2:52204805-52204824	None:intergenic	60.0%
	GGTTAGACCCGACGCAAGCT+TGG	-	chr8_2:52204805-52204824	None:intergenic	60.0%
	TTGCTGCGAGCACCCACCCA+TGG	+	chr8_2:52203886-52203905	Msa1254170:CDS	65.0%
	CGAGCACCCACCCATGGAGA+GGG	+	chr8_2:52203892-52203911	Msa1254170:CDS	65.0%
	GAGCACCCACCCATGGAGAG+GGG	+	chr8_2:52203893-52203912	Msa1254170:CDS	65.0%
	GCGAGCACCCACCCATGGAG+AGG	+	chr8_2:52203891-52203910	Msa1254170:CDS	70.0%

Chromosome	Type	Strat	End	Strand	Name
chr8_2	gene	52201811	52206054	52201811	ID=Msa1254170;Name=Msa1254170
chr8_2	mRNA	52201811	52206054	52201811	ID=Msa1254170-mRNA-1;Parent=Msa1254170;Name=Msa1254170-mRNA-1;_AED=0.07;_eAED=0.07;_QI=144\|0.6\|0.83\|0.83\|0.8\|0.66\|6\|420\|392
chr8_2	exon	52201811	52202206	52201811	ID=Msa1254170-mRNA-1:exon:15972;Parent=Msa1254170-mRNA-1
chr8_2	exon	52202334	52202581	52202334	ID=Msa1254170-mRNA-1:exon:15973;Parent=Msa1254170-mRNA-1
chr8_2	exon	52202954	52203281	52202954	ID=Msa1254170-mRNA-1:exon:15974;Parent=Msa1254170-mRNA-1
chr8_2	exon	52203801	52203914	52203801	ID=Msa1254170-mRNA-1:exon:15975;Parent=Msa1254170-mRNA-1
chr8_2	exon	52205341	52205766	52205341	ID=Msa1254170-mRNA-1:exon:15976;Parent=Msa1254170-mRNA-1
chr8_2	exon	52205824	52206054	52205824	ID=Msa1254170-mRNA-1:exon:15977;Parent=Msa1254170-mRNA-1
chr8_2	five_prime_UTR	52201811	52201954	52201811	ID=Msa1254170-mRNA-1:five_prime_utr;Parent=Msa1254170-mRNA-1
chr8_2	CDS	52201955	52202206	52201955	ID=Msa1254170-mRNA-1:cds;Parent=Msa1254170-mRNA-1
chr8_2	CDS	52202334	52202581	52202334	ID=Msa1254170-mRNA-1:cds;Parent=Msa1254170-mRNA-1
chr8_2	CDS	52202954	52203281	52202954	ID=Msa1254170-mRNA-1:cds;Parent=Msa1254170-mRNA-1
chr8_2	CDS	52203801	52203914	52203801	ID=Msa1254170-mRNA-1:cds;Parent=Msa1254170-mRNA-1
chr8_2	CDS	52205341	52205577	52205341	ID=Msa1254170-mRNA-1:cds;Parent=Msa1254170-mRNA-1
chr8_2	three_prime_UTR	52205578	52205766	52205578	ID=Msa1254170-mRNA-1:three_prime_utr;Parent=Msa1254170-mRNA-1
chr8_2	three_prime_UTR	52205824	52206054	52205824	ID=Msa1254170-mRNA-1:three_prime_utr;Parent=Msa1254170-mRNA-1

Gene Sequence

>Msa1254170

ATGGAAGTGTCGGCAGAGGTTGAGATAGTTGGTAGTAAATCGGTTCAAGAGTTGGCATTGAATTCTGAAAATCTTCCACCAAATAATTATATCTATAATGAAGGTGGTGTTGGATTTCGTGATGCTCTTCTTCCTTCAGAATCAGATTTTCATGTTCCAATCATTGACATTGCCAACCTCACTTCTCCATCTACTTCACAACATGAGCTTCTTAAACTCCAAGCTGCACTTCATTCTTGTGGCTTCTTTCTGGTGATAAACCATGGGATGACAAGCTCGTTTCTTGACAAAGTGAGGGAAGTTTCAAAGCAATTTTTTGAACTTCCAAAGGAAGAAAAGCAAAAATATGCAAGGGAACAAAACAATATTGAAGGATATGGAAATGATACAATATATTCAGAAAATCAAATGCTTGATTGGTGTGACAGAATATTTTTGAAGGTACATCCTCAAGATCAAAGGAATTTCAAACTTTGGCCCCAAAACCCCATTGATTTCAGGAATACTATACAACAATATACCGAATGTATCTGGCAGTTATATGAAGTAATTTTAAGGGCCATGGCGAAGACACTGAACTTGGAAGAGGATTGTTTCCTAAAGGAATGTGGAGAGAGAGGTACAATGTCTATGAGAACCAATTACTACCCTCCATGTCCTATGGCTGATCATGCTCTGGGCCTGAAGCCACATTCTGATTCATCATCTATAACTTTTTTGCTGCAAGATAAAAAGGTAGAAGGCCTCCAAGTTCTCAAAGATAACCAGTGGTTTAAAGTTCCAATAATCCATGATGCTCTTGTGATTAATGTTGGTGATCAAATGGAGATATCGGGATCCGTAATTGTAAAGCGTTACAAGTTGGCAATGATGGAGGCAGTTACGAATCATTGTTTTGAATCGTTGCCCCAAATTGCTGCGAGCACCCACCCATGGAGAGGGATAATGAGCAATGGGATTTTTCAGAGTCCAATACACAGAGTAGTGGTAAATGCAGAAAGGGAAAGGCTCTCAGTAGCTATGTTTTGCCGCCCAGATTCAGAGAAAGAGATTCAACCGGTTGACAAACTAGTGAACGAGTCAAGGCCAGTATTATACAGACCAGTAAAAGATTGTGCTAAGATATTTCTCGAGTACTACCAACAAGGAAAAAGGCCAATTGATGCTTTCAAAATCTAA

Protein sequence

>Msa1254170

MEVSAEVEIVGSKSVQELALNSENLPPNNYIYNEGGVGFRDALLPSESDFHVPIIDIANLTSPSTSQHELLKLQAALHSCGFFLVINHGMTSSFLDKVREVSKQFFELPKEEKQKYAREQNNIEGYGNDTIYSENQMLDWCDRIFLKVHPQDQRNFKLWPQNPIDFRNTIQQYTECIWQLYEVILRAMAKTLNLEEDCFLKECGERGTMSMRTNYYPPCPMADHALGLKPHSDSSSITFLLQDKKVEGLQVLKDNQWFKVPIIHDALVINVGDQMEISGSVIVKRYKLAMMEAVTNHCFESLPQIAASTHPWRGIMSNGIFQSPIHRVVVNAERERLSVAMFCRPDSEKEIQPVDKLVNESRPVLYRPVKDCAKIFLEYYQQGKRPIDAFKI*