AlfalfaGEDB | Msa1302170

M. sativa cultivar zhongmu-4 / Msa1302170

KEGG: -
GO: GO:0003674 GO:0003824 GO:0007275 GO:0007568 GO:0008150 GO:0008152 GO:0010150 GO:0016491 GO:0016679 GO:0016682 GO:0032501 GO:0032502 GO:0048366 GO:0048367 GO:0048731 GO:0048827 GO:0048856 GO:0055114 GO:0090693 GO:0099402
PFAM: PF14226.9

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1302170	XP_024628133.1	85.969	392	24	2	1	392	1	361	0.0	689

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1302170	sp\|Q94LP4\|ODD11_ORYSJ	33.046	348	191	4	47	392	48	355	4.96e-65	214

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1302170	G7L9H5	85.459	392	19	1	1	392	1	354	0.0	687

TFs/TRs:

Gene ID	Type	Classification

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
Msa0003470	Msa1302170	0.877772	4.806121e-69	-8.615850e-47
Msa0004350	Msa1302170	0.811790	5.869361e-51	-8.615850e-47
Msa0007450	Msa1302170	0.816310	5.906306e-52	-8.615850e-47
Msa0008850	Msa1302170	0.808942	2.417093e-50	-8.615850e-47
Msa0009210	Msa1302170	0.802473	5.518583e-49	-8.615850e-47
Msa0012460	Msa1302170	0.847951	8.357053e-60	-8.615850e-47
Msa0013810	Msa1302170	0.827415	1.584309e-54	-8.615850e-47
Msa0017120	Msa1302170	0.882571	9.316309e-71	-8.615850e-47
Msa0018870	Msa1302170	0.819348	1.217892e-52	-8.615850e-47
Msa0030000	Msa1302170	0.805809	1.115712e-49	-8.615850e-47
Msa0030730	Msa1302170	0.801175	1.019168e-48	-8.615850e-47
Msa0032350	Msa1302170	0.818855	1.576243e-52	-8.615850e-47
Msa0033600	Msa1302170	0.825054	5.776843e-54	-8.615850e-47
Msa0033650	Msa1302170	0.827622	1.413485e-54	-8.615850e-47
Msa0034320	Msa1302170	0.839037	2.013515e-57	-8.615850e-47
Msa0035090	Msa1302170	0.837111	6.304103e-57	-8.615850e-47
Msa0037820	Msa1302170	0.801440	8.995898e-49	-8.615850e-47
Msa0039200	Msa1302170	0.805269	1.448081e-49	-8.615850e-47
Msa0040190	Msa1302170	0.814971	1.174045e-51	-8.615850e-47
Msa0041540	Msa1302170	0.802815	4.690678e-49	-8.615850e-47
Msa0043680	Msa1302170	0.835473	1.643811e-56	-8.615850e-47
Msa0044380	Msa1302170	0.804426	2.172764e-49	-8.615850e-47
Msa0047470	Msa1302170	0.810404	1.172226e-50	-8.615850e-47
Msa0049990	Msa1302170	0.817679	2.910288e-52	-8.615850e-47
Msa0056040	Msa1302170	0.863278	2.791277e-64	-8.615850e-47
Msa0057740	Msa1302170	0.801080	1.066106e-48	-8.615850e-47
Msa0058970	Msa1302170	0.800129	1.665541e-48	-8.615850e-47
Msa0059590	Msa1302170	0.804627	1.973133e-49	-8.615850e-47
Msa0061320	Msa1302170	0.807991	3.857149e-50	-8.615850e-47
Msa0062750	Msa1302170	0.814465	1.519586e-51	-8.615850e-47
Msa0065390	Msa1302170	0.877516	5.903307e-69	-8.615850e-47
Msa0073390	Msa1302170	0.802469	5.528624e-49	-8.615850e-47
Msa0075850	Msa1302170	0.817164	3.800404e-52	-8.615850e-47
Msa0077910	Msa1302170	0.838408	2.927039e-57	-8.615850e-47
Msa0078090	Msa1302170	0.811357	7.291981e-51	-8.615850e-47
Msa0078520	Msa1302170	0.802838	4.639520e-49	-8.615850e-47
Msa0079530	Msa1302170	0.802681	4.997870e-49	-8.615850e-47
Msa0081300	Msa1302170	0.815414	9.358020e-52	-8.615850e-47
Msa0082820	Msa1302170	0.817851	2.661313e-52	-8.615850e-47
Msa0083160	Msa1302170	0.818119	2.314395e-52	-8.615850e-47
Msa0083570	Msa1302170	0.823513	1.330216e-53	-8.615850e-47
Msa0084630	Msa1302170	0.816891	4.377251e-52	-8.615850e-47
Msa0084680	Msa1302170	0.808027	3.788233e-50	-8.615850e-47
Msa0086090	Msa1302170	0.801149	1.031940e-48	-8.615850e-47
Msa0086820	Msa1302170	0.805709	1.170996e-49	-8.615850e-47
Msa0089210	Msa1302170	0.851984	6.213200e-61	-8.615850e-47
Msa0092660	Msa1302170	0.842963	1.876037e-58	-8.615850e-47
Msa0092680	Msa1302170	0.815750	7.877983e-52	-8.615850e-47
Msa0092730	Msa1302170	0.837675	4.519630e-57	-8.615850e-47
Msa0094060	Msa1302170	0.818192	2.228726e-52	-8.615850e-47
Msa0094420	Msa1302170	0.857555	1.507284e-62	-8.615850e-47
Msa0097980	Msa1302170	0.823304	1.488968e-53	-8.615850e-47
Msa0102410	Msa1302170	0.814718	1.335982e-51	-8.615850e-47
Msa0102800	Msa1302170	0.811661	6.261444e-51	-8.615850e-47
Msa0103060	Msa1302170	0.811768	5.934013e-51	-8.615850e-47
Msa0103780	Msa1302170	0.843388	1.444560e-58	-8.615850e-47
Msa0104420	Msa1302170	0.833195	6.131295e-56	-8.615850e-47
Msa0107460	Msa1302170	0.840329	9.285016e-58	-8.615850e-47
Msa0110710	Msa1302170	0.876084	1.849296e-68	-8.615850e-47
Msa0112340	Msa1302170	0.827785	1.291576e-54	-8.615850e-47
Msa0115010	Msa1302170	0.806870	6.667643e-50	-8.615850e-47
Msa0604700	Msa1302170	0.827733	1.328780e-54	-8.615850e-47
Msa0605230	Msa1302170	0.809591	1.754135e-50	-8.615850e-47
Msa0606060	Msa1302170	0.823181	1.590072e-53	-8.615850e-47
Msa0606140	Msa1302170	0.833685	4.625885e-56	-8.615850e-47
Msa0607280	Msa1302170	0.816380	5.698632e-52	-8.615850e-47
Msa0607300	Msa1302170	0.832820	7.597534e-56	-8.615850e-47
Msa0607480	Msa1302170	0.804423	2.175398e-49	-8.615850e-47
Msa0609990	Msa1302170	0.808444	3.087736e-50	-8.615850e-47
Msa0614230	Msa1302170	0.866031	3.838226e-65	-8.615850e-47
Msa0619060	Msa1302170	0.841520	4.520547e-58	-8.615850e-47
Msa0619170	Msa1302170	0.800327	1.517933e-48	-8.615850e-47
Msa0619330	Msa1302170	0.838803	2.314505e-57	-8.615850e-47
Msa0620090	Msa1302170	0.832965	6.993869e-56	-8.615850e-47
Msa0622390	Msa1302170	0.850694	1.438401e-60	-8.615850e-47
Msa0624220	Msa1302170	0.823573	1.288152e-53	-8.615850e-47
Msa0624240	Msa1302170	0.834940	2.241061e-56	-8.615850e-47
Msa0626890	Msa1302170	0.810891	9.197793e-51	-8.615850e-47
Msa0628060	Msa1302170	0.802797	4.729802e-49	-8.615850e-47
Msa0629500	Msa1302170	0.802880	4.546899e-49	-8.615850e-47
Msa0631340	Msa1302170	0.804595	2.003681e-49	-8.615850e-47
Msa0634270	Msa1302170	0.804559	2.038641e-49	-8.615850e-47
Msa0635130	Msa1302170	0.814113	1.817954e-51	-8.615850e-47
Msa0635990	Msa1302170	0.816033	6.810158e-52	-8.615850e-47
Msa0637850	Msa1302170	0.821450	4.010819e-53	-8.615850e-47
Msa0638710	Msa1302170	0.820208	7.745048e-53	-8.615850e-47
Msa0640390	Msa1302170	0.803812	2.915289e-49	-8.615850e-47
Msa0640880	Msa1302170	0.866785	2.212109e-65	-8.615850e-47
Msa0642650	Msa1302170	0.829412	5.223929e-55	-8.615850e-47
Msa0643800	Msa1302170	0.830880	2.288468e-55	-8.615850e-47
Msa0645780	Msa1302170	0.802366	5.805528e-49	-8.615850e-47
Msa0646710	Msa1302170	0.805734	1.156899e-49	-8.615850e-47
Msa0647110	Msa1302170	0.860746	1.665857e-63	-8.615850e-47
Msa0647460	Msa1302170	0.804605	1.993789e-49	-8.615850e-47
Msa0653710	Msa1302170	0.856059	4.155460e-62	-8.615850e-47
Msa0654060	Msa1302170	0.843280	1.544076e-58	-8.615850e-47
Msa0659130	Msa1302170	0.810927	9.033934e-51	-8.615850e-47
Msa0659960	Msa1302170	0.827804	1.278111e-54	-8.615850e-47
Msa0660820	Msa1302170	0.810678	1.022913e-50	-8.615850e-47
Msa0662850	Msa1302170	0.817663	2.934882e-52	-8.615850e-47
Msa0665910	Msa1302170	-0.820891	5.396505e-53	-8.615850e-47
Msa0667220	Msa1302170	0.834810	2.415966e-56	-8.615850e-47
Msa0667970	Msa1302170	0.830251	3.263297e-55	-8.615850e-47
Msa0672350	Msa1302170	0.800729	1.257049e-48	-8.615850e-47
Msa0678890	Msa1302170	0.820859	5.489655e-53	-8.615850e-47
Msa0681890	Msa1302170	0.868534	6.081796e-66	-8.615850e-47
Msa0682400	Msa1302170	0.806217	9.155832e-50	-8.615850e-47
Msa0683650	Msa1302170	0.816622	5.028728e-52	-8.615850e-47
Msa0685520	Msa1302170	0.820240	7.615060e-53	-8.615850e-47
Msa0685540	Msa1302170	0.811026	8.600965e-51	-8.615850e-47
Msa0686610	Msa1302170	0.824973	6.037145e-54	-8.615850e-47
Msa0690350	Msa1302170	0.834876	2.325426e-56	-8.615850e-47
Msa0690500	Msa1302170	0.817657	2.942902e-52	-8.615850e-47
Msa0690720	Msa1302170	0.821116	4.791244e-53	-8.615850e-47
Msa0698880	Msa1302170	0.806602	7.596514e-50	-8.615850e-47
Msa0698900	Msa1302170	0.811995	5.297396e-51	-8.615850e-47
Msa0700910	Msa1302170	0.819074	1.405957e-52	-8.615850e-47
Msa0701320	Msa1302170	0.817573	3.074331e-52	-8.615850e-47
Msa0702070	Msa1302170	0.837725	4.388350e-57	-8.615850e-47
Msa0702120	Msa1302170	0.829038	6.435544e-55	-8.615850e-47
Msa0703720	Msa1302170	0.853501	2.291443e-61	-8.615850e-47
Msa0703760	Msa1302170	0.860845	1.554406e-63	-8.615850e-47
Msa0704570	Msa1302170	0.806500	7.982465e-50	-8.615850e-47
Msa0704720	Msa1302170	0.803180	3.942817e-49	-8.615850e-47
Msa0704990	Msa1302170	0.815911	7.253442e-52	-8.615850e-47
Msa0705030	Msa1302170	0.817857	2.652259e-52	-8.615850e-47
Msa0705610	Msa1302170	0.823022	1.732130e-53	-8.615850e-47
Msa0707780	Msa1302170	0.839699	1.355093e-57	-8.615850e-47
Msa0709480	Msa1302170	0.856246	3.663313e-62	-8.615850e-47
Msa0712500	Msa1302170	0.802448	5.583875e-49	-8.615850e-47
Msa0714020	Msa1302170	0.819593	1.070543e-52	-8.615850e-47
Msa0714160	Msa1302170	0.814244	1.700254e-51	-8.615850e-47
Msa0716670	Msa1302170	0.803207	3.892861e-49	-8.615850e-47
Msa0717090	Msa1302170	0.820688	6.009604e-53	-8.615850e-47
Msa0719340	Msa1302170	0.856108	4.019864e-62	-8.615850e-47
Msa0720270	Msa1302170	0.833151	6.289046e-56	-8.615850e-47
Msa0724050	Msa1302170	0.807084	6.006724e-50	-8.615850e-47
Msa0730180	Msa1302170	0.834028	3.797209e-56	-8.615850e-47
Msa0732100	Msa1302170	0.812049	5.154477e-51	-8.615850e-47
Msa0733000	Msa1302170	0.810945	8.955718e-51	-8.615850e-47
Msa0733110	Msa1302170	0.822694	2.064959e-53	-8.615850e-47
Msa0734430	Msa1302170	0.815117	1.089772e-51	-8.615850e-47
Msa0736930	Msa1302170	0.818771	1.647114e-52	-8.615850e-47
Msa0738870	Msa1302170	0.814743	1.318669e-51	-8.615850e-47
Msa0738880	Msa1302170	0.823065	1.692745e-53	-8.615850e-47
Msa0738970	Msa1302170	0.847492	1.117497e-59	-8.615850e-47
Msa0739570	Msa1302170	0.834610	2.713311e-56	-8.615850e-47
Msa0739610	Msa1302170	0.820745	5.832762e-53	-8.615850e-47
Msa0740420	Msa1302170	0.859705	3.438523e-63	-8.615850e-47
Msa0742130	Msa1302170	0.829649	4.573419e-55	-8.615850e-47
Msa0744450	Msa1302170	0.807023	6.190022e-50	-8.615850e-47
Msa0756480	Msa1302170	0.801245	9.860108e-49	-8.615850e-47
Msa0761790	Msa1302170	0.833780	4.380394e-56	-8.615850e-47
Msa0763880	Msa1302170	0.815364	9.603161e-52	-8.615850e-47
Msa0763910	Msa1302170	0.821603	3.697870e-53	-8.615850e-47
Msa0766880	Msa1302170	0.822110	2.823151e-53	-8.615850e-47
Msa0770430	Msa1302170	0.814349	1.612151e-51	-8.615850e-47
Msa0771960	Msa1302170	0.814542	1.461180e-51	-8.615850e-47
Msa0772150	Msa1302170	0.864497	1.165045e-64	-8.615850e-47
Msa0772210	Msa1302170	0.824130	9.535829e-54	-8.615850e-47
Msa0773080	Msa1302170	0.824556	7.571341e-54	-8.615850e-47
Msa0774090	Msa1302170	0.801452	8.945331e-49	-8.615850e-47
Msa0778060	Msa1302170	0.813113	3.017061e-51	-8.615850e-47
Msa0780140	Msa1302170	0.815121	1.087024e-51	-8.615850e-47
Msa0782330	Msa1302170	0.848636	5.401514e-60	-8.615850e-47
Msa0783270	Msa1302170	0.827698	1.355199e-54	-8.615850e-47
Msa0783280	Msa1302170	0.825628	4.226241e-54	-8.615850e-47
Msa0786090	Msa1302170	0.867195	1.636422e-65	-8.615850e-47
Msa0790180	Msa1302170	0.801184	1.014785e-48	-8.615850e-47
Msa0790830	Msa1302170	0.841531	4.490773e-58	-8.615850e-47
Msa0793060	Msa1302170	0.825693	4.077529e-54	-8.615850e-47
Msa0796450	Msa1302170	0.833922	4.036475e-56	-8.615850e-47
Msa0802500	Msa1302170	0.862886	3.689398e-64	-8.615850e-47
Msa0803130	Msa1302170	0.848886	4.606380e-60	-8.615850e-47
Msa0804110	Msa1302170	0.829698	4.450012e-55	-8.615850e-47
Msa0804930	Msa1302170	0.828591	8.257296e-55	-8.615850e-47
Msa0808420	Msa1302170	0.815582	8.586774e-52	-8.615850e-47
Msa0810370	Msa1302170	0.814912	1.209876e-51	-8.615850e-47
Msa0811510	Msa1302170	0.809060	2.280822e-50	-8.615850e-47
Msa0811710	Msa1302170	0.803843	2.873142e-49	-8.615850e-47
Msa0814760	Msa1302170	0.833147	6.302241e-56	-8.615850e-47
Msa0819320	Msa1302170	0.829414	5.216765e-55	-8.615850e-47
Msa0819330	Msa1302170	0.805677	1.189108e-49	-8.615850e-47
Msa0819370	Msa1302170	0.829853	4.080546e-55	-8.615850e-47
Msa0819470	Msa1302170	0.839405	1.616499e-57	-8.615850e-47
Msa0820670	Msa1302170	0.855787	4.989056e-62	-8.615850e-47
Msa0823300	Msa1302170	0.863378	2.598090e-64	-8.615850e-47
Msa0824140	Msa1302170	0.803906	2.788024e-49	-8.615850e-47
Msa0830410	Msa1302170	0.809988	1.441509e-50	-8.615850e-47
Msa0838660	Msa1302170	0.808685	2.743181e-50	-8.615850e-47
Msa0841490	Msa1302170	0.847218	1.328644e-59	-8.615850e-47
Msa0841980	Msa1302170	0.809484	1.849715e-50	-8.615850e-47
Msa0842220	Msa1302170	0.812317	4.504803e-51	-8.615850e-47
Msa0122210	Msa1302170	0.811899	5.556934e-51	-8.615850e-47
Msa0123940	Msa1302170	0.838849	2.252645e-57	-8.615850e-47
Msa0125230	Msa1302170	0.829107	6.193048e-55	-8.615850e-47
Msa0125800	Msa1302170	0.845319	4.373063e-59	-8.615850e-47
Msa0126300	Msa1302170	0.812296	4.552618e-51	-8.615850e-47
Msa0127080	Msa1302170	0.807925	3.982344e-50	-8.615850e-47
Msa0130120	Msa1302170	0.822728	2.028196e-53	-8.615850e-47
Msa0130800	Msa1302170	0.802184	6.328676e-49	-8.615850e-47
Msa0132620	Msa1302170	0.803401	3.547819e-49	-8.615850e-47
Msa0133670	Msa1302170	0.806915	6.524243e-50	-8.615850e-47
Msa0133880	Msa1302170	0.811435	7.009805e-51	-8.615850e-47
Msa0134550	Msa1302170	0.807543	4.801565e-50	-8.615850e-47
Msa0135980	Msa1302170	0.822816	1.934968e-53	-8.615850e-47
Msa0137600	Msa1302170	0.833473	5.227991e-56	-8.615850e-47
Msa0139740	Msa1302170	0.824785	6.685637e-54	-8.615850e-47
Msa0141550	Msa1302170	0.826528	2.582709e-54	-8.615850e-47
Msa0141670	Msa1302170	0.866903	2.028381e-65	-8.615850e-47
Msa0143490	Msa1302170	0.807208	5.654289e-50	-8.615850e-47
Msa0143970	Msa1302170	0.809452	1.878794e-50	-8.615850e-47
Msa0143980	Msa1302170	0.813217	2.862973e-51	-8.615850e-47
Msa0144340	Msa1302170	0.857865	1.220060e-62	-8.615850e-47
Msa0146470	Msa1302170	0.871589	6.090356e-67	-8.615850e-47
Msa0147990	Msa1302170	0.808790	2.605229e-50	-8.615850e-47
Msa0149070	Msa1302170	0.818756	1.660361e-52	-8.615850e-47
Msa0150210	Msa1302170	0.837406	5.296077e-57	-8.615850e-47
Msa0152380	Msa1302170	0.846868	1.657069e-59	-8.615850e-47
Msa0155540	Msa1302170	0.808619	2.833101e-50	-8.615850e-47
Msa0155550	Msa1302170	0.822520	2.267530e-53	-8.615850e-47
Msa0157020	Msa1302170	0.870788	1.120177e-66	-8.615850e-47
Msa0157350	Msa1302170	0.808884	2.487034e-50	-8.615850e-47
Msa0162030	Msa1302170	0.812655	3.801273e-51	-8.615850e-47
Msa0162070	Msa1302170	0.809739	1.630205e-50	-8.615850e-47
Msa0164540	Msa1302170	0.806125	9.576121e-50	-8.615850e-47
Msa0168390	Msa1302170	0.817646	2.959918e-52	-8.615850e-47
Msa0168900	Msa1302170	0.832750	7.912252e-56	-8.615850e-47
Msa0170440	Msa1302170	0.839450	1.573582e-57	-8.615850e-47
Msa0173610	Msa1302170	0.839364	1.656452e-57	-8.615850e-47
Msa0175280	Msa1302170	0.807848	4.137165e-50	-8.615850e-47
Msa0175530	Msa1302170	0.801823	7.506965e-49	-8.615850e-47
Msa0175900	Msa1302170	0.832989	6.898485e-56	-8.615850e-47
Msa0176710	Msa1302170	0.811276	7.590004e-51	-8.615850e-47
Msa0181010	Msa1302170	0.823731	1.182529e-53	-8.615850e-47
Msa0181290	Msa1302170	0.809595	1.751075e-50	-8.615850e-47
Msa0182610	Msa1302170	0.805830	1.104736e-49	-8.615850e-47
Msa0184120	Msa1302170	0.808435	3.102118e-50	-8.615850e-47
Msa0185390	Msa1302170	0.856247	3.660980e-62	-8.615850e-47
Msa0185550	Msa1302170	0.842843	2.019036e-58	-8.615850e-47
Msa0190000	Msa1302170	0.809887	1.515496e-50	-8.615850e-47
Msa0192020	Msa1302170	0.807434	5.063902e-50	-8.615850e-47
Msa0194570	Msa1302170	0.811424	7.049891e-51	-8.615850e-47
Msa0197900	Msa1302170	0.802002	6.896663e-49	-8.615850e-47
Msa0202630	Msa1302170	0.818445	1.952600e-52	-8.615850e-47
Msa0203180	Msa1302170	0.809124	2.209858e-50	-8.615850e-47
Msa0206080	Msa1302170	0.837898	3.960017e-57	-8.615850e-47
Msa0206120	Msa1302170	0.814290	1.661382e-51	-8.615850e-47
Msa0206940	Msa1302170	0.804263	2.349285e-49	-8.615850e-47
Msa0206970	Msa1302170	0.846211	2.503773e-59	-8.615850e-47
Msa0207180	Msa1302170	0.825159	5.456018e-54	-8.615850e-47
Msa0212370	Msa1302170	0.816621	5.032448e-52	-8.615850e-47
Msa0213080	Msa1302170	0.838675	2.497507e-57	-8.615850e-47
Msa0215980	Msa1302170	0.830698	2.536646e-55	-8.615850e-47
Msa0216010	Msa1302170	0.813571	2.392293e-51	-8.615850e-47
Msa0216210	Msa1302170	0.803807	2.923272e-49	-8.615850e-47
Msa0216790	Msa1302170	0.802126	6.504028e-49	-8.615850e-47
Msa0217470	Msa1302170	0.843174	1.647543e-58	-8.615850e-47
Msa0219660	Msa1302170	0.820498	6.645881e-53	-8.615850e-47
Msa0221800	Msa1302170	0.827575	1.450345e-54	-8.615850e-47
Msa0222070	Msa1302170	0.845381	4.207441e-59	-8.615850e-47
Msa0222120	Msa1302170	0.843743	1.161569e-58	-8.615850e-47
Msa0223280	Msa1302170	0.824206	9.152553e-54	-8.615850e-47
Msa0223390	Msa1302170	0.824075	9.824557e-54	-8.615850e-47
Msa0224960	Msa1302170	0.824895	6.298124e-54	-8.615850e-47
Msa0225010	Msa1302170	0.835239	1.884374e-56	-8.615850e-47
Msa0227290	Msa1302170	0.844172	8.914097e-59	-8.615850e-47
Msa0227490	Msa1302170	0.814819	1.268394e-51	-8.615850e-47
Msa0227500	Msa1302170	0.815552	8.719157e-52	-8.615850e-47
Msa0230400	Msa1302170	0.841124	5.745643e-58	-8.615850e-47
Msa1226360	Msa1302170	0.812303	4.538229e-51	-8.615850e-47
Msa1226600	Msa1302170	0.807221	5.619760e-50	-8.615850e-47
Msa1228950	Msa1302170	0.801058	1.076930e-48	-8.615850e-47
Msa1229050	Msa1302170	0.824900	6.281800e-54	-8.615850e-47
Msa1232010	Msa1302170	0.858294	9.091727e-63	-8.615850e-47
Msa1232860	Msa1302170	0.855005	8.431381e-62	-8.615850e-47
Msa1235890	Msa1302170	0.823170	1.599808e-53	-8.615850e-47
Msa1244180	Msa1302170	0.813816	2.113152e-51	-8.615850e-47
Msa1244260	Msa1302170	0.800447	1.435056e-48	-8.615850e-47
Msa1246420	Msa1302170	0.817012	4.111114e-52	-8.615850e-47
Msa1248400	Msa1302170	0.833297	5.783813e-56	-8.615850e-47
Msa1250670	Msa1302170	0.823032	1.723342e-53	-8.615850e-47
Msa1252730	Msa1302170	0.840421	8.787050e-58	-8.615850e-47
Msa1254170	Msa1302170	0.875892	2.153618e-68	-8.615850e-47
Msa1254190	Msa1302170	0.816536	5.257856e-52	-8.615850e-47
Msa1254210	Msa1302170	0.805374	1.376630e-49	-8.615850e-47
Msa1254770	Msa1302170	0.808104	3.648996e-50	-8.615850e-47
Msa1254800	Msa1302170	0.805416	1.348983e-49	-8.615850e-47
Msa1258810	Msa1302170	0.804602	1.996196e-49	-8.615850e-47
Msa1258940	Msa1302170	0.818193	2.227797e-52	-8.615850e-47
Msa1263030	Msa1302170	0.808690	2.736251e-50	-8.615850e-47
Msa1267860	Msa1302170	0.804319	2.286934e-49	-8.615850e-47
Msa1271490	Msa1302170	0.824911	6.243143e-54	-8.615850e-47
Msa1271510	Msa1302170	0.829539	4.866025e-55	-8.615850e-47
Msa1271600	Msa1302170	0.824483	7.879122e-54	-8.615850e-47
Msa1274740	Msa1302170	0.832640	8.424352e-56	-8.615850e-47
Msa1275290	Msa1302170	0.831790	1.366695e-55	-8.615850e-47
Msa1279700	Msa1302170	0.814568	1.442046e-51	-8.615850e-47
Msa1280020	Msa1302170	0.809297	2.028272e-50	-8.615850e-47
Msa1284030	Msa1302170	0.824568	7.521673e-54	-8.615850e-47
Msa1289340	Msa1302170	0.803145	4.008087e-49	-8.615850e-47
Msa1291400	Msa1302170	0.817002	4.132981e-52	-8.615850e-47
Msa1293530	Msa1302170	0.855057	8.145026e-62	-8.615850e-47
Msa1298740	Msa1302170	0.816841	4.490548e-52	-8.615850e-47
Msa1300880	Msa1302170	0.831458	1.650560e-55	-8.615850e-47
Msa1302150	Msa1302170	0.850784	1.357409e-60	-8.615850e-47
Msa1302160	Msa1302170	0.936404	1.832323e-97	-8.615850e-47
Msa1302170	Msa1302920	0.819149	1.351313e-52	-8.615850e-47
Msa1302170	Msa1305650	0.806274	8.907814e-50	-8.615850e-47
Msa1302170	Msa1306540	0.811992	5.305455e-51	-8.615850e-47
Msa1302170	Msa1307370	0.806439	8.222910e-50	-8.615850e-47
Msa1302170	Msa1309100	0.829481	5.025171e-55	-8.615850e-47
Msa1302170	Msa1309360	0.818628	1.774866e-52	-8.615850e-47
Msa1302170	Msa1309910	0.846159	2.587555e-59	-8.615850e-47
Msa1302170	Msa1312730	0.839520	1.508653e-57	-8.615850e-47
Msa1302170	Msa1315980	0.835684	1.454040e-56	-8.615850e-47
Msa1302170	Msa1316170	0.810080	1.376896e-50	-8.615850e-47
Msa1302170	Msa1319440	0.800488	1.408118e-48	-8.615850e-47
Msa1302170	Msa1319520	0.813560	2.405732e-51	-8.615850e-47
Msa1302170	Msa1323060	0.815444	9.218532e-52	-8.615850e-47
Msa1302170	Msa1324940	0.801232	9.921240e-49	-8.615850e-47
Msa1302170	Msa1325650	0.818456	1.941487e-52	-8.615850e-47
Msa1302170	Msa1325980	0.847018	1.507956e-59	-8.615850e-47
Msa1302170	Msa1326000	0.811838	5.731631e-51	-8.615850e-47
Msa1302170	Msa1327040	0.806140	9.505645e-50	-8.615850e-47
Msa1302170	Msa1327820	0.833762	4.426305e-56	-8.615850e-47
Msa1302170	Msa1330240	0.800832	1.197952e-48	-8.615850e-47
Msa1302170	Msa1331900	0.834262	3.318138e-56	-8.615850e-47
Msa1302170	Msa1334650	0.834250	3.340364e-56	-8.615850e-47
Msa1302170	Msa1336320	0.835789	1.367243e-56	-8.615850e-47
Msa1302170	Msa1337340	0.811676	6.215643e-51	-8.615850e-47
Msa1302170	Msa1339250	0.861404	1.050901e-63	-8.615850e-47
Msa1302170	Msa1344430	0.816345	5.801263e-52	-8.615850e-47
Msa1302170	Msa1345470	0.803406	3.539710e-49	-8.615850e-47
Msa1302170	Msa1349360	0.816954	4.236285e-52	-8.615850e-47
Msa1302170	Msa1351560	0.806645	7.437566e-50	-8.615850e-47
Msa1302170	Msa1352820	0.834894	2.301938e-56	-8.615850e-47
Msa1302170	Msa1354040	0.839875	1.219954e-57	-8.615850e-47
Msa1302170	Msa1355260	0.808801	2.591080e-50	-8.615850e-47
Msa1302170	Msa1365210	0.829512	4.939248e-55	-8.615850e-47
Msa1302170	Msa1366620	0.823077	1.681626e-53	-8.615850e-47
Msa1302170	Msa1367810	0.862163	6.157374e-64	-8.615850e-47
Msa1302170	Msa1367940	0.838869	2.225237e-57	-8.615850e-47
Msa1302170	Msa1368730	0.843225	1.597336e-58	-8.615850e-47
Msa1302170	Msa1369860	0.807518	4.861473e-50	-8.615850e-47
Msa1302170	Msa1372560	0.850032	2.207290e-60	-8.615850e-47
Msa1302170	Msa1373500	0.816890	4.379896e-52	-8.615850e-47
Msa1302170	Msa1374810	0.837969	3.797653e-57	-8.615850e-47
Msa1302170	Msa1375400	0.813648	2.300947e-51	-8.615850e-47
Msa1302170	Msa1375630	0.848119	7.508422e-60	-8.615850e-47
Msa1302170	Msa1376530	0.849434	3.241124e-60	-8.615850e-47
Msa1302170	Msa1376590	0.800938	1.139448e-48	-8.615850e-47
Msa1302170	Msa1376640	0.811413	7.090054e-51	-8.615850e-47
Msa1302170	Msa1379370	0.809394	1.933558e-50	-8.615850e-47
Msa1302170	Msa1379980	0.809145	2.186789e-50	-8.615850e-47
Msa1302170	Msa1381130	0.852593	4.169270e-61	-8.615850e-47
Msa1302170	Msa1385940	0.805421	1.346158e-49	-8.615850e-47
Msa1302170	Msa1388230	0.814562	1.446205e-51	-8.615850e-47
Msa1302170	Msa1388850	0.867158	1.682089e-65	-8.615850e-47
Msa1302170	Msa1392680	0.810174	1.313918e-50	-8.615850e-47
Msa1302170	Msa1397110	0.809014	2.332247e-50	-8.615850e-47
Msa1302170	Msa1397540	0.811612	6.418446e-51	-8.615850e-47
Msa1302170	Msa1398840	0.837574	4.796312e-57	-8.615850e-47
Msa1302170	Msa1403900	0.812000	5.283991e-51	-8.615850e-47
Msa1302170	Msa1404370	0.822071	2.881674e-53	-8.615850e-47
Msa1302170	Msa1404790	0.811038	8.550096e-51	-8.615850e-47
Msa1302170	Msa1405770	0.865415	6.005088e-65	-8.615850e-47
Msa1302170	Msa1406230	0.843349	1.479549e-58	-8.615850e-47
Msa1302170	Msa1406550	0.808436	3.099809e-50	-8.615850e-47
Msa1302170	Msa1406880	0.812701	3.712946e-51	-8.615850e-47
Msa1302170	Msa1407710	0.849132	3.933161e-60	-8.615850e-47
Msa1302170	Msa1410170	0.837169	6.092232e-57	-8.615850e-47
Msa1302170	Msa1412080	0.801251	9.834379e-49	-8.615850e-47
Msa1302170	Msa1412520	0.829399	5.261160e-55	-8.615850e-47
Msa1302170	Msa1415120	0.822300	2.550174e-53	-8.615850e-47
Msa1302170	Msa1415250	0.826987	2.006225e-54	-8.615850e-47
Msa1302170	Msa1416460	0.841688	4.083696e-58	-8.615850e-47
Msa1302170	Msa1418200	0.806721	7.169817e-50	-8.615850e-47
Msa1302170	Msa1421810	0.804376	2.225789e-49	-8.615850e-47
Msa1302170	Msa1422490	0.836649	8.269993e-57	-8.615850e-47
Msa1302170	Msa1422750	0.821864	3.218988e-53	-8.615850e-47
Msa1302170	Msa1424240	0.818049	2.401159e-52	-8.615850e-47
Msa1302170	Msa1427020	0.811514	6.740514e-51	-8.615850e-47
Msa1302170	Msa1429830	0.811809	5.815567e-51	-8.615850e-47
Msa1302170	Msa1430270	0.810143	1.334280e-50	-8.615850e-47
Msa1302170	Msa1432470	0.829894	3.985974e-55	-8.615850e-47
Msa1302170	Msa1434020	0.801419	9.086113e-49	-8.615850e-47
Msa1302170	Msa1435040	0.818116	2.317983e-52	-8.615850e-47
Msa1302170	Msa1435050	0.821115	4.791946e-53	-8.615850e-47
Msa1302170	Msa1435470	0.823127	1.637407e-53	-8.615850e-47
Msa1302170	Msa1435670	0.807259	5.517092e-50	-8.615850e-47
Msa1302170	Msa1435910	0.814291	1.660527e-51	-8.615850e-47
Msa1302170	Msa1437150	0.845585	3.704433e-59	-8.615850e-47
Msa1302170	Msa1437320	0.815980	7.001149e-52	-8.615850e-47
Msa1302170	Msa1439670	0.820388	7.042586e-53	-8.615850e-47
Msa1302170	Msa1439680	0.813687	2.256127e-51	-8.615850e-47
Msa1302170	Msa1439800	0.807357	5.259389e-50	-8.615850e-47
Msa1302170	Msa1440180	0.810188	1.304893e-50	-8.615850e-47
Msa1302170	Msa1449600	0.815367	9.584558e-52	-8.615850e-47
Msa1302170	Msa1449680	0.840904	6.565624e-58	-8.615850e-47
Msa1302170	Msa1449740	0.806892	6.595209e-50	-8.615850e-47
Msa1302170	Msa1451840	0.835841	1.327107e-56	-8.615850e-47
Msa1302170	Msa1458330	0.841045	6.027894e-58	-8.615850e-47
Msa1302170	Msa1458920	0.829287	5.601558e-55	-8.615850e-47
Msa1302170	Msa1460650	0.809255	2.071282e-50	-8.615850e-47
Msa1302170	Msa1464800	0.830016	3.723867e-55	-8.615850e-47
Msa0367370	Msa1302170	0.820888	5.407309e-53	-8.615850e-47
Msa0367490	Msa1302170	0.826620	2.454304e-54	-8.615850e-47
Msa0368430	Msa1302170	0.806985	6.305479e-50	-8.615850e-47
Msa0369780	Msa1302170	0.829179	5.950920e-55	-8.615850e-47
Msa0370180	Msa1302170	0.820697	5.982297e-53	-8.615850e-47
Msa0370510	Msa1302170	0.802824	4.671132e-49	-8.615850e-47
Msa0371610	Msa1302170	0.852367	4.837011e-61	-8.615850e-47
Msa0375430	Msa1302170	0.836078	1.155299e-56	-8.615850e-47
Msa0376900	Msa1302170	0.812347	4.438507e-51	-8.615850e-47
Msa0377460	Msa1302170	0.828213	1.018881e-54	-8.615850e-47
Msa0378750	Msa1302170	0.801897	7.250168e-49	-8.615850e-47
Msa0379110	Msa1302170	0.829616	4.658426e-55	-8.615850e-47
Msa0379390	Msa1302170	0.806811	6.861633e-50	-8.615850e-47
Msa0379450	Msa1302170	0.800895	1.162682e-48	-8.615850e-47
Msa0380060	Msa1302170	0.846173	2.565103e-59	-8.615850e-47
Msa0380360	Msa1302170	0.819186	1.325592e-52	-8.615850e-47
Msa0380420	Msa1302170	0.849534	3.040129e-60	-8.615850e-47
Msa0380430	Msa1302170	0.824234	9.013562e-54	-8.615850e-47
Msa0382290	Msa1302170	0.824287	8.757981e-54	-8.615850e-47
Msa0382500	Msa1302170	0.834631	2.679943e-56	-8.615850e-47
Msa0382560	Msa1302170	0.822988	1.764603e-53	-8.615850e-47
Msa0392410	Msa1302170	0.813806	2.124007e-51	-8.615850e-47
Msa0392450	Msa1302170	0.825742	3.971326e-54	-8.615850e-47
Msa0392480	Msa1302170	0.819470	1.142147e-52	-8.615850e-47
Msa0393540	Msa1302170	0.812819	3.499860e-51	-8.615850e-47
Msa0399180	Msa1302170	0.825196	5.346874e-54	-8.615850e-47
Msa0404870	Msa1302170	0.805732	1.158170e-49	-8.615850e-47
Msa0411560	Msa1302170	0.836794	7.594241e-57	-8.615850e-47
Msa0413180	Msa1302170	0.807475	4.964325e-50	-8.615850e-47
Msa0413740	Msa1302170	0.802794	4.737026e-49	-8.615850e-47
Msa0414990	Msa1302170	0.819152	1.349568e-52	-8.615850e-47
Msa0415050	Msa1302170	0.821293	4.360986e-53	-8.615850e-47
Msa0415460	Msa1302170	0.832254	1.050059e-55	-8.615850e-47
Msa0415930	Msa1302170	0.820888	5.405794e-53	-8.615850e-47
Msa0417150	Msa1302170	0.820039	8.465169e-53	-8.615850e-47
Msa0417630	Msa1302170	0.861919	7.311744e-64	-8.615850e-47
Msa0418480	Msa1302170	0.804367	2.234751e-49	-8.615850e-47
Msa0420070	Msa1302170	0.840532	8.214932e-58	-8.615850e-47
Msa0421800	Msa1302170	0.854986	8.539341e-62	-8.615850e-47
Msa0423110	Msa1302170	0.809913	1.495719e-50	-8.615850e-47
Msa0423600	Msa1302170	0.814748	1.315151e-51	-8.615850e-47
Msa0426860	Msa1302170	0.832510	9.073687e-56	-8.615850e-47
Msa0426890	Msa1302170	0.824896	6.297235e-54	-8.615850e-47
Msa0427050	Msa1302170	0.816145	6.430418e-52	-8.615850e-47
Msa0429270	Msa1302170	0.842344	2.739281e-58	-8.615850e-47
Msa0431800	Msa1302170	0.818650	1.755206e-52	-8.615850e-47
Msa0432680	Msa1302170	0.843268	1.555438e-58	-8.615850e-47
Msa0434630	Msa1302170	0.828681	7.853762e-55	-8.615850e-47
Msa0436450	Msa1302170	0.804205	2.415491e-49	-8.615850e-47
Msa0440110	Msa1302170	0.803697	3.080553e-49	-8.615850e-47
Msa0446480	Msa1302170	0.802928	4.445315e-49	-8.615850e-47
Msa0458110	Msa1302170	0.814256	1.690206e-51	-8.615850e-47
Msa0458790	Msa1302170	0.806708	7.214646e-50	-8.615850e-47
Msa0463990	Msa1302170	0.805331	1.405655e-49	-8.615850e-47
Msa0464500	Msa1302170	0.815428	9.291732e-52	-8.615850e-47
Msa0465860	Msa1302170	0.808227	3.434725e-50	-8.615850e-47
Msa0466070	Msa1302170	0.800557	1.362726e-48	-8.615850e-47
Msa0466100	Msa1302170	0.833199	6.116244e-56	-8.615850e-47
Msa0467800	Msa1302170	0.845533	3.827743e-59	-8.615850e-47
Msa0467880	Msa1302170	0.848064	7.776878e-60	-8.615850e-47
Msa0471090	Msa1302170	0.812031	5.202618e-51	-8.615850e-47
Msa0473450	Msa1302170	0.808056	3.735173e-50	-8.615850e-47
Msa0476150	Msa1302170	0.838614	2.590157e-57	-8.615850e-47
Msa0476180	Msa1302170	0.840393	8.936505e-58	-8.615850e-47
Msa0480150	Msa1302170	0.803323	3.683334e-49	-8.615850e-47
Msa0482580	Msa1302170	0.841739	3.957332e-58	-8.615850e-47
Msa0990520	Msa1302170	0.848263	6.849780e-60	-8.615850e-47
Msa0992570	Msa1302170	0.864755	9.674885e-65	-8.615850e-47
Msa0992590	Msa1302170	0.871159	8.447220e-67	-8.615850e-47
Msa1000470	Msa1302170	0.838947	2.124034e-57	-8.615850e-47
Msa1001780	Msa1302170	0.809170	2.160145e-50	-8.615850e-47
Msa1002040	Msa1302170	0.854193	1.448425e-61	-8.615850e-47
Msa1002980	Msa1302170	0.839729	1.331553e-57	-8.615850e-47
Msa1009790	Msa1302170	0.807427	5.081255e-50	-8.615850e-47
Msa1011210	Msa1302170	0.807568	4.744136e-50	-8.615850e-47
Msa1022310	Msa1302170	0.853597	2.150922e-61	-8.615850e-47
Msa1024140	Msa1302170	0.819502	1.122968e-52	-8.615850e-47
Msa1024580	Msa1302170	0.827517	1.497567e-54	-8.615850e-47
Msa1027790	Msa1302170	0.855094	7.942924e-62	-8.615850e-47
Msa1028460	Msa1302170	0.852942	3.313935e-61	-8.615850e-47
Msa1029320	Msa1302170	0.816664	4.920590e-52	-8.615850e-47
Msa1030280	Msa1302170	0.828492	8.722888e-55	-8.615850e-47
Msa1032140	Msa1302170	0.809045	2.297673e-50	-8.615850e-47
Msa1033120	Msa1302170	0.810774	9.751882e-51	-8.615850e-47
Msa1033160	Msa1302170	0.835525	1.594985e-56	-8.615850e-47
Msa1035090	Msa1302170	0.801616	8.279450e-49	-8.615850e-47
Msa1038320	Msa1302170	0.833605	4.846039e-56	-8.615850e-47
Msa1040770	Msa1302170	0.825734	3.988596e-54	-8.615850e-47
Msa1044040	Msa1302170	0.866044	3.801472e-65	-8.615850e-47
Msa1045440	Msa1302170	0.825686	4.095364e-54	-8.615850e-47
Msa1055360	Msa1302170	0.806424	8.281957e-50	-8.615850e-47
Msa1058980	Msa1302170	0.818493	1.904518e-52	-8.615850e-47
Msa1061180	Msa1302170	0.853628	2.107153e-61	-8.615850e-47
Msa1067430	Msa1302170	0.837248	5.813441e-57	-8.615850e-47
Msa1070900	Msa1302170	0.877398	6.488465e-69	-8.615850e-47
Msa1070930	Msa1302170	0.825508	4.512719e-54	-8.615850e-47
Msa1072080	Msa1302170	0.831115	2.004611e-55	-8.615850e-47
Msa1074630	Msa1302170	0.833208	6.086366e-56	-8.615850e-47
Msa1079610	Msa1302170	0.812586	3.934931e-51	-8.615850e-47
Msa1081850	Msa1302170	0.803503	3.379879e-49	-8.615850e-47
Msa1084150	Msa1302170	0.818760	1.656572e-52	-8.615850e-47
Msa1084490	Msa1302170	0.837862	4.046976e-57	-8.615850e-47
Msa1085700	Msa1302170	0.809447	1.883488e-50	-8.615850e-47
Msa1088690	Msa1302170	0.812986	3.216559e-51	-8.615850e-47
Msa1090230	Msa1302170	0.827512	1.501800e-54	-8.615850e-47
Msa1099690	Msa1302170	0.807142	5.839083e-50	-8.615850e-47
Msa1106560	Msa1302170	0.854858	9.304833e-62	-8.615850e-47
Msa1106580	Msa1302170	0.856675	2.740608e-62	-8.615850e-47
Msa0244750	Msa1302170	0.807290	5.433889e-50	-8.615850e-47
Msa0247310	Msa1302170	0.815439	9.241313e-52	-8.615850e-47
Msa0249270	Msa1302170	0.824063	9.888177e-54	-8.615850e-47
Msa0250520	Msa1302170	0.800744	1.248492e-48	-8.615850e-47
Msa0253410	Msa1302170	0.832225	1.067383e-55	-8.615850e-47
Msa0256170	Msa1302170	0.808453	3.074918e-50	-8.615850e-47
Msa0257130	Msa1302170	0.839072	1.971749e-57	-8.615850e-47
Msa0257310	Msa1302170	0.826811	2.210206e-54	-8.615850e-47
Msa0259330	Msa1302170	0.819259	1.275598e-52	-8.615850e-47
Msa0259980	Msa1302170	0.819688	1.018238e-52	-8.615850e-47
Msa0261440	Msa1302170	0.845419	4.109410e-59	-8.615850e-47
Msa0262100	Msa1302170	0.813492	2.491142e-51	-8.615850e-47
Msa0263430	Msa1302170	0.845291	4.449765e-59	-8.615850e-47
Msa0263620	Msa1302170	0.842937	1.905720e-58	-8.615850e-47
Msa0265780	Msa1302170	0.817980	2.489075e-52	-8.615850e-47
Msa0268420	Msa1302170	0.817949	2.528536e-52	-8.615850e-47
Msa0269830	Msa1302170	0.838408	2.926993e-57	-8.615850e-47
Msa0274690	Msa1302170	0.802646	5.082065e-49	-8.615850e-47
Msa0274780	Msa1302170	0.837839	4.101446e-57	-8.615850e-47
Msa0280140	Msa1302170	0.844326	8.103392e-59	-8.615850e-47
Msa0281570	Msa1302170	0.805880	1.078080e-49	-8.615850e-47
Msa0282860	Msa1302170	0.821981	3.023105e-53	-8.615850e-47
Msa0284260	Msa1302170	0.822213	2.670983e-53	-8.615850e-47
Msa0284780	Msa1302170	0.802414	5.673760e-49	-8.615850e-47
Msa0284870	Msa1302170	0.829960	3.841131e-55	-8.615850e-47
Msa0285740	Msa1302170	0.826536	2.570627e-54	-8.615850e-47
Msa0291040	Msa1302170	0.835192	1.936625e-56	-8.615850e-47
Msa0295240	Msa1302170	0.827339	1.652422e-54	-8.615850e-47
Msa0295520	Msa1302170	0.804136	2.496243e-49	-8.615850e-47
Msa0296000	Msa1302170	0.806133	9.539903e-50	-8.615850e-47
Msa0296610	Msa1302170	0.853993	1.654031e-61	-8.615850e-47
Msa0301020	Msa1302170	0.837470	5.099169e-57	-8.615850e-47
Msa0301460	Msa1302170	0.830351	3.084733e-55	-8.615850e-47
Msa0301800	Msa1302170	0.827362	1.631631e-54	-8.615850e-47
Msa0303780	Msa1302170	0.814628	1.398611e-51	-8.615850e-47
Msa0304870	Msa1302170	0.818378	2.022399e-52	-8.615850e-47
Msa0306130	Msa1302170	0.843942	1.027541e-58	-8.615850e-47
Msa0307460	Msa1302170	0.806619	7.535208e-50	-8.615850e-47
Msa0308430	Msa1302170	0.824539	7.640251e-54	-8.615850e-47
Msa0314790	Msa1302170	0.806487	8.032533e-50	-8.615850e-47
Msa0315480	Msa1302170	0.833344	5.629347e-56	-8.615850e-47
Msa0317260	Msa1302170	0.809806	1.577118e-50	-8.615850e-47
Msa0320540	Msa1302170	0.811095	8.310452e-51	-8.615850e-47
Msa0323630	Msa1302170	0.822530	2.254711e-53	-8.615850e-47
Msa0330270	Msa1302170	0.806944	6.432161e-50	-8.615850e-47
Msa0331780	Msa1302170	0.821367	4.192224e-53	-8.615850e-47
Msa0333900	Msa1302170	0.810646	1.039545e-50	-8.615850e-47
Msa0334020	Msa1302170	0.814181	1.755896e-51	-8.615850e-47
Msa0334780	Msa1302170	0.818627	1.776209e-52	-8.615850e-47
Msa0334980	Msa1302170	0.818112	2.323034e-52	-8.615850e-47
Msa0338570	Msa1302170	0.834638	2.670201e-56	-8.615850e-47
Msa0339860	Msa1302170	0.817232	3.668923e-52	-8.615850e-47
Msa0341260	Msa1302170	0.817391	3.379035e-52	-8.615850e-47
Msa0342620	Msa1302170	0.824766	6.756472e-54	-8.615850e-47
Msa0343920	Msa1302170	0.820956	5.215574e-53	-8.615850e-47
Msa0344070	Msa1302170	0.816113	6.537803e-52	-8.615850e-47
Msa0344580	Msa1302170	0.806937	6.452771e-50	-8.615850e-47
Msa0349000	Msa1302170	0.803939	2.744414e-49	-8.615850e-47
Msa0353880	Msa1302170	0.814572	1.438886e-51	-8.615850e-47
Msa0353890	Msa1302170	0.805082	1.584686e-49	-8.615850e-47
Msa0354490	Msa1302170	0.816873	4.416892e-52	-8.615850e-47
Msa0358230	Msa1302170	0.839596	1.441772e-57	-8.615850e-47
Msa0358710	Msa1302170	0.811106	8.263779e-51	-8.615850e-47
Msa0362840	Msa1302170	0.814682	1.360462e-51	-8.615850e-47
Msa1107970	Msa1302170	0.827126	1.858193e-54	-8.615850e-47
Msa1108530	Msa1302170	0.801791	7.619798e-49	-8.615850e-47
Msa1112610	Msa1302170	0.855502	6.042585e-62	-8.615850e-47
Msa1115580	Msa1302170	0.817260	3.615976e-52	-8.615850e-47
Msa1116010	Msa1302170	0.834012	3.831931e-56	-8.615850e-47
Msa1122510	Msa1302170	0.817077	3.975482e-52	-8.615850e-47
Msa1123340	Msa1302170	0.826996	1.995754e-54	-8.615850e-47
Msa1125780	Msa1302170	0.840506	8.345547e-58	-8.615850e-47
Msa1125950	Msa1302170	0.841277	5.237447e-58	-8.615850e-47
Msa1126140	Msa1302170	0.827913	1.202707e-54	-8.615850e-47
Msa1126310	Msa1302170	0.807672	4.509458e-50	-8.615850e-47
Msa1127510	Msa1302170	0.828771	7.470737e-55	-8.615850e-47
Msa1128350	Msa1302170	0.826654	2.409056e-54	-8.615850e-47
Msa1132820	Msa1302170	0.807154	5.806829e-50	-8.615850e-47
Msa1137800	Msa1302170	0.800183	1.624077e-48	-8.615850e-47
Msa1138600	Msa1302170	0.825052	5.783966e-54	-8.615850e-47
Msa1140010	Msa1302170	0.820998	5.099610e-53	-8.615850e-47
Msa1145370	Msa1302170	0.802824	4.670255e-49	-8.615850e-47
Msa1148780	Msa1302170	0.813288	2.761630e-51	-8.615850e-47
Msa1149760	Msa1302170	0.818072	2.372189e-52	-8.615850e-47
Msa1149960	Msa1302170	0.813307	2.734965e-51	-8.615850e-47
Msa1151120	Msa1302170	0.815556	8.702568e-52	-8.615850e-47
Msa1157160	Msa1302170	0.838465	2.829986e-57	-8.615850e-47
Msa1159100	Msa1302170	0.811903	5.547296e-51	-8.615850e-47
Msa1161160	Msa1302170	0.826299	2.928417e-54	-8.615850e-47
Msa1162470	Msa1302170	0.808843	2.537303e-50	-8.615850e-47
Msa1166180	Msa1302170	0.847354	1.219413e-59	-8.615850e-47
Msa1166280	Msa1302170	0.841883	3.625815e-58	-8.615850e-47
Msa1171340	Msa1302170	0.848510	5.852825e-60	-8.615850e-47
Msa1173410	Msa1302170	0.822397	2.421041e-53	-8.615850e-47
Msa1175750	Msa1302170	0.816346	5.797981e-52	-8.615850e-47
Msa1178470	Msa1302170	0.804287	2.322126e-49	-8.615850e-47
Msa1178970	Msa1302170	0.822550	2.231172e-53	-8.615850e-47
Msa1180410	Msa1302170	0.846216	2.497137e-59	-8.615850e-47
Msa1183390	Msa1302170	0.822368	2.459453e-53	-8.615850e-47
Msa1183610	Msa1302170	0.818633	1.770362e-52	-8.615850e-47
Msa1183760	Msa1302170	0.830401	2.997778e-55	-8.615850e-47
Msa1184580	Msa1302170	0.801715	7.899845e-49	-8.615850e-47
Msa1186210	Msa1302170	0.816195	6.267868e-52	-8.615850e-47
Msa1190910	Msa1302170	0.843212	1.609655e-58	-8.615850e-47
Msa1195860	Msa1302170	0.814059	1.868404e-51	-8.615850e-47
Msa1196600	Msa1302170	0.806718	7.178890e-50	-8.615850e-47
Msa1197110	Msa1302170	0.808719	2.696881e-50	-8.615850e-47
Msa1199210	Msa1302170	0.859491	3.986130e-63	-8.615850e-47
Msa1200920	Msa1302170	0.857374	1.705392e-62	-8.615850e-47
Msa1200930	Msa1302170	0.952007	6.103634e-110	-8.615850e-47
Msa1201990	Msa1302170	0.809468	1.864343e-50	-8.615850e-47
Msa1208510	Msa1302170	0.805224	1.480029e-49	-8.615850e-47
Msa1209390	Msa1302170	0.800959	1.128204e-48	-8.615850e-47
Msa1213170	Msa1302170	0.803985	2.683805e-49	-8.615850e-47
Msa1213540	Msa1302170	0.817149	3.831070e-52	-8.615850e-47
Msa1214900	Msa1302170	0.842952	1.887967e-58	-8.615850e-47
Msa1215210	Msa1302170	0.843171	1.651079e-58	-8.615850e-47
Msa1215530	Msa1302170	0.826310	2.909515e-54	-8.615850e-47
Msa1215770	Msa1302170	0.812957	3.263417e-51	-8.615850e-47
Msa1218720	Msa1302170	0.834155	3.529908e-56	-8.615850e-47
Msa1219250	Msa1302170	0.853042	3.102804e-61	-8.615850e-47
Msa1220740	Msa1302170	0.841827	3.752674e-58	-8.615850e-47
Msa1221260	Msa1302170	0.835634	1.497303e-56	-8.615850e-47
Msa1222390	Msa1302170	0.824329	8.564493e-54	-8.615850e-47
Msa1224140	Msa1302170	0.815708	8.049179e-52	-8.615850e-47
Msa0485280	Msa1302170	0.853745	1.950141e-61	-8.615850e-47
Msa0486530	Msa1302170	0.818299	2.107368e-52	-8.615850e-47
Msa0486860	Msa1302170	0.814024	1.901622e-51	-8.615850e-47
Msa0487560	Msa1302170	0.833340	5.641828e-56	-8.615850e-47
Msa0487620	Msa1302170	0.839261	1.760996e-57	-8.615850e-47
Msa0488830	Msa1302170	0.800473	1.417619e-48	-8.615850e-47
Msa0498320	Msa1302170	0.802151	6.427789e-49	-8.615850e-47
Msa0504740	Msa1302170	0.808912	2.453069e-50	-8.615850e-47
Msa0505390	Msa1302170	0.802339	5.879055e-49	-8.615850e-47
Msa0509500	Msa1302170	0.802228	6.196486e-49	-8.615850e-47
Msa0509540	Msa1302170	0.829306	5.542594e-55	-8.615850e-47
Msa0510230	Msa1302170	0.821506	3.894115e-53	-8.615850e-47
Msa0511890	Msa1302170	0.842561	2.399341e-58	-8.615850e-47
Msa0512130	Msa1302170	0.830493	2.847240e-55	-8.615850e-47
Msa0514260	Msa1302170	0.852210	5.359862e-61	-8.615850e-47
Msa0517300	Msa1302170	0.803275	3.767827e-49	-8.615850e-47
Msa0517400	Msa1302170	0.827767	1.304269e-54	-8.615850e-47
Msa0519200	Msa1302170	0.852534	4.334424e-61	-8.615850e-47
Msa0520730	Msa1302170	0.800143	1.655248e-48	-8.615850e-47
Msa0524020	Msa1302170	0.825184	5.382657e-54	-8.615850e-47
Msa0524050	Msa1302170	0.813886	2.040147e-51	-8.615850e-47
Msa0524090	Msa1302170	0.821989	3.010073e-53	-8.615850e-47
Msa0524120	Msa1302170	0.828557	8.413413e-55	-8.615850e-47
Msa0525240	Msa1302170	0.810162	1.322263e-50	-8.615850e-47
Msa0526130	Msa1302170	0.850462	1.671973e-60	-8.615850e-47
Msa0528870	Msa1302170	0.835243	1.879565e-56	-8.615850e-47
Msa0530210	Msa1302170	0.830072	3.607935e-55	-8.615850e-47
Msa0532840	Msa1302170	0.835121	2.017313e-56	-8.615850e-47
Msa0533010	Msa1302170	0.832121	1.132510e-55	-8.615850e-47
Msa0534420	Msa1302170	0.801169	1.022287e-48	-8.615850e-47
Msa0538260	Msa1302170	0.821407	4.104583e-53	-8.615850e-47
Msa0538570	Msa1302170	0.830263	3.241180e-55	-8.615850e-47
Msa0539320	Msa1302170	0.814228	1.714161e-51	-8.615850e-47
Msa0540340	Msa1302170	0.808610	2.845780e-50	-8.615850e-47
Msa0542040	Msa1302170	0.855044	8.214095e-62	-8.615850e-47
Msa0546380	Msa1302170	0.821325	4.286832e-53	-8.615850e-47
Msa0546740	Msa1302170	0.835817	1.345386e-56	-8.615850e-47
Msa0547050	Msa1302170	0.844971	5.431903e-59	-8.615850e-47
Msa0547810	Msa1302170	0.841692	4.073754e-58	-8.615850e-47
Msa0550720	Msa1302170	0.858985	5.655262e-63	-8.615850e-47
Msa0553520	Msa1302170	0.820948	5.237766e-53	-8.615850e-47
Msa0555940	Msa1302170	0.819458	1.149258e-52	-8.615850e-47
Msa0558850	Msa1302170	0.804570	2.027512e-49	-8.615850e-47
Msa0558890	Msa1302170	0.845391	4.181537e-59	-8.615850e-47
Msa0560200	Msa1302170	0.838023	3.678949e-57	-8.615850e-47
Msa0561510	Msa1302170	0.819934	8.946314e-53	-8.615850e-47
Msa0567290	Msa1302170	0.855894	4.642104e-62	-8.615850e-47
Msa0574170	Msa1302170	0.823168	1.601443e-53	-8.615850e-47
Msa0575250	Msa1302170	0.808966	2.388477e-50	-8.615850e-47
Msa0575450	Msa1302170	0.831664	1.468818e-55	-8.615850e-47
Msa0576150	Msa1302170	0.812490	4.129506e-51	-8.615850e-47
Msa0576420	Msa1302170	0.845480	3.956452e-59	-8.615850e-47
Msa0579610	Msa1302170	0.818049	2.401159e-52	-8.615850e-47
Msa0581340	Msa1302170	0.833461	5.263167e-56	-8.615850e-47
Msa0587900	Msa1302170	0.808891	2.477828e-50	-8.615850e-47
Msa0589290	Msa1302170	0.810066	1.386375e-50	-8.615850e-47
Msa0594390	Msa1302170	0.843388	1.444785e-58	-8.615850e-47
Msa0595780	Msa1302170	0.838147	3.417503e-57	-8.615850e-47
Msa0598250	Msa1302170	0.834288	3.268891e-56	-8.615850e-47
Msa0600390	Msa1302170	0.858250	9.372628e-63	-8.615850e-47
Msa0601710	Msa1302170	0.810330	1.216421e-50	-8.615850e-47
Msa0601780	Msa1302170	0.830601	2.679634e-55	-8.615850e-47
Msa0843690	Msa1302170	0.803602	3.224071e-49	-8.615850e-47
Msa0844100	Msa1302170	0.824907	6.259369e-54	-8.615850e-47
Msa0846640	Msa1302170	0.802805	4.712488e-49	-8.615850e-47
Msa0851740	Msa1302170	0.806745	7.085567e-50	-8.615850e-47
Msa0851870	Msa1302170	0.817911	2.578708e-52	-8.615850e-47
Msa0855490	Msa1302170	0.816406	5.620928e-52	-8.615850e-47
Msa0859390	Msa1302170	0.848421	6.197419e-60	-8.615850e-47
Msa0860270	Msa1302170	0.834545	2.817756e-56	-8.615850e-47
Msa0862240	Msa1302170	0.844997	5.345857e-59	-8.615850e-47
Msa0863250	Msa1302170	0.808998	2.350894e-50	-8.615850e-47
Msa0873830	Msa1302170	0.819044	1.428258e-52	-8.615850e-47
Msa0877420	Msa1302170	0.826649	2.416247e-54	-8.615850e-47
Msa0881050	Msa1302170	0.804127	2.507910e-49	-8.615850e-47
Msa0890250	Msa1302170	0.801444	8.977056e-49	-8.615850e-47
Msa0897390	Msa1302170	0.810317	1.224001e-50	-8.615850e-47
Msa0900320	Msa1302170	0.841886	3.620252e-58	-8.615850e-47
Msa0906720	Msa1302170	0.825126	5.556007e-54	-8.615850e-47
Msa0910650	Msa1302170	0.804905	1.725512e-49	-8.615850e-47
Msa0925160	Msa1302170	0.843690	1.199585e-58	-8.615850e-47
Msa0926860	Msa1302170	0.807180	5.732156e-50	-8.615850e-47
Msa0930160	Msa1302170	0.819292	1.253901e-52	-8.615850e-47
Msa0930330	Msa1302170	0.833213	6.068679e-56	-8.615850e-47
Msa0931480	Msa1302170	0.828949	6.762499e-55	-8.615850e-47
Msa0931730	Msa1302170	0.812638	3.834172e-51	-8.615850e-47
Msa0934830	Msa1302170	0.812448	4.218695e-51	-8.615850e-47
Msa0935730	Msa1302170	0.804353	2.250604e-49	-8.615850e-47
Msa0937940	Msa1302170	0.801729	7.849746e-49	-8.615850e-47
Msa0938970	Msa1302170	0.802597	5.203028e-49	-8.615850e-47
Msa0945560	Msa1302170	0.802837	4.640692e-49	-8.615850e-47
Msa0955260	Msa1302170	0.842054	3.268094e-58	-8.615850e-47
Msa0955310	Msa1302170	0.822136	2.783812e-53	-8.615850e-47
Msa0958020	Msa1302170	0.831777	1.377022e-55	-8.615850e-47
Msa0965960	Msa1302170	0.802040	6.774183e-49	-8.615850e-47
Msa0971860	Msa1302170	0.822997	1.755822e-53	-8.615850e-47
Msa0971920	Msa1302170	0.813878	2.048425e-51	-8.615850e-47
Msa0972730	Msa1302170	0.843138	1.684359e-58	-8.615850e-47
Msa0975080	Msa1302170	0.816751	4.705328e-52	-8.615850e-47
Msa0975910	Msa1302170	0.817482	3.223585e-52	-8.615850e-47
Msa0978000	Msa1302170	0.837747	4.332113e-57	-8.615850e-47

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1302170	MtrunA17_Chr8g0370711	85.459	392	19	1	1	392	1	354	0.0	687
Msa1302170	MtrunA17_Chr8g0370721	80.102	392	40	1	1	392	1	354	0.0	649
Msa1302170	MtrunA17_Chr3g0145171	67.857	392	88	1	1	392	1	354	0.0	545
Msa1302170	MtrunA17_Chr3g0145181	63.077	390	99	6	7	392	5	353	8.40e-168	473
Msa1302170	MtrunA17_Chr3g0145201	63.143	350	85	5	47	392	679	988	1.68e-145	437
Msa1302170	MtrunA17_Chr4g0064781	45.000	380	163	4	13	392	15	348	3.26e-111	329
Msa1302170	MtrunA17_Chr5g0423251	34.555	382	202	6	14	392	12	348	4.16e-68	219
Msa1302170	MtrunA17_Chr3g0087031	36.158	354	184	5	14	367	23	334	9.99e-68	218
Msa1302170	MtrunA17_Chr5g0421041	33.858	381	204	5	14	392	12	346	1.58e-66	215
Msa1302170	MtrunA17_Chr2g0296371	33.756	394	211	8	5	392	7	356	8.94e-66	213
Msa1302170	MtrunA17_Chr2g0314401	33.420	386	203	6	14	392	16	354	1.47e-65	212
Msa1302170	MtrunA17_Chr5g0423191	36.047	344	177	4	51	392	46	348	2.57e-65	212
Msa1302170	MtrunA17_Chr7g0239111	33.333	381	209	6	14	392	19	356	3.09e-65	212
Msa1302170	MtrunA17_Chr8g0375671	34.006	347	186	4	50	392	50	357	8.67e-64	208
Msa1302170	MtrunA17_Chr2g0314391	34.115	384	203	6	14	392	35	373	4.40e-63	206
Msa1302170	MtrunA17_Chr7g0239121	31.414	382	216	7	14	392	15	353	1.97e-62	204
Msa1302170	MtrunA17_Chr5g0420981	33.140	344	188	4	51	392	52	355	2.41e-62	204
Msa1302170	MtrunA17_Chr7g0242551	34.268	321	169	3	50	366	52	334	6.78e-62	203
Msa1302170	MtrunA17_Chr8g0375681	36.129	310	157	3	85	392	15	285	8.28e-62	201
Msa1302170	MtrunA17_Chr7g0239101	32.945	343	187	5	52	392	55	356	1.41e-61	202
Msa1302170	MtrunA17_Chr8g0375601	31.937	382	216	5	15	392	11	352	8.52e-61	201
Msa1302170	MtrunA17_Chr5g0423201	33.623	345	185	5	51	392	46	349	2.64e-60	199
Msa1302170	MtrunA17_Chr5g0421011	32.564	390	210	7	10	392	5	348	2.72e-60	199
Msa1302170	MtrunA17_Chr5g0421101	31.937	382	212	6	14	392	12	348	4.71e-60	198
Msa1302170	MtrunA17_Chr7g0239821	31.686	344	192	4	51	392	63	365	8.19e-60	198
Msa1302170	MtrunA17_Chr8g0375571	32.031	384	213	6	14	392	10	350	1.14e-59	197
Msa1302170	MtrunA17_Chr4g0006371	32.927	328	178	3	46	369	56	345	1.78e-59	197
Msa1302170	MtrunA17_Chr2g0314381	31.771	384	213	6	14	392	41	380	2.07e-59	197
Msa1302170	MtrunA17_Chr7g0232161	41.228	228	131	2	50	277	58	282	3.30e-59	195
Msa1302170	MtrunA17_Chr8g0365241	31.686	344	193	4	51	392	56	359	1.06e-58	195
Msa1302170	MtrunA17_Chr5g0420941	33.159	383	206	6	14	392	10	346	1.09e-58	194
Msa1302170	MtrunA17_Chr8g0375701	34.006	347	177	6	52	392	55	355	3.81e-58	193
Msa1302170	MtrunA17_Chr5g0423221	32.659	346	185	4	52	392	71	373	8.15e-58	193
Msa1302170	MtrunA17_Chr5g0420951	32.558	344	190	4	51	392	52	355	5.54e-57	190
Msa1302170	MtrunA17_Chr3g0113641	32.716	324	177	3	46	366	44	329	8.21e-57	190
Msa1302170	MtrunA17_Chr5g0420901	30.670	388	219	6	9	392	6	347	6.00e-56	187
Msa1302170	MtrunA17_Chr5g0421091	31.854	383	212	5	14	392	10	347	5.63e-55	185
Msa1302170	MtrunA17_Chr5g0437181	32.188	320	174	4	51	366	48	328	5.76e-55	185
Msa1302170	MtrunA17_Chr7g0239071	33.871	310	164	3	85	392	31	301	7.16e-55	183
Msa1302170	MtrunA17_Chr1g0162191	31.975	319	178	3	51	369	46	325	6.66e-54	182
Msa1302170	MtrunA17_Chr4g0064771	35.593	295	100	2	90	384	1	205	8.26e-53	174
Msa1302170	MtrunA17_Chr5g0398291	31.307	329	172	7	51	368	46	331	3.24e-52	177
Msa1302170	MtrunA17_Chr5g0424201	31.776	321	173	6	50	367	42	319	4.18e-52	177
Msa1302170	MtrunA17_Chr5g0420721	35.664	286	143	3	109	392	4	250	1.83e-51	173
Msa1302170	MtrunA17_Chr3g0114861	32.817	323	165	8	64	379	44	321	1.21e-50	173
Msa1302170	MtrunA17_Chr3g0128001	33.033	333	173	6	51	382	37	320	5.47e-50	171
Msa1302170	MtrunA17_Chr2g0314371	35.395	291	153	5	14	277	16	298	1.47e-49	170
Msa1302170	MtrunA17_Chr3g0109041	33.711	353	176	11	52	390	42	350	1.03e-47	166
Msa1302170	MtrunA17_Chr5g0423211	30.058	346	195	6	52	392	47	350	4.83e-47	164
Msa1302170	MtrunA17_Chr1g0179801	30.295	373	203	9	6	366	18	345	2.54e-46	163
Msa1302170	MtrunA17_Chr5g0424211	30.284	317	173	6	52	363	42	315	7.27e-46	160
Msa1302170	MtrunA17_Chr2g0332191	32.515	326	163	9	52	369	52	328	4.37e-44	157
Msa1302170	MtrunA17_Chr5g0412671	30.966	352	176	10	52	387	38	338	8.98e-42	150
Msa1302170	MtrunA17_Chr3g0102041	28.571	329	190	8	51	376	38	324	1.45e-41	149
Msa1302170	MtrunA17_Chr8g0345831	28.686	373	207	11	15	382	8	326	2.40e-41	149
Msa1302170	MtrunA17_Chr7g0265221	30.149	335	177	8	46	366	61	352	6.46e-41	148
Msa1302170	MtrunA17_Chr8g0371931	28.657	335	190	8	51	382	38	326	2.90e-40	146
Msa1302170	MtrunA17_Chr6g0455481	28.895	353	194	9	40	385	30	332	3.88e-40	145
Msa1302170	MtrunA17_Chr3g0114871	33.898	236	142	7	48	277	38	265	5.01e-40	143
Msa1302170	MtrunA17_Chr7g0239091	27.907	387	224	7	8	392	118	451	8.39e-40	147
Msa1302170	MtrunA17_Chr5g0412651	29.412	357	175	10	52	387	38	338	1.02e-39	144
Msa1302170	MtrunA17_Chr2g0289341	28.280	343	191	9	51	386	3	297	1.22e-39	143
Msa1302170	MtrunA17_Chr5g0405411	27.545	334	193	7	52	382	39	326	4.23e-39	143
Msa1302170	MtrunA17_Chr3g0121141	28.035	346	197	9	51	391	3	301	9.78e-39	141
Msa1302170	MtrunA17_Chr4g0045471	30.678	339	174	11	52	370	26	323	3.02e-38	140
Msa1302170	MtrunA17_Chr7g0250511	28.616	318	183	6	52	367	49	324	4.15e-38	140
Msa1302170	MtrunA17_Chr1g0162361	32.530	332	163	10	52	368	27	312	5.42e-38	140
Msa1302170	MtrunA17_Chr4g0045441	31.751	337	168	11	52	368	26	320	6.61e-38	139
Msa1302170	MtrunA17_Chr8g0371921	27.761	335	193	8	51	382	38	326	1.90e-37	139
Msa1302170	MtrunA17_Chr5g0412681	28.902	346	178	9	52	385	33	322	2.14e-37	138
Msa1302170	MtrunA17_Chr3g0125201	27.974	311	174	4	52	358	3	267	2.80e-37	137
Msa1302170	MtrunA17_Chr4g0045451	31.214	346	175	12	52	377	26	328	3.14e-37	138
Msa1302170	MtrunA17_Chr4g0050031	28.367	349	198	8	52	392	62	366	5.05e-37	137
Msa1302170	MtrunA17_Chr8g0351101	28.809	361	187	7	50	390	52	362	1.07e-36	137
Msa1302170	MtrunA17_Chr4g0045411	30.030	333	176	11	52	369	30	320	2.62e-36	135
Msa1302170	MtrunA17_Chr1g0162321	29.738	343	171	11	51	368	68	365	3.04e-35	133
Msa1302170	MtrunA17_Chr3g0126741	28.086	324	183	8	52	370	59	337	5.05e-35	132
Msa1302170	MtrunA17_Chr1g0187831	26.966	356	200	9	48	391	66	373	6.82e-35	132
Msa1302170	MtrunA17_Chr6g0474391	28.571	357	196	10	49	390	61	373	1.12e-34	132
Msa1302170	MtrunA17_Chr2g0311921	28.615	325	180	9	52	369	54	333	1.48e-34	130
Msa1302170	MtrunA17_Chr2g0311761	29.503	322	177	9	52	367	68	345	1.61e-34	131
Msa1302170	MtrunA17_Chr1g0162351	29.738	343	171	11	51	368	68	365	1.97e-34	131
Msa1302170	MtrunA17_Chr5g0426891	27.794	349	198	9	27	369	17	317	8.40e-34	128
Msa1302170	MtrunA17_Chr1g0184161	26.791	321	190	6	52	370	38	315	1.04e-33	128
Msa1302170	MtrunA17_Chr1g0184101	28.324	346	201	7	27	370	15	315	1.29e-33	128
Msa1302170	MtrunA17_Chr1g0184121	28.302	318	184	6	52	367	37	312	2.38e-33	127
Msa1302170	MtrunA17_Chr2g0311701	29.003	331	182	7	46	367	63	349	5.41e-33	127
Msa1302170	MtrunA17_Chr1g0184151	26.791	321	190	6	52	370	38	315	9.84e-33	125
Msa1302170	MtrunA17_Chr5g0439011	26.923	312	178	7	50	358	3	267	1.35e-32	124
Msa1302170	MtrunA17_Chr8g0336781	29.830	352	190	14	52	392	95	400	1.56e-32	126
Msa1302170	MtrunA17_Chr8g0354261	29.050	358	198	11	46	392	62	374	2.08e-32	125
Msa1302170	MtrunA17_Chr2g0311681	29.129	333	179	8	46	367	57	343	2.51e-32	125
Msa1302170	MtrunA17_Chr7g0220011	27.108	332	189	7	52	377	39	323	2.52e-32	124
Msa1302170	MtrunA17_Chr8g0336851	27.143	350	201	9	52	392	60	364	4.02e-32	124
Msa1302170	MtrunA17_Chr1g0204181	26.879	346	202	7	49	385	56	359	4.50e-32	124
Msa1302170	MtrunA17_Chr7g0235951	28.212	358	199	12	47	392	62	373	7.56e-32	124
Msa1302170	MtrunA17_Chr1g0184111	27.139	339	201	7	52	388	37	331	1.35e-31	122
Msa1302170	MtrunA17_Chr8g0354241	28.492	358	200	10	46	392	62	374	2.44e-31	122
Msa1302170	MtrunA17_Chr6g0472861	26.531	343	195	11	46	380	64	357	2.68e-31	122
Msa1302170	MtrunA17_Chr1g0167951	26.989	352	205	9	48	392	49	355	3.35e-31	122
Msa1302170	MtrunA17_Chr8g0336761	27.920	351	197	11	52	392	60	364	3.84e-31	122
Msa1302170	MtrunA17_Chr1g0184241	27.746	346	194	10	27	367	46	340	5.20e-31	121
Msa1302170	MtrunA17_Chr8g0336861	27.485	342	191	12	52	384	60	353	7.28e-31	121
Msa1302170	MtrunA17_Chr8g0336631	27.841	352	197	11	52	392	60	365	7.84e-31	120
Msa1302170	MtrunA17_Chr1g0187821	25.862	348	198	11	46	383	61	358	9.61e-31	120
Msa1302170	MtrunA17_Chr2g0311631	27.401	354	197	10	52	392	55	361	1.10e-30	120
Msa1302170	MtrunA17_Chr2g0311831	28.882	322	178	9	52	367	68	344	2.04e-30	120
Msa1302170	MtrunA17_Chr6g0488511	26.923	338	187	8	52	384	3	285	2.24e-30	118
Msa1302170	MtrunA17_Chr2g0311741	27.988	343	195	9	46	383	21	316	4.90e-30	118
Msa1302170	MtrunA17_Chr8g0336751	28.125	352	194	10	52	392	94	397	5.33e-30	119
Msa1302170	MtrunA17_Chr1g0187811	26.857	350	194	12	46	383	182	481	5.38e-30	120
Msa1302170	MtrunA17_Chr7g0265351	28.611	360	195	12	43	392	30	337	5.54e-30	118
Msa1302170	MtrunA17_Chr8g0348081	28.409	352	194	14	52	392	60	364	5.55e-30	118
Msa1302170	MtrunA17_Chr3g0093741	28.852	357	199	11	43	392	46	354	5.68e-30	118
Msa1302170	MtrunA17_Chr5g0420881	34.807	181	78	2	214	392	2	144	6.31e-30	112
Msa1302170	MtrunA17_Chr4g0011311	31.489	235	153	5	46	278	61	289	6.45e-30	117
Msa1302170	MtrunA17_Chr4g0045431	30.128	312	161	10	72	368	51	320	6.47e-30	118
Msa1302170	MtrunA17_Chr3g0093761	28.889	360	194	10	43	392	46	353	8.53e-30	117
Msa1302170	MtrunA17_Chr4g0045461	31.065	338	172	12	52	370	26	321	1.04e-29	118
Msa1302170	MtrunA17_Chr2g0311691	28.440	327	177	8	52	367	63	343	1.41e-29	117
Msa1302170	MtrunA17_Chr3g0130391	28.060	335	186	9	41	362	55	347	2.13e-29	117
Msa1302170	MtrunA17_Chr3g0093751	29.558	362	190	12	43	392	46	354	2.21e-29	116
Msa1302170	MtrunA17_Chr8g0364471	27.692	325	181	9	52	367	67	346	2.29e-29	117
Msa1302170	MtrunA17_Chr2g0319491	27.596	337	177	12	52	382	33	308	2.45e-29	116
Msa1302170	MtrunA17_Chr4g0066121	28.704	324	178	10	52	367	60	338	3.00e-29	116
Msa1302170	MtrunA17_Chr2g0311711	29.012	324	176	9	52	367	67	344	3.36e-29	116
Msa1302170	MtrunA17_Chr7g0225881	26.284	331	189	9	45	367	60	343	6.57e-29	115
Msa1302170	MtrunA17_Chr1g0167961	27.414	321	184	7	52	367	69	345	1.10e-28	115
Msa1302170	MtrunA17_Chr1g0191201	27.190	331	188	7	40	359	41	329	2.22e-28	114
Msa1302170	MtrunA17_Chr2g0311861	28.286	350	176	12	52	392	64	347	4.28e-28	113
Msa1302170	MtrunA17_Chr2g0285931	25.305	328	184	9	52	367	28	306	4.49e-28	112
Msa1302170	MtrunA17_Chr7g0235981	25.680	331	190	7	74	392	41	327	5.88e-28	112
Msa1302170	MtrunA17_Chr8g0358941	27.273	330	176	11	52	367	27	306	7.84e-28	112
Msa1302170	MtrunA17_Chr4g0055591	27.246	345	193	10	47	383	55	349	1.06e-27	112
Msa1302170	MtrunA17_Chr7g0266651	26.944	360	200	12	46	392	53	362	1.08e-27	112
Msa1302170	MtrunA17_Chr8g0384461	24.282	383	218	11	19	385	19	345	4.62e-27	110
Msa1302170	MtrunA17_Chr7g0236011	28.530	347	193	10	46	383	61	361	5.36e-27	110
Msa1302170	MtrunA17_Chr1g0161041	27.928	333	188	9	44	370	85	371	1.37e-26	109
Msa1302170	MtrunA17_Chr3g0125421	25.073	343	200	7	27	359	17	312	2.98e-26	108
Msa1302170	MtrunA17_Chr1g0161081	27.439	328	190	8	44	367	62	345	6.70e-26	107
Msa1302170	MtrunA17_Chr8g0384481	26.912	353	203	12	46	389	53	359	8.14e-26	107
Msa1302170	MtrunA17_Chr1g0167911	24.845	322	190	9	52	367	54	329	1.04e-25	106
Msa1302170	MtrunA17_Chr8g0362741	32.663	199	126	5	81	278	83	274	1.23e-25	105
Msa1302170	MtrunA17_Chr1g0161111	28.354	328	187	8	44	367	121	404	2.89e-25	106
Msa1302170	MtrunA17_Chr2g0313111	27.900	319	170	11	52	361	28	295	3.25e-25	104
Msa1302170	MtrunA17_Chr4g0053251	26.852	324	177	8	52	355	8	291	3.58e-25	104
Msa1302170	MtrunA17_Chr8g0335411	27.654	358	203	11	46	392	61	373	6.64e-25	104
Msa1302170	MtrunA17_Chr1g0148771	28.526	312	162	10	52	359	63	317	7.33e-25	104
Msa1302170	MtrunA17_Chr7g0220001	24.658	292	169	5	81	366	66	312	1.31e-24	103
Msa1302170	MtrunA17_Chr8g0375661	38.983	118	70	1	52	167	52	169	2.74e-24	98.2
Msa1302170	MtrunA17_Chr6g0486831	28.024	339	178	15	54	369	20	315	7.76e-24	101
Msa1302170	MtrunA17_Chr8g0375641	34.815	135	83	2	52	184	52	183	1.02e-23	97.1
Msa1302170	MtrunA17_Chr4g0075471	31.410	156	69	1	205	360	21	138	6.74e-23	94.4
Msa1302170	MtrunA17_Chr3g0092531	26.032	315	179	9	52	360	6	272	8.24e-23	97.8
Msa1302170	MtrunA17_Chr7g0247991	25.424	354	202	9	46	387	61	364	2.74e-22	97.4
Msa1302170	MtrunA17_Chr5g0394071	31.455	213	95	6	170	382	5	166	3.82e-22	92.8
Msa1302170	MtrunA17_Chr4g0004061	26.761	355	208	11	44	392	1	309	8.75e-22	94.7
Msa1302170	MtrunA17_Chr4g0004071	26.124	356	208	12	44	392	1	308	1.71e-21	94.0
Msa1302170	MtrunA17_Chr3g0126761	30.114	176	83	3	207	382	85	220	7.38e-21	90.5
Msa1302170	MtrunA17_Chr4g0068891	26.506	332	173	11	52	368	20	295	2.44e-20	90.9
Msa1302170	MtrunA17_Chr7g0233661	33.690	187	74	5	196	382	4	140	3.32e-20	86.7
Msa1302170	MtrunA17_Chr4g0066991	26.163	344	183	11	47	383	62	341	1.88e-19	89.0
Msa1302170	MtrunA17_Chr1g0167931	24.688	320	155	7	52	367	54	291	1.91e-19	88.2
Msa1302170	MtrunA17_Chr8g0364171	36.937	111	68	2	167	277	18	126	2.38e-19	84.0
Msa1302170	MtrunA17_Chr1g0170631	29.353	201	93	5	199	392	34	192	3.50e-19	85.1
Msa1302170	MtrunA17_Chr8g0389941	24.405	336	192	12	54	369	33	326	6.41e-19	87.0
Msa1302170	MtrunA17_Chr3g0105281	25.776	322	175	9	52	366	34	298	1.72e-18	85.5
Msa1302170	MtrunA17_Chr8g0375581	44.595	74	41	0	200	273	12	85	5.19e-18	78.2
Msa1302170	MtrunA17_Chr1g0158021	31.004	229	139	8	48	269	45	261	6.06e-18	82.8
Msa1302170	MtrunA17_Chr4g0009541	26.300	327	191	12	52	370	7	291	1.39e-17	82.8
Msa1302170	MtrunA17_Chr3g0138351	26.590	346	194	15	48	380	3	301	2.22e-17	82.4
Msa1302170	MtrunA17_Chr4g0055871	26.254	339	175	14	51	370	8	290	3.44e-17	81.6
Msa1302170	MtrunA17_Chr4g0055911	25.948	343	182	14	48	370	5	295	5.20e-17	81.3
Msa1302170	MtrunA17_Chr8g0375591	35.772	123	75	2	14	134	10	130	3.02e-16	74.7
Msa1302170	MtrunA17_Chr8g0336831	30.526	190	121	7	52	236	60	243	4.38e-16	77.4
Msa1302170	MtrunA17_Chr2g0319521	31.858	113	75	2	165	277	14	124	2.54e-15	72.4
Msa1302170	MtrunA17_Chr5g0420891	29.814	161	104	3	9	167	6	159	1.20e-14	71.2
Msa1302170	MtrunA17_Chr8g0336801	28.804	184	87	5	214	392	12	156	1.43e-14	70.9
Msa1302170	MtrunA17_Chr1g0158011	25.735	272	145	9	98	363	10	230	1.74e-14	73.2
Msa1302170	MtrunA17_Chr4g0037611	29.167	168	78	5	179	345	3	130	7.13e-14	69.7
Msa1302170	MtrunA17_Chr1g0167921	31.008	129	79	5	149	276	37	156	3.24e-13	67.4
Msa1302170	MtrunA17_Chr2g0311611	44.286	70	33	1	214	277	2	71	9.45e-13	63.2

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
Msa1302170	AT1G49390.1	45.238	378	167	3	13	389	7	345	4.63e-115	339
Msa1302170	AT5G20400.1	44.974	378	168	3	13	389	7	345	2.91e-114	337
Msa1302170	AT5G54000.2	44.675	385	166	5	13	392	7	349	6.82e-113	334
Msa1302170	AT5G20550.1	47.941	340	137	3	52	389	45	346	6.97e-113	334
Msa1302170	AT1G49390.2	48.355	304	119	1	86	389	1	266	2.74e-104	309
Msa1302170	AT5G54000.1	46.906	307	125	1	86	392	1	269	7.01e-103	305
Msa1302170	AT3G21420.1	35.949	395	207	7	5	392	7	362	9.88e-71	226
Msa1302170	AT1G17020.1	35.072	345	183	3	51	392	52	358	5.59e-66	214
Msa1302170	AT1G17010.1	34.286	385	205	5	14	392	16	358	2.24e-65	213
Msa1302170	AT1G78550.1	35.211	355	183	5	41	392	46	356	5.91e-64	209
Msa1302170	AT2G38240.1	33.841	328	172	4	46	370	42	327	6.32e-64	208
Msa1302170	AT4G25300.1	36.842	323	158	3	51	369	51	331	1.20e-63	208
Msa1302170	AT4G25310.1	37.383	321	152	4	51	367	51	326	4.00e-60	199
Msa1302170	AT5G05600.1	33.721	344	185	5	51	389	61	366	1.29e-59	197
Msa1302170	AT3G11180.2	32.857	350	189	6	45	391	88	394	1.62e-55	188
Msa1302170	AT1G78550.2	34.700	317	163	5	79	392	3	278	1.94e-55	184
Msa1302170	AT3G11180.1	33.140	344	184	6	45	385	88	388	4.02e-55	187
Msa1302170	AT3G55970.1	32.500	320	173	5	52	366	52	333	1.47e-52	179
Msa1302170	AT4G22880.1	29.846	325	182	6	51	368	46	331	6.15e-51	174
Msa1302170	AT4G22880.2	29.846	325	182	6	51	368	46	331	6.15e-51	174
Msa1302170	AT4G22880.3	29.846	325	182	6	51	368	46	331	6.15e-51	174
Msa1302170	AT5G08640.2	29.825	342	188	8	53	388	41	336	1.55e-50	173
Msa1302170	AT5G08640.1	29.825	342	188	8	53	388	41	336	1.55e-50	173
Msa1302170	AT5G05600.2	37.391	230	141	2	51	277	61	290	1.77e-48	166
Msa1302170	AT3G60290.1	31.579	361	193	10	40	391	38	353	1.63e-46	163
Msa1302170	AT2G44800.1	33.022	321	171	6	48	366	48	326	1.14e-45	160
Msa1302170	AT4G16330.2	32.948	346	175	10	52	390	67	362	1.59e-45	160
Msa1302170	AT2G36690.2	31.492	362	195	10	13	366	19	335	3.76e-45	160
Msa1302170	AT2G36690.1	31.492	362	195	10	13	366	19	335	3.76e-45	160
Msa1302170	AT4G10500.1	30.539	334	181	9	52	382	44	329	3.56e-44	157
Msa1302170	AT3G55970.2	34.914	232	146	4	52	278	52	283	1.04e-43	154
Msa1302170	AT1G55290.1	30.469	384	207	11	14	388	25	357	7.13e-43	154
Msa1302170	AT5G24530.1	30.137	365	189	10	36	382	7	323	7.68e-42	150
Msa1302170	AT3G13610.1	30.878	353	191	8	46	392	56	361	1.07e-41	150
Msa1302170	AT3G19010.1	32.635	334	168	10	52	370	28	319	2.77e-41	149
Msa1302170	AT3G19010.4	32.635	334	168	10	52	370	28	319	2.77e-41	149
Msa1302170	AT4G10490.1	28.818	347	196	10	52	391	42	344	5.33e-41	148
Msa1302170	AT4G25310.2	32.808	317	144	4	51	367	51	298	1.77e-40	146
Msa1302170	AT5G07480.1	28.492	358	192	11	52	392	44	354	3.49e-40	146
Msa1302170	AT1G62380.1	27.405	343	199	7	47	386	2	297	9.46e-40	144
Msa1302170	AT3G19000.1	31.933	357	176	12	27	367	16	321	1.19e-38	142
Msa1302170	AT4G16330.1	33.000	300	150	9	98	390	1	256	1.57e-38	139
Msa1302170	AT5G07200.1	30.986	355	191	9	52	392	58	372	1.73e-38	142
Msa1302170	AT1G12010.1	27.697	343	198	8	47	386	2	297	2.48e-38	140
Msa1302170	AT5G63600.2	26.646	319	183	8	48	363	29	299	8.96e-38	139
Msa1302170	AT1G60980.1	30.247	324	172	7	50	360	55	337	7.04e-37	138
Msa1302170	AT5G63600.1	26.332	319	183	7	48	363	29	298	7.95e-37	136
Msa1302170	AT1G05010.1	29.487	312	169	7	52	359	4	268	1.08e-36	136
Msa1302170	AT1G15550.1	29.080	337	185	7	39	369	44	332	3.95e-36	135
Msa1302170	AT3G19010.3	30.838	334	144	10	52	370	28	289	9.15e-36	133
Msa1302170	AT5G63580.2	33.624	229	142	6	52	277	19	240	1.00e-35	131
Msa1302170	AT5G63580.1	33.921	227	140	6	52	275	19	238	1.23e-35	131
Msa1302170	AT3G19000.2	34.307	274	151	10	27	284	16	276	1.72e-35	132
Msa1302170	AT5G59540.1	28.852	357	199	11	46	392	55	366	2.00e-35	134
Msa1302170	AT5G63590.1	26.866	335	187	8	48	370	10	298	2.43e-35	132
Msa1302170	AT3G51240.1	26.048	334	198	8	52	382	38	325	3.10e-35	133
Msa1302170	AT1G44090.1	29.846	325	178	7	43	358	54	337	3.17e-35	134
Msa1302170	AT4G25420.1	28.035	346	197	7	49	385	58	360	9.16e-35	132
Msa1302170	AT3G19010.2	35.223	247	141	8	52	283	28	270	2.70e-34	129
Msa1302170	AT5G63595.1	26.316	304	156	8	44	345	19	256	6.53e-34	127
Msa1302170	AT5G43935.1	26.646	319	161	9	52	363	19	271	7.01e-34	128
Msa1302170	AT2G30830.1	28.045	353	202	10	48	392	50	358	1.27e-32	126
Msa1302170	AT1G06620.1	29.268	328	183	8	45	367	55	338	1.73e-32	125
Msa1302170	AT1G80340.1	29.513	349	183	11	27	366	28	322	2.24e-32	125
Msa1302170	AT5G51810.1	28.242	347	193	8	53	385	54	358	6.31e-32	124
Msa1302170	AT5G43450.1	28.793	323	179	9	52	369	61	337	7.65e-32	124
Msa1302170	AT1G80330.1	27.119	354	193	14	52	392	49	350	1.01e-31	123
Msa1302170	AT1G77330.1	27.097	310	172	6	52	354	3	265	1.64e-31	122
Msa1302170	AT5G59530.1	29.091	330	182	9	46	367	52	337	1.69e-31	123
Msa1302170	AT3G12900.1	26.531	343	194	11	55	388	59	352	1.97e-31	122
Msa1302170	AT5G43440.1	27.273	352	203	10	49	392	59	365	2.66e-31	122
Msa1302170	AT1G06620.2	32.906	234	149	5	45	276	55	282	4.88e-31	120
Msa1302170	AT1G78440.1	27.134	328	175	12	52	366	18	294	6.41e-31	120
Msa1302170	AT1G06650.2	28.977	352	193	12	52	392	64	369	1.30e-30	120
Msa1302170	AT4G25420.2	31.092	238	154	4	49	278	58	293	2.38e-30	118
Msa1302170	AT5G43450.2	31.858	226	146	5	52	276	61	279	2.73e-30	118
Msa1302170	AT1G04380.1	27.809	356	195	10	48	392	41	345	3.08e-30	119
Msa1302170	AT5G59540.2	30.508	236	154	6	46	277	55	284	4.68e-30	117
Msa1302170	AT1G06640.1	28.809	361	182	14	52	392	64	369	7.21e-30	119
Msa1302170	AT1G06645.1	28.490	351	193	12	52	392	77	379	1.14e-29	118
Msa1302170	AT5G43440.2	30.435	230	152	5	49	276	59	282	4.32e-29	115
Msa1302170	AT1G03410.2	27.190	331	188	10	45	367	50	335	4.40e-29	116
Msa1302170	AT4G25300.2	33.654	208	92	3	166	369	72	237	4.91e-29	114
Msa1302170	AT1G03410.1	27.190	331	188	10	45	367	87	372	8.37e-29	116
Msa1302170	AT4G21200.1	26.738	374	204	12	28	390	10	324	1.04e-28	115
Msa1302170	AT1G04350.1	29.143	350	183	14	46	383	52	348	1.71e-28	114
Msa1302170	AT3G51240.2	26.408	284	161	6	101	382	4	241	1.76e-28	112
Msa1302170	AT1G04380.2	31.780	236	144	6	48	278	41	264	2.18e-28	112
Msa1302170	AT5G07480.2	28.897	263	131	7	143	392	26	245	9.96e-28	110
Msa1302170	AT3G61400.1	28.060	335	186	8	45	367	53	344	1.41e-27	112
Msa1302170	AT2G19590.1	26.923	338	190	10	43	376	2	286	1.00e-26	108
Msa1302170	AT5G12270.1	26.271	354	198	8	52	392	56	359	1.67e-26	109
Msa1302170	AT1G06640.3	31.064	235	133	8	52	273	64	282	7.16e-26	106
Msa1302170	AT1G06640.2	30.417	240	138	8	52	278	64	287	7.42e-26	106
Msa1302170	AT1G06650.1	29.565	230	151	6	52	277	64	286	1.79e-25	105
Msa1302170	AT5G51810.2	30.081	246	156	6	53	284	54	297	1.94e-25	105
Msa1302170	AT3G61400.2	30.290	241	155	5	45	277	53	288	2.80e-25	104
Msa1302170	AT3G46500.5	27.247	356	195	15	52	391	17	324	5.37e-25	104
Msa1302170	AT1G30040.1	24.398	332	194	9	44	367	23	305	1.17e-24	103
Msa1302170	AT2G30840.1	26.807	332	192	9	43	367	48	335	2.29e-24	103
Msa1302170	AT4G21690.1	26.347	334	187	9	45	367	40	325	7.58e-24	101
Msa1302170	AT2G30840.3	28.685	251	166	6	43	289	48	289	5.39e-23	99.4
Msa1302170	AT2G30840.2	28.571	238	160	5	43	276	48	279	5.86e-23	98.6
Msa1302170	AT1G50960.1	25.868	317	167	9	48	351	36	297	7.71e-23	98.6
Msa1302170	AT1G03400.2	27.164	335	206	11	57	373	42	356	1.83e-22	98.2
Msa1302170	AT3G49630.1	25.617	324	182	7	52	355	9	293	8.30e-22	95.5
Msa1302170	AT2G25450.1	24.157	356	218	9	45	392	48	359	8.39e-22	95.9
Msa1302170	AT3G46500.7	28.387	310	159	14	52	345	17	279	8.79e-22	95.1
Msa1302170	AT3G49630.3	25.723	311	181	6	56	355	18	289	2.87e-21	94.0
Msa1302170	AT1G52820.1	25.414	362	213	12	37	391	1	312	1.03e-20	92.4
Msa1302170	AT2G19590.2	25.839	298	165	9	83	376	26	271	1.47e-20	91.7
Msa1302170	AT1G03400.1	25.970	335	182	10	57	373	42	328	1.57e-20	92.4
Msa1302170	AT1G35190.1	27.635	351	183	16	55	382	15	317	3.57e-20	90.9
Msa1302170	AT1G30040.2	25.207	242	162	8	44	277	23	253	6.33e-20	89.0
Msa1302170	AT2G34555.1	25.697	323	182	11	52	366	27	299	8.39e-20	90.1
Msa1302170	AT3G46490.1	26.902	368	176	17	52	381	9	321	1.96e-17	83.2
Msa1302170	AT3G46490.2	27.711	332	148	16	52	344	9	287	6.17e-16	78.6
Msa1302170	AT1G14130.1	23.913	322	189	8	52	369	9	278	3.94e-14	73.2

Find 113 sgRNAs with CRISPR-Local

Find 465 sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
TCATTCATGTGGCTTCTTTC+TGG	0.080795	8_3:-64611712	Msa1302170:intron
AAATCTAATCAAATGCTTTC+TGG	0.125132	8_3:-64605218	Msa1302170:exon
TGAATCTCTTTCTCTGAATC+TGG	0.180143	8_3:+64605357	None:intergenic
TCATTGTATATATAATTATT+TGG	0.188546	8_3:+64611864	None:intergenic
ACCTGAAATCAATGGGGTTT+TGG	0.196014	8_3:+64611337	None:intergenic
GGTGGGTGCTCGCAGCAATT+TGG	0.216062	8_3:+64606754	None:intergenic
TTGAAATTCCTTTGATCTTC+AGG	0.217680	8_3:+64611369	None:intergenic
TCTTGATTGCACCTCTAAAT+AGG	0.225206	8_3:+64604795	None:intergenic
GTGGGTGCTCGCAGCAATTT+GGG	0.228023	8_3:+64606755	None:intergenic
CCCAAAACCCCATTGATTTC+AGG	0.235480	8_3:-64611338	Msa1302170:intron
TAAGCTTTAATCTATGAATT+TGG	0.235673	8_3:-64605137	Msa1302170:three_prime_UTR
CAAAACAATATTGAAGGATA+TGG	0.284911	8_3:-64611459	Msa1302170:CDS
CACGCTAACTCTAATTAATT+AGG	0.311816	8_3:-64604856	Msa1302170:three_prime_UTR
CAGAAAATCAAATGCTTGAT+TGG	0.314111	8_3:-64611419	Msa1302170:CDS
TCCTATGGCTGATCATGCTC+TGG	0.314307	8_3:-64607539	Msa1302170:CDS
ACGTATTATGCTATCTGATT+AGG	0.317289	8_3:-64605090	Msa1302170:three_prime_UTR
CTCTCTCTCCACATTCCTTT+AGG	0.320419	8_3:+64607599	None:intergenic
AGTACTACCAACAAGGAAAA+AGG	0.333621	8_3:-64605257	Msa1302170:CDS
TTTACTGGTCTGTATAATAC+TGG	0.341137	8_3:+64605303	None:intergenic
AACAATATACCGAATGTATC+TGG	0.350766	8_3:-64607684	Msa1302170:CDS
ATCAAAGGAATTTCAAACTT+TGG	0.350874	8_3:-64611362	Msa1302170:CDS
ACAAGAGCATCATGGATTAT+TGG	0.359537	8_3:+64607415	None:intergenic
CTATTCTTGAATCTTGATAC+AGG	0.378306	8_3:-64605059	Msa1302170:three_prime_UTR
ATTGGTGACATCCTATTTAG+AGG	0.384471	8_3:-64604806	Msa1302170:three_prime_UTR
AGGACATGGAGGGTAGTAAT+TGG	0.385875	8_3:+64607558	None:intergenic
AATTTATACCTGAAATCAAT+GGG	0.410650	8_3:+64611330	None:intergenic
TTTACCACTACTCTGTGTAT+TGG	0.412856	8_3:+64605420	None:intergenic
ATGAATCAGAATGTGGCTTC+AGG	0.416306	8_3:+64607515	None:intergenic
ACTGGTTATCTTTGAGAACT+TGG	0.422799	8_3:+64607449	None:intergenic
CCTTGATGGTTACAGATAAC+GGG	0.431990	8_3:-64606849	Msa1302170:intron
GCGTTACAAGTTGGCAATGA+TGG	0.440803	8_3:-64606811	Msa1302170:CDS
GAATTTATACCTGAAATCAA+TGG	0.446659	8_3:+64611329	None:intergenic
GGAAGAGGATTGTTTCCTAA+AGG	0.458189	8_3:-64607614	Msa1302170:CDS
AACTTGTGAAAGTGCTAATC+CGG	0.468546	8_3:+64604966	None:intergenic
ATATACAATGAAGGTGGTGT+TGG	0.469623	8_3:-64611852	Msa1302170:CDS
TCATTCACTAGTTTGTCAAC+CGG	0.472035	8_3:+64605333	None:intergenic
GATAAATGTTGGTGATCAAA+TGG	0.474201	8_3:-64607392	Msa1302170:CDS
CTTGTAACGCTTTACAGTTA+CGG	0.476749	8_3:+64606824	None:intergenic
GAATCTCTTTCTCTGAATCT+GGG	0.476860	8_3:+64605358	None:intergenic
TTATTGGAACTTTAAACCAC+TGG	0.480568	8_3:+64607431	None:intergenic
AGCATGTCACCTACCCTACT+TGG	0.484401	8_3:-64604765	Msa1302170:three_prime_UTR
ATGTTAAAGGAGGCCAAGTA+GGG	0.493711	8_3:+64604752	None:intergenic
GTGAAAGTGAAAGCCTAATC+CGG	0.494942	8_3:+64605019	None:intergenic
AGTAGTGGTAAATGCAGAAA+GGG	0.496294	8_3:-64605409	Msa1302170:CDS
AGGGAACAAAACAATATTGA+AGG	0.499241	8_3:-64611465	Msa1302170:CDS
AGCTCATGTTGTGATGTAGA+TGG	0.499763	8_3:+64611756	None:intergenic
ATATACAGATAATGAGCAAT+GGG	0.504522	8_3:-64605455	Msa1302170:intron
GGTTATCTTTGAGAACTTGG+AGG	0.510231	8_3:+64607452	None:intergenic
ATATAACTGCCAGATACATT+CGG	0.510757	8_3:+64607675	None:intergenic
CATGGCGAAGACACTTAACT+TGG	0.510992	8_3:-64607635	Msa1302170:CDS
AATAATTATATATACAATGA+AGG	0.515453	8_3:-64611861	Msa1302170:CDS
TTCAGAGAAAGAGATTCAAC+CGG	0.515663	8_3:-64605352	Msa1302170:CDS
CATTTATCACAAGAGCATCA+TGG	0.515743	8_3:+64607407	None:intergenic
TTACTACCCTCCATGTCCTA+TGG	0.516124	8_3:-64607554	Msa1302170:CDS
GTCTTAAGTGGTCCGCTGGA+TGG	0.518133	8_3:+64612074	None:intergenic
GATGTTAAAGGAGGCCAAGT+AGG	0.520122	8_3:+64604751	None:intergenic
CGAGCACCCACCCATGGAGA+GGG	0.525848	8_3:-64606743	Msa1302170:CDS
CTGCAGATACTCGTCTTAAG+TGG	0.530991	8_3:+64612062	None:intergenic
GCTCGTTTCTTGACAAAGTG+AGG	0.541459	8_3:-64611542	Msa1302170:CDS
ACTCGTCTTAAGTGGTCCGC+TGG	0.551396	8_3:+64612070	None:intergenic
ACATAACCCCTCTCCATGGG+TGG	0.556536	8_3:+64606736	None:intergenic
TTGTATATATAATTATTTGG+TGG	0.556737	8_3:+64611867	None:intergenic
CCTATGGCTGATCATGCTCT+GGG	0.557427	8_3:-64607538	Msa1302170:CDS
ATGAATTTGGTGCTTGCAAG+AGG	0.558741	8_3:-64605124	Msa1302170:three_prime_UTR
TGGTAAATGCAGAAAGGGAA+AGG	0.560475	8_3:-64605404	Msa1302170:CDS
GCATGATCAGCCATAGGACA+TGG	0.560749	8_3:+64607544	None:intergenic
AGGTTGGCAATGTCAATGAT+TGG	0.563323	8_3:+64611786	None:intergenic
GAAGACACTTAACTTGGAAG+AGG	0.563733	8_3:-64607629	Msa1302170:CDS
GCAGTCAAACGCGCAACAAG+TGG	0.564127	8_3:-64612043	Msa1302170:five_prime_UTR
CACATGAATGAAGTGCAGCT+TGG	0.566650	8_3:+64611724	None:intergenic
GAGTAGTGGTAAATGCAGAA+AGG	0.567843	8_3:-64605410	Msa1302170:CDS
AGGTAGAGATAGCCACTAGT+AGG	0.567892	8_3:-64611926	Msa1302170:CDS
TTCTGGAAAAGTTTGTGAGA+TGG	0.571136	8_3:-64605201	Msa1302170:three_prime_UTR
AACTGTAAAGCGTTACAAGT+TGG	0.574444	8_3:-64606820	Msa1302170:CDS
TTGCTGCGAGCACCCACCCA+TGG	0.575561	8_3:-64606749	Msa1302170:CDS
CTCGTTTCTTGACAAAGTGA+GGG	0.576302	8_3:-64611541	Msa1302170:CDS
GACACATAACCCCTCTCCAT+GGG	0.582435	8_3:+64606733	None:intergenic
GAAACGAGCTTGTCATCCCA+TGG	0.585363	8_3:+64611556	None:intergenic
TGTAGATGGAGAAGTGAGGT+TGG	0.585949	8_3:+64611770	None:intergenic
GGACACATAACCCCTCTCCA+TGG	0.587393	8_3:+64606732	None:intergenic
GCGAGCACCCACCCATGGAG+AGG	0.589350	8_3:-64606744	Msa1302170:CDS
GATTGTTTCCTAAAGGAATG+TGG	0.591700	8_3:-64607607	Msa1302170:CDS
CAAGCTGCACTTCATTCATG+TGG	0.592642	8_3:-64611723	Msa1302170:CDS
AATATACAGATAATGAGCAA+TGG	0.593689	8_3:-64605456	Msa1302170:intron
AGGTACATCCTGAAGATCAA+AGG	0.594954	8_3:-64611377	Msa1302170:CDS
CTAAAGGAATGTGGAGAGAG+AGG	0.597062	8_3:-64607598	Msa1302170:CDS
GCTGTTCAGGTGATAAACCA+TGG	0.598562	8_3:-64611573	Msa1302170:intron
AATTATATATACAATGAAGG+TGG	0.598998	8_3:-64611858	Msa1302170:CDS
CTGTTCAGGTGATAAACCAT+GGG	0.603760	8_3:-64611572	Msa1302170:intron
GATGCTCTTGTGATAAATGT+TGG	0.616610	8_3:-64607403	Msa1302170:CDS
TGGGTGCTCGCAGCAATTTG+GGG	0.624881	8_3:+64606756	None:intergenic
ATATGAAAATCAGATTCTGA+AGG	0.630963	8_3:+64611810	None:intergenic
CATAACCCCTCTCCATGGGT+GGG	0.632835	8_3:+64606737	None:intergenic
TAAAGGAGGCCAAGTAGGGT+AGG	0.633239	8_3:+64604756	None:intergenic
CAGTCAAACGCGCAACAAGT+GGG	0.637870	8_3:-64612042	Msa1302170:five_prime_UTR
ATAGATGATGAATCAGAATG+TGG	0.639173	8_3:+64607508	None:intergenic
TTCTTGAACCGACCTACTAG+TGG	0.643893	8_3:+64611914	None:intergenic
TTTGGTGCTTGCAAGAGGAA+TGG	0.644533	8_3:-64605119	Msa1302170:three_prime_UTR
TTACAAGTTGGCAATGATGG+AGG	0.645179	8_3:-64606808	Msa1302170:CDS
CCCAGAGCATGATCAGCCAT+AGG	0.646801	8_3:+64607538	None:intergenic
ACAAACTAGTGAATGAGTCA+AGG	0.647074	8_3:-64605326	Msa1302170:CDS
GAGTCCAATACACAGAGTAG+TGG	0.648084	8_3:-64605424	Msa1302170:CDS
AGAGATAGCCACTAGTAGGT+CGG	0.653864	8_3:-64611922	Msa1302170:CDS
AAGTTCTCAAAGATAACCAG+TGG	0.660926	8_3:-64607447	Msa1302170:CDS
ATTTATACCTGAAATCAATG+GGG	0.672971	8_3:+64611331	None:intergenic
GAGCACCCACCCATGGAGAG+GGG	0.673204	8_3:-64606742	Msa1302170:intron
TGATCAGCCATAGGACATGG+AGG	0.676264	8_3:+64607547	None:intergenic
GATCAGCCATAGGACATGGA+GGG	0.682438	8_3:+64607548	None:intergenic
TACGTCAAGTATCCATCCAG+CGG	0.683576	8_3:-64612086	Msa1302170:five_prime_UTR
AAATGTTGGTGATCAAATGG+AGG	0.684032	8_3:-64607389	Msa1302170:intron
GTGATGTAGATGGAGAAGTG+AGG	0.707417	8_3:+64611766	None:intergenic
TTTCTCGAGTACTACCAACA+AGG	0.720997	8_3:-64605264	Msa1302170:CDS
TCTCTTTCTCTGAATCTGGG+CGG	0.729749	8_3:+64605361	None:intergenic

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content
!!!	TTATTTTTTATTTTTTATTA+TGG	+	chr8_3:64606053-64606072	None:intergenic	0.0%
!!	TCATTGTATATATAATTATT+TGG	+	chr8_3:64604999-64605018	None:intergenic	10.0%
!!	AATAATTATATATACAATGA+AGG	-	chr8_3:64604999-64605018	Msa1302170:three_prime_UTR	10.0%
!!!	TTTTTTTTGTTAAATTTTAC+AGG	+	chr8_3:64606134-64606153	None:intergenic	10.0%
!!	GAAAAATAAAATAAAAAAAG+AGG	+	chr8_3:64607294-64607313	None:intergenic	10.0%
!!	TAACATTCAAAATTAATTAA+TGG	+	chr8_3:64608184-64608203	None:intergenic	10.0%
!!!	TTTTTAATTAATGTATGAAA+TGG	+	chr8_3:64608640-64608659	None:intergenic	10.0%
!!	AATTTACACATTAAAATAAT+TGG	+	chr8_3:64610763-64610782	None:intergenic	10.0%
!!	ATATTATACATATATATAAG+TGG	-	chr8_3:64611211-64611230	Msa1302170:intron	10.0%
!!	TTGTATATATAATTATTTGG+TGG	+	chr8_3:64604996-64605015	None:intergenic	15.0%
!!	TTTAGATTTAAATGTACTTT+CGG	-	chr8_3:64605663-64605682	Msa1302170:intron	15.0%
!!	TATTTGCCATAAAAAAATAT+AGG	-	chr8_3:64605894-64605913	Msa1302170:intron	15.0%
!!!	ATGTCATTTGATTTTAAATT+TGG	+	chr8_3:64605945-64605964	None:intergenic	15.0%
!!	GATAAGTCTATATATATATA+AGG	-	chr8_3:64606208-64606227	Msa1302170:intron	15.0%
!!	AAATAACATCACTTTATAAT+AGG	+	chr8_3:64607460-64607479	None:intergenic	15.0%
!!!	ACACTTTTCTTTAAAAAAAA+AGG	+	chr8_3:64607519-64607538	None:intergenic	15.0%
!!	TTAATCACACATTAATTTAA+GGG	+	chr8_3:64608340-64608359	None:intergenic	15.0%
!!	TTTAATCACACATTAATTTA+AGG	+	chr8_3:64608341-64608360	None:intergenic	15.0%
!!!	TTTTACAATTTCAATTTGAT+AGG	+	chr8_3:64608600-64608619	None:intergenic	15.0%
!!!	AAAATAAATTCAAATGGATT+TGG	+	chr8_3:64609042-64609061	None:intergenic	15.0%
!!!	AAATCCATTTGAATTTATTT+TGG	-	chr8_3:64609041-64609060	Msa1302170:intron	15.0%
!!!	AGTTATATGAAGTAATTTTA+AGG	-	chr8_3:64609200-64609219	Msa1302170:intron	15.0%
!!!	GTTATATGAAGTAATTTTAA+GGG	-	chr8_3:64609201-64609220	Msa1302170:intron	15.0%
!!!	AAGTTTTATGTTTTATGTTA+GGG	-	chr8_3:64610265-64610284	Msa1302170:intron	15.0%
!!	TATATATACTATGAAATTGT+GGG	+	chr8_3:64610613-64610632	None:intergenic	15.0%
!!	ATATATATACTATGAAATTG+TGG	+	chr8_3:64610614-64610633	None:intergenic	15.0%
!!!	ACTATTAATTTTTTGTTCTA+TGG	-	chr8_3:64610812-64610831	Msa1302170:intron	15.0%
!!!	TTTTTATTTACACAAAATGT+TGG	-	chr8_3:64610917-64610936	Msa1302170:intron	15.0%
!!	TACATAAGAAATTAAAAGTA+TGG	-	chr8_3:64611091-64611110	Msa1302170:intron	15.0%
!!!	TATTTTTACTTATGTTTTCA+AGG	-	chr8_3:64611370-64611389	Msa1302170:CDS	15.0%
!!	AAAAAAAATGTGAACAATAT+TGG	-	chr8_3:64612036-64612055	Msa1302170:five_prime_UTR	15.0%
!!	CACAATAACAATAACAAAAA+TGG	-	chr8_3:64604899-64604918	Msa1302170:three_prime_UTR	20.0%
!!	AATTATATATACAATGAAGG+TGG	-	chr8_3:64605002-64605021	Msa1302170:three_prime_UTR	20.0%
!!	AATTTATACCTGAAATCAAT+GGG	+	chr8_3:64605533-64605552	None:intergenic	20.0%
!!	AAAAAAGTTTAAGAACTTAG+TGG	+	chr8_3:64605563-64605582	None:intergenic	20.0%
!!	ATTCAAACACAAACATAAAT+GGG	-	chr8_3:64605820-64605839	Msa1302170:intron	20.0%
!!!	TTATGGTGAATTTTTTGTTT+TGG	+	chr8_3:64606036-64606055	None:intergenic	20.0%
!!	AAGTCTATATATATATAAGG+TGG	-	chr8_3:64606211-64606230	Msa1302170:intron	20.0%
!!	AGTCTATATATATATAAGGT+GGG	-	chr8_3:64606212-64606231	Msa1302170:intron	20.0%
!!	TAGATATTGCAACATATAAT+TGG	-	chr8_3:64606389-64606408	Msa1302170:intron	20.0%
!!!	ATCAATTTTTATTCCAAGAA+TGG	+	chr8_3:64606566-64606585	None:intergenic	20.0%
!!	CTAAATGATATTAAATGTTC+TGG	+	chr8_3:64606752-64606771	None:intergenic	20.0%
!!!	TTGAATATTTTCAACTACTT+TGG	-	chr8_3:64606952-64606971	Msa1302170:intron	20.0%
!!!	TGAATATTTTCAACTACTTT+GGG	-	chr8_3:64606953-64606972	Msa1302170:intron	20.0%
!!	AAGTCAATTAATGAATGTAA+AGG	-	chr8_3:64606983-64607002	Msa1302170:intron	20.0%
!!!	AGATAAAAAAATTTGCTGAT+TGG	+	chr8_3:64607105-64607124	None:intergenic	20.0%
!!!	ATATGGTGTCATAAAATAAT+GGG	-	chr8_3:64607173-64607192	Msa1302170:intron	20.0%
!!!	ATGTGAAAATATCATTTTGT+GGG	+	chr8_3:64607257-64607276	None:intergenic	20.0%
!!	TATTTAAGAATTGAATCTCA+AGG	+	chr8_3:64607396-64607415	None:intergenic	20.0%
!!!	ATTTGCTAAATACATTAGTT+AGG	+	chr8_3:64607437-64607456	None:intergenic	20.0%
!!	TATTGTTGTAATGTTAACTT+TGG	+	chr8_3:64607632-64607651	None:intergenic	20.0%
!!	ATTCAAAATTAATTAATGGC+TGG	+	chr8_3:64608180-64608199	None:intergenic	20.0%
!!	AACACCAAAATAAATTCAAA+TGG	+	chr8_3:64609048-64609067	None:intergenic	20.0%
!!!	ATTTGAATTTATTTTGGTGT+TGG	-	chr8_3:64609047-64609066	Msa1302170:intron	20.0%
!!!	TAATTTTTTAATCAACAACG+TGG	+	chr8_3:64609722-64609741	None:intergenic	20.0%
!!!	GAAGTTTTATGTTTTATGTT+AGG	-	chr8_3:64610264-64610283	Msa1302170:intron	20.0%
!!	CTATGGAAGATAATTTAAAT+CGG	-	chr8_3:64610829-64610848	Msa1302170:intron	20.0%
!!!	TAATTTAAATCGGTGTTTTA+AGG	-	chr8_3:64610839-64610858	Msa1302170:intron	20.0%
!!	TTATTAAAGAAAACGTCAAT+GGG	+	chr8_3:64611053-64611072	None:intergenic	20.0%
!!	TTTATTAAAGAAAACGTCAA+TGG	+	chr8_3:64611054-64611073	None:intergenic	20.0%
!!	TTATACATATATATAAGTGG+CGG	-	chr8_3:64611214-64611233	Msa1302170:intron	20.0%
!!	ATAAAATTAACAAGTGTCTT+TGG	-	chr8_3:64611278-64611297	Msa1302170:intron	20.0%
!!!	TAAGCTTTAATCTATGAATT+TGG	-	chr8_3:64611723-64611742	Msa1302170:CDS	20.0%
!!	AATAACAAAAATGGAAGTGT+CGG	-	chr8_3:64604908-64604927	Msa1302170:three_prime_UTR	25.0%
!	ATATGAAAATCAGATTCTGA+AGG	+	chr8_3:64605053-64605072	None:intergenic	25.0%
!	TATAAATAAATGTTTGCAGC+TGG	+	chr8_3:64605205-64605224	None:intergenic	25.0%
!!	AAAACAGTTGCGAAAAATTT+TGG	+	chr8_3:64605265-64605284	None:intergenic	25.0%
!!!	TATTTTTGCTTTTCTTCCTT+TGG	+	chr8_3:64605371-64605390	None:intergenic	25.0%
!	AAGAAAAGCAAAAATATGCA+AGG	-	chr8_3:64605375-64605394	Msa1302170:CDS	25.0%
!	AGAAAAGCAAAAATATGCAA+GGG	-	chr8_3:64605376-64605395	Msa1302170:CDS	25.0%
!	CAAAACAATATTGAAGGATA+TGG	-	chr8_3:64605401-64605420	Msa1302170:CDS	25.0%
!	ATCAAAGGAATTTCAAACTT+TGG	-	chr8_3:64605498-64605517	Msa1302170:intron	25.0%
!	ATTTATACCTGAAATCAATG+GGG	+	chr8_3:64605532-64605551	None:intergenic	25.0%
!	GAATTTATACCTGAAATCAA+TGG	+	chr8_3:64605534-64605553	None:intergenic	25.0%
!	GATTCAAACACAAACATAAA+TGG	-	chr8_3:64605819-64605838	Msa1302170:intron	25.0%
!	TGCCATAAAAAAATATAGGT+CGG	-	chr8_3:64605898-64605917	Msa1302170:intron	25.0%
!!!	ATCCGACCTATATTTTTTTA+TGG	+	chr8_3:64605903-64605922	None:intergenic	25.0%
!!	TATAAATTTTCAAAGACTCC+AGG	-	chr8_3:64606283-64606302	Msa1302170:intron	25.0%
!!	ATCCTAATTTTGGATGAAAA+TGG	+	chr8_3:64606343-64606362	None:intergenic	25.0%
!!!	GACAATCTTTTTCAAAAGTT+GGG	+	chr8_3:64606447-64606466	None:intergenic	25.0%
!	ATTGCAAAACACAAACATAT+GGG	-	chr8_3:64606487-64606506	Msa1302170:intron	25.0%
!	TGTCTTCTACTAAATTTGAA+AGG	-	chr8_3:64606514-64606533	Msa1302170:intron	25.0%
!	GTCTTCTACTAAATTTGAAA+GGG	-	chr8_3:64606515-64606534	Msa1302170:intron	25.0%
!!!	TTTTATTCCAAGAATGGATT+TGG	+	chr8_3:64606560-64606579	None:intergenic	25.0%
!!	ATATTCCTTAGAAGCATAAT+GGG	-	chr8_3:64606688-64606707	Msa1302170:intron	25.0%
!!	TATGTTTTATCTTTGATTCC+TGG	+	chr8_3:64606863-64606882	None:intergenic	25.0%
!!!	GATATGGTGTCATAAAATAA+TGG	-	chr8_3:64607172-64607191	Msa1302170:intron	25.0%
!	GGACAACAAAATTAAATTAC+AGG	+	chr8_3:64607205-64607224	None:intergenic	25.0%
!!	CATGTGAAAATATCATTTTG+TGG	+	chr8_3:64607258-64607277	None:intergenic	25.0%
!	AACAAAACACAATAACAATG+AGG	-	chr8_3:64607562-64607581	Msa1302170:CDS	25.0%
!!	TGAGGATTAATTCTAAAAAC+CGG	-	chr8_3:64607580-64607599	Msa1302170:CDS	25.0%
!	ATAAAGACTGATACGATAAA+AGG	-	chr8_3:64607869-64607888	Msa1302170:intron	25.0%
!	CAAACACAATGTATATTTAC+AGG	+	chr8_3:64608150-64608169	None:intergenic	25.0%
!	AACATTAGACATTAAGTTAC+AGG	-	chr8_3:64608361-64608380	Msa1302170:intron	25.0%
!	AATTTCAATTTGATAGGAGT+GGG	+	chr8_3:64608594-64608613	None:intergenic	25.0%
!!	AAATCAATTTAAGACCAAGT+GGG	+	chr8_3:64608744-64608763	None:intergenic	25.0%
!!	TAAATCAATTTAAGACCAAG+TGG	+	chr8_3:64608745-64608764	None:intergenic	25.0%
!	TTGATTTATGATAACTCCAT+CGG	-	chr8_3:64608757-64608776	Msa1302170:intron	25.0%
!!	TAAATTCAAATGGATTTGGA+AGG	+	chr8_3:64609038-64609057	None:intergenic	25.0%
!!!	AATTTATTTTGGTGTTGGTT+TGG	-	chr8_3:64609052-64609071	Msa1302170:intron	25.0%
!!!	ATTTATTTTGGTGTTGGTTT+GGG	-	chr8_3:64609053-64609072	Msa1302170:intron	25.0%
!	ATGTAAATGAAGAATCATGT+CGG	-	chr8_3:64609125-64609144	Msa1302170:intron	25.0%
!!!	TTTTTTGCTGCAAGATAAAA+AGG	-	chr8_3:64609378-64609397	Msa1302170:intron	25.0%
!	GTCAAACAAAGTTTATAAGT+TGG	-	chr8_3:64609551-64609570	Msa1302170:intron	25.0%
!	TCAAATAACATTGATGTATC+TGG	+	chr8_3:64609590-64609609	None:intergenic	25.0%
!!	TATGTTTTATGTTAGGGAAA+AGG	-	chr8_3:64610271-64610290	Msa1302170:intron	25.0%
!!!	CAGAGCTAGAAATAATTTTT+TGG	-	chr8_3:64610732-64610751	Msa1302170:intron	25.0%
!!!	GCTAGAAATAATTTTTTGGA+TGG	-	chr8_3:64610736-64610755	Msa1302170:intron	25.0%
!	TATTAAAGAAAACGTCAATG+GGG	+	chr8_3:64611052-64611071	None:intergenic	25.0%
!!	GAAATTAAAAGTATGGCTAA+CGG	-	chr8_3:64611098-64611117	Msa1302170:intron	25.0%
!!	AAATTAAAAGTATGGCTAAC+GGG	-	chr8_3:64611099-64611118	Msa1302170:intron	25.0%
!	AATATACAGATAATGAGCAA+TGG	-	chr8_3:64611404-64611423	Msa1302170:CDS	25.0%
!	ATATACAGATAATGAGCAAT+GGG	-	chr8_3:64611405-64611424	Msa1302170:CDS	25.0%
!!!	TAGATTTTGAAAGCATCAAT+TGG	+	chr8_3:64611629-64611648	None:intergenic	25.0%
!	AAATCTAATCAAATGCTTTC+TGG	-	chr8_3:64611642-64611661	Msa1302170:intron	25.0%
!!	AAAATAGCTTTTGTCATAAC+CGG	-	chr8_3:64611875-64611894	Msa1302170:CDS	25.0%
!!!	AAAAATTTTGGAGCTTAAGG+AGG	+	chr8_3:64605253-64605272	None:intergenic	30.0%
!!!	GCAATTTTTTGAACTTCCAA+AGG	-	chr8_3:64605352-64605371	Msa1302170:CDS	30.0%
	AGGGAACAAAACAATATTGA+AGG	-	chr8_3:64605395-64605414	Msa1302170:CDS	30.0%
	CAGAAAATCAAATGCTTGAT+TGG	-	chr8_3:64605441-64605460	Msa1302170:CDS	30.0%
!!	GTGTGACAGAATATTTTTGA+AGG	-	chr8_3:64605463-64605482	Msa1302170:intron	30.0%
	TTGAAATTCCTTTGATCTTC+AGG	+	chr8_3:64605494-64605513	None:intergenic	30.0%
!!	ATAGCTTTACATTTTGCTGT+AGG	-	chr8_3:64605611-64605630	Msa1302170:intron	30.0%
!!	TAGCTTTACATTTTGCTGTA+GGG	-	chr8_3:64605612-64605631	Msa1302170:intron	30.0%
!	AATTTTCCAGTTCTTGAGTT+AGG	-	chr8_3:64606094-64606113	Msa1302170:intron	30.0%
!	ACTAACAATGTTGTTTATCC+TGG	+	chr8_3:64606304-64606323	None:intergenic	30.0%
!	GACCATTTTCATCCAAAATT+AGG	-	chr8_3:64606338-64606357	Msa1302170:intron	30.0%
!	GGGATTGAAAATCCTAATTT+TGG	+	chr8_3:64606353-64606372	None:intergenic	30.0%
!	TCTAGAGTTACAACTACAAA+GGG	+	chr8_3:64606373-64606392	None:intergenic	30.0%
!	ATCTAGAGTTACAACTACAA+AGG	+	chr8_3:64606374-64606393	None:intergenic	30.0%
!!!	GGACAATCTTTTTCAAAAGT+TGG	+	chr8_3:64606448-64606467	None:intergenic	30.0%
	CATTGCAAAACACAAACATA+TGG	-	chr8_3:64606486-64606505	Msa1302170:intron	30.0%
!	GATATTCCTTAGAAGCATAA+TGG	-	chr8_3:64606687-64606706	Msa1302170:intron	30.0%
!!!	ACCAACCTTTTAAAGTCAAA+CGG	-	chr8_3:64606714-64606733	Msa1302170:intron	30.0%
!	AATCACCGTTTGACTTTAAA+AGG	+	chr8_3:64606722-64606741	None:intergenic	30.0%
!	TTTAAAGTCAAACGGTGATT+TGG	-	chr8_3:64606722-64606741	Msa1302170:intron	30.0%
!!!	TTTTCAACAACCTCTAAAGT+AGG	-	chr8_3:64606893-64606912	Msa1302170:intron	30.0%
!!	TTCTGAGATTACTATTCCAA+AGG	+	chr8_3:64607035-64607054	None:intergenic	30.0%
!	TGGATTTTGAATATTGGTGA+TGG	+	chr8_3:64607085-64607104	None:intergenic	30.0%
!	GCTGATTGGATTTTGAATAT+TGG	+	chr8_3:64607091-64607110	None:intergenic	30.0%
	TAACAAACTAAGCTATGGTT+TGG	+	chr8_3:64607316-64607335	None:intergenic	30.0%
!!	AACCATAGCTTAGTTTGTTA+AGG	-	chr8_3:64607316-64607335	Msa1302170:intron	30.0%
!!	AAGTCGCATAAGTTTGTTTT+GGG	+	chr8_3:64607664-64607683	None:intergenic	30.0%
!!	TAAGTCGCATAAGTTTGTTT+TGG	+	chr8_3:64607665-64607684	None:intergenic	30.0%
!!	TATATTGGGCATTTTGTTTG+TGG	+	chr8_3:64607703-64607722	None:intergenic	30.0%
	AACAAAATGCCCAATATAAC+TGG	-	chr8_3:64607705-64607724	Msa1302170:intron	30.0%
	ACAAAATGCCCAATATAACT+GGG	-	chr8_3:64607706-64607725	Msa1302170:intron	30.0%
	TTGTAAGACCCAGTTATATT+GGG	+	chr8_3:64607717-64607736	None:intergenic	30.0%
	TTTGTAAGACCCAGTTATAT+TGG	+	chr8_3:64607718-64607737	None:intergenic	30.0%
	AAAATTGAGAAGATCTAGCT+AGG	+	chr8_3:64607951-64607970	None:intergenic	30.0%
!	TGATAGTGTTTATAAGTACC+TGG	-	chr8_3:64608242-64608261	Msa1302170:intron	30.0%
	TTAGACATTAAGTTACAGGT+TGG	-	chr8_3:64608365-64608384	Msa1302170:intron	30.0%
	ATTTCAATTTGATAGGAGTG+GGG	+	chr8_3:64608593-64608612	None:intergenic	30.0%
	CAATTTCAATTTGATAGGAG+TGG	+	chr8_3:64608595-64608614	None:intergenic	30.0%
	AACAATATACCGAATGTATC+TGG	-	chr8_3:64609176-64609195	Msa1302170:intron	30.0%
	ATATAACTGCCAGATACATT+CGG	+	chr8_3:64609188-64609207	None:intergenic	30.0%
!!	TGAAGTAATTTTAAGGGTCA+TGG	-	chr8_3:64609207-64609226	Msa1302170:intron	30.0%
	ATAGATGATGAATCAGAATG+TGG	+	chr8_3:64609355-64609374	None:intergenic	30.0%
	TTATTGGAACTTTAAACCAC+TGG	+	chr8_3:64609432-64609451	None:intergenic	30.0%
!!	GATAAATGTTGGTGATCAAA+TGG	-	chr8_3:64609468-64609487	Msa1302170:intron	30.0%
!!	TCAGTATTTTGAGCTAGAAA+GGG	-	chr8_3:64609889-64609908	Msa1302170:intron	30.0%
	TGTTCAAGTCTCCTTATATA+GGG	-	chr8_3:64609950-64609969	Msa1302170:intron	30.0%
	CCTAATAAGAAGGCTTAATT+CGG	+	chr8_3:64610158-64610177	None:intergenic	30.0%
	AACTAAGAACTCATCAAAGT+CGG	+	chr8_3:64610326-64610345	None:intergenic	30.0%
	TCATTATTCATTCCACTTTC+AGG	+	chr8_3:64610564-64610583	None:intergenic	30.0%
	GTATATATATTACGAGTGAG+TGG	-	chr8_3:64610624-64610643	Msa1302170:intron	30.0%
	CAAGAATGAGGAAAATATCA+AGG	+	chr8_3:64610704-64610723	None:intergenic	30.0%
	TAATTAGAATGTAGTTGCCT+TGG	-	chr8_3:64610985-64611004	Msa1302170:intron	30.0%
!	ATTTGAAACGTGAAACGTAA+AGG	-	chr8_3:64611128-64611147	Msa1302170:intron	30.0%
!	TTTTTATGAAACAAGAGCAG+TGG	+	chr8_3:64611254-64611273	None:intergenic	30.0%
!	TTTACTGGTCTGTATAATAC+TGG	+	chr8_3:64611560-64611579	None:intergenic	30.0%
!	ATCTTAGCACAATCTTTTAC+TGG	+	chr8_3:64611575-64611594	None:intergenic	30.0%
	ACGTATTATGCTATCTGATT+AGG	-	chr8_3:64611770-64611789	Msa1302170:CDS	30.0%
	CTATTCTTGAATCTTGATAC+AGG	-	chr8_3:64611801-64611820	Msa1302170:CDS	30.0%
!	GGAAAAGTTTTTGTGATAAC+CGG	-	chr8_3:64611822-64611841	Msa1302170:CDS	30.0%
	AAAAATAGCGTGAGTCATAT+TGG	-	chr8_3:64611922-64611941	Msa1302170:CDS	30.0%
	CACGCTAACTCTAATTAATT+AGG	-	chr8_3:64612004-64612023	Msa1302170:five_prime_UTR	30.0%
	ATATACAATGAAGGTGGTGT+TGG	-	chr8_3:64605008-64605027	Msa1302170:three_prime_UTR	35.0%
!!!	GCGAAAAATTTTGGAGCTTA+AGG	+	chr8_3:64605256-64605275	None:intergenic	35.0%
!!	AGCTTTACATTTTGCTGTAG+GGG	-	chr8_3:64605613-64605632	Msa1302170:intron	35.0%
	ACTAGTACCTTACAGTTACA+AGG	+	chr8_3:64605705-64605724	None:intergenic	35.0%
	AACTTAGTCACTCAAACATC+AGG	+	chr8_3:64606248-64606267	None:intergenic	35.0%
	ACATTGTTAGTAGTTGTGCA+AGG	-	chr8_3:64606313-64606332	Msa1302170:intron	35.0%
	AATTGGCCATGTGTAAATAC+CGG	-	chr8_3:64606406-64606425	Msa1302170:intron	35.0%
	ATGACTATCAACAAGAGTCA+AGG	+	chr8_3:64606469-64606488	None:intergenic	35.0%
	TTTGAAAGGGAATCCTGAAT+CGG	-	chr8_3:64606528-64606547	Msa1302170:intron	35.0%
	GTGATCAGTGGCAAAAATAT+TGG	+	chr8_3:64606592-64606611	None:intergenic	35.0%
	AAGGTCTTTGTAATGGTACA+TGG	+	chr8_3:64606657-64606676	None:intergenic	35.0%
	CAAGCTAAAGGTCTTTGTAA+TGG	+	chr8_3:64606664-64606683	None:intergenic	35.0%
	AGGAATATCGATCAAGCTAA+AGG	+	chr8_3:64606676-64606695	None:intergenic	35.0%
!	ACCGTTTGACTTTAAAAGGT+TGG	+	chr8_3:64606718-64606737	None:intergenic	35.0%
	ACTATGAAGTTCAAGGTGAT+TGG	+	chr8_3:64606790-64606809	None:intergenic	35.0%
	AATTCTGTGTCCTACTTTAG+AGG	+	chr8_3:64606906-64606925	None:intergenic	35.0%
!!	GAATATTGGTGATGGTATCA+TGG	+	chr8_3:64607077-64607096	None:intergenic	35.0%
	AAACATGTGCATAGCTAACA+TGG	-	chr8_3:64607231-64607250	Msa1302170:intron	35.0%
	GACCTTAACAAACTAAGCTA+TGG	+	chr8_3:64607321-64607340	None:intergenic	35.0%
	ACAAACTTATGCGACTTAGA+TGG	-	chr8_3:64607667-64607686	Msa1302170:CDS	35.0%
!	GTCATCGATGTTTTCCTATT+TGG	-	chr8_3:64607770-64607789	Msa1302170:intron	35.0%
!	ATCGATGTTTTCCTATTTGG+TGG	-	chr8_3:64607773-64607792	Msa1302170:intron	35.0%
!	TCGATGTTTTCCTATTTGGT+GGG	-	chr8_3:64607774-64607793	Msa1302170:intron	35.0%
!	TCTTTTGTTAGAGTCAAGTG+TGG	+	chr8_3:64607803-64607822	None:intergenic	35.0%
	AACAAAAGATCCTCCATATG+TGG	-	chr8_3:64607814-64607833	Msa1302170:intron	35.0%
	ACAAAAGATCCTCCATATGT+GGG	-	chr8_3:64607815-64607834	Msa1302170:intron	35.0%
	CAAGCCATTATCACAAACTT+AGG	-	chr8_3:64607913-64607932	Msa1302170:intron	35.0%
	GTCTCCTAAGTTTGTGATAA+TGG	+	chr8_3:64607920-64607939	None:intergenic	35.0%
	TTCCTATCAAACTGTTGAAG+CGG	+	chr8_3:64607980-64607999	None:intergenic	35.0%
	TGAAAACAAGGGAGGTAAAA+GGG	+	chr8_3:64608039-64608058	None:intergenic	35.0%
	TTGAAAACAAGGGAGGTAAA+AGG	+	chr8_3:64608040-64608059	None:intergenic	35.0%
	GATGTGGTGATTGAAAACAA+GGG	+	chr8_3:64608050-64608069	None:intergenic	35.0%
	TGATGTGGTGATTGAAAACA+AGG	+	chr8_3:64608051-64608070	None:intergenic	35.0%
	AACAACAGCAGATGAAAACT+TGG	-	chr8_3:64608115-64608134	Msa1302170:intron	35.0%
	ACAACAGCAGATGAAAACTT+GGG	-	chr8_3:64608116-64608135	Msa1302170:intron	35.0%
	CACATCGAGACGTTATAAAA+TGG	-	chr8_3:64608987-64609006	Msa1302170:intron	35.0%
	TCGAGACGTTATAAAATGGT+TGG	-	chr8_3:64608991-64609010	Msa1302170:intron	35.0%
	TAAATGAAGAATCATGTCGG+CGG	-	chr8_3:64609128-64609147	Msa1302170:intron	35.0%
	GATTGTTTCCTAAAGGAATG+TGG	-	chr8_3:64609253-64609272	Msa1302170:intron	35.0%
	CTGCAAGATAAAAAGGTAGA+AGG	-	chr8_3:64609385-64609404	Msa1302170:intron	35.0%
!	ACTGGTTATCTTTGAGAACT+TGG	+	chr8_3:64609414-64609433	None:intergenic	35.0%
	AAGTTCTCAAAGATAACCAG+TGG	-	chr8_3:64609413-64609432	Msa1302170:intron	35.0%
!!	ACAAGAGCATCATGGATTAT+TGG	+	chr8_3:64609448-64609467	None:intergenic	35.0%
!!	CATTTATCACAAGAGCATCA+TGG	+	chr8_3:64609456-64609475	None:intergenic	35.0%
	GATGCTCTTGTGATAAATGT+TGG	-	chr8_3:64609457-64609476	Msa1302170:intron	35.0%
!!	AAATGTTGGTGATCAAATGG+AGG	-	chr8_3:64609471-64609490	Msa1302170:intron	35.0%
	ACAACGTGGTTGACATAATA+TGG	+	chr8_3:64609708-64609727	None:intergenic	35.0%
!!	GTCAGTATTTTGAGCTAGAA+AGG	-	chr8_3:64609888-64609907	Msa1302170:intron	35.0%
!!	CAGTATTTTGAGCTAGAAAG+GGG	-	chr8_3:64609890-64609909	Msa1302170:intron	35.0%
!!	AGTATTTTGAGCTAGAAAGG+GGG	-	chr8_3:64609891-64609910	Msa1302170:intron	35.0%
	TAGAAATCAATCGTACCTTG+AGG	-	chr8_3:64609923-64609942	Msa1302170:intron	35.0%
	CTGTTCAAGTCTCCTTATAT+AGG	-	chr8_3:64609949-64609968	Msa1302170:intron	35.0%
	AGCTACATACGTCAAAATAC+CGG	+	chr8_3:64609988-64610007	None:intergenic	35.0%
!	TCCTTGATGGTTACAGATAA+CGG	-	chr8_3:64610010-64610029	Msa1302170:intron	35.0%
	CTTGTAACGCTTTACAGTTA+CGG	+	chr8_3:64610039-64610058	None:intergenic	35.0%
!	AACTGTAAAGCGTTACAAGT+TGG	-	chr8_3:64610040-64610059	Msa1302170:intron	35.0%
	CCGAATTAAGCCTTCTTATT+AGG	-	chr8_3:64610155-64610174	Msa1302170:intron	35.0%
!	GATTACGAGCATATGCTTTT+GGG	-	chr8_3:64610183-64610202	Msa1302170:intron	35.0%
	ACTAAGAACTCATCAAAGTC+GGG	+	chr8_3:64610325-64610344	None:intergenic	35.0%
	CAAGAAACCTTGAGCATTTA+AGG	-	chr8_3:64610389-64610408	Msa1302170:intron	35.0%
!!	GTAGTTTGCTAAGATCATTG+AGG	-	chr8_3:64610484-64610503	Msa1302170:intron	35.0%
	ATCATTGAGGATATGTTGCT+CGG	-	chr8_3:64610497-64610516	Msa1302170:intron	35.0%
	ATTTACCACTTTCATGCTAG+CGG	+	chr8_3:64610533-64610552	None:intergenic	35.0%
	AAATTAGTCAAGCCTGAAAG+TGG	-	chr8_3:64610549-64610568	Msa1302170:intron	35.0%
	AATGATCTGAGCAATCTCTT+CGG	-	chr8_3:64610579-64610598	Msa1302170:intron	35.0%
!	TTTTCCTCATTCTTGCTTAG+TGG	-	chr8_3:64610709-64610728	Msa1302170:intron	35.0%
!	TATATAAGTGGCGGAATAAG+TGG	-	chr8_3:64611223-64611242	Msa1302170:intron	35.0%
	TTTACCACTACTCTGTGTAT+TGG	+	chr8_3:64611443-64611462	None:intergenic	35.0%
	AGTAGTGGTAAATGCAGAAA+GGG	-	chr8_3:64611451-64611470	Msa1302170:CDS	35.0%
	GAATCTCTTTCTCTGAATCT+GGG	+	chr8_3:64611505-64611524	None:intergenic	35.0%
	TGAATCTCTTTCTCTGAATC+TGG	+	chr8_3:64611506-64611525	None:intergenic	35.0%
	TTCAGAGAAAGAGATTCAAC+CGG	-	chr8_3:64611508-64611527	Msa1302170:CDS	35.0%
!	TCATTCACTAGTTTGTCAAC+CGG	+	chr8_3:64611530-64611549	None:intergenic	35.0%
	ACAAACTAGTGAATGAGTCA+AGG	-	chr8_3:64611534-64611553	Msa1302170:CDS	35.0%
	AGTACTACCAACAAGGAAAA+AGG	-	chr8_3:64611603-64611622	Msa1302170:intron	35.0%
!	TTCTGGAAAAGTTTGTGAGA+TGG	-	chr8_3:64611659-64611678	Msa1302170:intron	35.0%
!	GTTTTTGTGATAACCGGATT+AGG	-	chr8_3:64611828-64611847	Msa1302170:CDS	35.0%
!!	AACTTGTGAAAGTGCTAATC+CGG	+	chr8_3:64611897-64611916	None:intergenic	35.0%
!	ATTGGTGACATCCTATTTAG+AGG	-	chr8_3:64612054-64612073	Msa1302170:five_prime_UTR	35.0%
	TCTTGATTGCACCTCTAAAT+AGG	+	chr8_3:64612068-64612087	None:intergenic	35.0%
	AGGTTGGCAATGTCAATGAT+TGG	+	chr8_3:64605077-64605096	None:intergenic	40.0%
	AGCTCATGTTGTGATGTAGA+TGG	+	chr8_3:64605107-64605126	None:intergenic	40.0%
	TCATTCATGTGGCTTCTTTC+TGG	-	chr8_3:64605148-64605167	Msa1302170:three_prime_UTR	40.0%
	ATGGTTTATCACCTGAACAG+CGG	+	chr8_3:64605288-64605307	None:intergenic	40.0%
	CTGTTCAGGTGATAAACCAT+GGG	-	chr8_3:64605288-64605307	Msa1302170:CDS	40.0%
	CTCGTTTCTTGACAAAGTGA+GGG	-	chr8_3:64605319-64605338	Msa1302170:CDS	40.0%
	AGGTACATCCTGAAGATCAA+AGG	-	chr8_3:64605483-64605502	Msa1302170:intron	40.0%
!	CTGAAATCAATGGGGTTTTG+GGG	+	chr8_3:64605524-64605543	None:intergenic	40.0%
!	CCTGAAATCAATGGGGTTTT+GGG	+	chr8_3:64605525-64605544	None:intergenic	40.0%
!	ACCTGAAATCAATGGGGTTT+TGG	+	chr8_3:64605526-64605545	None:intergenic	40.0%
!!	AGCTTAGCCTTGTAACTGTA+AGG	-	chr8_3:64605695-64605714	Msa1302170:intron	40.0%
	TGACGAACACTTGCAAAGTA+TGG	+	chr8_3:64605992-64606011	None:intergenic	40.0%
	TGGGTTGTATTTACCAAGAC+CGG	+	chr8_3:64606428-64606447	None:intergenic	40.0%
	ATTACTGCAACTGTGATCAG+TGG	+	chr8_3:64606604-64606623	None:intergenic	40.0%
	TGGCTGCAAGTTAAGGATTT+GGG	+	chr8_3:64606637-64606656	None:intergenic	40.0%
	ATGGCTGCAAGTTAAGGATT+TGG	+	chr8_3:64606638-64606657	None:intergenic	40.0%
	GTGTTCCCATTATGCTTCTA+AGG	+	chr8_3:64606696-64606715	None:intergenic	40.0%
	GATGAGGACTATGAAGTTCA+AGG	+	chr8_3:64606797-64606816	None:intergenic	40.0%
	AAGTAATCCTTAGCTTCTCC+AGG	-	chr8_3:64606842-64606861	Msa1302170:intron	40.0%
	TTTGATTCCTGGAGAAGCTA+AGG	+	chr8_3:64606852-64606871	None:intergenic	40.0%
	AAGTAGGACACAGAATTGCT+TGG	-	chr8_3:64606909-64606928	Msa1302170:intron	40.0%
	AAGGAGTTGTGCATTCTTGA+AGG	+	chr8_3:64607016-64607035	None:intergenic	40.0%
	TCAAGAATGCACAACTCCTT+TGG	-	chr8_3:64607016-64607035	Msa1302170:intron	40.0%
!!	ATTGGTGATGGTATCATGGA+AGG	+	chr8_3:64607073-64607092	None:intergenic	40.0%
!!	GCTATGCACATGTTTGTTGT+GGG	+	chr8_3:64607226-64607245	None:intergenic	40.0%
!	AGCTATGCACATGTTTGTTG+TGG	+	chr8_3:64607227-64607246	None:intergenic	40.0%
	TTCCGCTTCAACAGTTTGAT+AGG	-	chr8_3:64607975-64607994	Msa1302170:intron	40.0%
	GCTTCAACAGTTTGATAGGA+AGG	-	chr8_3:64607979-64607998	Msa1302170:intron	40.0%
!	CATTGGTGATACTTCTGATG+TGG	+	chr8_3:64608066-64608085	None:intergenic	40.0%
	AAGTATCACCAATGCCCAAT+GGG	-	chr8_3:64608072-64608091	Msa1302170:intron	40.0%
	TGCTGTTGTTGAACTAGATG+AGG	+	chr8_3:64608105-64608124	None:intergenic	40.0%
	GATCACAAGTTCCTTCTCTT+TGG	-	chr8_3:64608288-64608307	Msa1302170:intron	40.0%
	TGCATCTTCTTCCAAAGAGA+AGG	+	chr8_3:64608302-64608321	None:intergenic	40.0%
	AGGAGATTGTGATGATTCTC+AGG	+	chr8_3:64608552-64608571	None:intergenic	40.0%
!	GTTTAAGGTCGAATGCAAAG+TGG	+	chr8_3:64608831-64608850	None:intergenic	40.0%
	CTTTGCATTCGACCTTAAAC+AGG	-	chr8_3:64608831-64608850	Msa1302170:intron	40.0%
	TTCGACCTTAAACAGGTAAG+TGG	-	chr8_3:64608838-64608857	Msa1302170:intron	40.0%
	CAAGTCCACTTACCTGTTTA+AGG	+	chr8_3:64608846-64608865	None:intergenic	40.0%
	CTTGACCAAAGCAGAAATCT+CGG	-	chr8_3:64608862-64608881	Msa1302170:intron	40.0%
!	GAAGACACTTAACTTGGAAG+AGG	-	chr8_3:64609231-64609250	Msa1302170:intron	40.0%
	GGAAGAGGATTGTTTCCTAA+AGG	-	chr8_3:64609246-64609265	Msa1302170:intron	40.0%
	ATGAATCAGAATGTGGCTTC+AGG	+	chr8_3:64609348-64609367	None:intergenic	40.0%
!	GGTTATCTTTGAGAACTTGG+AGG	+	chr8_3:64609411-64609430	None:intergenic	40.0%
	TCAAGTCTCCTTATATAGGG+AGG	-	chr8_3:64609953-64609972	Msa1302170:intron	40.0%
	CGTATGTAGCTATTCCTTGA+TGG	-	chr8_3:64609997-64610016	Msa1302170:intron	40.0%
!	CCTTGATGGTTACAGATAAC+GGG	-	chr8_3:64610011-64610030	Msa1302170:intron	40.0%
!	TTACAAGTTGGCAATGATGG+AGG	-	chr8_3:64610052-64610071	Msa1302170:intron	40.0%
	AAGAAGGCTTAATTCGGCAT+TGG	+	chr8_3:64610152-64610171	None:intergenic	40.0%
	TAAGCCTTCTTATTAGGCCT+CGG	-	chr8_3:64610161-64610180	Msa1302170:intron	40.0%
	TAATCCGAGGCCTAATAAGA+AGG	+	chr8_3:64610168-64610187	None:intergenic	40.0%
!	GGATTACGAGCATATGCTTT+TGG	-	chr8_3:64610182-64610201	Msa1302170:intron	40.0%
	TGATGAGTTCTTAGTTCGCA+AGG	-	chr8_3:64610330-64610349	Msa1302170:intron	40.0%
	TTTACCACTTTCATGCTAGC+GGG	+	chr8_3:64610532-64610551	None:intergenic	40.0%
	TTAGAATGTAGTTGCCTTGG+TGG	-	chr8_3:64610988-64611007	Msa1302170:intron	40.0%
	TTATGAAACAAGAGCAGTGG+CGG	+	chr8_3:64611251-64611270	None:intergenic	40.0%
	GAGTAGTGGTAAATGCAGAA+AGG	-	chr8_3:64611450-64611469	Msa1302170:CDS	40.0%
	TGGTAAATGCAGAAAGGGAA+AGG	-	chr8_3:64611456-64611475	Msa1302170:CDS	40.0%
	TTTCTCGAGTACTACCAACA+AGG	-	chr8_3:64611596-64611615	Msa1302170:intron	40.0%
!!!	CAATTGGCCTTTTTCCTTGT+TGG	+	chr8_3:64611613-64611632	None:intergenic	40.0%
!!	ATGAATTTGGTGCTTGCAAG+AGG	-	chr8_3:64611736-64611755	Msa1302170:CDS	40.0%
	GTGAAAGTGAAAGCCTAATC+CGG	+	chr8_3:64611844-64611863	None:intergenic	40.0%
	ATAGCGTGAGTCATATTGGA+TGG	-	chr8_3:64611926-64611945	Msa1302170:CDS	40.0%
	TACGTCAAGTATCCATCCAG+CGG	-	chr8_3:64604774-64604793	Msa1302170:three_prime_UTR	45.0%
	CTGCAGATACTCGTCTTAAG+TGG	+	chr8_3:64604801-64604820	None:intergenic	45.0%
!!	AAAAATGGAAGTGTCGGCAG+AGG	-	chr8_3:64604914-64604933	Msa1302170:intron	45.0%
	AGGTAGAGATAGCCACTAGT+AGG	-	chr8_3:64604934-64604953	Msa1302170:intron	45.0%
	AGAGATAGCCACTAGTAGGT+CGG	-	chr8_3:64604938-64604957	Msa1302170:intron	45.0%
	TTCTTGAACCGACCTACTAG+TGG	+	chr8_3:64604949-64604968	None:intergenic	45.0%
	TGTAGATGGAGAAGTGAGGT+TGG	+	chr8_3:64605093-64605112	None:intergenic	45.0%
	GTGATGTAGATGGAGAAGTG+AGG	+	chr8_3:64605097-64605116	None:intergenic	45.0%
	CACATGAATGAAGTGCAGCT+TGG	+	chr8_3:64605139-64605158	None:intergenic	45.0%
	CAAGCTGCACTTCATTCATG+TGG	-	chr8_3:64605137-64605156	Msa1302170:three_prime_UTR	45.0%
	GCTGTTCAGGTGATAAACCA+TGG	-	chr8_3:64605287-64605306	Msa1302170:CDS	45.0%
	GCTCGTTTCTTGACAAAGTG+AGG	-	chr8_3:64605318-64605337	Msa1302170:CDS	45.0%
!!	CCCAAAACCCCATTGATTTC+AGG	-	chr8_3:64605522-64605541	Msa1302170:intron	45.0%
	GTCACACCTAACTCAAGAAC+TGG	+	chr8_3:64606103-64606122	None:intergenic	45.0%
	CCAAGACCGGTATTTACACA+TGG	+	chr8_3:64606415-64606434	None:intergenic	45.0%
	CCATGTGTAAATACCGGTCT+TGG	-	chr8_3:64606412-64606431	Msa1302170:intron	45.0%
	AAAGGGAATCCTGAATCGGT+GGG	-	chr8_3:64606532-64606551	Msa1302170:intron	45.0%
	TGGTACATGGCTGCAAGTTA+AGG	+	chr8_3:64606644-64606663	None:intergenic	45.0%
	ATCATGGAAGGCGATGAGAA+TGG	+	chr8_3:64607061-64607080	None:intergenic	45.0%
	TGTGTCCTTGACACGTGATA+TGG	-	chr8_3:64607156-64607175	Msa1302170:intron	45.0%
	TGACACCATATCACGTGTCA+AGG	+	chr8_3:64607164-64607183	None:intergenic	45.0%
	CAAATGTCAAAGCTGCAGTC+CGG	+	chr8_3:64607602-64607621	None:intergenic	45.0%
	CTCCATATGTGGGAGTGATA+CGG	-	chr8_3:64607825-64607844	Msa1302170:intron	45.0%
	ATCCGTATCACTCCCACATA+TGG	+	chr8_3:64607830-64607849	None:intergenic	45.0%
	ATCTTCATCTGCTTCAGCAG+TGG	-	chr8_3:64608007-64608026	Msa1302170:intron	45.0%
	TCTTCATCTGCTTCAGCAGT+GGG	-	chr8_3:64608008-64608027	Msa1302170:intron	45.0%
	GTGGTGATTGAAAACAAGGG+AGG	+	chr8_3:64608047-64608066	None:intergenic	45.0%
!	GAAGTATCACCAATGCCCAA+TGG	-	chr8_3:64608071-64608090	Msa1302170:intron	45.0%
	AGTATCACCAATGCCCAATG+GGG	-	chr8_3:64608073-64608092	Msa1302170:intron	45.0%
!	AGGAGATAGTGGTGATTCTC+AGG	+	chr8_3:64608477-64608496	None:intergenic	45.0%
	GATTGTGATGATTCTCAGGC+TGG	+	chr8_3:64608548-64608567	None:intergenic	45.0%
	AGGAGGAGGCAATCTTCTAT+AGG	+	chr8_3:64608718-64608737	None:intergenic	45.0%
!	ATTTAAGACCAAGTGGGCGA+AGG	+	chr8_3:64608738-64608757	None:intergenic	45.0%
	CGAAAGGACTGTTCAAACGT+AGG	-	chr8_3:64608797-64608816	Msa1302170:intron	45.0%
	TTAACACAGAATGCTGCTCC+TGG	+	chr8_3:64608899-64608918	None:intergenic	45.0%
	CATGGCGAAGACACTTAACT+TGG	-	chr8_3:64609225-64609244	Msa1302170:intron	45.0%
	CTCTCTCTCCACATTCCTTT+AGG	+	chr8_3:64609264-64609283	None:intergenic	45.0%
	CTAAAGGAATGTGGAGAGAG+AGG	-	chr8_3:64609262-64609281	Msa1302170:intron	45.0%
	AGGACATGGAGGGTAGTAAT+TGG	+	chr8_3:64609305-64609324	None:intergenic	45.0%
	TTACTACCCTCCATGTCCTA+TGG	-	chr8_3:64609306-64609325	Msa1302170:intron	45.0%
!!	GTTGGTGATCAAATGGAGGT+AGG	-	chr8_3:64609475-64609494	Msa1302170:intron	45.0%
	GCATGTTGTTCTTGAGTGCT+TGG	-	chr8_3:64609823-64609842	Msa1302170:intron	45.0%
	TTGAGTGCTTGGAACAAGCA+GGG	-	chr8_3:64609834-64609853	Msa1302170:intron	45.0%
	TGAGCTAGAAAGGGGGATTA+AGG	-	chr8_3:64609898-64609917	Msa1302170:intron	45.0%
	GAGCTAGAAAGGGGGATTAA+GGG	-	chr8_3:64609899-64609918	Msa1302170:intron	45.0%
	AGACTTGAACAGTCTCCTCA+AGG	+	chr8_3:64609941-64609960	None:intergenic	45.0%
	AACCTGCACCTCCCTATATA+AGG	+	chr8_3:64609964-64609983	None:intergenic	45.0%
	CCCGTTATCTGTAACCATCA+AGG	+	chr8_3:64610014-64610033	None:intergenic	45.0%
!	GCGTTACAAGTTGGCAATGA+TGG	-	chr8_3:64610049-64610068	Msa1302170:intron	45.0%
	AAGCATATGCTCGTAATCCG+AGG	+	chr8_3:64610181-64610200	None:intergenic	45.0%
!	TGCTTTTGGGCAGTCAAGAA+CGG	-	chr8_3:64610196-64610215	Msa1302170:intron	45.0%
	TAGTCCAAGAATGACGACCT+GGG	+	chr8_3:64610227-64610246	None:intergenic	45.0%
	TTAGTCCAAGAATGACGACC+TGG	+	chr8_3:64610228-64610247	None:intergenic	45.0%
	TAGGGAAAAGGTCATGCTTG+CGG	-	chr8_3:64610283-64610302	Msa1302170:intron	45.0%
	CACGCATCCTTAAATGCTCA+AGG	+	chr8_3:64610399-64610418	None:intergenic	45.0%
	ATATCCCGCTAGCATGAAAG+TGG	-	chr8_3:64610525-64610544	Msa1302170:intron	45.0%
	ATCTGAGCAATCTCTTCGGA+AGG	-	chr8_3:64610583-64610602	Msa1302170:intron	45.0%
	CCACAAGAAACTCCTATCCT+CGG	+	chr8_3:64610650-64610669	None:intergenic	45.0%
	CGAGGATAGGAGTTTCTTGT+GGG	-	chr8_3:64610648-64610667	Msa1302170:intron	45.0%
	TCTGCCACTAAGCAAGAATG+AGG	+	chr8_3:64610716-64610735	None:intergenic	45.0%
	TGCGTTCTAGCGCTTAAGTT+CGG	+	chr8_3:64611164-64611183	None:intergenic	45.0%
	GAGTCCAATACACAGAGTAG+TGG	-	chr8_3:64611436-64611455	Msa1302170:CDS	45.0%
	TCTCTTTCTCTGAATCTGGG+CGG	+	chr8_3:64611502-64611521	None:intergenic	45.0%
!!	TTTGGTGCTTGCAAGAGGAA+TGG	-	chr8_3:64611741-64611760	Msa1302170:CDS	45.0%
	CAGTCAAACGCGCAACAAGT+GGG	-	chr8_3:64604818-64604837	Msa1302170:three_prime_UTR	50.0%
!	GCAACTGTTTTCCGCTGTTC+AGG	-	chr8_3:64605274-64605293	Msa1302170:CDS	50.0%
	GAAACGAGCTTGTCATCCCA+TGG	+	chr8_3:64605307-64605326	None:intergenic	50.0%
	GAAAGGGAATCCTGAATCGG+TGG	-	chr8_3:64606531-64606550	Msa1302170:intron	50.0%
	AAGGGAATCCTGAATCGGTG+GGG	-	chr8_3:64606533-64606552	Msa1302170:intron	50.0%
	GTGGGGACCAAATCCATTCT+TGG	-	chr8_3:64606550-64606569	Msa1302170:intron	50.0%
!	TAGTCCTCATCCGACTTGCA+CGG	-	chr8_3:64606806-64606825	Msa1302170:CDS	50.0%
	TGCAGATACACCGTGCAAGT+CGG	+	chr8_3:64606819-64606838	None:intergenic	50.0%
	AGTGTGGCATCCCACCAAAT+AGG	+	chr8_3:64607787-64607806	None:intergenic	50.0%
	CGTATCACTCCCACATATGG+AGG	+	chr8_3:64607827-64607846	None:intergenic	50.0%
	GATGAGGCTGTTACCCCATT+GGG	+	chr8_3:64608089-64608108	None:intergenic	50.0%
	AGATGAGGCTGTTACCCCAT+TGG	+	chr8_3:64608090-64608109	None:intergenic	50.0%
	TAAGTACCTGGCTCACAGCA+AGG	-	chr8_3:64608254-64608273	Msa1302170:intron	50.0%
	TGATTCTCAGGCTGGTGCTT+CGG	+	chr8_3:64608465-64608484	None:intergenic	50.0%
!	GATAGTGGTGATTCTCAGGC+TGG	+	chr8_3:64608473-64608492	None:intergenic	50.0%
!!	AGTGGATTGGCAGGAGATAG+TGG	+	chr8_3:64608488-64608507	None:intergenic	50.0%
!!	GCTTCTTTGAGTGGATTGGC+AGG	+	chr8_3:64608497-64608516	None:intergenic	50.0%
	GGCTGCTTCTTTGAGTGGAT+TGG	+	chr8_3:64608501-64608520	None:intergenic	50.0%
	TCTCAGGCTGCTTCTTTGAG+TGG	+	chr8_3:64608506-64608525	None:intergenic	50.0%
!!	GGTTCTTTGAGTGGATTGGC+AGG	+	chr8_3:64608572-64608591	None:intergenic	50.0%
	GTGGGGTTCTTTGAGTGGAT+TGG	+	chr8_3:64608576-64608595	None:intergenic	50.0%
	TAGGAGTGGGGTTCTTTGAG+TGG	+	chr8_3:64608581-64608600	None:intergenic	50.0%
	GTGCGTAAGATATGCACCGA+TGG	+	chr8_3:64608776-64608795	None:intergenic	50.0%
	GCATATCTTACGCACGCGAA+AGG	-	chr8_3:64608781-64608800	Msa1302170:intron	50.0%
	GACCAAAGCAGAAATCTCGG+CGG	-	chr8_3:64608865-64608884	Msa1302170:intron	50.0%
	ACCAAAGCAGAAATCTCGGC+GGG	-	chr8_3:64608866-64608885	Msa1302170:intron	50.0%
	GATCAGCCATAGGACATGGA+GGG	+	chr8_3:64609315-64609334	None:intergenic	50.0%
	TGATCAGCCATAGGACATGG+AGG	+	chr8_3:64609316-64609335	None:intergenic	50.0%
	GCATGATCAGCCATAGGACA+TGG	+	chr8_3:64609319-64609338	None:intergenic	50.0%
	TCCTATGGCTGATCATGCTC+TGG	-	chr8_3:64609321-64609340	Msa1302170:intron	50.0%
	CCTATGGCTGATCATGCTCT+GGG	-	chr8_3:64609322-64609341	Msa1302170:intron	50.0%
	CTTGAGTGCTTGGAACAAGC+AGG	-	chr8_3:64609833-64609852	Msa1302170:intron	50.0%
	TGAGTGCTTGGAACAAGCAG+GGG	-	chr8_3:64609835-64609854	Msa1302170:intron	50.0%
!	CTCCTTATATAGGGAGGTGC+AGG	-	chr8_3:64609959-64609978	Msa1302170:intron	50.0%
	GACACATAACCCCTCTCCAT+GGG	+	chr8_3:64610130-64610149	None:intergenic	50.0%
	AGTCCAAGAATGACGACCTG+GGG	+	chr8_3:64610226-64610245	None:intergenic	50.0%
	AGGGAAAAGGTCATGCTTGC+GGG	-	chr8_3:64610284-64610303	Msa1302170:intron	50.0%
	TGAGGATATGTTGCTCGGAG+AGG	-	chr8_3:64610502-64610521	Msa1302170:intron	50.0%
	ATATTACGAGTGAGTGGCCG+AGG	-	chr8_3:64610630-64610649	Msa1302170:intron	50.0%
	CCGAGGATAGGAGTTTCTTG+TGG	-	chr8_3:64610647-64610666	Msa1302170:intron	50.0%
	GAAGCTCAGACATTCCGACT+AGG	+	chr8_3:64610680-64610699	None:intergenic	50.0%
	CAACTAGCATACGACCACCA+AGG	+	chr8_3:64611005-64611024	None:intergenic	50.0%
	AGTTGTGTCCAAGCTTGCGT+CGG	-	chr8_3:64611020-64611039	Msa1302170:intron	50.0%
	AGCATGTCACCTACCCTACT+TGG	-	chr8_3:64612095-64612114	Msa1302170:five_prime_UTR	50.0%
	GTCTTAAGTGGTCCGCTGGA+TGG	+	chr8_3:64604789-64604808	None:intergenic	55.0%
	ACTCGTCTTAAGTGGTCCGC+TGG	+	chr8_3:64604793-64604812	None:intergenic	55.0%
	GCAGTCAAACGCGCAACAAG+TGG	-	chr8_3:64604817-64604836	Msa1302170:three_prime_UTR	55.0%
	AATAACGCCCGTGCAACGCA+CGG	-	chr8_3:64605725-64605744	Msa1302170:intron	55.0%
	AAGTATCCCGTGCGTTGCAC+GGG	+	chr8_3:64605735-64605754	None:intergenic	55.0%
!	GAAGTATCCCGTGCGTTGCA+CGG	+	chr8_3:64605736-64605755	None:intergenic	55.0%
!!	GATTTGGTCCCCACCGATTC+AGG	+	chr8_3:64606544-64606563	None:intergenic	55.0%
	TACACCGTGCAAGTCGGATG+AGG	+	chr8_3:64606813-64606832	None:intergenic	55.0%
	GCTGTTACCCCATTGGGCAT+TGG	+	chr8_3:64608083-64608102	None:intergenic	55.0%
	TTCGGCTCTTGTGCTGTCTG+AGG	+	chr8_3:64608447-64608466	None:intergenic	55.0%
	GTCAGCTCTTGTGCTGTCTC+AGG	+	chr8_3:64608522-64608541	None:intergenic	55.0%
	TAAGACCAAGTGGGCGAAGG+AGG	+	chr8_3:64608735-64608754	None:intergenic	55.0%
	TCCCGCCGAGATTTCTGCTT+TGG	+	chr8_3:64608870-64608889	None:intergenic	55.0%
	GTCGGCGGATATGTCAATGC+AGG	-	chr8_3:64609143-64609162	Msa1302170:intron	55.0%
	CCCAGAGCATGATCAGCCAT+AGG	+	chr8_3:64609325-64609344	None:intergenic	55.0%
!	TATAGGGAGGTGCAGGTTGC+CGG	-	chr8_3:64609966-64609985	Msa1302170:intron	55.0%
	TGGGTGCTCGCAGCAATTTG+GGG	+	chr8_3:64610107-64610126	None:intergenic	55.0%
	GTGGGTGCTCGCAGCAATTT+GGG	+	chr8_3:64610108-64610127	None:intergenic	55.0%
	CATAACCCCTCTCCATGGGT+GGG	+	chr8_3:64610126-64610145	None:intergenic	55.0%
	ACATAACCCCTCTCCATGGG+TGG	+	chr8_3:64610127-64610146	None:intergenic	55.0%
	GGACACATAACCCCTCTCCA+TGG	+	chr8_3:64610131-64610150	None:intergenic	55.0%
	GTCCAAGAATGACGACCTGG+GGG	+	chr8_3:64610225-64610244	None:intergenic	55.0%
	CTTGTGGGCTTCGACCTAGT+CGG	-	chr8_3:64610663-64610682	Msa1302170:intron	55.0%
	GTTGTGTCCAAGCTTGCGTC+GGG	-	chr8_3:64611021-64611040	Msa1302170:intron	55.0%
	ATAACGCCCGTGCAACGCAC+GGG	-	chr8_3:64605726-64605745	Msa1302170:intron	60.0%
!!	TGCTAGCCTTGCTGTGAGCC+AGG	+	chr8_3:64608263-64608282	None:intergenic	60.0%
	ATCTCGGCGGGAAGAACTCC+AGG	-	chr8_3:64608878-64608897	Msa1302170:intron	60.0%
	GGTGGGTGCTCGCAGCAATT+TGG	+	chr8_3:64610109-64610128	None:intergenic	60.0%
	AGTCAAGAACGGTTGCCCCC+AGG	-	chr8_3:64610207-64610226	Msa1302170:intron	60.0%
	TGCCCCCAGGTCGTCATTCT+TGG	-	chr8_3:64610220-64610239	Msa1302170:intron	60.0%
	ACGAGTGAGTGGCCGAGGAT+AGG	-	chr8_3:64610635-64610654	Msa1302170:intron	60.0%
	GGTTAGACCCGACGCAAGCT+TGG	+	chr8_3:64611031-64611050	None:intergenic	60.0%
	TGCCTCCTCCTTCGCCCACT+TGG	-	chr8_3:64608727-64608746	Msa1302170:intron	65.0%
	GACCAAGTGGGCGAAGGAGG+AGG	+	chr8_3:64608732-64608751	None:intergenic	65.0%
	TTGCTGCGAGCACCCACCCA+TGG	-	chr8_3:64610111-64610130	Msa1302170:intron	65.0%
	CGAGCACCCACCCATGGAGA+GGG	-	chr8_3:64610117-64610136	Msa1302170:intron	65.0%
	GAGCACCCACCCATGGAGAG+GGG	-	chr8_3:64610118-64610137	Msa1302170:intron	65.0%
	GCGAGCACCCACCCATGGAG+AGG	-	chr8_3:64610116-64610135	Msa1302170:intron	70.0%

Chromosome	Type	Strat	End	Strand	Name
chr8_3	gene	64604764	64612118	64604764	ID=Msa1302170;Name=Msa1302170
chr8_3	mRNA	64604764	64612118	64604764	ID=Msa1302170-mRNA-1;Parent=Msa1302170;Name=Msa1302170-mRNA-1;_AED=0.12;_eAED=0.12;_QI=154\|0.6\|0.83\|0.83\|0.6\|0.5\|6\|444\|392
chr8_3	exon	64604764	64604930	64604764	ID=Msa1302170-mRNA-1:exon:19511;Parent=Msa1302170-mRNA-1
chr8_3	exon	64604956	64605469	64604956	ID=Msa1302170-mRNA-1:exon:19510;Parent=Msa1302170-mRNA-1
chr8_3	exon	64606743	64606856	64606743	ID=Msa1302170-mRNA-1:exon:19509;Parent=Msa1302170-mRNA-1
chr8_3	exon	64607390	64607717	64607390	ID=Msa1302170-mRNA-1:exon:19508;Parent=Msa1302170-mRNA-1
chr8_3	exon	64611339	64611586	64611339	ID=Msa1302170-mRNA-1:exon:19507;Parent=Msa1302170-mRNA-1
chr8_3	exon	64611713	64612118	64611713	ID=Msa1302170-mRNA-1:exon:19506;Parent=Msa1302170-mRNA-1
chr8_3	five_prime_UTR	64611965	64612118	64611965	ID=Msa1302170-mRNA-1:five_prime_utr;Parent=Msa1302170-mRNA-1
chr8_3	CDS	64611713	64611964	64611713	ID=Msa1302170-mRNA-1:cds;Parent=Msa1302170-mRNA-1
chr8_3	CDS	64611339	64611586	64611339	ID=Msa1302170-mRNA-1:cds;Parent=Msa1302170-mRNA-1
chr8_3	CDS	64607390	64607717	64607390	ID=Msa1302170-mRNA-1:cds;Parent=Msa1302170-mRNA-1
chr8_3	CDS	64606743	64606856	64606743	ID=Msa1302170-mRNA-1:cds;Parent=Msa1302170-mRNA-1
chr8_3	CDS	64605233	64605469	64605233	ID=Msa1302170-mRNA-1:cds;Parent=Msa1302170-mRNA-1
chr8_3	three_prime_UTR	64604956	64605232	64604956	ID=Msa1302170-mRNA-1:three_prime_utr;Parent=Msa1302170-mRNA-1
chr8_3	three_prime_UTR	64604764	64604930	64604764	ID=Msa1302170-mRNA-1:three_prime_utr;Parent=Msa1302170-mRNA-1

Gene Sequence

>Msa1302170

ATGGAAGTGTCGGCAGAGGTAGAGATAGCCACTAGTAGGTCGGTTCAAGAACTAGCATTGAATTCTGAACATCTACCACCAAATAATTATATATACAATGAAGGTGGTGTTGGATTTCGTGATGCTCTTCTTCCTTCAGAATCTGATTTTCATATTCCAATCATTGACATTGCCAACCTCACTTCTCCATCTACATCACAACATGAGCTTCTTAAACTCCAAGCTGCACTTCATTCATGTGGCTTCTTTCTGGTGATAAACCATGGGATGACAAGCTCGTTTCTTGACAAAGTGAGGGAAGTTTCAAAGCAATTTTTTGAACTTCCAAAGGAAGAAAAGCAAAAATATGCAAGGGAACAAAACAATATTGAAGGATATGGAAATGATACAATATATTCAGAAAATCAAATGCTTGATTGGTGTGACAGAATATTTTTGAAGGTACATCCTGAAGATCAAAGGAATTTCAAACTTTGGCCCCAAAACCCCATTGATTTCAGGAATACTATACAACAATATACCGAATGTATCTGGCAGTTATATGAAGTAATTTTAAGGGTCATGGCGAAGACACTTAACTTGGAAGAGGATTGTTTCCTAAAGGAATGTGGAGAGAGAGGTACAATGTCTATGAGAACCAATTACTACCCTCCATGTCCTATGGCTGATCATGCTCTGGGCCTGAAGCCACATTCTGATTCATCATCTATAACTTTTTTGCTGCAAGATAAAAAGGTAGAAGGCCTCCAAGTTCTCAAAGATAACCAGTGGTTTAAAGTTCCAATAATCCATGATGCTCTTGTGATAAATGTTGGTGATCAAATGGAGATAACGGGATCCGTAACTGTAAAGCGTTACAAGTTGGCAATGATGGAGGCAATTACGAATCATTGTTTTGAATCGTTGCCCCAAATTGCTGCGAGCACCCACCCATGGAGAGGGATAATGAGCAATGGGATTTTTCAGAGTCCAATACACAGAGTAGTGGTAAATGCAGAAAGGGAAAGGCTCTCAGTAGCTATGTTTTGCCGCCCAGATTCAGAGAAAGAGATTCAACCGGTTGACAAACTAGTGAATGAGTCAAGGCCAGTATTATACAGACCAGTAAAAGATTGTGCTAAGATATTTCTCGAGTACTACCAACAAGGAAAAAGGCCAATTGATGCTTTCAAAATCTAA

Protein sequence

>Msa1302170

MEVSAEVEIATSRSVQELALNSEHLPPNNYIYNEGGVGFRDALLPSESDFHIPIIDIANLTSPSTSQHELLKLQAALHSCGFFLVINHGMTSSFLDKVREVSKQFFELPKEEKQKYAREQNNIEGYGNDTIYSENQMLDWCDRIFLKVHPEDQRNFKLWPQNPIDFRNTIQQYTECIWQLYEVILRVMAKTLNLEEDCFLKECGERGTMSMRTNYYPPCPMADHALGLKPHSDSSSITFLLQDKKVEGLQVLKDNQWFKVPIIHDALVINVGDQMEITGSVTVKRYKLAMMEAITNHCFESLPQIAASTHPWRGIMSNGIFQSPIHRVVVNAERERLSVAMFCRPDSEKEIQPVDKLVNESRPVLYRPVKDCAKIFLEYYQQGKRPIDAFKI*